Hepcidin, a hormone mainly synthesized by hepatocytes and secreted in plasma, controls iron bioavailability. Thus, by inducing the internalization of the iron exporter ferroportin, it regulates iron release from macrophages, enterocytes and hepatocytes towards plasma. Abnormal levels of hepcidin expression alter plasma iron parameters and lead to iron metabolism disorders. Understanding the mechanisms controlling hepcidin (HAMP encodes hepcidin) gene expression is therefore an important goal. We identified a potential GATA-binding site within the human hepcidin promoter. Indeed, in hepatic HepG2 cells, luciferase experiments demonstrated that mutation of this GATA-binding site impaired the hepcidin promoter transcriptional activity in basal conditions. Gel-retardation experiments showed that GATA-4 could bind to this site. Co-transfection of a GATA-4 expression vector with a hepcidin promoter reporter construct enhanced hepcidin promoter transcriptional activity. Furthermore, modulation of GATA4 mRNA expression using specific siRNAs (small interfering RNAs) down-regulated endogenous hepcidin gene expression. Finally, we found that mutation of the GATA-binding site impaired the interleukin-6 induction of hepcidin gene expression, but did not prevent the bone morphogenetic protein-6 response. In conclusion, the findings of the present study (i) indicate that GATA-4 may participate in the control of hepcidin expression, and (ii) suggest that alteration of its expression could contribute to the development of iron-related disorders.

INTRODUCTION

Hepcidin is an iron-regulated peptide synthesized mainly by hepatocytes in the liver, secreted in plasma [14] and involved in the regulation of iron metabolism [2] by controlling the expression of the cellular iron exporter ferroportin [5]. Studies in mice, humans and cell cultures have demonstrated that hepcidin mRNA levels (hepcidin is encoded by the HAMP gene) are regulated by numerous factors, including iron stores, inflammation, anaemia, hypoxia and transcription factors involved in hepatocyte differentiation [6]. Studies of patients with iron disorders, during haemochromatosis {including juvenile haemochromatosis [7] and adult forms of haemochromatosis as HFE-related haemochromatosis [8,9] and TfR2 (transferrin receptor 2)-related haemochromatosis [10]} and in chronic inflammatory diseases [11], have demonstrated the involvement of dysregulation of hepcidin expression.

Hepcidin expression is mainly up-regulated by two pathways, the first one is the IL (interleukin)-6 pathway [1214], which activates STAT3 (signal transducer and activator of transcription 3), whose binding site is located within the proximal 150 bp from the start of translation. The second one is the BMP (bone morphogenetic protein) pathway, stimulated by BMP6, [15,16], which activates the SMAD transcription factors by phosphorylation. Two BMP-REs (responsive elements) [1719] have been described; one (BMP-RE1) is located near the STAT3-binding site and the second (BMP-RE2) in the distal part of the hepcidin promoter. Other transcription factors have been reported to stimulate hepcidin gene expression, such as C/EBPα (CCAAT/enhancer-binding protein α) [20], HNF4α (hepatocyte nuclear factor 4 α) [19,20], USFs (upstream stimulatory factors) 1 and 2 [21], p53 [22], MTF-1 [MRE (metal response element)-binding transcription factor-1] [23] and CREBH (cAMP-response-element-binding protein H) [24].

GATA-1 transcription factor has been described to enhance murine TfR2 transcriptional activity, implying a potential role for GATA proteins in the regulation of genes involved in the control of iron metabolism [25]. Therefore we performed an in silico analysis of the hepcidin promoter that indicates the presence of a putative binding motif for members of the zinc-finger GATA transcription factors. In the liver, GATA proteins have been reported previously to exert a role, especially during hepatic development [2628]. In the present study, we demonstrate that, in human HepG2 cells, GATA-4 could activate hepcidin gene expression by binding to its promoter.

MATERIALS AND METHODS

Cell culture

Human hepatoma HepG2 cells were grown in MEMα (minimal essential medium α; Invitrogen) supplemented with 10% FBS (fetal bovine serum; Invitrogen), 100 units/ml penicillin, 100 μg/ml streptomycin and 2 mM L-glutamine. Cells were maintained at 37 °C under 5% CO2.

Plasmid constructs

A fragment of −2762 bp from the translation start site of the human hepcidin promoter from the pGL3 basic vector (a gift from Professor Martina Muckenthaler, University of Heidelberg, Heidelberg, Germany) was hydrolysed and inserted into the pGL4.17 vector at the Kpn1-Xho1 restriction sites (Promega) within the firefly luciferase reporter gene to generate the −2762Hep/Luc plasmid construct. The internal mutations in the BMP-RE, and STAT3- and GATA-binding sites were made according to the QuikChange® method (Stratagene) using the −2762 Hep/Luc as a template and the internal primers described in Table 1. The identity of the constructs was confirmed by DNA sequencing.

Table 1
Sequences of primers used in the present study

F, forward, R, reverse.

Primer name Sequence (5′→3′) 
Used in QuikChange® experiments (mutations are underlined)  
 BMP-RE1 mutant F CCCGCCTTTTCGGTGCCACCACCTTCTTGG 
 BMP-RE1 mutant R CCAAGAAGGTGGTGGCACCGAAAAGGCGGG 
 BMP-RE2 mutant F CCTTGCACCAAGGCTCTGGTGCCTGTGCTGTGACCC 
 BMP-RE2 mutant R GGGTCACAGCACAGGCACCAGAGCCTTGGTGCAAGG 
 STAT3 mutant F CGCCACCACCTTCTTGGCCGTGAGACAGAGCAAAGGG 
 STAT3 mutant R CCCTTTGCTCTGTCTCACGGCCAAGAAGGTGGTGGCG 
 GATA mutant F CCTGTCGCTCTGTTCCCGCTTAAGTCTCCCGCCTTTTCGGCGCC 
 GATA mutant R GGCGCCGAAAAGGCGGGAGACTTAAGCGGGAACAGAGCGACAGG 
Used in qRT-PCR  
 GATA-4 F AGAAAACGGAAGCCCAAGAAC 
 GATA-4 R CTGGAGTTGCTGGAAGCAC 
 Hepcidin F CACTTCCCCATCTGCATTTTC 
 Hepcidin R GTCTTGCAGCACATCCCACA 
 HPRT F GCTTTCCTTGGTCAGGCAGTA 
 HPRT R AAGCTTGCGACCTTGACCAT 
Used in EMSAs (mutations are underlined)  
 GATA wild-type F TGTTCCCGCTTATCTCTCCCGCCT 
 GATA wild-type R AGGCGGGAGAGATAAGCGGGAACA 
 GATA mutant F TGTTCCCGCTTAAGTCTCCCGCCT 
 GATA mutant R AGGCGGGAGACTTAAGCGGGAACA 
Primer name Sequence (5′→3′) 
Used in QuikChange® experiments (mutations are underlined)  
 BMP-RE1 mutant F CCCGCCTTTTCGGTGCCACCACCTTCTTGG 
 BMP-RE1 mutant R CCAAGAAGGTGGTGGCACCGAAAAGGCGGG 
 BMP-RE2 mutant F CCTTGCACCAAGGCTCTGGTGCCTGTGCTGTGACCC 
 BMP-RE2 mutant R GGGTCACAGCACAGGCACCAGAGCCTTGGTGCAAGG 
 STAT3 mutant F CGCCACCACCTTCTTGGCCGTGAGACAGAGCAAAGGG 
 STAT3 mutant R CCCTTTGCTCTGTCTCACGGCCAAGAAGGTGGTGGCG 
 GATA mutant F CCTGTCGCTCTGTTCCCGCTTAAGTCTCCCGCCTTTTCGGCGCC 
 GATA mutant R GGCGCCGAAAAGGCGGGAGACTTAAGCGGGAACAGAGCGACAGG 
Used in qRT-PCR  
 GATA-4 F AGAAAACGGAAGCCCAAGAAC 
 GATA-4 R CTGGAGTTGCTGGAAGCAC 
 Hepcidin F CACTTCCCCATCTGCATTTTC 
 Hepcidin R GTCTTGCAGCACATCCCACA 
 HPRT F GCTTTCCTTGGTCAGGCAGTA 
 HPRT R AAGCTTGCGACCTTGACCAT 
Used in EMSAs (mutations are underlined)  
 GATA wild-type F TGTTCCCGCTTATCTCTCCCGCCT 
 GATA wild-type R AGGCGGGAGAGATAAGCGGGAACA 
 GATA mutant F TGTTCCCGCTTAAGTCTCCCGCCT 
 GATA mutant R AGGCGGGAGACTTAAGCGGGAACA 

Transfection and luciferase assay

Cells (5×105) were plated on to 12-well plates. The following day, 100 ng of pGL4.17-hepcidin promoter was transfected into the cells together with the normalization plasmid Renilla-SV40 (simian virus 40) (Promega). For co-transfection experiments, the human pcDNA.3.1.A-GATA-4 expression plasmid was added as indicated. In each experiment, a given construct was transfected in duplicate, and two different clones of each construct were tested in at least three distinct experiments. Plasmid transfections were performed using transfectin reagent (Bio-Rad) according to the manufacturer's instructions. After 48 h, the cells were lysed and the luciferase activities were measured in cell lysates using the dual-luciferase reporter assay system (Promega) and a Centro LB 960 luminometer (Berthold Technologies). For cell treatments either 50 ng/ml human BMP-6 (R&D Systems) or 50 ng/ml human IL-6 (R&D Systems) was added to the cells for 48 h. Luciferase activity values represent firefly/Renilla luciferase activity ratios relative to that obtained with the −2762Hep/Luc construct, which was arbitrarily set at 100%.

qRT-PCR (quantitative real-time PCR)

Two different specific siRNAs (small interfering RNAs) against GATA-4 (siRNA1 ref SI03246558; siRNA2 ref SIO3246894) and one control siRNA (ref 1022081) (Qiagen) were transfected into HepG2 cells as described above. At 48 h later, total RNAs were extracted using the SV total RNA isolation system (Promega). Quality-checked RNA (1 μg) was used for reverse transcription following the manufacturer's protocol [M-MLV (Moloney murine leukaemia virus) reverse transcriptase; Promega]. We performed qRT-PCR in triplicate to evaluate the hepcidin and GATA4 mRNA levels, using qPCR MasterMixPlus for SYBR® Green I according to the manufacturer's instructions (Eurogentec). qRT-PCR was carried out on an ABI PRISM StepOne sequence detection system (Applied Biosciences). Each mRNA sample threshold cycle (Ct) value was normalized to HPRT (hypoxanthine-guanine phosphoribosyl transferase) RNA Ct values. Primer sequences used for the mRNA amplification are described in Table 1.

EMSA (electrophoretic mobility-shift assay)

For gel-retardation assays, HepG2 nuclear extract (10 μg) was pre-incubated with 250 ng of poly(dI-dC)·poly(dI-dC), used as a non-specific competitor, in a binding buffer [10 mM Tris/HCl (pH 7.5), 50 mM NaCl, 1 mM DTT (dithiothreitol), 1 mM EDTA and 5% glycerol] for 10 min on ice. This mixture was then added to the binding buffer containing 33P-end-labelled probes described in Table 1 (100000 c.p.m./well) either with or without specific competitor oligonucleotides containing the wild-type or a mutated GATA site, in a final volume of 10 μl, and the incubation was carried out for a further 30 min at room temperature (20 °C). EMSAs with purified polyclonal rabbit IgG anti-GATA-2, anti-GATA-4 or anti-GATA-6 antibodies (Santa Cruz Biotechnology) were performed under the same conditions, except that the non-relevant antibody and pre-immune IgG were pre-incubated with the nuclear extracts for 1 h on ice. Complexes were resolved by electrophoresis on pre-run Tris-glycine 6% native polyacrylamide gels. After drying, the gels were autoradiographed overnight.

Statistical analysis

Data represent means (±S.D.) of at least three independent experiments. Statistical analyses were determined by using Student's t test. P<0.05 was considered as statistically significant.

RESULTS AND DISCUSSION

Mutations of the putative GATA-binding site located near the BMP and IL-6 REs down-regulate the human hepcidin gene expression in basal conditions

The MatInspector algorithm (Genomatix, http://genomatix.de) was used to search for GATA-binding motifs in the hepcidin promoter. GATA proteins, a family composed of six members (1–6) in vertebrates, contain a highly conserved DNA-binding domain consisting of two zinc-finger motifs. A putative GATA-binding site (A/T)GATA(A/G) [29] was located on the DNA minus strand, near BMP RE1 [17] and the STAT3-binding site [1214] (Figure 1A). To investigate the effect of this putative GATA-binding site on hepcidin gene expression in basal conditions, we performed transfection experiments in HepG2 cells using the wild-type promoter inserted among the luciferase gene (−2762Hep/Luc construct) compared with a construct with mutations in the putative GATA-binding site (−2762Hep/Luc GATA mutant). We observed a decrease in luciferase activity equivalent to that observed with mutations in the BMP or IL-6 REs (Figure 1B), suggesting that this potential binding site plays a role in the control of hepcidin gene expression.

Mutations of the putative GATA-binding site located near the BMP and IL-6 REs down-regulate human hepcidin gene expression in basal conditions

Figure 1
Mutations of the putative GATA-binding site located near the BMP and IL-6 REs down-regulate human hepcidin gene expression in basal conditions

(A) Nucleotide sequence of the human hepcidin promoter and putative GATA-binding site location. The TATA sequence and the translational start site are underlined. The GATA- and STAT3-binding sites, and the BMP RE are underlined and enclosed by grey boxes. (B) Effect of mutations within the GATA-binding site on hepcidin promoter transcriptional activity under basal conditions. HepG2 cells were transfected with Hep/Luc constructs as indicated in the Figure for 48 h. Luciferase activity values represent firefly/Renilla luciferase activity ratios relative to the ratio obtained with the −2762Hep/Luc plasmid construct, which was arbitrarily set at 100%. ***P<0.001.

Figure 1
Mutations of the putative GATA-binding site located near the BMP and IL-6 REs down-regulate human hepcidin gene expression in basal conditions

(A) Nucleotide sequence of the human hepcidin promoter and putative GATA-binding site location. The TATA sequence and the translational start site are underlined. The GATA- and STAT3-binding sites, and the BMP RE are underlined and enclosed by grey boxes. (B) Effect of mutations within the GATA-binding site on hepcidin promoter transcriptional activity under basal conditions. HepG2 cells were transfected with Hep/Luc constructs as indicated in the Figure for 48 h. Luciferase activity values represent firefly/Renilla luciferase activity ratios relative to the ratio obtained with the −2762Hep/Luc plasmid construct, which was arbitrarily set at 100%. ***P<0.001.

GATA-4 binds to the human hepcidin promoter

We next investigated GATA proteins expressed in HepG2 cells. qRT-PCR experiments showed that GATA-4 was mainly expressed, and GATA-2 and GATA-6 were expressed to a lesser extent, whereas GATA-1, GATA-3 and GATA-5 were expressed at very low levels, if at all (results not shown). Thus, to determine which GATA protein could bind to the hepcidin promoter, an EMSA (Figure 2A) was performed using HepG2 nuclear extracts, a probe containing the GATA-binding site and antibodies against GATA-2, GATA-4 or GATA-6. We observed the formation of three nucleoprotein complexes supershifted using the anti-GATA-4 antibody, whereas no supershift was found with the anti-GATA-2 or anti-GATA-6 antibodies.

GATA-4 binds to the human hepcidin promoter

Figure 2
GATA-4 binds to the human hepcidin promoter

(A) To investigate the GATA factors that could bind to the putative GATA-binding site, we performed EMSAs using HepG2 nuclear extracts incubated with radiolabelled probes containing the wild-type GATA motif and either a non-relevant antibody or antibodies against GATA-2, GATA-4 or GATA-6. (B) The binding specificity of GATA-4 complexes was ascertained by EMSA using HepG2 nuclear extracts incubated with radiolabelled probes containing the mutated GATA site or the wild-type GATA motif, and 25-, 50- or 100-fold excess of non-radioactive competitor oligonucleotides containing the wild-type or mutated GATA-binding site. wt, wild-type.

Figure 2
GATA-4 binds to the human hepcidin promoter

(A) To investigate the GATA factors that could bind to the putative GATA-binding site, we performed EMSAs using HepG2 nuclear extracts incubated with radiolabelled probes containing the wild-type GATA motif and either a non-relevant antibody or antibodies against GATA-2, GATA-4 or GATA-6. (B) The binding specificity of GATA-4 complexes was ascertained by EMSA using HepG2 nuclear extracts incubated with radiolabelled probes containing the mutated GATA site or the wild-type GATA motif, and 25-, 50- or 100-fold excess of non-radioactive competitor oligonucleotides containing the wild-type or mutated GATA-binding site. wt, wild-type.

The specificity of formation of the nucleoprotein complexes containing GATA-4 was demonstrated by EMSA using a probe with the wild-type GATA motif and unlabelled oligonucleotides containing wild-type or a mutated GATA site in 25-, 50- or 100-fold molar excess. Competition for the binding of the nucleoprotein complexes was observed with the use of a non-radioactive competitor containing the wild-type GATA motif in excess, whereas a competitor containing the mutated GATA site had no effect (Figure 2B).

These results suggest that the GATA-4 protein could specifically bind to the GATA-binding site present within the human hepcidin promoter. GATA-4 plays a role in embryonic development. Thus mice null for GATA-4 die between embryonic days 8 and 9, in part because of defects in heart morphogenesis. In addition, it has been reported that patients with GATA-4 haploinsufficiency due to an interstitial deletion of chromosome region 8p23.1 [30] or with mutations in the GATA4 gene [31] may present with a congenital heart defect and physical anomalies. Beside the role for GATA-4 during embryogenesis, it is also expressed in the adult mouse in the heart, ovary, testis, lung, liver and small intestine, and can regulate expression of genes [29]. Thus, in human hepatic cell lines, expression of other hepatic genes, such as the CYP2C9 (encoding cytochrome P450 2C9) gene in Huh-7 cells [32] and ABCG5/ABCG8 (encoding ATP-binding cassette G5/8 respectively) genes, which are implicated in the hepatic excretion of cholesterol in HepG2 cells [33], were reported to be significantly increased by GATA-4. In HepG2 cells, GATA-4 and GATA-6 were demonstrated to co-localize in the nuclei [33]. Therefore we investigated whether GATA-4 controls hepcidin gene expression.

GATA-4 activates human hepcidin gene expression

Thus we next evaluated the effect of the GATA-4 transcription factor on hepcidin gene expression by co-transfection experiments combining the −2762Hep/Luc or −2762Hep/Luc GATA mutant constructs along with a human GATA-4 expression vector, which enhanced its expression by approximately 7-fold (Figure 3A). We observed an activation of hepcidin promoter transcriptional activity with the −2762Hep/Luc wild-type construct, but not with the −2762Hep/Luc GATA mutant construct, suggesting that GATA-4 binds this DNA GATA motif and could activate hepcidin promoter transcriptional activity (Figure 3B).

GATA-4 activates human hepcidin gene expression

Figure 3
GATA-4 activates human hepcidin gene expression

(A) The effect of GATA-4 on hepcidin promoter transcriptional activity was determined by transfection experiments with the −2762Hep/Luc or −2762Hep/Luc GATA mutant, along with a GATA-4 expression plasmid. GATA4 mRNA expression was enhanced by approximately 7-fold in this experiment. Results are expressed as a percentage compared with the value obtained with the control well transfected with the −2762Hep/Luc and the empty vector set at 100%. In (B) luciferase activity values represent firefly/Renilla luciferase activity ratios relative to the ratio obtained with the −2762Hep/Luc plasmid construct, which was arbitrarily set at 100%. Effect of two specific siRNAs directed against GATA-4 (C) transfected in HepG2 cells on hepcidin mRNA expression (D). Results are expressed as a percentage compared with the value obtained with the control well transfected with a control siRNA set at 100%. *P<0.05; ***P < 0.001; ns, non significant.

Figure 3
GATA-4 activates human hepcidin gene expression

(A) The effect of GATA-4 on hepcidin promoter transcriptional activity was determined by transfection experiments with the −2762Hep/Luc or −2762Hep/Luc GATA mutant, along with a GATA-4 expression plasmid. GATA4 mRNA expression was enhanced by approximately 7-fold in this experiment. Results are expressed as a percentage compared with the value obtained with the control well transfected with the −2762Hep/Luc and the empty vector set at 100%. In (B) luciferase activity values represent firefly/Renilla luciferase activity ratios relative to the ratio obtained with the −2762Hep/Luc plasmid construct, which was arbitrarily set at 100%. Effect of two specific siRNAs directed against GATA-4 (C) transfected in HepG2 cells on hepcidin mRNA expression (D). Results are expressed as a percentage compared with the value obtained with the control well transfected with a control siRNA set at 100%. *P<0.05; ***P < 0.001; ns, non significant.

The effect of GATA-4 on endogenous hepcidin gene expression in HepG2 cells was investigated by experiments using siRNAs directed against GATA-4 (Figure 3C). We observed that a decrease in GATA-4 mRNA expression induced a significant decrease in the level of hepcidin mRNA (Figure 3D). This result confirmed a potential role for GATA-4 protein as an activator of hepcidin mRNA expression.

Mutations of the GATA-binding site impair the IL-6 response and prevent total responsiveness to BMP-6

We investigated the effect of mutations within the GATA-binding site on induction of the hepcidin gene by BMP-6 or IL-6. Thus we transfected the −2762Hep/Luc or −2762Hep/Luc GATA mutant constructs and exposed cells to 50 ng/ml BMP-6 or IL-6. In the presence of BMP-6, as expected, the −1024 Hep/Luc construct that contains only one BMP RE was less inducible than the −2762Hep/Luc construct, which contains the two BMP REs [18,33]. BMP-6 induced the −2762Hep/Luc GATA mutant transcriptional activity. Therefore the impairment of GATA binding did not prevent a response to this cytokine, but we did not observe total hepcidin promoter transcriptional activity as obtained with the wild-type promoter (Figure 4). When cells were exposed to IL-6, we did not observe an induction of the −2762Hep/Luc GATA mutant transcriptional activity (Figure 4). Thus the hepcidin promoter IL-6 response was markedly impaired by the absence of GATA binding. It has been reported previously that mutation of the BMP-RE1 also severely impaired hepcidin activation in response to IL-6 [17,34]. This might be due to the fact that IL-6 signalling requires the presence of associated transcription factors to STAT3 phosphorylated protein in order to recruit and/or stabilize co-factors that bring RNA polymerase II complex. Therefore GATA-4 could be one of these transcriptional factors, and the observation of three nucleoprotein complexes in EMSAs could be related to interactions between GATA-4 and co-factors. For the BMP/SMAD pathway, despite GATA-binding site mutations, we observed a response to BMP-6 treatment, suggesting that activated SMAD proteins could bring the co-factors required to activate hepcidin gene expression.

Mutations of the GATA-binding site impair the IL-6 response and prevent the total responsiveness to BMP-6

Figure 4
Mutations of the GATA-binding site impair the IL-6 response and prevent the total responsiveness to BMP-6

HepG2 cells were transfected with Hep/Luc constructs as indicated in the Figure and were treated or not with 50 ng/ml BMP-6 or IL-6 for 48 h. Luciferase activity values represent firefly/Renilla luciferase activity ratios relative to the ratio obtained with the −2762Hep/Luc plasmid construct, which was arbitrarily set at 100%. ***P<0.001; ns, non significant.

Figure 4
Mutations of the GATA-binding site impair the IL-6 response and prevent the total responsiveness to BMP-6

HepG2 cells were transfected with Hep/Luc constructs as indicated in the Figure and were treated or not with 50 ng/ml BMP-6 or IL-6 for 48 h. Luciferase activity values represent firefly/Renilla luciferase activity ratios relative to the ratio obtained with the −2762Hep/Luc plasmid construct, which was arbitrarily set at 100%. ***P<0.001; ns, non significant.

In conclusion, the findings of the present study indicate that the GATA-4 transcription factor may participate in the control of hepcidin expression. Therefore pathophysiological situations that could affect the expression of GATA-4 could also, in turn, modulate hepcidin expression and contribute to alterations in iron metabolism.

Abbreviations

     
  • BMP

    bone morphogenetic protein

  •  
  • EMSA

    electrophoretic mobility-shift assay

  •  
  • HPRT

    hypoxanthine-guanine phosphoribosyl transferase

  •  
  • IL

    interleukin

  •  
  • qRT-PCR

    quantitative real-time PCR

  •  
  • RE

    responsive element

  •  
  • siRNA

    small interfering RNA

  •  
  • STAT3

    signal transducer and activator of transcription 3

  •  
  • TfR2

    transferrin receptor 2

AUTHOR CONTRIBUTION

Marie-Laure Island designed and performed the experiments, analysed the data and wrote the paper. Patricia Leroyer and Nadia Fatih performed the experiments. Pierre Brissot and Olivier Loréal initiated the study, analysed the data and wrote the paper.

FUNDING

This work was supported by the EEC FP6 programme Euroiron1 [grant number LSHM-CT-2006-037296]; and the ANR IRONREG [grant number ANR-09-GENO-016-02].

References

References
1
Krause
A.
Neitz
S.
Magert
H. J.
Schulz
A.
Forssmann
W. G.
Schulz-Knappe
P.
Adermann
K.
LEAP-1, a novel highly disulfide-bonded human peptide, exhibits antimicrobial activity
FEBS Lett.
2000
, vol. 
480
 (pg. 
147
-
150
)
2
Nicolas
G.
Bennoun
M.
Devaux
I.
Beaumont
C.
Grandchamp
B.
Kahn
A.
Vaulont
S.
Lack of hepcidin gene expression and severe tissue iron overload in upstream stimulatory factor 2 (USF2) knockout mice
Proc. Natl. Acad. Sci. U.S.A.
2001
, vol. 
98
 (pg. 
8780
-
8785
)
3
Park
C. H.
Valore
E. V.
Waring
A. J.
Ganz
T.
Hepcidin, a urinary antimicrobial peptide synthesized in the liver
J. Biol. Chem.
2001
, vol. 
276
 (pg. 
7806
-
7810
)
4
Pigeon
C.
Ilyin
G.
Courselaud
B.
Leroyer
P.
Turlin
B.
Brissot
P.
Loreal
O.
A new mouse liver-specific gene, encoding a protein homologous to human antimicrobial peptide hepcidin, is overexpressed during iron overload
J. Biol. Chem.
2001
, vol. 
276
 (pg. 
7811
-
7819
)
5
Nemeth
E.
Tuttle
M. S.
Powelson
J.
Vaughn
M. B.
Donovan
A.
Ward
D. M.
Ganz
T.
Kaplan
J.
Hepcidin regulates cellular iron efflux by binding to ferroportin and inducing its internalization
Science
2004
, vol. 
306
 (pg. 
2090
-
2093
)
6
Hentze
M. W.
Muckenthaler
M. U.
Galy
B.
Camaschella
C.
Two to tango: regulation of mammalian iron metabolism
Cell
2010
, vol. 
142
 (pg. 
24
-
38
)
7
Roetto
A.
Camaschella
C.
New insights into iron homeostasis through the study of non-HFE hereditary haemochromatosis
Best Pract. Res. Clin. Haematol.
2005
, vol. 
18
 (pg. 
235
-
250
)
8
Bridle
K. R.
Frazer
D. M.
Wilkins
S. J.
Dixon
J. L.
Purdie
D. M.
Crawford
D. H.
Subramaniam
V. N.
Powell
L. W.
Anderson
G. J.
Ramm
G. A.
Disrupted hepcidin regulation in HFE-associated haemochromatosis and the liver as a regulator of body iron homoeostasis
Lancet
2003
, vol. 
361
 (pg. 
669
-
673
)
9
Gehrke
S. G.
Kulaksiz
H.
Herrmann
T.
Riedel
H. D.
Bents
K.
Veltkamp
C.
Stremmel
W.
Expression of hepcidin in hereditary hemochromatosis: evidence for a regulation in response to the serum transferrin saturation and to non-transferrin-bound iron
Blood
2003
, vol. 
102
 (pg. 
371
-
376
)
10
Pelucchi
S.
Mariani
R.
Trombini
P.
Coletti
S.
Pozzi
M.
Paolini
V.
Barisani
D.
Piperno
A.
Expression of hepcidin and other iron-related genes in type 3 hemochromatosis due to a novel mutation in transferrin receptor-2
Haematologica
2009
, vol. 
94
 (pg. 
276
-
279
)
11
Nemeth
E.
Valore
E. V.
Territo
M.
Schiller
G.
Lichtenstein
A.
Ganz
T.
Hepcidin, a putative mediator of anemia of inflammation, is a type II acute-phase protein
Blood
2003
, vol. 
101
 (pg. 
2461
-
2463
)
12
Pietrangelo
A.
Dierssen
U.
Valli
L.
Garuti
C.
Rump
A.
Corradini
E.
Ernst
M.
Klein
C.
Trautwein
C.
STAT3 is required for IL-6-gp130-dependent activation of hepcidin in vivo
Gastroenterology
2007
, vol. 
132
 (pg. 
294
-
300
)
13
Verga Falzacappa
M. V.
Vujic Spasic
M.
Kessler
R.
Stolte
J.
Hentze
M. W.
Muckenthaler
M. U.
STAT3 mediates hepatic hepcidin expression and its inflammatory stimulation
Blood
2007
, vol. 
109
 (pg. 
353
-
358
)
14
Wrighting
D. M.
Andrews
N. C.
Interleukin-6 induces hepcidin expression through STAT3
Blood
2006
, vol. 
108
 (pg. 
3204
-
3209
)
15
Andriopoulos
B.
Jr
Corradini
E.
Xia
Y.
Faasse
S. A.
Chen
S.
Grgurevic
L.
Knutson
M. D.
Pietrangelo
A.
Vukicevic
S.
Lin
H. Y.
Babitt
J. L.
BMP6 is a key endogenous regulator of hepcidin expression and iron metabolism
Nat. Genet.
2009
, vol. 
41
 (pg. 
482
-
487
)
16
Meynard
D.
Kautz
L.
Darnaud
V.
Canonne-Hergaux
F.
Coppin
H.
Roth
M. P.
Lack of the bone morphogenetic protein BMP6 induces massive iron overload
Nat. Genet.
2009
, vol. 
41
 (pg. 
478
-
481
)
17
Verga Falzacappa
M. V.
Casanovas
G.
Hentze
M. W.
Muckenthaler
M. U.
A bone morphogenetic protein (BMP)-responsive element in the hepcidin promoter controls HFE2-mediated hepatic hepcidin expression and its response to IL-6 in cultured cells
J. Mol. Med.
2008
, vol. 
86
 (pg. 
531
-
540
)
18
Casanovas
G.
Mleczko-Sanecka
K.
Altamura
S.
Hentze
M. W.
Muckenthaler
M. U.
Bone morphogenetic protein (BMP)-responsive elements located in the proximal and distal hepcidin promoter are critical for its response to HJV/BMP/SMAD
J. Mol. Med.
2009
, vol. 
87
 (pg. 
471
-
480
)
19
Truksa
J.
Lee
P.
Beutler
E.
Two BMP responsive elements, STAT, and bZIP/HNF4/COUP motifs of the hepcidin promoter are critical for BMP, SMAD1, and HJV responsiveness
Blood
2009
, vol. 
113
 (pg. 
688
-
695
)
20
Courselaud
B.
Pigeon
C.
Inoue
Y.
Inoue
J.
Gonzalez
F. J.
Leroyer
P.
Gilot
D.
Boudjema
K.
Guguen-Guillouzo
C.
Brissot
P.
, et al. 
C/EBPα regulates hepatic transcription of hepcidin, an antimicrobial peptide and regulator of iron metabolism. Cross-talk between C/EBP pathway and iron metabolism
J. Biol. Chem.
2002
, vol. 
277
 (pg. 
41163
-
41170
)
21
Bayele
H. K.
McArdle
H.
Srai
S. K.
Cis and trans regulation of hepcidin expression by upstream stimulatory factor
Blood
2006
, vol. 
108
 (pg. 
4237
-
4245
)
22
Weizer-Stern
O.
Adamsky
K.
Margalit
O.
Ashur-Fabian
O.
Givol
D.
Amariglio
N.
Rechavi
G.
Hepcidin, a key regulator of iron metabolism, is transcriptionally activated by p53
Br. J. Haematol.
2007
, vol. 
138
 (pg. 
253
-
262
)
23
Balesaria
S.
Ramesh
B.
McArdle
H.
Bayele
H. K.
Srai
S. K.
Divalent metal-dependent regulation of hepcidin expression by MTF-1
FEBS Lett.
2010
, vol. 
584
 (pg. 
719
-
725
)
24
Vecchi
C.
Montosi
G.
Zhang
K.
Lamberti
I.
Duncan
S. A.
Kaufman
R. J.
Pietrangelo
A.
ER stress controls iron metabolism through induction of hepcidin
Science
2009
, vol. 
325
 (pg. 
877
-
880
)
25
Kawabata
H.
Germain
R. S.
Ikezoe
T.
Tong
X.
Green
E. M.
Gombart
A. F.
Koeffler
H. P.
Regulation of expression of murine transferrin receptor 2
Blood
2001
, vol. 
98
 (pg. 
1949
-
1954
)
26
Haworth
K. E.
Kotecha
S.
Mohun
T. J.
Latinkic
B. V.
GATA4 and GATA5 are essential for heart and liver development in Xenopus embryos
BMC Dev. Biol.
2008
, vol. 
8
 pg. 
74
 
27
Zaret
K. S.
Hepatocyte differentiation: from the endoderm and beyond
Curr. Opin. Genet. Dev.
2001
, vol. 
11
 (pg. 
568
-
574
)
28
Zhao
R.
Duncan
S. A.
Embryonic development of the liver
Hepatology
2005
, vol. 
41
 (pg. 
956
-
967
)
29
Molkentin
J. D.
The zinc finger-containing transcription factors GATA-4, -5, and -6. Ubiquitously expressed regulators of tissue-specific gene expression
J. Biol. Chem.
2000
, vol. 
275
 (pg. 
38949
-
38952
)
30
Pehlivan
T.
Pober
B. R.
Brueckner
M.
Garrett
S.
Slaugh
R.
Van Rheeden
R.
Wilson
D. B.
Watson
M. S.
Hing
A. V.
GATA4 haploinsufficiency in patients with interstitial deletion of chromosome region 8p23.1 and congenital heart disease
Am. J. Med. Genet.
1999
, vol. 
83
 (pg. 
201
-
206
)
31
Tomita-Mitchell
A.
Maslen
C. L.
Morris
C. D.
Garg
V.
Goldmuntz
E.
GATA4 sequence variants in patients with congenital heart disease
J. Med. Genet.
2007
, vol. 
44
 (pg. 
779
-
783
)
32
Mwinyi
J.
Nekvindova
J.
Cavaco
I.
Hofmann
Y.
Pedersen
R. S.
Landman
E.
Mkrtchian
S.
Ingelman-Sundberg
M.
New insights into the regulation of CYP2C9 gene expression: the role of the transcription factor GATA-4
Drug Metab. Dispos.
2010
, vol. 
38
 (pg. 
415
-
421
)
33
Sumi
K.
Tanaka
T.
Uchida
A.
Magoori
K.
Urashima
Y.
Ohashi
R.
Ohguchi
H.
Okamura
M.
Kudo
H.
Daigo
K.
, et al. 
Cooperative interaction between hepatocyte nuclear factor 4α and GATA transcription factors regulates ATP-binding cassette sterol transporters ABCG5 and ABCG8
Mol. Cell. Biol.
2007
, vol. 
27
 (pg. 
4248
-
4260
)
34
Island
M. L.
Jouanolle
A. M.
Mosser
A.
Deugnier
Y.
David
V.
Brissot
P.
Loreal
O.
A new mutation in the hepcidin promoter impairs its BMP response and contributes to a severe phenotype in HFE related hemochromatosis
Haematologica
2009
, vol. 
94
 (pg. 
720
-
724
)