Accumulating evidence indicates that heregulins, EGF (epidermal growth factor)-like ligands, promote breast cancer cell proliferation and are involved in the progression of breast cancer towards an aggressive and invasive phenotype. However, there is limited information regarding the molecular mechanisms that mediate these effects. We have recently established that HRG (heregulin β1) promotes breast cancer cell proliferation and migration via cross-talk with EGFR (EGF receptor) that involves the activation of the small GTPase Rac1. In the present paper we report that Rac1 is an essential player for mediating the induction of cyclin D1 and p21Cip1 by HRG in breast cancer cells. Inhibition of Rac function by expressing either the Rac-GAP (GTPase-activating protein) β2-chimaerin or the dominant-negative Rac mutant N17Rac1, or Rac1 depletion using RNAi (RNA interference), abolished the cyclin D1 and p21Cip1 induction by HRG. Interestingly, the proliferative effect of HRG was impaired not only when the expression of Rac1 or cyclin D1 was inhibited, but also when cells were depleted of p21Cip1 using RNAi. Inhibition of EGFR, PI3K (phosphoinositide 3-kinase; kinases required for Rac activation by HRG) or MEK [MAPK (mitogen-activated protein kinase)/ERK (extracellular-signal-regulated kinase) kinase] also blocked the up-regulation of cyclin D1 and p21Cip1 by HRG. In addition, we found that HRG activates NF-κB (nuclear factor κB) in a Rac1- and MEK-dependent fashion, and inhibition of NF-κB abrogates cyclin D1/p21Cip1 induction and proliferation by HRG. Taken together, these findings establish a central role for Rac1 in the control of HRG-induced breast cancer cell-cycle progression and proliferation through up-regulating the expression of cyclin D1 and p21Cip1.

INTRODUCTION

Heregulins (also called neuregulins), widely expressed EGF (epidermal growth factor)-like ligands, have been implicated in the progression of different types of cancers, particularly breast cancer [13]. Heregulins are expressed in approx. 30% of breast tumours [4,5] and have been associated with the progression of breast cancer towards an aggressive and invasive phenotype [2,6]. Expression of heregulin β2 in MCF-7 breast cancer cells induces oestrogen-independent tumour formation in ovariectomized nude mice [6]. Moreover, blockade of heregulin β2 expression inhibits tumorigenicity and metastasis of breast cancer cells [7]. Heregulins bind to ErbB3 and ErbB4 receptors to promote their dimerization with distinct members of the ErbB receptor family. Indeed, ErbB2/ErbB3 and ErbB2/ErbB4 dimers can be readily detected upon heregulin stimulation [810]. Despite their well-established roles in tumour development and progression, the mechanisms by which heregulins exert their tumorigenic effects are not fully understood. Recent studies have shown that HRG (heregulin β1)-induced breast cancer cell proliferation and migration are mediated not only by ErbB3 and ErbB2, but also by EGFR (EGF receptor), as judged by the ability of EGFR inhibitors and EGFR RNAi (RNA interference) to impair HRG mitogenic and motogenic effects [11]. The involvement of multiple ErbB receptors as mediators of HRG responses predicts a complex array of signalling pathways activated by this ligand.

The small Rho GTPases have been established as important mediators of responses elicited by tyrosine kinase and G-protein-coupled receptors. Rac1, a member of the Rho GTPase family, is known to play crucial roles in actin cytoskeleton organization, cell proliferation, transformation, migration, invasion and metastasis [1214]. Rac1 becomes activated by Rac-GEFs (guanine-nucleotide-exchange factors) and inactivated by Rac-GAPs (GTPase-activating proteins), and a misbalance in the expression or function of these Rac regulators may contribute to cancer progression. In breast cancer, for example, overexpression of Rac, up-regulation of Rac-GEFs (such as Tiam1) and down-regulation of Rac-GAPs (such as β2-chimaerin) have been reported [1520], arguing for the involvement of Rac and its effectors in breast cancer progression and/or the maintenance of the malignant phenotype. The Rac effector Pak1 (p21-activated kinase 1) is also overexpressed in breast tumours and plays an important role in breast cancer metastasis [21,22]. We have recently established an essential role for Rac1 in the mitogenic response of HRG in breast cancer cell models [11]. Stimulation of breast cancer cells with HRG promotes a strong activation of Rac1, an effect mediated by ErbB3 and ErbB2 and independent of ErbB4. Unlike EGF, HRG causes a sustained Rac activation. Moreover, EGFR and PI3K (phosphoinositide 3-kinase) are also required for Rac activation by HRG. Despite these observations, there is a limited knowledge of the mechanisms downstream of Rac1 that mediate the HRG proliferative response.

In the present study we demonstrate a key role for Rac1 in regulating cyclin D1 induction in response to HRG stimulation in breast cancer cells, and more interestingly, we found that HRG caused a sustained elevation in the levels of the cell-cycle inhibitor p21Cip1 that is required for the mitogenic effect of HRG. Like cyclin D1, p21Cip1 induction by HRG is also dependent on Rac1. In addition, we established a role for the NF-κB (nuclear factor κB) pathway in the proliferative effect of HRG via Rac1. Our results support a central role for Rac1 in the regulation of HRG-mediated breast cancer cell mitogenicity and argue for the involvement of a complex set of signalling events regulated by this small G-protein that contribute to the HRG response.

MATERIALS AND METHODS

Cell culture, chemicals and plasmids

Human breast cancer T-47D cells were purchased from ATCC and cultured in RPMI 1640 medium supplemented with 10% FBS (foetal bovine serum), 2 μg/ml insulin, 1 mM sodium pyruvate and 2 mM glutamine, at 37 °C in a humidified 5% CO2 atmosphere. HRG was purchased from R&D Systems. Insulin, actinomycin D and cycloheximide were obtained from Sigma. Wortmannin and AG1478 were from LC Laboratories. U0126 was from Calbiochem. A pcDNA3 vector encoding for the NF-κB super suppressor (IκBαM; mutant inhibitory κBα) [23] was a gift from Dr Han-Ming Shen (Department of Community, Occupational and Family Medicine, National University of Singapore, Singapore).

Generation of AdVs (adenoviruses) and infection

The generation of AdVs for β2-chimaerin and LacZ has been described previously [18]. N17Rac1-AdV was a gift from Dr Anne Ridley (Ludwig Institute for Cancer Research, University College London, U.K.). Serum-starved (for 8 h) T-47D cells were infected with the corresponding AdVs for 16 h, and then AdVs were removed by extensive washing. Maximum protein expression was generally observed 24 h after removal of the AdV and remained stable for at least 3 additional days. Experiments were performed 48 h after infection.

RNAi

siRNA (small interfering RNA) duplexes were purchased from Dharmacon Research. The target sequences were AAACACGCGCAGACCTTCG (cyclin D1) and AACATACTGGCCTGGACTGTT (p21Cip1). The Rac1 and control siRNA sequences have been described previously [11]. siRNA duplexes (100 nM) were transfected into T-47D cells using Lipofectamine™ 2000 (Invitrogen) in serum-free medium, and 24–48 h later cells were stimulated with HRG (10 ng/ml) for different times.

RT (reverse transcriptase)-PCR and Q-PCR (quantitative PCR)

Total RNA was prepared using TRIzol® according to the manufacturer's protocol and reverse transcribed using SuperScript™ II RT (Invitrogen). The resulting cDNA was used for PCR amplification using the following primers: cyclin D1 (forward), 5′-TGTGCTGCGAAGTGGAAACC-3′; cyclin D1 (reverse), 5′-CCATTTGCAGCAGCTCCTCG-3′; p21Cip1 (forward), 5′-GCGATGGAACTTCGACTTTGT-3′; p21Cip1 (reverse), 5′-GGGCTTCCTCTTGGAGAAGAT-3′; GAPDH (glyceraldehyde-3-phosphate dehydrogenase; forward), 5′-CCCTTCATTGACCTCAACTACATGG-3′; and GAPDH (reverse), 5′-CATGGTGGTGAAGACGCCAG-3′.

For Q-PCR, RNA (75 ng) was reverse transcribed in a 10 μl reaction mixture with Multiscribe RT (Applied Biosystems) using random hexamer primers. Taqman Q-PCR was carried out using 2 μl of cDNA in a 22 μl reaction mixture (Applied Biosystems). Primers and probes were as follows: cyclin D1 (forward primer), 5′-TGTTCGTGGCCTCTAAGATGAAG-3′; cyclin D1 (reverse primer), 5′-AGGTTCCACTTGAGCTTGTTCAC-3′; cyclin D1 (probe), 6FAM-AGCAGCTCCATTTGCAGCAGCTCCT-TAMRA (where FAM is 6-carboxyfluorescein and TAMRA is 6-carboxytetramethylrhodamine); 18S (forward primer), 5′-CCTGGTTGATCCTGCCAGTAG-3′; 18S (reverse primer), 5′-CCGTGCGTACTTAGACATGCA-3′; and 18S (probe), VIC®-TGCTTGTCTCAAAGATTA-MGBNFQ. For p21Cip1, the Assay-on-Demand primer–probe mix (Applied Biosystems) was used. cDNA amplification was carried out in an ABI Prism 7000 Sequence Detection System using the standard curve method. Cyclin D1 and p21Cip1 mRNA levels were normalized to 18S rRNA.

Western blot analysis

Cells were lysed and subjected to SDS/PAGE as described previously [18] using 10–30 μg of protein/lane. The following antibodies were used: anti-Rac and anti-cyclin D1 (Upstate Biotechnology); anti-p27 and anti-p53 (Santa Cruz Biotechnology); anti-p21Cip1, anti-HA (haemagluttinin) tag, anti-Myc tag, antiphospho-Rb (retinoblastoma; Ser780), anti-phospho-IκBα (inhibitory κBα; Ser32), anti-total-IκBα, and anti-phospho-ERK1/2 (extracellular-signal-regulated kinase; Thr202/Tyr204) (Cell Signaling Technology); anti-phospho-Rb (retinoblastoma; Thr821) (Abcam); anti-β2-chimaerin [18]; and anti-β-actin (Sigma).

Rac-GTP pulldown assays

After 48 h of serum starvation, cells were stimulated with HRG (10 ng/ml) for 5 min. Maximum Rac stimulation was observed at this time [11]. Rac-GTP levels were determined with a PBD (Pak p21-binding domain) pulldown assay, as described previously [18], using an anti-Rac antibody for Western blot detection.

Plasmid transfection

T-47D cells in 60 mm dishes were transfected with 0.5 μg of a plasmid encoding the NF-κB super suppressor pIκBαM [23] or empty vector (pcDNA3) using Lipofectamine™ 2000 (Invitrogen) in serum-free medium, and 24–48 h later cells were stimulated with HRG (10 ng/ml) for different times, as indicated in the corresponding experiments.

NF-κB luciferase reporter assay

T-47D cells in 6-well plates were co-transfected with a NF-κB-luciferase vector (pNFκB-luc, 0.5 μg) and a Renilla-luciferase vector (pRL-CMV, 10 ng), together with a vector expressing NF-κB super-suppressor (pIκαM, 0.5 μg) or an empty vector (pcDNA3, 0.5 μg). After 24 h serum starvation, cells were stimulated with HRG (10 ng/ml) for 24 h and luciferase activity was measured using the Promega dual-luciferase reporter assay system. Results are presented as means±S.D. (n=3).

Proliferation assays

Cells were serum-starved for 24 h and stimulated with 10 ng/ml HRG twice every 24 h (a protocol that maximized the HRG response). Cells were harvested 48 h later by trypsinization, and the cell number was determined with a haemocytometer.

Statistical analysis

Results are presented as means±S.D. or means±S.E.M., and were analysed using either a Student's t test or ANOVA with a Scheffe's test. A P value of <0.05 was considered statistically significant.

RESULTS

Cyclin D1 and p21Cip1 induction are required for HRG-induced breast cancer cell proliferation

We have recently established that HRG induces breast cancer cell proliferation via ErbB3/ErbB2 cross-talk with EGFR [11]. To initiate the characterization of the relevant cell-cycle players involved in this mitogenic effect, T-47D breast cancer cells were serum-starved, treated with HRG (10 ng/ml), and at different times cell lysates were subjected to Western blot analysis for various cell-cycle regulators. Figure 1(A) shows that HRG caused a significant elevation in cyclin D1 levels, starting at 6 h after treatment. In addition, HRG caused a marked increase in p21Cip1 levels, but it did not appreciably affect the levels of other negative cell-cycle regulators expressed in T-47D breast cancer cells, such as p53 and p27. p21Cip1 up-regulation was noticeable at 3 h and persisted for at least 12 h after HRG treatment. Increased pRb phosphorylation by HRG in Ser780 (the cyclin D-CDK4/6 site, where CDK is cyclin-dependent kinase) and Thr821 (the cyclin E-CDK2 site) was observed at 12 and 24 h after treatment respectively (Figure 1A). These results suggest that p21Cip1 up-regulation in this context was not inhibitory for the activities of CDK4/6 and CDK2. HRG stimulation also markedly increased cyclin D1 and p21Cip1 mRNA levels in a time-dependent manner, as determined by RT-PCR (Figure 1B). These observations were confirmed by Q-PCR (see Figure 3 and results not shown). Elevations in cyclin D1 and p21Cip1 protein levels were abolished by inhibitors of transcription (actinomycin D) and translation (cycloheximide), suggesting that the effects may be at a transcriptional level in either case (Figure 1C). Next, to determine whether a causal relationship existed between cyclin D1 and p21Cip1 up-regulation and HRG-induced cell proliferation, we used a RNAi knockdown approach. As shown in Figure 1(D), upon delivery of specific dsRNAs (double stranded RNAs) for either cyclin D1 or p21Cip1, which caused 60±5% and 71%±4% depletion respectively, HRG failed to cause a significant elevation in either cell-cycle regulator. No effect was observed upon delivery of an unrelated (control) RNAi duplex. The specificity of cyclin D1 and p21 RNAi was demonstrated by RT-PCR (Supplementary Figure 1 at http://www.biochemj.org/bj/410/4100167add.htm). As predicted, the proliferative response of HRG was markedly reduced in cyclin D1-depleted cells. Notably, a similar inhibition of proliferation was observed upon p21Cip1 RNAi (Figure 1E), suggesting that up-regulation of both cyclin D1 and p21Cip1 was required for the mitogenic activity of HRG in breast cancer cells.

HRG promotes breast cancer T-47D cell proliferation via cyclin D1 and p21Cip1

Figure 1
HRG promotes breast cancer T-47D cell proliferation via cyclin D1 and p21Cip1

(A) Time-course for cyclin D1 and p21Cip1 protein induction by HRG. After 48 h serum starvation, cells were treated with HRG (10 ng/ml) for different times and subject to Western blot analysis. ppRb, phosphorylated Rb. (B) After 48 h serum starvation, cells were stimulated with HRG (10 ng/ml) for different times. mRNA levels were determined using RT-PCR. (C) After 48 h serum starvation, cells were treated with either actinomycin D (Act D) or cycloheximide (CHX) for 1 h, and then stimulated with HRG (10 ng/ml) for 6 h. Cyclin D1 and p21Cip1 levels were detected by Western blot analysis. (D and E) After 24–48 h serum starvation, cells transfected with cyclin D1 (D1), p21Cip1 (p21) or control (C) siRNA duplexes were stimulated with HRG (10 ng/ml). Cyclin D1 and p21Cip1 expression was analysed 6 h later by Western blot analysis (D). Cell number was determined 48 h after stimulation (E). Results are presented as means±S.D. (n=3). *P<0.05 compared with the control RNAi group. All experiments were repeated three times and similar results were obtained.

Figure 1
HRG promotes breast cancer T-47D cell proliferation via cyclin D1 and p21Cip1

(A) Time-course for cyclin D1 and p21Cip1 protein induction by HRG. After 48 h serum starvation, cells were treated with HRG (10 ng/ml) for different times and subject to Western blot analysis. ppRb, phosphorylated Rb. (B) After 48 h serum starvation, cells were stimulated with HRG (10 ng/ml) for different times. mRNA levels were determined using RT-PCR. (C) After 48 h serum starvation, cells were treated with either actinomycin D (Act D) or cycloheximide (CHX) for 1 h, and then stimulated with HRG (10 ng/ml) for 6 h. Cyclin D1 and p21Cip1 levels were detected by Western blot analysis. (D and E) After 24–48 h serum starvation, cells transfected with cyclin D1 (D1), p21Cip1 (p21) or control (C) siRNA duplexes were stimulated with HRG (10 ng/ml). Cyclin D1 and p21Cip1 expression was analysed 6 h later by Western blot analysis (D). Cell number was determined 48 h after stimulation (E). Results are presented as means±S.D. (n=3). *P<0.05 compared with the control RNAi group. All experiments were repeated three times and similar results were obtained.

Induction of cyclin D1 and p21Cip1 by HRG is Rac1-dependent

Our recent studies showing an essential role for Rac1 in the mitogenic response of HRG in breast cancer cells [11] prompted us to examine whether this small G-protein plays any role in the induction of cyclin D1 and p21Cip1 by HRG. Three approaches were used to address this issue. First, we ectopically expressed the Rac-specific GAP β2-chimaerin, which inhibits Rac activation and proliferation by HRG in breast cancer cells [11]. β2-Chimaerin inhibits Rac without interfering with RhoA or Cdc42 activities, both in vitro and in cellular models, including breast cancer cells [11,18,24]. β2-Chimaerin was delivered into T-47D cells by adenoviral means, using a range of MOIs (multiplicities of infection). Figure 2(A) shows that expression of β2-chimaerin (MOI=3–30 pfu/cell; where pfu is plaque-forming unit) dose-dependently inhibited Rac activation by HRG, as previously described [11]. A control LacZ AdV (MOI=30 pfu/cell) showed no effect. Interestingly, induction of either cyclin D1 or p21Cip1 by HRG was markedly impaired in β2-chimaerin AdV-infected cells. The effect was proportional to the expression levels of the Rac-GAP. Moreover, a striking correlation between the inhibition of Rac activation and the induction of either cyclin D1 or p21Cip1 by HRG was observed (R=0.97 and 0.99 respectively) (Figure 2B). As a second approach we used an AdV encoding a dominant-negative Rac1 mutant (Myc-tagged N17Rac1). Upon delivery of this mutant (MOI=1–10 pfu/cell), expression of N17Rac1 could be readily detected by Western blot analysis, and it impaired dose-dependently the activation of Rac in response to HRG (Figure 2C). As observed with the Rac-GAP, N17Rac1 also inhibited cyclin D1 and p21Cip1 induction by HRG (Figure 2C). Both β2-chimaerin and N17Rac1 inhibited HRG-induced proliferation in a MOI-dependent manner (Figure 2D). Lastly, to confirm further the involvement of Rac1 in cyclin D1 and p21Cip1 up-regulation we used Rac1 RNAi, which reduced Rac1 expression by 78±6% (n=3) (Figure 3A). HRG failed to up-regulate cyclin D1 and p21Cip1 in Rac1-depleted T-47D cells (Figure 3A). Figures 3(B) and 3(C) show that Rac1 RNAi significantly reduced the elevations of cyclin D1 and p21Cip1 mRNA levels. As observed with the Rac-GAP and dominant negative Rac1, depletion of Rac1 using RNAi also significantly inhibited HRG-induced cell proliferation (Figure 3D). Taken together, these results strongly suggest that Rac activation is required for cyclin D1 and p21Cip1 induction by HRG.

Induction of cyclin D1 and p21Cip1 by HRG is Rac-dependent: correlation with proliferation

Figure 2
Induction of cyclin D1 and p21Cip1 by HRG is Rac-dependent: correlation with proliferation

(A and C) At 16 h after infection with different MOIs of β2-chimaerin-AdV (A) or N17Rac1-AdV (C) in serum-free medium, cells were washed once with PBS and serum-starved for a further 24 h. A LacZ-AdV was used as a control. Cells were then stimulated with HRG (10 ng/ml) for 5 min for Rac-GTP pulldown assays, or 6 h for Western blot analysis. (B) Densitometric analysis of the inhibitory effect of β2-chimaerin on HRG-induced Rac activation and expression of cyclin D1 (D1) and p21Cip1 (p21). Insets show the correlation between the inhibition of Rac-GTP and cyclin D1 or p21Cip1 levels at the different MOIs of the β2-chimerin-AdV (expressed as a percentage of control cells). (D) Inhibition of HRG-induced cell proliferation by β2-chimaerin (β2) or dominant negative Rac1 (N17Rac1; N17). At 16 h after infection with different AdVs in serum-free medium, cells were washed once with PBS and then stimulated with HRG (10 ng/ml). Cell number was determined 48 h later. Results are presented as means±S.D. (n=3). *P<0.05 compared with LacZ-AdV-infected group (Z). All experiments were repeated three times and similar results were obtained.

Figure 2
Induction of cyclin D1 and p21Cip1 by HRG is Rac-dependent: correlation with proliferation

(A and C) At 16 h after infection with different MOIs of β2-chimaerin-AdV (A) or N17Rac1-AdV (C) in serum-free medium, cells were washed once with PBS and serum-starved for a further 24 h. A LacZ-AdV was used as a control. Cells were then stimulated with HRG (10 ng/ml) for 5 min for Rac-GTP pulldown assays, or 6 h for Western blot analysis. (B) Densitometric analysis of the inhibitory effect of β2-chimaerin on HRG-induced Rac activation and expression of cyclin D1 (D1) and p21Cip1 (p21). Insets show the correlation between the inhibition of Rac-GTP and cyclin D1 or p21Cip1 levels at the different MOIs of the β2-chimerin-AdV (expressed as a percentage of control cells). (D) Inhibition of HRG-induced cell proliferation by β2-chimaerin (β2) or dominant negative Rac1 (N17Rac1; N17). At 16 h after infection with different AdVs in serum-free medium, cells were washed once with PBS and then stimulated with HRG (10 ng/ml). Cell number was determined 48 h later. Results are presented as means±S.D. (n=3). *P<0.05 compared with LacZ-AdV-infected group (Z). All experiments were repeated three times and similar results were obtained.

Rac1 RNAi impairs HRG-induced up-regulation of cyclin D1 and p21Cip1 and cell proliferation

Figure 3
Rac1 RNAi impairs HRG-induced up-regulation of cyclin D1 and p21Cip1 and cell proliferation

T-47D cells were transfected with Rac1 or control (C) siRNA duplexes. After 24–48 h serum starvation, cells were stimulated with HRG (10 ng/ml). (A) Western blot analysis at 6 h. (B) Q-PCR analysis for cyclin D1 at 6 h. (C) Q-PCR analysis for p21Cip1 at 3 h. (D) Analysis of cell proliferation at 48 h. Results are presented as means±S.E.M. (B and C) (n=4) or means±S.D. (n=3) (D). *P<0.05 compared with the control RNAi group. Experiments in (A) and (D) were repeated three times and similar results were obtained.

Figure 3
Rac1 RNAi impairs HRG-induced up-regulation of cyclin D1 and p21Cip1 and cell proliferation

T-47D cells were transfected with Rac1 or control (C) siRNA duplexes. After 24–48 h serum starvation, cells were stimulated with HRG (10 ng/ml). (A) Western blot analysis at 6 h. (B) Q-PCR analysis for cyclin D1 at 6 h. (C) Q-PCR analysis for p21Cip1 at 3 h. (D) Analysis of cell proliferation at 48 h. Results are presented as means±S.E.M. (B and C) (n=4) or means±S.D. (n=3) (D). *P<0.05 compared with the control RNAi group. Experiments in (A) and (D) were repeated three times and similar results were obtained.

EGFR, PI3K and MEK [MAPK (mitogen-activated protein kinase)/ERK kinase] mediate cyclin D1 and p21Cip1 induction by HRG

In a recent study we showed that HRG-induced Rac activation requires PI3K. Rac1 mediates ERK1/2 activation by HRG in breast cancer cells and inhibition of Rac1 impairs ERK1/2 activation and proliferation by HRG [11]. Figure 4(A) shows that the MEK inhibitor UO126 efficiently blocked the induction of cyclin D1 and p21Cip1 by HRG. Likewise, the PI3K inhibitor wortmannin impaired HRG-induced up-regulation of cyclin D1 and p21Cip1 (Figure 4B).

Inhibition of MEK, PI3K or EGFR impairs cyclin D1 and p21Cip1 up-regulation by HRG

Figure 4
Inhibition of MEK, PI3K or EGFR impairs cyclin D1 and p21Cip1 up-regulation by HRG

After 48 h serum starvation, T-47D cells were pre-treated with UO126 (A), wortmannin (B) or AG1478 (C) for 1 h, and then stimulated with HRG (10 ng/ml) in the presence of the inhibitors. Protein levels of cyclin D1 and p21Cip1 were determined 6 h later by Western blot analysis. Similar results were obtained in two additional experiments. Right-hand panels show the densitometric analysis of the effects of UO126, wortmannin and AG1478 on HRG-induced cyclin D1 and p21Cip1 expression. Results are presented as means±S.D. (n=3). *P<0.05 compared with the HRG-only group (cyclin D1), #P<0.05 compared with the HRG-only group (p21Cip1).

Figure 4
Inhibition of MEK, PI3K or EGFR impairs cyclin D1 and p21Cip1 up-regulation by HRG

After 48 h serum starvation, T-47D cells were pre-treated with UO126 (A), wortmannin (B) or AG1478 (C) for 1 h, and then stimulated with HRG (10 ng/ml) in the presence of the inhibitors. Protein levels of cyclin D1 and p21Cip1 were determined 6 h later by Western blot analysis. Similar results were obtained in two additional experiments. Right-hand panels show the densitometric analysis of the effects of UO126, wortmannin and AG1478 on HRG-induced cyclin D1 and p21Cip1 expression. Results are presented as means±S.D. (n=3). *P<0.05 compared with the HRG-only group (cyclin D1), #P<0.05 compared with the HRG-only group (p21Cip1).

We have recently shown that HRG-induced activation of Rac and proliferation involves cross-talk with the EGFR, as both responses can be impaired by the EGFR inhibitors AG1478 and gefitinib (Iressa), as well as by EGFR RNAi [11]. Figure 4(C) shows that AG1478 markedly inhibited the induction of cyclin D1 and p21Cip1 by HRG, further supporting the mechanistic link between HRG stimulation and the induction of cyclin D1 and p21Cip1 via Rac.

Involvement of NF-κB in HRG-induced proliferation and signalling in breast cancer cells

Previous studies have shown that HRG activates NF-κB in breast cancer cells [25,26]. We hypothesized that this pathway could be involved in the induction of cyclin D1 and p21Cip1 by HRG. It was found that HRG stimulation elevates NF-κB activity, as determined using a luciferase reporter assay (Figure 5A). Figure 5(B) shows that HRG activates NF-κB in T-47D breast cancer cells in a time-dependent manner, as judged by Western blot analysis using an anti-phospho-IκBα antibody. Phosphorylation of IκBα became evident 30 min after HRG stimulation and lasted for at least 3 h. A time-course analysis in the same samples revealed that IκBα phosphorylation preceded cyclin D1 and p21Cip1 up-regulation (Figure 5B). To determine the involvement of NF-κB, we expressed the NF-κB super suppressor IκBαM [23] in T-47D cells, and found that it markedly inhibited cyclin D1 and p21Cip1 up-regulation by HRG (Figure 5C), and importantly, it also inhibited the proliferative response of HRG (Figure 5D). These findings strongly argue for the functional involvement of NF-κB in cyclin D1 and p21Cip1 up-regulation by HRG.

NF-κB is involved in HRG-induced cyclin D1 and p21Cip1 up-regulation and cell proliferation

Figure 5
NF-κB is involved in HRG-induced cyclin D1 and p21Cip1 up-regulation and cell proliferation

(A) Effect of HRG (10 ng/ml) on the activation of a NF-κB-luciferase reporter. Reporter activation is inhibited by co-transfection of a vector expressing an NF-κB super-suppressor (pIκαM), but not an empty vector (pcDNA3). Results are presented as means±S.D. (n=3). *P<0.05 compared with the HRG-only group; #P<0.05 compared with the pcDNA3 empty vector group. (B) After 48 h serum starvation, T-47D cells were treated with HRG (10 ng/ml) for different times and lysates were subject to Western blot analysis. (C) Cells were transfected with either a vector encoding an NF-κB super suppressor (pIκBαM) or an empty control vector pcDNA3. After 48 h serum starvation, cells were stimulated with HRG (10 ng/ml) for 3 h and cell lysates were subject to Western blot analysis. (D) At 24 h after plasmid transfection, cells were stimulated with HRG (10 ng/ml). Cell number was determined 48 h later. Results are presented as means±S.D. (n=3). *P<0.05 compared with the pcDNA3 control vector (C) transfection group. All experiments were repeated three times with similar results.

Figure 5
NF-κB is involved in HRG-induced cyclin D1 and p21Cip1 up-regulation and cell proliferation

(A) Effect of HRG (10 ng/ml) on the activation of a NF-κB-luciferase reporter. Reporter activation is inhibited by co-transfection of a vector expressing an NF-κB super-suppressor (pIκαM), but not an empty vector (pcDNA3). Results are presented as means±S.D. (n=3). *P<0.05 compared with the HRG-only group; #P<0.05 compared with the pcDNA3 empty vector group. (B) After 48 h serum starvation, T-47D cells were treated with HRG (10 ng/ml) for different times and lysates were subject to Western blot analysis. (C) Cells were transfected with either a vector encoding an NF-κB super suppressor (pIκBαM) or an empty control vector pcDNA3. After 48 h serum starvation, cells were stimulated with HRG (10 ng/ml) for 3 h and cell lysates were subject to Western blot analysis. (D) At 24 h after plasmid transfection, cells were stimulated with HRG (10 ng/ml). Cell number was determined 48 h later. Results are presented as means±S.D. (n=3). *P<0.05 compared with the pcDNA3 control vector (C) transfection group. All experiments were repeated three times with similar results.

Next, to establish further the sequence of events leading to cyclin D1 and p21Cip1 induction by HRG in breast cancer cells, we examined whether Rac1 was involved in NF-κB activation. Figure 6(A) shows that T-47D cells subject to Rac1 RNAi have impaired IκBα phosphorylation in response to HRG stimulation. The MEK inhibitor UO126 also significantly impaired IκBα phosphorylation by HRG (Figure 6B). Furthermore, the PI3K inhibitor wortmannin, which blocks Rac and ERK activation by HRG, also abrogated IκBα phosphorylation (Figure 6C) and reduced cell proliferation by ∼30% (results not shown). Taken together, these results indicate that HRG activates NF-κB via a Rac1/ERK-dependent pathway.

HRG activates NF-κB via Rac/ERK

Figure 6
HRG activates NF-κB via Rac/ERK

(A) T-47D cells were transfected with either Rac1 or control (C) siRNA duplexes, stimulated 48 h later with HRG (10 ng/ml) for 3 h, and subjected to Western blot analysis. (B and C) T-47D cells were treated with the MEK inhibitor UO126 (B) or the PI3K inhibitor wortmannin (wortm; C) for 1 h, stimulated with HRG (10 ng/ml) for 3 h, and subjected to Western blot analysis. Similar results were obtained in two additional experiments.

Figure 6
HRG activates NF-κB via Rac/ERK

(A) T-47D cells were transfected with either Rac1 or control (C) siRNA duplexes, stimulated 48 h later with HRG (10 ng/ml) for 3 h, and subjected to Western blot analysis. (B and C) T-47D cells were treated with the MEK inhibitor UO126 (B) or the PI3K inhibitor wortmannin (wortm; C) for 1 h, stimulated with HRG (10 ng/ml) for 3 h, and subjected to Western blot analysis. Similar results were obtained in two additional experiments.

DISCUSSION

Although accumulating evidence indicates that heregulins promote breast cancer cell proliferation and breast tumorigenesis, the detailed mechanisms involved in these effects are not well understood. Our recent studies have established an essential role for the small GTPase Rac1 in HRG mitogenic signalling, which involves the activation of EGFR and is independent of ErbB4 [11]. HRG triggers a sustained Rac activation in breast cancer cells, which is dependent on ErbB3, ErbB2, EGFR and PI3K. Rac activation by HRG promotes breast cancer cell proliferation mainly through the MEK/ERK pathway [11]. In the present study, we demonstrate that in addition to stimulating cyclin D1 expression, HRG also elevates the levels of p21Cip1, a well-established negative regulator of the cell cycle [27,28]. We found that HRG-induced proliferation via Rac1 depends not only on cyclin D1 but, paradoxically, also on p21Cip1.

Cyclin D1 is overexpressed in approx. 30–50% of breast tumours and plays important roles in the development of breast cancer [29,30]. Cyclin D1 is one of the essential cyclins that regulate G1- to S-phase transition during normal cell-cycle progression, and it is also an essential component of hormone- and growth factor-induced mitogenesis in breast epithelial cells. In many breast cancers, overexpression of cyclin D1 could not be explained by gene amplification, and possibly involves epigenetic mechanisms. ErbB receptors and their ligand-triggered oncogenic signals are known to up-regulate cyclin D1 both at transcriptional and post-transcriptional levels [30]. Although studies have shown that cyclin D1 protein levels are elevated in response to HRG in NIH 3T3 [31] or breast cancer T-47D cells [32], the mechanisms involved are not well understood. In the present study we demonstrate that elevation in cyclin D1 expression both at mRNA and protein levels is dependent on Rac1, as evidenced by the ability of a dominant-negative Rac1 mutant (N17Rac1), a Rac-GAP (β2-chimaerin) and Rac1 RNAi to impair cyclin D1 up-regulation by HRG. Moreover, inhibition of EGFR or PI3K, which are both required for Rac1 activation by HRG, or inhibition of ERK1/2, whose activity is enhanced by Rac [11], abrogate cyclin D1 induction by HRG. Consistent with its role in cell-cycle progression, cyclin D1 up-regulation is required for HRG-induced breast cancer cell proliferation, as depletion of cyclin D1 using RNAi or inhibition of cyclin D1 induction through Rac1 inactivation/depletion impairs the proliferative activity of HRG. HRG also up-regulates p21Cip1, in agreement with previous studies [3235]. The present study provides the first evidence that this effect is mediated by the small GTPase Rac. Indeed, Rac1 depletion as well as inhibition of Rac function by β2-chimaerin or N17Rac1 blocks p21Cip1 induction by HRG. As observed with cyclin D1, inhibition of EGFR or PI3K, which are both required for Rac activation by HRG, abrogates p21Cip1 induction. p21Cip1 up-regulation is also impaired by the MEK inhibitor UO126, thus supporting that, like cyclin D1, p21Cip1 induction by HRG is mediated by a Rac/ERK-dependent pathway. A recent study showed that heregulin activates Brk (breast tumour kinase), and Brk siRNA impaired Rac and p38 activation [36]. Both Brk and p38 activities are involved in cyclin D1 induction by heregulin; however, it is not known whether p38 activation by heregulin is Rac-dependent or independent [36]. Remarkably, the mitogenic response of HRG is lost when p21Cip1 is knocked-down from T-47D cells using RNAi. The role for p21Cip1 as a negative regulator of the cell cycle is well established [27,28]. However, increasing evidence suggests that p21Cip1 can also have positive roles in cell proliferation and tumorigenesis [3740]. p21Cip1 was found to be essential for promoting the assembly of the cyclin D1–CDK4 complex in mammary epithelial cells [37], murine fibroblasts [41,42] and vascular smooth muscle cells [43]. p21Cip1 binds to the active cyclin D1–CDK4 complex leading to increased stability of cyclin D1 [37,42]. We speculate that p21Cip1 up-regulation in response to HRG stimulation stabilizes the cyclin D1–CDK complex and promotes pRb phosphorylation, therefore favouring the progression through G1-/S-phase and the mitogenic response. However, although increased pRb phosphorylation was observed upon HRG stimulation (Figure 1A), depletion of p21Cip1 by RNAi did not markedly affect pRb phosphorylation (Supplementary Figure 2 at http://www.biochemj.org/bj/410/4100167add.htm), suggesting that additional mechanisms may also take place.

The NF-κB complex consists of different homodimers and heterodimers of the Rel/NF-κB family of transcription factors. In its inactive state, the NF-κB complex is retained in the cytoplasm in a latent form by the inhibitory protein IκB. Many stimuli rapidly activate NF-κB by triggering the phosphorylation and proteolytic degradation of IκB, freeing the dimer complex, and subsequently enabling the translocation of NF-κB into the nucleus where it transcriptionally regulates target genes [44,45]. Heregulins were known to activate NF-κB in breast cancer cells [25,26], and our results showing an increase in NF-κB luciferase reporter activity and time-dependent phosphorylation of IκBα in response to HRG support this concept. In addition, we determined that NF-κB plays a role in cyclin D1 and p21Cip1 induction by HRG via Rac1 in breast cancer cells, as these effects were impaired by expression of the NF-κB super-suppressor IκBαM. Cyclin D1 is a well-known NF-κB target gene. Activated Rac1 induces cyclin D1 expression in NIH 3T3 cells in an NF-κB-dependent manner, and inhibition of NF-κB reduces cyclin D1 levels induced by activated Rac1 [46]. The reported activation of NF-κB by Rac in fibroblast cells [47,48] fits well with our results in breast cancer cells. We also found that activation of NF-κB by HRG is dependent on ERK, as revealed by the ability of the MEK inhibitor UO126 to block IκBα phosphorylation. Thus Rac serves as a point of hierarchical integration that transmits the HRG signal via an MEK/ERK/NF-κB pathway. Interestingly, in a recent study we found that Rac can also up-regulate cyclin D1 expression in an NF-κB-independent manner in mouse embryonic fibroblasts, arguing for a more complex regulatory mechanism [49]. While p21Cip1 is a major target of p53 [27,28], p53-independent up-regulation of p21Cip1 can also occur in response to various stimuli [38,50]. Studies have shown that p21Cip1 expression is also subject to regulation by NF-κB. For example, Javelaud et al. [51] found that induction of p21Cip1 by TNFα (tumour necrosis factor α) in Ewing tumour cells requires NF-κB activity. Wuerzberger-Davis et al. [52] reported that G2/M arrest in leukaemic T-cells in response to ionizing radiation or the chemotherapeutic agent etoposide is mediated by NF-κB-dependent induction of p21Cip1.

Our studies may have significant clinical implications for breast cancer progression and treatment. HRG is up-regulated in approx. 30% of breast tumours. It would be interesting to determine whether those tumours also present cyclin D1 up-regulation. p21Cip1 is also frequently overexpressed in breast carcinomas and is strongly correlated with cyclin D1 overexpression [53] and ErbB2 overexpression [54,55]. Recent studies have shown that p21Cip1 depletion using antisense causes apoptosis in breast cancer cells and suppresses breast cancer growth and angiogenesis in animal models [39,56,57]. Given the fact that Rac and Rac effectors are overexpressed or hyperactivated in human breast tumours [1517,22], our findings provide a strong rationale for designing breast cancer therapeutic strategies targeting the Rac signalling pathway.

This work was supported by grants RO1-CA74197 (National Institutes of Health) to M.G.K. and RO1-GM069064 (National Institutes of Health) to R.K.A.

Abbreviations

     
  • AdV

    adenovirus

  •  
  • Brk

    breast tumour kinase

  •  
  • CDK

    cyclin-dependent kinase

  •  
  • EGF

    epidermal growth factor

  •  
  • EGFR

    EGF receptor

  •  
  • ERK

    extracellular-signal-regulated kinase

  •  
  • GAP

    GTPase-activating protein

  •  
  • GAPDH

    glyceraldehyde-3-phosphate dehydrogenase

  •  
  • GEF

    guanine-nucleotide-exchange factor

  •  
  • HRG

    heregulin β1

  •  
  • IκB

    inhibitory κB

  •  
  • MEK

    MAPK (mitogen activated protein kinase)/ERK kinase

  •  
  • MOI

    multiplicity of infection

  •  
  • NF-κB

    nuclear factor κB

  •  
  • Pak

    p21-activated kinase

  •  
  • pfu

    plaque-forming unit

  •  
  • PI3K

    phosphoinositide 3-kinase

  •  
  • pRb

    retinoblastoma

  •  
  • RNAi

    RNA interference

  •  
  • RT

    reverse transcriptase

  •  
  • Q-PCR

    quantitative PCR

  •  
  • siRNA

    small interfering RNA

References

References
1
Falls
D. L.
Neuregulins: functions, forms, and signaling strategies
Exp. Cell Res.
2003
, vol. 
284
 (pg. 
14
-
30
)
2
Stove
C.
Bracke
M.
Roles for neuregulins in human cancer
Clin. Exp. Metastasis
2004
, vol. 
21
 (pg. 
665
-
684
)
3
Barnes
C. J.
Li
F.
Talukder
A. H.
Kumar
R.
Growth factor regulation of a 26S proteasomal subunit in breast cancer
Clin. Cancer Res.
2005
, vol. 
11
 (pg. 
2868
-
2874
)
4
Dunn
M.
Sinha
P.
Campbell
R.
Blackburn
E.
Levinson
N.
Rampaul
R.
Bates
T.
Humphreys
S.
Gullick
W. J.
Co-expression of neuregulins 1, 2, 3 and 4 in human breast cancer
J. Pathol.
2004
, vol. 
203
 (pg. 
672
-
680
)
5
Marshall
C.
Blackburn
E.
Clark
M.
Humphreys
S.
Gullick
W. J.
Neuregulins 1–4 are expressed in the cytoplasm or nuclei of ductal carcinoma (in situ) of the human breast
Breast Cancer Res. Treat.
2006
, vol. 
96
 (pg. 
163
-
168
)
6
Atlas
E.
Cardillo
M.
Mehmi
I.
Zahedkargaran
H.
Tang
C.
Lupu
R.
Heregulin is sufficient for the promotion of tumorigenicity and metastasis of breast cancer cells in vivo
Mol. Cancer Res.
2003
, vol. 
1
 (pg. 
165
-
175
)
7
Tsai
M. S.
Shamon-Taylor
L. A.
Mehmi
I.
Tang
C. K.
Lupu
R.
Blockage of heregulin expression inhibits tumorigenicity and metastasis of breast cancer
Oncogene
2003
, vol. 
22
 (pg. 
761
-
768
)
8
Gamett
D. C.
Pearson
G.
Cerione
R. A.
Friedberg
I.
Secondary dimerization between members of the epidermal growth factor receptor family
J. Biol. Chem.
1997
, vol. 
272
 (pg. 
12052
-
12056
)
9
Citri
A.
Skaria
K. B.
Yarden
Y.
The deaf and the dumb: the biology of ErbB-2 and ErbB-3
Exp. Cell Res.
2003
, vol. 
284
 (pg. 
54
-
65
)
10
Citri
A.
Yarden
Y.
EGF-ERBB signalling: towards the systems level
Nat. Rev. Mol. Cell Biol.
2006
, vol. 
7
 (pg. 
505
-
516
)
11
Yang
C.
Liu
Y.
Lemmon
M. A.
Kazanietz
M. G.
Essential role for Rac in heregulin β1 mitogenic signaling: a mechanism that involves epidermal growth factor receptor and is independent of ErbB4
Mol. Cell Biol.
2006
, vol. 
26
 (pg. 
831
-
842
)
12
Bar-Sagi
D.
Hall
A.
Ras and Rho GTPases: a family reunion
Cell
2000
, vol. 
103
 (pg. 
227
-
238
)
13
Takai
Y.
Sasaki
T.
Matozaki
T.
Small GTP-binding proteins
Physiol. Rev.
2001
, vol. 
81
 (pg. 
153
-
208
)
14
Wennerberg
K.
Rossman
K. L.
Der
C. J.
The Ras superfamily at a glance
J. Cell Sci.
2005
, vol. 
118
 (pg. 
843
-
846
)
15
Fritz
G.
Just
I.
Kaina
B.
Rho GTPases are over-expressed in human tumors
Int. J. Cancer
1999
, vol. 
81
 (pg. 
682
-
687
)
16
Schnelzer
A.
Prechtel
D.
Knaus
U.
Dehne
K.
Gerhard
M.
Graeff
H.
Harbeck
N.
Schmitt
M.
Lengyel
E.
Rac1 in human breast cancer: overexpression, mutation analysis, and characterization of a new isoform, Rac1b
Oncogene
2000
, vol. 
19
 (pg. 
3013
-
3020
)
17
Minard
M. E.
Kim
L. S.
Price
J. E.
Gallick
G. E.
The role of the guanine nucleotide exchange factor Tiam1 in cellular migration, invasion, adhesion and tumor progression
Breast Cancer Res. Treat.
2004
, vol. 
84
 (pg. 
21
-
32
)
18
Yang
C.
Liu
Y.
Leskow
F. C.
Weaver
V. M.
Kazanietz
M. G.
Rac-GAP-dependent inhibition of breast cancer cell proliferation by β2-chimerin
J. Biol. Chem.
2005
, vol. 
280
 (pg. 
24363
-
24370
)
19
Yang
C.
Kazanietz
M. G.
Chimaerins: GAPs that bridge diacylglycerol (DAG) signaling and the small G-protein Rac
Biochem. J.
2007
, vol. 
403
 (pg. 
1
-
12
)
20
Griner
E. M.
Kazanietz
M. G.
Protein kinase C and other diacylglycerol effectors in cancer
Nat. Rev. Cancer
2007
, vol. 
7
 (pg. 
281
-
294
)
21
Vadlamudi
R. K.
Kumar
R.
p21-activated kinases in human cancer
Cancer Metastasis Rev.
2003
, vol. 
22
 (pg. 
385
-
393
)
22
Kumar
R.
Gururaj
A. E.
Barnes
C. J.
p21-activated kinases in cancer
Nat. Rev. Cancer
2006
, vol. 
6
 (pg. 
459
-
471
)
23
Cai
Z.
Korner
M.
Tarantino
N.
Chouaib
S.
IκBα overexpression in human breast carcinoma MCF7 cells inhibits nuclear factor-κB activation but not tumor necrosis factor-α-induced apoptosis
J. Biol. Chem.
1997
, vol. 
272
 (pg. 
96
-
101
)
24
Caloca
M. J.
Wang
H.
Kazanietz
M. G.
Characterization of the Rac-GAP (Rac-GTPase-activating protein) activity of β2-chimaerin, a ‘non-protein kinase C’ phorbol ester receptor
Biochem. J.
2003
, vol. 
375
 (pg. 
313
-
321
)
25
Bhat-Nakshatri
P.
Sweeney
C. J.
Nakshatri
H.
Identification of signal transduction pathways involved in constitutive NF-κB activation in breast cancer cells
Oncogene
2002
, vol. 
21
 (pg. 
2066
-
2078
)
26
Biswas
D. K.
Shi
Q.
Baily
S.
Strickland
I.
Ghosh
S.
Pardee
A. B.
Iglehart
J. D.
NF-κB activation in human breast cancer specimens and its role in cell proliferation and apoptosis
Proc. Natl. Acad. Sci. U.S.A.
2006
, vol. 
101
 (pg. 
10137
-
10142
)
27
el-Deiry
W. S.
Tokino
T.
Velculescu
V. E.
Levy
D. B.
Parsons
R.
Trent
J. M.
Lin
D.
Mercer
W. E.
Kinzler
K. W.
Vogelstein
B.
WAF1, a potential mediator of p53 tumor suppression
Cell
1993
, vol. 
75
 (pg. 
817
-
825
)
28
Slebos
R. J.
Lee
M. H.
Plunkett
B. S.
Kessis
T. D.
Williams
B. O.
Jacks
T.
Hedrick
L.
Kastan
M. B.
Cho
K. R.
p53-dependent G1 arrest involves pRB-related proteins and is disrupted by the human papillomavirus 16 E7 oncoprotein
Proc. Natl. Acad. Sci. U.S.A.
1994
, vol. 
91
 (pg. 
5320
-
5324
)
29
Fu
M.
Wang
C.
Li
Z.
Sakamaki
T.
Pestell
R. G.
Cyclin D1: normal and abnormal functions
Endocrinology
2004
, vol. 
145
 (pg. 
5439
-
5447
)
30
Arnold
A.
Papanikolaou
A.
Cyclin D1 in breast cancer pathogenesis
J. Clin. Oncol.
2005
, vol. 
23
 (pg. 
4215
-
4224
)
31
Vijapurkar
U.
Kim
M. S.
Koland
J. G.
Roles of mitogen-activated protein kinase and phosphoinositide 3′-kinase in ErbB2/ErbB3 coreceptor-mediated heregulin signaling
Exp. Cell Res.
2003
, vol. 
284
 (pg. 
291
-
302
)
32
Neve
R. M.
Holbro
T.
Hynes
N. E.
Distinct roles for phosphoinositide 3-kinase, mitogen-activated protein kinase and p38 MAPK in mediating cell cycle progression of breast cancer cells
Oncogene
2002
, vol. 
21
 (pg. 
4567
-
4576
)
33
Fiddes
R. J.
Janes
P. W.
Sivertsen
S. P.
Sutherland
R. L.
Musgrove
E. A.
Daly
R. J.
Inhibition of the MAP kinase cascade blocks heregulin-induced cell cycle progression in T-47D human breast cancer cells
Oncogene
1998
, vol. 
16
 (pg. 
2803
-
2813
)
34
Menendez
J. A.
Mehmi
I.
Lupu
R.
Heregulin-triggered Her-2/neu signaling enhances nuclear accumulation of p21WAF1/CIP1 and protects breast cancer cells from cisplatin-induced genotoxic damage
Int. J. Oncol.
2005
, vol. 
26
 (pg. 
649
-
659
)
35
Perez-Tenorio
G.
Berglund
F.
Esguerra Merca
A.
Nordenskjold
B.
Rutqvist
L. E.
Skoog
L.
Stal
O.
Cytoplasmic p21WAF1/CIP1 correlates with Akt activation and poor response to tamoxifen in breast cancer
Int. J. Oncol.
2006
, vol. 
28
 (pg. 
1031
-
1042
)
36
Ostrander
J. H.
Daniel
A. R.
Lofgren
K.
Kleer
C. G.
Lange
C. A.
Breast tumor kinase (protein tyrosine kinase 6) regulates heregulin-induced activation of ERK5 and p38 MAP kinases in breast cancer cells
Cancer Res.
2007
, vol. 
67
 (pg. 
4199
-
4209
)
37
LaBaer
J.
Garrett
M. D.
Stevenson
L. F.
Slingerland
J. M.
Sandhu
C.
Chou
H. S.
Fattaey
A.
Harlow
E.
New functional activities for the p21 family of CDK inhibitors
Genes Dev.
1997
, vol. 
11
 (pg. 
847
-
862
)
38
Roninson
I. B.
Oncogenic functions of tumour suppressor p21(Waf1/Cip1/Sdi1): association with cell senescence and tumour-promoting activities of stromal fibroblasts
Cancer Lett.
2002
, vol. 
179
 (pg. 
1
-
14
)
39
Weiss
R. H.
p21Waf1/Cip1 as a therapeutic target in breast and other cancers
Cancer Cell
2003
, vol. 
4
 (pg. 
425
-
429
)
40
Gartel
A. L.
Is p21 an oncogene?
Mol. Cancer Ther.
2006
, vol. 
5
 (pg. 
1385
-
1386
)
41
Zhang
H.
Hannon
G. J.
Beach
D.
p21-containing cyclin kinases exist in both active and inactive states
Genes Dev.
1994
, vol. 
8
 (pg. 
1750
-
1758
)
42
Cheng
M.
Olivier
P.
Diehl
J. A.
Fero
M.
Roussel
M. F.
Roberts
J. M.
Sherr
C. J.
The p21(Cip1) and p27(Kip1) CDK ‘inhibitors’ are essential activators of cyclin D-dependent kinases in murine fibroblasts
EMBO J.
1999
, vol. 
18
 (pg. 
1571
-
1583
)
43
Weiss
R. H.
Joo
A.
Randour
C.
p21Waf1/Cip1 is an assembly factor required for platelet-derived growth factor-induced vascular smooth muscle cell proliferation
J. Biol. Chem.
2000
, vol. 
275
 (pg. 
10285
-
10290
)
44
Pahl
H. L.
Activators and target genes of Rel/NF-κB transcription factors
Oncogene
1999
, vol. 
18
 (pg. 
6853
-
6866
)
45
Karin
M.
Ben-Neriah
Y.
Phosphorylation meets ubiquitination: the control of NF-κB activity
Annu. Rev. Immunol.
2000
, vol. 
18
 (pg. 
621
-
663
)
46
Joyce
D.
Bouzahzah
B.
Fu
M.
Albanese
C.
D'Amico
M.
Steer
J.
Klein
J. U.
Lee
R. J
Segall
J. E.
Westwick
J. K.
Der
C. J.
Pestell
R. G.
Integration of Rac-dependent regulation of cyclin D1 transcription through a nuclear factor-κB-dependent pathway
J. Biol. Chem.
1999
, vol. 
274
 (pg. 
25245
-
25249
)
47
Perona
R.
Montaner
S.
Saniger
L.
Sanchez-Perez
I.
Bravo
R.
Lacal
J. C.
Activation of the nuclear factor-κB by Rho, CDC42, and Rac-1 proteins
Genes Dev.
1997
, vol. 
11
 (pg. 
463
-
475
)
48
Montaner
S.
Perona
R.
Saniger
L.
Lacal
J. C.
Multiple signalling pathways lead to the activation of the nuclear factor κB by the Rho family of GTPases
J. Biol. Chem.
1998
, vol. 
273
 (pg. 
12779
-
12785
)
49
Klein
E. A.
Yang
C.
Kazanietz
M. G.
Assoian
R. K.
NFκB-independent signaling to the Cyclin D1 Gene by Rac
Cell Cycle
2007
, vol. 
6
 (pg. 
1115
-
1121
)
50
Sowa
Y.
Orita
T.
Hiranabe-Minamikawa
S.
Nakano
K.
Mizuno
T.
Nomura
H.
Sakai
T.
Histone deacetylase inhibitor activates the p21/WAF1/Cip1 gene promoter through the Sp1 sites
Ann. N.Y. Acad. Sci.
1999
, vol. 
886
 (pg. 
195
-
199
)
51
Javelaud
D.
Wietzerbin
J.
Delattre
O.
Besancon
F.
Induction of p21Waf1/Cip1 by TNFα requires NF-κB activity and antagonizes apoptosis in Ewing tumor cells
Oncogene
2000
, vol. 
19
 (pg. 
61
-
68
)
52
Wuerzberger-Davis
S. M.
Chang
P. Y.
Berchtold
C.
Miyamoto
S.
Enhanced G2-M arrest by nuclear factor-κB-dependent p21waf1/cip1 induction
Mol. Cancer Res.
2005
, vol. 
3
 (pg. 
345
-
353
)
53
Rey
M. J.
Fernandez
P. L.
Jares
P.
Munoz
M.
Nadal
A.
Peiro
N.
Nayach
I.
Mallofre
C.
Muntane
J.
Campo
E.
Estape
J.
Cardesa
A.
p21WAF1/Cip1 is associated with cyclin D1CCND1 expression and tubular differentiation but is independent of p53 overexpression in human breast carcinoma
J. Pathol.
1998
, vol. 
184
 (pg. 
265
-
271
)
54
Winters
Z. E.
Leek
R. D.
Bradburn
M. J.
Norbury
C. J.
Harris
A. L.
Cytoplasmic p21WAF1/CIP1 expression is correlated with HER-2/neu in breast cancer and is an independent predictor of prognosis
Breast Cancer Res.
2003
, vol. 
5
 (pg. 
242
-
249
)
55
Yang
W.
Klos
K. S.
Zhou
X.
Yao
J.
Yang
Y.
Smith
T. L.
Shi
D.
Yu
D.
ErbB2 overexpression in human breast carcinoma is correlated with p21Cip1 up-regulation and tyrosine-15 hyperphosphorylation of p34Cdc2: poor responsiveness to chemotherapy with cyclophoshamide methotrexate, and 5-fluorouracil is associated with Erb2 overexpression and with p21Cip1 overexpression
Cancer
2003
, vol. 
98
 (pg. 
1123
-
1130
)
56
Fan
Y.
Borowsky
A. D.
Weiss
R. H.
An antisense oligodeoxynucleotide to p21(Waf1/Cip1) causes apoptosis in human breast cancer cells
Mol. Cancer Ther.
2003
, vol. 
2
 (pg. 
773
-
782
)
57
Weiss
R. H.
Marshall
D.
Howard
L.
Corbacho
A. M.
Cheung
A. T.
Sawai
E. T.
Suppression of breast cancer growth and angiogenesis by an antisense oligodeoxynucleotide to p21(Waf1/Cip1)
Cancer Lett.
2003
, vol. 
189
 (pg. 
39
-
48
)

Author notes

1

Present address: Department of Physiology and Center for Integrative Toxicology, Michigan State University, 4171 Biomedical Physical Sciences, East Lansing, MI 48864, U.S.A.

Supplementary data