Expression from the Escherichia coli hcp-hcr operon promoter is optimally induced during anaerobic conditions in the presence of nitrite. This expression depends on transcription activation by FNR (fumarate and nitrate reduction regulator), which binds to a target centred at position −72.5 upstream of the transcript start site. Mutational analysis was exploited to identify the corresponding −10 and −35 hexamer elements. A DNA site for NarL and NarP, located at position −104.5, plays only a minor role, whereas NsrR binding to a DNA target centred at position +6 plays a major role in induction of the hcp-hcr operon promoter. Electrophoretic mobility-shift assays show that NsrR binds to this target. The consequences of this for the kinetics of induction of the hcp-hcr operon are discussed.

INTRODUCTION

The expression of many Escherichia coli transcripts is tightly controlled in response to environmental cues, and, in many instances, this control is exercised at the level of the promoter by the regulation of the initiation of transcript formation [1]. Two very important signals are the absence of oxygen and the presence of nitrate or nitrite ions, and many promoters are activated only when these are combined [2]. These signals are ‘transmitted’ to promoters by transcription factors that can either activate or repress transcription initiation [3]. Hence, absence of oxygen triggers the activity of FNR (fumarate and nitrate reduction regulator), a well-characterized transcription factor that is the master regulator of E. coli adaptation to growth in anaerobic conditions [4]. FNR binds to ~25 bp sequences at target promoters and recruits RNA polymerase, thereby activating transcription. Similarly, the presence of nitrate or nitrite ions leads to the activation of NarL and its homologue, NarP, which belong to the response regulator family of transcription factors. Activation of both NarL and NarP is mediated by the membrane-bound NarX and NarQ sensor kinases that are triggered by nitrate or nitrite ions in the environment (reviewed in [5,6]). Upon activation, NarL and NarP bind to identical heptamer sequences and, at many target promoters, two heptamers are found as a ‘tail-to-tail’ inverted repeat (often referred to as the 7-2-7 arrangement). These heptamers are found at a variety of locations at different target promoters and NarL and NarP have been found to modulate transcription by a variety of mechanisms. Many of these target promoters control the expression of gene products involved in the reduction of nitrate or nitrite and, hence, NarL and NarP are thought to be the principal regulators of nitrate and nitrite metabolism. However, recently, another transcription factor, NsrR, has been found to play a role at some promoters that are controlled by oxygen and by nitrate or nitrite ions (reviewed in [7,8]). NsrR appears to bind to 23 bp sequences at many target promoters and it functions as a repressor [9]. The activity of NsrR is regulated by NO or RNS (reactive nitrogen species) that convert NsrR into a form that is unable to bind to its targets and hence unable to repress transcription. As NO and RNS are produced as by-products of nitrate and nitrite metabolism this means that nitrate- or nitrite-induced changes in transcription can be mediated by NsrR as well as by NarL and NarP.

The E. coli hcp-hcr operon encodes an iron–sulfur cluster-containing protein (hcp is locus b0873 in http://cmr.jcvi.org) and an NADH oxidoreductase (hcr is locus b0872 in http://cmr.jcvi.org). The in vivo function of these proteins is not clear, but it is well established that their expression is induced by the absence of oxygen and the presence of nitrate or nitrite ions [10,11]. Studies of the hcp-hcr operon regulatory region have identified a single promoter and mapped the transcript start [10]. Expression from this promoter was shown to be completely dependent on FNR, and a single DNA site for FNR, centred at position −72.5 (i.e. between base pairs 72 and 73 upstream of the transcript start) was identified [10]. An upstream 7-2-7 NarL/NarP-binding site at position −104.5 was also identified and it was suggested that this site is essential for stimulation of hcp-hcr operon expression by nitrate or nitrite ions [11]. However, previous studies also found a 23 bp DNA site for NsrR centred at position +6, and showed that the hcp-hcr promoter can be repressed by NsrR [9,11]. Hence, the major aim of the present study was to quantify the relative contributions of NarL/NarP and NsrR to the regulation of the hcp-hcr promoter by nitrate and nitrite ions. A second aim was to confirm the location of the DNA site for FNR at position −72.5 and to identify other functional determinants. To achieve these aims, we performed a mutational and deletion analysis of the hcp-hcr operon promoter, and we report in the present paper that NsrR plays a major role, whereas the effects of NarL and NarP are minimal.

EXPERIMENTAL

Bacterial strains, plasmids, promoter fragments and primers

The bacterial strains, plasmids, promoter fragments and oligodeoxynucleotide primers used in the present study are listed in Table 1. E. coli K-12 strain JCB387 and derivatives were used throughout the study. Strains JCB387 ΔnsrR and JCB38849S ΔnsrR were constructed by P1 transduction of the ΔnsrR mutation from strain JCB5010 [11].

Table 1
Bacterial strains, plasmids, promoter fragments and oligodeoxynucleotide primers
Name Details Source 
Bacterial strains   
 JCB5010 ΔlacU169 araD139 rpsL gyrA ΔnsrR [11
 JCB387 Δnir Δlac [26
 JCB387 ΔnsrR ΔnsrR derivative The present study 
 JCB38849S Tets version of JCB387 narL narP253::Tn10dCm ΔhimA452::Tn10dTc isolated as a fusaric acid-resistant colony [27
 JCB38849S ΔnsrR ΔnsrR derivative The present study 
Bacterial plasmids   
 pRW50 Broad host range lacZ fusion vector for cloning promoters on EcoRI-HindIII fragments: contains the RK2 origin of replication and encodes TcR [12
 pNF383 pAA182 containing extended E. coli hcp-hcr promoter region on an EcoRI-HindIII fragment [10
 pSTBlue-1 Cloning vector containing the pUC origin of replication Novagen 
 pGIT9 pSTBlue-1 containing E. coli nsrR [28
Promoter fragments (all EcoRI-HindIII fragments)   
 hcp383-1 E. coli hcp-hcr promoter fragment carrying nucleotide sequences from −125 to +98 The present study 
 hcp383-2 E. coli hcp-hcr promoter fragment carrying nucleotide sequences from −92 to +98 The present study 
 hcp383-3 E. coli hcp-hcr promoter fragment carrying nucleotide sequences from −54 to +98 The present study 
 hcp383-1n Fragment hcp383-1 carrying A to G and T to G mutations at positions +9 and +10 The present study 
 hcp383-1ns hcp-hcr promoter fragment carrying nucleotide sequences from −125 to +46 and carrying A to G and T to G mutations at positions +9 and +10 The present study 
 hcp383-3s hcp-hcr promoter fragment carrying nucleotide sequences from −54 to +46 The present study 
 hcp383-3ns Fragment hcp383-3s carrying A to G and T to G mutations at positions +9 and +10 The present study 
ogt100 E. coli ogt promoter fragment carrying nucleotide sequences from −269 to +51 [18
Oligodeoxynucleotide primers (all are shown 5′→3′)   
 D10520 CCCTGCGGTGCCCCTCAAG – 
 D10527 GCAGGTCGTTGAACTGAGCCTGAAATTCAGG – 
 hcp-1 FWD CCCGAATTCTTTCTCTGCGTAATACCTCTCTGGCGGT – 
 hcp-2 FWD CCCGAATTCCTGCCGCCAAAATTGCGCTAAATC – 
 hcp-3 FWD CCCGAATTCGTTGCATGAAAAATCCCTTTTATCC – 
 hcp-n FWD CCTTAAACATGTATATTAAGGATAACTTTAAAAGG – 
 hcp-s REV CCCAAGCTTGCACACAAAACATGATCACACCTT – 
 hcp P9V FWD GCGTTAAGCGTCTTAACCVTAAACATGTATATTAA – 
 hcp P13G FWD GCGTTAAGCGTCTTGACCTTAAACATGTATATTAA – 
 hcp P14V FWD GCGTTAAGCGTCTVAACCTTAAACATGTATATTAA – 
 hcp P35R FWD GAAAAATCCCTTRTATCCCCGCGTTAAG – 
 hcp P37V FWD GAAAAATCCCVTTTATCCCCGCGTTAAG – 
Name Details Source 
Bacterial strains   
 JCB5010 ΔlacU169 araD139 rpsL gyrA ΔnsrR [11
 JCB387 Δnir Δlac [26
 JCB387 ΔnsrR ΔnsrR derivative The present study 
 JCB38849S Tets version of JCB387 narL narP253::Tn10dCm ΔhimA452::Tn10dTc isolated as a fusaric acid-resistant colony [27
 JCB38849S ΔnsrR ΔnsrR derivative The present study 
Bacterial plasmids   
 pRW50 Broad host range lacZ fusion vector for cloning promoters on EcoRI-HindIII fragments: contains the RK2 origin of replication and encodes TcR [12
 pNF383 pAA182 containing extended E. coli hcp-hcr promoter region on an EcoRI-HindIII fragment [10
 pSTBlue-1 Cloning vector containing the pUC origin of replication Novagen 
 pGIT9 pSTBlue-1 containing E. coli nsrR [28
Promoter fragments (all EcoRI-HindIII fragments)   
 hcp383-1 E. coli hcp-hcr promoter fragment carrying nucleotide sequences from −125 to +98 The present study 
 hcp383-2 E. coli hcp-hcr promoter fragment carrying nucleotide sequences from −92 to +98 The present study 
 hcp383-3 E. coli hcp-hcr promoter fragment carrying nucleotide sequences from −54 to +98 The present study 
 hcp383-1n Fragment hcp383-1 carrying A to G and T to G mutations at positions +9 and +10 The present study 
 hcp383-1ns hcp-hcr promoter fragment carrying nucleotide sequences from −125 to +46 and carrying A to G and T to G mutations at positions +9 and +10 The present study 
 hcp383-3s hcp-hcr promoter fragment carrying nucleotide sequences from −54 to +46 The present study 
 hcp383-3ns Fragment hcp383-3s carrying A to G and T to G mutations at positions +9 and +10 The present study 
ogt100 E. coli ogt promoter fragment carrying nucleotide sequences from −269 to +51 [18
Oligodeoxynucleotide primers (all are shown 5′→3′)   
 D10520 CCCTGCGGTGCCCCTCAAG – 
 D10527 GCAGGTCGTTGAACTGAGCCTGAAATTCAGG – 
 hcp-1 FWD CCCGAATTCTTTCTCTGCGTAATACCTCTCTGGCGGT – 
 hcp-2 FWD CCCGAATTCCTGCCGCCAAAATTGCGCTAAATC – 
 hcp-3 FWD CCCGAATTCGTTGCATGAAAAATCCCTTTTATCC – 
 hcp-n FWD CCTTAAACATGTATATTAAGGATAACTTTAAAAGG – 
 hcp-s REV CCCAAGCTTGCACACAAAACATGATCACACCTT – 
 hcp P9V FWD GCGTTAAGCGTCTTAACCVTAAACATGTATATTAA – 
 hcp P13G FWD GCGTTAAGCGTCTTGACCTTAAACATGTATATTAA – 
 hcp P14V FWD GCGTTAAGCGTCTVAACCTTAAACATGTATATTAA – 
 hcp P35R FWD GAAAAATCCCTTRTATCCCCGCGTTAAG – 
 hcp P37V FWD GAAAAATCCCVTTTATCCCCGCGTTAAG – 

The low-copy number lac expression vector, pRW50 [12], was used as the main cloning vector during the present study and it was maintained in host cells using medium supplemented with 35 μg/ml tetracycline. Plasmids pNF383, pSTBlue-1 and pGIT9 were maintained in host cells using medium supplemented with 80 μg/ml ampicillin.

All of the promoter fragments used in the present study carry an upstream EcoRI site and a downstream HindIII site and were cloned into pRW50. By convention, positions at the hcp-hcr operon promoter are labelled with the reported transcript start point [10] designated as +1 and upstream and downstream locations prefixed with ‘−’ and ‘+’ respectively.

The hcp383-1, hcp383-2 and hcp383-3 fragments, which encode hcp-hcr promoter sequences from positions −125, −92 and −54 respectively, to position +98, were constructed by PCR. DNA fragments were amplified using primers D10527 and either hcp-1 FWD, hcp-2 FWD or hcp-3 FWD using pNF383 as a template. PCR products were restricted with EcoRI and HindIII and cloned into pRW50. Different mutations were generated in these fragments using different PCR methods.

Single base substitutions in promoter fragments are denoted NX, where N is the position of the substitution relative to the transcript start, and X is the substituted base in the non-template strand of the promoter. The hcp383-1n fragment, containing the +9G and +10G substitutions, was constructed by two-step megaprimer PCR [13]. In the first step, a megaprimer was generated by PCR using primers hcp-n FWD and D10527 with hcp383-1 cloned into pRW50 as a template. Purified megaprimer product was then used in a second PCR, together with primer D10520 and the same template. This generated the hcp383-1n fragment which was then cloned into pRW50. This recombinant plasmid was then used as a template in a further PCR to generate the hcp383-1ns fragment using hcp-s REV and D10520 as primers. Further point mutations were introduced into the hcp383-1ns fragment by megaprimer PCR using the hcp P9V FWD, hcp P13G FWD, hcp P14V FWD, hcp P35R FWD and hcp P37V FWD primers.

The hcp383-3s fragment was constructed by PCR using primers D10520 and hcp-s REV using pRW50 carrying hcp383-3 as template. The hcp383-3ns fragment was constructed by PCR using primers hcp-3 FWD and hcp-s REV with pRW50 carrying hcp383-1ns as a template.

Promoter activity assays

The pRW50 lac expression vector plasmid was exploited to measure the activity of cloned promoters. Hence, relevant Δlac strains were transformed with plasmids encoding either hcp-hcr operon promoter::lacZ or ogt promoter::lacZ fusions, and β-galactosidase activities were measured using the Miller method [14]. Cells were grown in minimal medium (minimal salts with 0.4% glycerol, 10% Lennox broth and 40 mM fumarate [15]) at 37 °C. For aerobic growth, cells were shaken vigorously, whereas, for anaerobic growth, they were held static in growth tubes (150 mm long and 15 mm in diameter). Aerobic cultures were grown to a D650 of 0.2–0.3, anaerobic cultures were grown to a D650 of 0.4–0.6 and assayed exactly as described previously [16]. Note that aerobically grown cells were harvested at a lower cell density when it is known that cultures are fully oxygenated. Throughout the present study, secondary effects owing to differences in metabolism between different culture conditions were minimized by comparing the β-galactosidase expression controlled by different derivatives of the hcp-hcr operon promoter. β-Galactosidase activities are reported as nmol of ONPG (o-nitrophenyl-β-galactoside) hydrolysed in our assay conditions/min per mg of dry cell mass, and each activity is the average of three independent determinations.

In vitro experiments

DNase I footprinting of FNR at the hcp-hcr operon promoter region was performed as described in Browning et al. [16], using purified Ala154 FNR and a purified AatII-HindIII hcp383-1 fragment that had been 32P-end-labelled at the HindIII site using polynucleotide kinase and [γ-32P]ATP.

EMSAs (electrophoretic mobility-shift assays) using crude protein extracts containing NsrR were run as described in Browning et al. [17]. Extracts were made from a ΔnsrR derivative of JCB387 carrying either pGIT9, which expresses NsrR, or empty vector pSTBlue-1. Cells were grown anaerobically at 37 °C in 50 ml of minimum medium to a D650 of 0.6. Each culture was centrifuged in an Eppendorf 5810R centrifuge at 3000 g for 15 min at 4 °C and the pellet was resuspended in 5 ml of ice-cold wash buffer [20 mM Tris/HCl (pH 8.0), 5% glycerol, 1 mM DTT (dithiothreitol), 200 μg/ml PMSF and 4 μg/ml pepstatin]. Suspensions were recentrifuged and pellets were resuspended in 2 ml of wash buffer. Cells were disrupted by sonication using a Misonix Ultrasonic Processor XL for three 20 s bursts with 30 s cooling between each sonication step. Cell debris was removed by centrifuging 1 ml samples in an Eppendorf 5417R centrifuge at 20800 g for 30 min at 4 °C. Cell lysates were stored at 4 °C and used within 24 h of preparation.

For the EMSAs, purified EcoRI-HindIII hcp383-3s and hcp383-3ns promoter fragments were 32P-end-labelled using polynucleotide kinase and [γ-32P]ATP. Approx. 0.5 ng of each fragment was incubated with various amounts of lysate (0–9 μg of protein) in buffer containing 10 mM potassium phosphate (pH 7.5), 100 mM potassium glutamate, 1 mM EDTA, 50 μM DTT, 5% glycerol and 25 μg/ml herring sperm DNA. The final reaction volume was 10 μl. After incubation at 37 °C for 20 min, samples were run in 0.25×TBE [Tris/borate/EDTA (1×TBE is 45mM Tris/borate and 1mM EDTA)] on a 6% polyacrylamide gel containing 2% glycerol at 12 V/cm and analysed using a Bio-Rad Molecular Imager FX and Quantity One software (Bio-Rad).

RESULTS

Analysis of the hcp-hcr operon promoter

The hcp383-1 EcoRI-HindIII DNA fragment, illustrated in Figure 1, covers the hcp-hcr operon regulatory region which includes the hcp-hcr promoter. The Figure shows the base sequence from position −125 to position +98 with respect to the reported transcript start, and the previously proposed DNA sites for NarL and NarP, FNR and NsrR [911]. Note that the sequence 5′-TCTGCGTAA-3′ from position −121 to position −113 corresponds to the last three codons of the preceding gene, ybjE (locus b0874 in http://cmr.jcvi.org) and thus the hcp383-1 DNA fragment contains the complete ybjE-hcp intergenic region and is likely to carry all of the sequence elements needed for hcp-hcr promoter activity and regulation. Furthermore, extension of the hcp383-1 DNA fragment upstream to position −285 with respect to the hcp-hcr transcript start had no measurable effects in the assays described below (D. Chismon, unpublished work).

Base sequence of the hcp383-1 promoter DNA fragment

Figure 1
Base sequence of the hcp383-1 promoter DNA fragment

The hcp383-1 fragment carries the hcp-hcr operon promoter sequence from position −125 to position +98 flanked by an upstream EcoRI site (boxed) and a downstream HindIII site (boxed). The previously proposed DNA targets [11] for NarL (and NarP), FNR and NsrR are indicated by shaded horizontal inverted arrows. Consensus binding sequences are shown in bold below each target, aligned with the actual sequence, and the centre of the site is noted. In the consensus sequences, Y denotes either C or T, M denotes A or C, K denotes G or T, R denotes A or G, W denotes A or T, and N denotes any base. The proposed promoter −35 and −10 hexamer elements are underlined and labelled. The reported transcription start site for the hcp-hcr operon promoter [10] is identified with a bent arrow and the hcp gene translation start codon (ATG) is in bold type. The upstream ends of the hcp383-2 and hcp383-3 fragments are indicated by solid lines that become dotted lines above the sequence. Base substitutions described in the text are indicted by vertical arrows.

Figure 1
Base sequence of the hcp383-1 promoter DNA fragment

The hcp383-1 fragment carries the hcp-hcr operon promoter sequence from position −125 to position +98 flanked by an upstream EcoRI site (boxed) and a downstream HindIII site (boxed). The previously proposed DNA targets [11] for NarL (and NarP), FNR and NsrR are indicated by shaded horizontal inverted arrows. Consensus binding sequences are shown in bold below each target, aligned with the actual sequence, and the centre of the site is noted. In the consensus sequences, Y denotes either C or T, M denotes A or C, K denotes G or T, R denotes A or G, W denotes A or T, and N denotes any base. The proposed promoter −35 and −10 hexamer elements are underlined and labelled. The reported transcription start site for the hcp-hcr operon promoter [10] is identified with a bent arrow and the hcp gene translation start codon (ATG) is in bold type. The upstream ends of the hcp383-2 and hcp383-3 fragments are indicated by solid lines that become dotted lines above the sequence. Base substitutions described in the text are indicted by vertical arrows.

In order to assess the importance of different elements for the activity of the hcp-hcr operon promoter, the hcp383-1 fragment was cloned into plasmid pRW50, a low-copy number lac expression vector, and this fuses the promoter to the lacZ gene which encodes β-galactosidase. E. coli K-12 strain JCB387 containing the recombinant plasmid gives rise to Lac+ red colonies during growth on Maconkey indicator plates. In contrast, with empty pRW50, Lac white colonies are observed, since the JCB387 chromosome carries a deletion of the lac operon.

In a preliminary experiment to identify sequence elements essential for the hcp-hcr operon promoter, error-prone PCR was used to generate several independent preparations of EcoRI-HindIII promoter fragments carrying random point mutations. The fragments were then cloned into pRW50, the mixture of resulting recombinant plasmids was transformed into E. coli strain JCB387, and transformants were grown on Maconkey indicator plates. As expected, the majority of colonies scored as Lac+, but, after screening over 500 transformants, we identified seven Lac colonies. Sequence analysis showed that each of these colonies contained pRW50 carrying the hcp-hcr operon promoter fragment with different mutations. Three of the recombinant plasmids carried a point mutation at position −67 of the hcp-hcr promoter, two carried a mutation at position −69, one carried a mutation at position −78 and one carried a mutation at position −36. The different mutations are shown in Figure 1. Strikingly, six out of seven of these changes fall in the proposed DNA site for FNR and would be expected to reduce FNR binding at this target. This is consistent with FNR being essential for expression from the hcp-hcr operon promoter. DNase I footprinting was then used to provide a biochemical assay to confirm FNR binding at the proposed DNA site, and the result presented in Figure 2 shows that purified FNR creates a clear single ~25 bp footprint covering the target centred at position −72.5.

Binding of FNR at the hcp-hcr promoter

Figure 2
Binding of FNR at the hcp-hcr promoter

The Figure shows a DNase I footprint of purified FNR binding at the hcp-hcr operon promoter. End-labelled hcp383-1 AatII-HindIII fragment was incubated with increasing concentrations of Ala154 FNR and subjected to DNase I footprint analysis. The concentration of FNR was: lane 1, no protein; lane 2, 0.5 μM; lane 3, 1.0 μM; lane 4, 2.0 μM; and lane 5, 4.0 μM. The gel was calibrated using a Maxam-Gilbert ‘G+A’ sequencing reaction (GA) and relevant positions are indicated. The location of the DNA site for FNR is shown by a box and hypersensitive sites due to FNR binding are indicated with a star.

Figure 2
Binding of FNR at the hcp-hcr promoter

The Figure shows a DNase I footprint of purified FNR binding at the hcp-hcr operon promoter. End-labelled hcp383-1 AatII-HindIII fragment was incubated with increasing concentrations of Ala154 FNR and subjected to DNase I footprint analysis. The concentration of FNR was: lane 1, no protein; lane 2, 0.5 μM; lane 3, 1.0 μM; lane 4, 2.0 μM; and lane 5, 4.0 μM. The gel was calibrated using a Maxam-Gilbert ‘G+A’ sequencing reaction (GA) and relevant positions are indicated. The location of the DNA site for FNR is shown by a box and hypersensitive sites due to FNR binding are indicated with a star.

Surprisingly, none of the ‘down’ mutations identified in the preliminary analysis fell in the upstream DNA site for NarL and NarP. Since this target was thought to be important for promoter activity [10,11], we constructed two derivatives of the hcp383-1 fragment, hcp383-2 and hcp383-3, to investigate directly the role of the DNA site for NarL and NarP. The hcp383-2 fragment carries a deletion that removed just this site whereas, in the hcp383-3 fragment, both the DNA site for FNR and the DNA site for NarL and NarP are deleted (Figure 1). The upper panel of Figure 3 illustrates measurements of β-galactosidase activity in JCB387 cells containing pRW50 carrying the hcp383-1, hcp383-2 or hcp383-3 fragments, grown in different conditions. The results show that, with hcp383-1, hcp-hcr operon promoter expression, as measured by β-galactosidase expression, is induced by anaerobiosis. Some further induction was found with added sodium nitrate, whereas added sodium nitrite resulted in optimal induction. Removal of the DNA site for NarL and NarP in the hcp383-2 fragment causes a decrease in nitrate-dependent induction, while having a minimal effect on the greater nitrite-dependent induction. In contrast, as expected, removal of the DNA site for FNR in the hcp383-3 fragment prevented all induction.

Regulation at the hcp-hcr promoter: effects of nested upstream deletions

Figure 3
Regulation at the hcp-hcr promoter: effects of nested upstream deletions

The upper panel shows a histogram which illustrates β-galactosidase activities measured in JCB387 cells carrying pRW50, containing either the hcp383-1 fragment, the hcp383-2 fragment or the hcp383-3 fragment. Cells were grown in minimal medium, aerobically or anaerobically at 37 °C, and, where indicated, a supplement of 20 mM sodium nitrate or 2.5 mM sodium nitrite was added. β-Galactosidase activities are expressed as nmol of ONPG hydrolysed/min per mg of dry cell mass. Each activity is the average of three biological replicates and the error bars indicate the S.D. of the replicates. The lower panel shows a histogram which illustrates an identical experiment that measured β-galactosidase activities in JCB387 cells carrying pRW50, containing either the hcp383-1 fragment, the hcp383-101 fragment or the hcp383-102 fragment. The hcp383-101 fragment carries the −110G and −99C mutations in the proposed DNA site for NarL and NarP, and the hcp383-102 fragment carries the −78C and −67G mutations in the DNA site for FNR.

Figure 3
Regulation at the hcp-hcr promoter: effects of nested upstream deletions

The upper panel shows a histogram which illustrates β-galactosidase activities measured in JCB387 cells carrying pRW50, containing either the hcp383-1 fragment, the hcp383-2 fragment or the hcp383-3 fragment. Cells were grown in minimal medium, aerobically or anaerobically at 37 °C, and, where indicated, a supplement of 20 mM sodium nitrate or 2.5 mM sodium nitrite was added. β-Galactosidase activities are expressed as nmol of ONPG hydrolysed/min per mg of dry cell mass. Each activity is the average of three biological replicates and the error bars indicate the S.D. of the replicates. The lower panel shows a histogram which illustrates an identical experiment that measured β-galactosidase activities in JCB387 cells carrying pRW50, containing either the hcp383-1 fragment, the hcp383-101 fragment or the hcp383-102 fragment. The hcp383-101 fragment carries the −110G and −99C mutations in the proposed DNA site for NarL and NarP, and the hcp383-102 fragment carries the −78C and −67G mutations in the DNA site for FNR.

In a complementary experiment, we constructed derivatives of the hcp383-1 fragment carrying point mutations in the proposed DNA site for NarL and NarP (hcp383-101) or in the DNA site for FNR (hcp383-102). The lower panel of Figure 3 illustrates measurements of β-galactosidase activity in JCB387 cells containing pRW50 carrying the hcp383-1, hcp383-101 or hcp383-102 fragments. The results underscore the importance of FNR for induction of the hcp-hcr operon promoter and corroborate the deletion analysis.

Effects of NsrR at the hcp-hcr promoter

The results presented in Figure 3 argue that NarL and NarP play but a small role in the induction of the hcp-hcr promoter. To quantify effects due to NsrR, a derivative of the hcp383-1 fragment, carrying substitutions at positions +9 and +10 in the suggested DNA site for NsrR, was constructed (see Figure 1). The resulting fragment, hcp383-1n, was cloned into pRW50. The upper panel of Figure 4 illustrates measurements of β-galactosidase in JCB387 cells containing pRW50 carrying either the hcp383-1 or hcp383-1n fragment, grown in different conditions. The results show that, with the hcp383-1n fragment, promoter expression is increased in anaerobic conditions without the addition of nitrate or nitrite, and that induction by nitrate and nitrite is greatly decreased. These results argue that nitrate- and nitrite-dependent induction of the hcp-hcr promoter is principally due to relief of repression by NsrR. This conclusion was confirmed by comparison of the activity of the hcp-hcr promoter, carried by the hcp383-1 fragment, in an nsrR+ and a ΔnsrR background. In the ΔnsrR background, full induction is observed in anaerobic conditions without the addition of nitrate or nitrite (Figure 4).

Regulation at the hcp-hcr promoter: effects of NsrR

Figure 4
Regulation at the hcp-hcr promoter: effects of NsrR

β-Galactosidase activities measured in JCB387 cells (upper histogram) or JCB387 ΔnsrR cells (lower histogram) carrying pRW50 containing either the hcp383-1 fragment or the hcp383-1n fragment with the +9G and +10G mutations that abrogate NsrR binding. Cells were grown in minimal medium, anaerobically at 37 °C, and, where indicated, a supplement of 20 mM sodium nitrate or 2.5 mM sodium nitrite was added. β-Galactosidase activities are expressed as nmol of ONPG hydrolysed/min per mg of dry cell mass. Each activity is the average of three biological replicates and the error bars indicate the S.D. of the replicates.

Figure 4
Regulation at the hcp-hcr promoter: effects of NsrR

β-Galactosidase activities measured in JCB387 cells (upper histogram) or JCB387 ΔnsrR cells (lower histogram) carrying pRW50 containing either the hcp383-1 fragment or the hcp383-1n fragment with the +9G and +10G mutations that abrogate NsrR binding. Cells were grown in minimal medium, anaerobically at 37 °C, and, where indicated, a supplement of 20 mM sodium nitrate or 2.5 mM sodium nitrite was added. β-Galactosidase activities are expressed as nmol of ONPG hydrolysed/min per mg of dry cell mass. Each activity is the average of three biological replicates and the error bars indicate the S.D. of the replicates.

Figure 5 illustrates an EMSA to measure the binding of NsrR to the hcp-hcr promoter region. In this experiment, a shorter derivative of the hcp383-3 fragment, hcp383-3s, carrying hcp-hcr promoter sequences from positions −54 to +46, was end-labelled with 32P and incubated with cell extracts from ΔnsrR cells that carried either a plasmid encoding NsrR or a control empty vector plasmid. DNA–protein complexes were separated using PAGE. With extracts containing NsrR, the EMSA shows a unique NsrR–DNA complex, but this complex is absent with the control extract. Furthermore, the formation of the complex was greatly decreased when the fragment carried the substitutions at positions +9 and +10, in the DNA site for NsrR. Note that the residual binding of NsrR to the mutated DNA site probably accounts for the small NsrR-dependent nitrite-dependent induction of the hcp-hcr promoter seen with the hcp383-1n fragment (Figure 4).

EMSA analysis of NsrR binding at the hcp-hcr promoter

Figure 5
EMSA analysis of NsrR binding at the hcp-hcr promoter

An autoradiogram from an EMSA performed with the 32P-labelled hcp383-3s fragment (lanes 10–19) or the derivative hcp383-3ns fragment with the +9G and +10G mutations that abrogate NsrR binding (lanes 1–9). These fragments carry hcp-hcr operon promoter sequences from position −54 to position +46. Labelled fragments were incubated with increasing amounts of soluble cell extract from strain JCB38849S ΔnsrR carrying either pGIT9, which expresses NsrR (+NsrR; lanes 2–5 and 11–14), or empty vector pSTBlue-1 (−NsrR; lanes 7–9 and 16–19). The total amount of protein in the extract used in each reaction was: lanes 1, 6, 10 and 15, no protein; lanes 2, 7, 11 and 16, 1.5 μg; lanes 3, 8, 12 and 17, 3 μg; lanes 4, 9, 13 and 18, 6 μg; and lanes 5, 14 and 19, 9 μg. The location of the band due to the specific binding of NsrR is indicated.

Figure 5
EMSA analysis of NsrR binding at the hcp-hcr promoter

An autoradiogram from an EMSA performed with the 32P-labelled hcp383-3s fragment (lanes 10–19) or the derivative hcp383-3ns fragment with the +9G and +10G mutations that abrogate NsrR binding (lanes 1–9). These fragments carry hcp-hcr operon promoter sequences from position −54 to position +46. Labelled fragments were incubated with increasing amounts of soluble cell extract from strain JCB38849S ΔnsrR carrying either pGIT9, which expresses NsrR (+NsrR; lanes 2–5 and 11–14), or empty vector pSTBlue-1 (−NsrR; lanes 7–9 and 16–19). The total amount of protein in the extract used in each reaction was: lanes 1, 6, 10 and 15, no protein; lanes 2, 7, 11 and 16, 1.5 μg; lanes 3, 8, 12 and 17, 3 μg; lanes 4, 9, 13 and 18, 6 μg; and lanes 5, 14 and 19, 9 μg. The location of the band due to the specific binding of NsrR is indicated.

Identification of −10 and −35 elements at the hcp-hcr operon promoter

It is well established that the two principal sequence elements required for the activity of most bacterial promoters are the −10 and −35 hexamers that interact with the RNA polymerase σ subunit [1]. Inspection of the base sequence upstream of the hcp-hcr promoter transcript start suggested that the promoter −10 hexamer element is 5′-TAACCT-3′, corresponding to the consensus 5′-TATAAT-3′ at three out of six positions. If this were the case, the likely corresponding −35 hexamer element would be 5′-TTTTAT-3′ (Figure 1). Although this corresponds to the 5′-TTGACA-3′ consensus at only two out of six positions, it is consistent with the observation that one of the seven ‘down’ mutations in the hcp-hcr operon promoter, identified after random mutagenesis using error-prone PCR, fell at position −36, changing 5′-TTTTAT-3′ into 5′-TCTTAT-3′ (Figure 1). In order to confirm our assignment of the two hexamer elements, we used site-directed mutagenesis to make changes in each hexamer and then measured the effects of the different changes. For this experiment, we used the shorter hcp383-1ns fragment which carries the hcp-hcr promoter sequence from position −125 to position +46 and the substitutions at positions +9 and +10, in the DNA site for NsrR. Derivatives of the hcp383-1ns fragment carrying different mutations were cloned into pRW50, recombinant plasmids were transformed into strain JCB387 and the activity of the hcp-hcr promoter was deduced from measurements of β-galactosidase activities. Results in Figure 6 show that mutations at positions −14, −13 and −9, which changed the putative −10 hexamer away from the consensus, all caused substantial decreases in promoter activity. Similarly, substitutions at positions −37 and −36 that altered the −35 hexamer element away from the consensus, also caused decreases. A substitution at position −35 that changed the hexamer to 5′-TTGTAT-3′, which accords better with the consensus, led to an increase in activity. Taken together, these data support the assignation of 5′-TAACCT-3′ and 5′-TTTTAT-3′ as the hcp-hcr operon promoter −10 and −35 hexamer elements respectively.

Effect of point mutations in the hcp-hcr operon promoter −10 and −35 elements

Figure 6
Effect of point mutations in the hcp-hcr operon promoter −10 and −35 elements

β-Galactosidase expression was measured in JCB387 cells carrying pRW50 containing the hcp383-1ns promoter fragment with single-point mutations at different locations in the proposed −35 or −10 hexamer elements. The different base changes are shown in the first two columns and the consensus −35 and −10 hexamers for E. coli promoters are given at the head of each column. Cells were grown aerobically or anaerobically at 37 °C in minimal medium. Each measurement is the average of three biological replicates and is expressed as a percentage of the measured β-galactosidase activity during anaerobic growth with the starting hcp383-1ns fragment.

Figure 6
Effect of point mutations in the hcp-hcr operon promoter −10 and −35 elements

β-Galactosidase expression was measured in JCB387 cells carrying pRW50 containing the hcp383-1ns promoter fragment with single-point mutations at different locations in the proposed −35 or −10 hexamer elements. The different base changes are shown in the first two columns and the consensus −35 and −10 hexamers for E. coli promoters are given at the head of each column. Cells were grown aerobically or anaerobically at 37 °C in minimal medium. Each measurement is the average of three biological replicates and is expressed as a percentage of the measured β-galactosidase activity during anaerobic growth with the starting hcp383-1ns fragment.

Kinetics of activation of promoters in response to nitrate

The induction of promoter activity by NarL/NarP follows from the direct sensing of external nitrate or nitrite ions by the NarX/NarQ transmembrane sensor kinases [5,6]. In contrast, the induction of a promoter that is repressed by NsrR in response to nitrate or nitrite ions depends on the build-up of either NO or other RNS that result from the metabolism of nitrate or nitrite [7,8]. We reasoned that, upon addition of nitrate ions to a culture of E. coli, induction that was dependent on NarL/NarP would be more rapid than induction that was mainly dependent on NsrR. To test this, we compared the kinetics of induction of the hcp-hcr promoter by a pulse of sodium nitrate with the induction of the ogt promoter, which is known to be directly activated solely by NarL [18]. Figure 7 shows the results of this experiment using the pRW50 lac expression vector carrying either the hcp383-1 promoter fragment or the ogt100 fragment which carries the ogt promoter. The results show a clear lag in the induction of the hcp-hcr operon promoter in response to nitrate compared with the ogt promoter.

Kinetics of induction of the hcp-hcr and ogt promoters

Figure 7
Kinetics of induction of the hcp-hcr and ogt promoters

Cultures of strain JCB387 carrying pRW50 containing the hcp383-1 or ogt100 promoter fragments were grown anaerobically at 37 °C in minimal medium. Sodium nitrate (20 mM) was added when cells reached a D650 of ~0.2. β-Galactosidase activities were measured immediately prior to the addition of sodium nitrate (timepoint 0) and at 3 min intervals following addition. The Figure shows the ratio of the measured activity relative to timepoint 0 plotted as a function of time after the addition of sodium nitrate.

Figure 7
Kinetics of induction of the hcp-hcr and ogt promoters

Cultures of strain JCB387 carrying pRW50 containing the hcp383-1 or ogt100 promoter fragments were grown anaerobically at 37 °C in minimal medium. Sodium nitrate (20 mM) was added when cells reached a D650 of ~0.2. β-Galactosidase activities were measured immediately prior to the addition of sodium nitrate (timepoint 0) and at 3 min intervals following addition. The Figure shows the ratio of the measured activity relative to timepoint 0 plotted as a function of time after the addition of sodium nitrate.

DISCUSSION

Many E. coli transcription factors interact at more than one promoter, and most promoter targets are regulated by more than one transcription factor [3]. This results in a complex transcriptional regulatory network that permits responses to different combinations of environmental inputs [19]. The promoter of the E. coli hcp-hcr operon is activated by two signals, anaerobiosis and nitrate or nitrite ions, which are mediated by two different transcription factors [2,10,11]. Hence this promoter is completely dependent on FNR, the principal regulator of anaerobic adaptation, which binds to a location centred at position −72.5 [10]. This location is unusual, since the DNA site for FNR is centred near position −41.5 at the vast majority of FNR-dependent promoters [20], but the biological significance, if any, is unclear. Concerning the mechanism of activation, the consequence of the unusual location is that activation must be mediated by an interaction between FNR and the RNA polymerase α subunit, rather than an interaction between FNR and the RNA polymerase σ subunit, as at the majority of FNR-dependent promoters [20]. This is because the RNA polymerase α subunit contains a flexible linker that permits contact with upstream-bound transcription factors, whereas the RNA polymerase σ factor can only interact directly with transcription factors that overlap the promoter −35 element [1].

The second functional transcription factor at the hcp-hcr operon is the NsrR repressor whose activity is modulated by some of the by-products of nitrate and nitrite metabolism [7,8]. The consequence of this is a lag in the induction of the hcp-hcr transcript in response to increases in nitrate, compared with transcripts whose induction is directly stimulated by nitrate. Again, the biological significance of this is unknown, and the situation is not helped by our lack of understanding of the function of the hcp and hcr gene products. Since their most likely function is some role in detoxification of RNS, it is not difficult to rationalize the involvement of NsrR, which controls a network of gene products concerned with managing NO and other RNS.

Previous studies of the E. coli hcp-hcr operon promoter have focussed on possible roles for NarL and the DNA site for NarL and NarP located at position −104.5, and confirmed that purified NarL can bind to this site [10,11]. However, our results show that this site plays but a small role in the induction of the hcp-hcr operon promoter. We surmise that the previously reported lack of induction in narL mutants [10] was due to a failure to stop NsrR-dependent repression because of reduced nitrate and nitrite metabolism, rather than being due to the absence of direct NarL-mediated effects. The apparent secondary role for the upstream DNA site for NarL and NarP at the hcp-hcr promoter is best explained as a vestige of evolution, although it is possible that the site either plays another role or comes into play in conditions that are yet to be discovered. In any case, it is now clear that binding to some targets by some E. coli transcription factors has no apparent effect on promoter activity. For example, in the case of the cAMP receptor protein, up to 25% of hundreds of binding sites are likely to be redundant [21,22], whereas, for RutR, the majority of its 20 characterized binding targets play no role in controlling promoter activity [23]. The simplest explanation for this is that evolution drives the creation of new sites that are then eliminated if they have no function, and that genomes are bound to contain redundant sites that are ‘awaiting’ elimination. In the case of NarL, bioinformatics predicts over 300 binding targets throughout the E. coli chromosome [24], but transcriptomic experiments argue that NarL probably controls no more than 100 promoters directly [2]. Following analysis by chromatin immunoprecipitation several bona fide DNA sites for NarL that played little or no role in transcriptional regulation were identified [25]. We suggest that the upstream DNA site for NarL and NarP at the E. coli K-12 hcp-hcr promoter may also be moving towards redundancy. Consistent with this, comparison of the promoter sequence in several related bacteria show that core elements, including the DNA sites for FNR and NsrR, are better conserved than the upstream flanking sequences that contain the DNA site for NarL and NarP (Figure 8).

Phylogenetic analysis of hcp-hcr operon regulatory region sequences

Figure 8
Phylogenetic analysis of hcp-hcr operon regulatory region sequences

Alignment of the E. coli K-12 hcp-hcr operon promoter region sequence with corresponding sequences from related bacteria, downloaded from the xBASE database (http://xbase.bham.ac.uk) [29]. The different bacteria (and corresponding xbase Taxon ID) are: ECO, E. coli K-12 (83333); SEN, Salmonella enterica subspecies enterica serovar Choleraesuis str. SC-B67 (321314); STY, Salmonella typhimurium LT2 (99287); YEN, Yersinia enterocolitica (393305); YPE, Yersinia pestis (229193); and YPS, sequence from Yersinia pseudotuberculosis (349747). DNA targets for NarL (and NarP), FNR and NsrR are indicated by shaded horizontal inverted arrows. For each target, the consensus binding sequence is shown in bold, aligned with the actual sequence and the centre of the site is noted. In the consensus sequences, Y denotes either C or T, M denotes A or C, K denotes G or T, R denotes A or G, W denotes A or T, and N denotes any base. The transcription start point in the E. coli K-12 sequence is shown in lower case. Bases that are identical in the genome of each strain are highlighted with black shading.

Figure 8
Phylogenetic analysis of hcp-hcr operon regulatory region sequences

Alignment of the E. coli K-12 hcp-hcr operon promoter region sequence with corresponding sequences from related bacteria, downloaded from the xBASE database (http://xbase.bham.ac.uk) [29]. The different bacteria (and corresponding xbase Taxon ID) are: ECO, E. coli K-12 (83333); SEN, Salmonella enterica subspecies enterica serovar Choleraesuis str. SC-B67 (321314); STY, Salmonella typhimurium LT2 (99287); YEN, Yersinia enterocolitica (393305); YPE, Yersinia pestis (229193); and YPS, sequence from Yersinia pseudotuberculosis (349747). DNA targets for NarL (and NarP), FNR and NsrR are indicated by shaded horizontal inverted arrows. For each target, the consensus binding sequence is shown in bold, aligned with the actual sequence and the centre of the site is noted. In the consensus sequences, Y denotes either C or T, M denotes A or C, K denotes G or T, R denotes A or G, W denotes A or T, and N denotes any base. The transcription start point in the E. coli K-12 sequence is shown in lower case. Bases that are identical in the genome of each strain are highlighted with black shading.

Abbreviations

     
  • DTT

    dithiothreitol

  •  
  • EMSA

    electrophoretic mobility-shift assay

  •  
  • FNR

    fumarate and nitrate reduction regulator

  •  
  • ONPG

    o-nitrophenyl-β-galactoside

  •  
  • RNS

    reactive nitrogen species

AUTHOR CONTRIBUTION

David Chismon led the project and did most of the work, which is the basis of a chapter of his Ph.D. thesis. Doug Browning oversaw the in vitro work and did many of these experiments together with David Chismon. Greg Farrant did a masters project in Stephen Bubsy's laboratory and did the random mutagenesis work. Stephen Busby oversaw the project, led the planning and wrote most of the paper.

We are grateful to Jeff Cole for helpful discussions and unfailing support throughout the project.

FUNDING

This work was supported by the Wellcome Trust [grant number 076689]; and the UK BBSRC with a studentship to D.L.C.

References

References
1
Browning
D.
Busby
S.
The regulation of bacterial transcription initiation
Nat. Rev. Microbiol.
2004
, vol. 
2
 (pg. 
57
-
65
)
2
Constantinidou
C.
Hobman
J. L.
Griffiths
L.
Patel
M. D.
Penn
C. W.
Cole
J. A.
Overton
T. W.
A reassessment of the FNR regulon and transcriptomic analysis of the effects of nitrate, nitrite, NarXL, and NarQP as Escherichia coli K12 adapts from aerobic to anaerobic growth
J. Biol. Chem.
2006
, vol. 
281
 (pg. 
4802
-
4815
)
3
Salgado
H.
Santos-Zavaleta
A.
Garma-Castro
S.
Peralto-Gil
M.
Penaloza-Spinola
M. I.
Martinez-Antonio
A.
Karp
P. D.
Collado-Vides
J.
The comprehensive updated regulatory network of Escherichia coli K-12
BMC Bioinf.
2006
, vol. 
7
 pg. 
5
 
4
Spiro
S.
Guest
J. R.
FNR and its role in oxygen-regulated gene expression in Escherichia coli
FEMS Microbiol. Rev.
1990
, vol. 
6
 (pg. 
399
-
428
)
5
Darwin
A. J.
Stewart
V.
Lin
E.
Lynch
A.
The NAR modulon systems: nitrate and nitrite regulation of anaerobic gene expression
Regulation of Gene Expression in Escherichia coli
1996
Austin
R.G. Landes Company
(pg. 
343
-
359
)
6
Stewart
V.
Nitrate- and nitrite-responsive sensors NarX and NarQ of proteobacteria
Biochem. Soc. Trans.
2003
, vol. 
31
 (pg. 
1
-
10
)
7
Spiro
S.
Regulators of bacterial responses to nitric oxide
FEMS Microbiol. Rev.
2007
, vol. 
31
 (pg. 
193
-
211
)
8
Tucker
N. P.
Le Brun
N. E.
Dixon
R.
Hutchings
M. I.
Theres's NO stopping NsrR, a global regulator of the bacterial NO stress response
Trends Microbiol.
2010
, vol. 
18
 (pg. 
149
-
156
)
9
Partridge
J. D.
Bodenmiller
D. M.
Humphrys
M. S.
Spiro
S.
NsrR targets in the Escherichia coli genome: new insights into DNA sequence requirements for binding and a role for NsrR in the regulation of motility
Mol. Microbiol.
2009
, vol. 
73
 (pg. 
680
-
694
)
10
Filenko
N. A.
Browning
D. F.
Cole
J. A.
Transcriptional regulation of a hybrid cluster (prismane) protein
Biochem. Soc. Trans.
2005
, vol. 
33
 (pg. 
195
-
197
)
11
Filenko
N.
Spiro
S.
Browning
D. F.
Squire
D.
Overton
T. W.
Cole
J.
Constantinidou
C.
The NsrR regulon of Escherichia coli K-12 includes genes encoding the hybrid cluster protein and the periplasmic, respiratory nitrite reductase
J. Bacteriol.
2007
, vol. 
189
 (pg. 
4410
-
4417
)
12
Lodge
J.
Fear
J.
Busby
S.
Gunasekaran
P.
Kamini
N-R.
Broad host range plasmids carrying the Escherichia coli lactose and galactose operons
FEMS Microbiol. Lett.
1992
, vol. 
95
 (pg. 
271
-
276
)
13
Sarkar
G.
Sommer
S. S.
The ‘megaprimer’ method of site directed mutagenesis
Biotechniques
1990
, vol. 
8
 (pg. 
404
-
407
)
14
Miller
J.
Experiments in Molecular Genetics
1972
Cold Spring Harbor, NY
Cold Spring Harbor Laboratory Press
15
Pope
N. R.
Cole
J.
Generation of a membrane potential by one of two independent pathways of nitrite reduction by E. coli
J. Gen. Microbiol.
1982
, vol. 
128
 (pg. 
319
-
322
)
16
Browning
D. F.
Cole
J. A.
Busby
S. J. W.
Transcription activation by remodelling of a nucleoprotein assembly: the role of NarL at the FNR-dependent Escherichia coli nir promoter
Mol. Microbiol.
2004
, vol. 
53
 (pg. 
203
-
215
)
17
Browning
D. F.
Lee
D. J.
Spiro
S.
Busby
S. J.
Down-regulation of the Escherichia coli K-12 nrf promoter by binding of the NsrR nitric oxide sensing transcription repressor to an upstream site
J. Bacteriol.
2010
 
doi:10.1128/JB.00218-10
18
Squire
D. J.
Xu
M.
Cole
J. A.
Busby
S. J.
Browning
D. F.
Competition between NarL-dependent activation and Fis-dependent repression controls expression from the Escherichia coli yeaR and ogt promoters
Biochem. J.
2009
, vol. 
420
 (pg. 
249
-
257
)
19
Barnard
A.
Wolfe
A.
Busby
S. J.
Regulation at complex bacterial promoters: how bacteria use different promoter organisations to produce different regulatory outcomes
Curr. Opin. Microbiol.
2004
, vol. 
7
 (pg. 
102
-
108
)
20
Browning
D. F.
Lee
D. J.
Green
J.
Busby
S. J.
Hodgson
D. A.
Thomas
C. M.
Secrets of bacterial transcription initiation taught by the Escherichia coli FNR protein
Signals, Switches, Regulons and Cascades: Control of Bacterial Gene Expression SGM Symposium volume 61
2002
Cambridge
Cambridge University Press
(pg. 
127
-
142
)
21
Grainger
D. C.
Hurd
D.
Harrison
M.
Holdstock
J.
Busby
S. J.
Studies of the distribution of Escherichia coli cAMP receptor protein and RNA polymerase along the E. coli chromosome
Proc. Natl. Acad. Sci. U.S.A.
2005
, vol. 
102
 (pg. 
17693
-
17698
)
22
Hollands
K.
Busby
S. J.
Lloyd
G. S.
New targets for the cyclic AMP receptor protein in the E. coli K-12 genome
FEMS Lett.
2007
, vol. 
274
 (pg. 
89
-
94
)
23
Shimada
T.
Ishihama
A.
Busby
S. J.
Grainger
D. C.
The Escherichia coli RutR transcription factor binds at targets within genes as well as intergenic regions
Nucleic Acids Res.
2008
, vol. 
36
 (pg. 
3950
-
3955
)
24
Robison
K.
McGuire
A. M.
Church
G. M.
A comprehensive library of DNA-binding site matrices for 55 proteins applied to the complete Escherichia coli K-12 genome
J. Mol. Biol.
1998
, vol. 
284
 (pg. 
241
-
254
)
25
Xu
M.
Genomic studies of the Escherichia coli NarL protein
Ph.D. Thesis
2009
Birmingham, U.K.
University of Birmingham
26
Page
L.
Griffiths
L.
Cole
J. A.
Different physiological roles of two independent pathways for nitrite reduction to ammonia by enteric bacteria
Arch. Microbiol.
1990
, vol. 
154
 (pg. 
349
-
354
)
27
Browning
D. F.
Cole
J. A.
Busby
S. J.
Regulation by nucleoid-associated proteins at the Escherichia coli nir operon promoter
J. Bacteriol.
2008
, vol. 
190
 (pg. 
7258
-
7267
)
28
Bodenmiller
D. M.
Spiro
S.
The yjeB (nsrR) gene of Escherichia coli encodes a nitric oxide-sensitive transcriptional repressor
J. Bacteriol.
2006
, vol. 
188
 (pg. 
874
-
881
)
29
Chaudhuri
R. R.
Pallen
M. J.
xBASE
Nucl. Acids Res.
2006
, vol. 
34
 (pg. 
D335
-
D337
)