MSK1 (mitogen- and stress-activated kinase 1) and MSK2 are nuclear protein kinases that regulate transcription downstream of the ERK1/2 (extracellular-signal-regulated kinase 1/2) and p38α MAPKs (mitogen-activated protein kinases) via the phosphorylation of CREB (cAMP-response-element-binding protein) and histone H3. Previous studies on the function of MSKs have used two inhibitors, H89 and Ro 31-8220, both of which have multiple off-target effects. In the present study, we report the characterization of the in vitro and cellular properties of an improved MSK1 inhibitor, SB-747651A. In vitro, SB-747651A inhibits MSK1 with an IC50 value of 11 nM. Screening of an in vitro panel of 117 protein kinases revealed that, at 1 μM, SB-747651A inhibited four other kinases, PRK2 (double-stranded-RNA-dependent protein kinase 2), RSK1 (ribosomal S6 kinase 1), p70S6K (S6K is S6 kinase) (p70RSK) and ROCK-II (Rho-associated protein kinase 2), with a similar potency to MSK1. In cells, SB-747651A fully inhibited MSK activity at 5–10 μM. SB-747651A was found to inhibit the production of the anti-inflammatory cytokine IL-10 (interleukin-10) in wild-type, but not MSK1/2-knockout, macrophages following LPS (lipopolysaccharide) stimulation. Both SB-747651A and MSK1/2 knockout resulted in elevated pro-inflammatory cytokine production by macrophages in response to LPS. Comparison of the effects of SB-747651A, both in vitro and in cells, demonstrated that SB-747651A exhibited improved selectivity over H89 and Ro 31-8220 and therefore represents a useful tool to study MSK function in cells.

INTRODUCTION

MAPK (mitogen-activated protein kinase) signalling cascades are important mediators of the cellular response to a wide range of stimuli, including mitogens, growth factors, cytokines and cellular stress [13]. How these cascades produce the correct response in cells has been the subject of extensive study. Small-molecule inhibitors of the ERK1/2 (extracellular-signal-regulated kinase 1/2) cascade or p38α/β have been used extensively as a means to probe the functions of these pathways, and have played a crucial role in the advancement of this area. The impetus for the continued development of these compounds has come from the demonstration that ERK1/2 and p38 play key roles in cancer and autoimmunity, and MAPK pathway inhibitors have also shown efficacy in models of cancer and inflammation [36].

Both ERK1/2 and p38α are known to have multiple substrates, including several downstream kinases [7]. The ERK1/2 cascade has been shown to be essential for the activation of the RSK (ribosomal S6 kinase) family of kinases, whereas p38α MAPK activates the kinases MAPKAPK2 [MAPKAP (MAPK-activated protein) kinase 2] and MAPKAPK3. In contrast with RSK and MAPKAPK2, which are activated downstream of a single MAPK cascade, two further groups of kinases, MNKs (MAPK-interacting kinase) and MSKs (mitogen- and stress-activated kinases) can be activated by either ERK1/2 or p38α pathways [8,9]. These downstream kinases probably play key roles in mediating the physiological functions of ERK1/2 and p38 and also represent potential drug targets.

Two isoforms of MSK, termed MSK1 and MSK2, have been identified in mammalian cells. MSKs are most closely related to the RSK family of kinases and, similar to RSK, they contain two kinase domains in a single polypeptide. The use of cell-permeant inhibitors that block MAPK signalling has demonstrated a role for both ERK1/2 and p38α in the activation of MSKs [1012]. For stimuli such as PMA or EGF (epidermal growth factor), which predominantly activate ERK1/2 but not p38α, MSK activation is blocked by pre-treatment of the cells with inhibitors of MKK1 (MAPK kinase 1) and MKK2 that prevent the activation of ERK1/2. MSK activation by stimuli such as anisomycin that predominantly activate p38, but not ERK1/2, is blocked by pre-incubation with the p38α/β inhibitor SB-203580, whereas, for stimuli that activate both ERK1/2 and p38, such as TNF (tumour necrosis factor) or LPS (lipopolysaccharide), a combination of MEK1/2 (MAPK/ERK kinase 1/2) and p38 inhibitors are required to completely block MSK activation [12,13]. The p38 inhibitor SB-203580 targets both p38α and p38β; however, it has been shown using mouse knockouts that fibroblasts lacking p38β activate MSK1 normally, whereas, in cells lacking p38α, p38-dependent MSK1 activation was abolished, indicating that p38α and not p38β is the major p38 isoform involved in MSK activation [14,15].

Mice lacking MSK1 or MSK2, and also a double knockout of both MSK1 and MSK2, are viable and fertile, but show enhanced inflammation in immune models as well as impairments in some models of memory [11,16,17]. Using cells from MSK-knockout mice, it has been shown that MSK1/2 is critical for the mitogen- and stress-activated phosphorylation of the transcription factors CREB (cAMP-response-element-binding protein) and ATF1 (activating transcription factor 1) as well as the chromatin proteins histone H3 and HMG14 (high-mobility group protein 14) in a variety of cell types, including fibroblasts, macrophages and cortical neurons [11,1820]. In addition, MSKs have been suggested to phosphorylate RARα (retinoic acid receptor α) [21] and p65/RelA [22]. This suggests a role for MSKs in the regulation of immediate-early gene transcription. In line with this, the induction of several immediate-early genes, including c-fos, JunB, nur77, IL-1ra [IL-1 (interleukin-1) receptor antagonist] and miR-132 (microRNA 132), in response to mitogens or cellular stress is reduced in cells from the MSK1/2-knockout mice [11,15,2325].

Although the use of mouse germline manipulation has been a useful way of investigating MSK function, a selective cell-permeant inhibitor of MSKs would be of great help in elucidating MSK signalling mechanisms and function. Until recently, however, selective small-molecule inhibitors of the downstream kinases RSK, MSK and MAPKAPK2 have not been available. Ro 31-8220 and H89 inhibit RSK and MSK, but these compounds are non-selective and inhibit many other protein kinases [26,27], whereas H89 has also been shown to target proteins other than kinases [28]. In addition, they can also affect the activation of the ERK1/2 MAPK pathway by some stimuli, therefore limiting their utility to study MSK or RSK function [27,29]. Despite this, owing to the lack of alternatives, H89 and Ro 31-8220 have been used to study MSK function in cells [12,17,22,27,30,31]. There have been several reports on the identification of more selective inhibitors for these kinases. Three reports have described the identification of novel inhibitors of RSK that block its activity both in vitro and in cells [3234], and two recent papers have described the first MAPKAPK2 inhibitors [35,36]. With the exception of the MAPKAPK2 compounds reported by Revesz et al. [35] for which data are not yet available, profiling of these inhibitors has demonstrated that they are selective for RSK or MAPKAPK2 over MSKs [26,34,36]. (1H-Imidazo[4,5-c]pyridin-2-yl)-1,2,5-oxadiazol-3-ylamine derivatives have also been reported to act as potent inhibitors of MSK1 activity in vitro, with up to 300-fold selectivity for MSK1 over RSK [37,38]. However, the properties of such compounds in cells have not been reported. In the present study, we characterize the in vitro and cellular properties of SB-747651A, a selective and cell-active inhibitor of MSKs with properties superior to H89 and Ro 31-8220 for analysis of MSK signalling pathways.

MATERIALS AND METHODS

Kinase inhibitors

SB-747651A was synthesized by GlaxoSmithKline as described previously [37,38]. Requests for SB-747651A should be addressed to Alastair.d.reith@gsk.com. H89 and Ro 31-8220 were obtained from Calbiochem.

Kinase inhibitor specificity profiling

Kinase selectivity profiling for MSK1 inhibitors was carried out as described previously [26,27,39] (http://www.kinase-screen.mrc.ac.uk/). Briefly, protein kinase assays were carried out at room temperature (21°C) and were linear with respect to time and enzyme concentrations under the conditions used. Assays were performed for 40 min using a Biomek 2000 Laboratory Automation Workstation in a 96-well format (Beckman Instruments). The concentration of magnesium acetate in the assays was 10 mM, and the concentration of [γ-33P]ATP (800 c.p.m./pmol) used was selected to be close to the kinase's Km value for ATP (see Table 2). Assays were initiated with MgATP and stopped by the addition of 5 μl of 0.5 M orthophosphoric acid. Aliquots (30 μl) were then spotted on to P30 filtermats, washed four times in 75 mM phosphoric acid to remove ATP and once in methanol, then dried and counted for radioactivity. To determine IC50 values, kinase activities were determined at ten inhibitor concentrations ranging from 3 nM to 100 μM as indicated.

Cell culture

Primary MEFs (murine embryonic fibroblasts) were prepared as described previously [11]. MEF, HEK (human embryonic kidney)-293 and HeLa cells were maintained in DMEM (Dulbecco's modified Eagle's medium) supplemented with 10% FBS (fetal bovine serum), 2 mM L-glutamine, 50 units/ml penicillin G and 50 mg/ml streptomycin (Invitrogen). HEK-293 cells were transfected using a modified calcium phosphate protocol as described previously [12]. Before stimulation, MEF, HEK-293 and HeLa cells were serum-starved for 16 h. BMDMs (bone-marrow-derived macrophages) were isolated as described previously [14] and cultured in DMEM supplemented with 10% FBS, 5 ng/ml CSF (colony-stimulating factor), 2 mM L-glutamine, 50 units/ml penicillin G and 50 μg/ml streptomycin (Invitrogen). Animals were maintained in accordance with EU and U.K. regulations, and work was carried out under a U.K. Home Office Project Licence and subject to local ethical review.

Immunoblotting

Samples were run on 4–12% polyacrylamide gels (Novex, Invitrogen) and transferred on to nitrocellulose membranes. Antibodies that recognize total ERK1/2, phospho-ERK1/2 (which recognizes phospho-Thr202/Tyr204 of ERK1 or phospho-Thr185/Tyr187 of ERK2), phospho-Thr308 PKB (protein kinase B), phospho-Ser473 PKB, phospho-GSK3 (glycogen synthase kinase 3) (phospho-Ser21 GSK3α, phospho-Ser9 GSK3β), phospho-Thr359 RSK, total p38α, phospho-Thr180/Tyr182 p38α, phospho-Thr334 MAPKAPK2, phospho-Thr180/Tyr182 JNK (c-Jun N-terminal kinase), phospho-Thr389 p70S6K (S6K is S6 kinase, also called RSK), phospho-Ser235/Ser236 S6K, phospho-Ser133 CREB (also recognizes phospho-Ser63 in ATF1) and phospho-Ser360, phopsho-Ser376 or phospho-Thr581 MSK1 were from Cell Signaling Technology. Antibodies against phospho-Ser212 MSK1, Ser750/Ser752 MSK1, Nur77 and phospho-Ser354 Nur77 have been described previously [10,29]. Residue numbers are for human proteins. HRP (horseradish peroxidase)-conjugated secondary antibodies were from Pierce, and detection was performed using the enhanced chemiluminescence reagent from Amersham Biosciences.

Quantitative RT (reverse transcription)–PCR

Cells were treated as indicated, then lysed and total RNA isolated using the NucleoSpin RNA purification method (Qiagen). RNA was reverse-transcribed (iScript; BioRad Laboratories) and real-time PCR was carried out using SYBR Green-based detection. 18S rRNA levels were used as normalization controls and relative mRNA levels were calculated using the equation:

 
formula

where E is the efficiency of the PCR, ct is the threshold cycle, u is the mRNA of interest, r is the reference gene (18S RNA), s is the sample and c is the unstimulated control sample. The PCR efficiency was determined experimentally, and the identity of the PCR products was confirmed by sequencing. The primers used are listed in Table 1.

Table 1
Quantitative RT–PCR primer sequences
Target Forward primer (5′→3′) Reverse primer (5′→3′) 
c-Fos CTACTGTGTTCCTGGCAATAGC AACATTGACGCTGAAGGACTAC 
Egr-1 ACAGAAGGACAAGAAAGCAGAC CCAGGAGAGGAGTAGGAAGTG 
Nur 77 CCTGTTGCTAGAGTCTGCCTTC CAATCCAATCACCAAAGCCACG 
Nor-1 GCCATCTCCTCCGATCTGTATG GAGGCCGTCAGAAGGTTGTAG 
18s rRNA GTAACCCGTTGAACCCCATT CCATCCAATCGGTAGTAGCG 
IL-10 CCCTTTGCTATGGTGTCCTTTC GATCTCCCTGGTTTCTCTTCCC 
IL-6 TTCCATCCAGTTGCCTTCTTG AGGTCTGTTGGGAGTGGTATC 
TNF CAGACCCTCACACTCAGATCATC GGCTACAGGCTTGTCACTCG 
Target Forward primer (5′→3′) Reverse primer (5′→3′) 
c-Fos CTACTGTGTTCCTGGCAATAGC AACATTGACGCTGAAGGACTAC 
Egr-1 ACAGAAGGACAAGAAAGCAGAC CCAGGAGAGGAGTAGGAAGTG 
Nur 77 CCTGTTGCTAGAGTCTGCCTTC CAATCCAATCACCAAAGCCACG 
Nor-1 GCCATCTCCTCCGATCTGTATG GAGGCCGTCAGAAGGTTGTAG 
18s rRNA GTAACCCGTTGAACCCCATT CCATCCAATCGGTAGTAGCG 
IL-10 CCCTTTGCTATGGTGTCCTTTC GATCTCCCTGGTTTCTCTTCCC 
IL-6 TTCCATCCAGTTGCCTTCTTG AGGTCTGTTGGGAGTGGTATC 
TNF CAGACCCTCACACTCAGATCATC GGCTACAGGCTTGTCACTCG 

Cytokine measurements

The levels of TNF, IL-12p40, IL-12p70 and IL-10 in culture medium were determined using a multiplex assay from BioRad Laboratories using Luminex-based technology. Assays were performed according to the manufacturer's protocols.

RESULTS

SB-747651A inhibits activity of the N-terminal kinase domain of MSK1

The (1H-imidazo[4,5-c]pyridin-2-yl)-1,2,5-oxadiazol-3-ylamine derivative SB-747651A (Figure 1A) has been identified as a potent ATP-competitive inhibitor of MSK1 in vitro [37,38]. We found that SB-747651A inhibited MSK1 with an IC50 value of 11 nM in vitro (Figure 1B). To establish which of the two kinase domains of MSK1 is the target of SB-747651A, we determined the effect of SB-747651A on key MSK1 phosphorylation sites. FLAG–MSK1 was expressed in HEK-293 cells by transient transfection and activated by stimulation in the presence or absence of 5 μM SB-747651A with either UV-C, which activates MSK1 via p38, or PMA, which activates MSK1 via ERK1/2. The activation of p38 in response to UV-C, or the activation of ERK1/2 in response to PMA, was not significantly affected by SB-747651A, as judged by immunoblotting with phospho-specific antibodies against their TXY activation motifs (Figure 1C).

Inhibition of MSK1 by SB-747651A

Figure 1
Inhibition of MSK1 by SB-747651A

(A) Chemical structure of SB-747651A is shown [37]. (B) MSK1 activity was measured using in vitro kinase assays against a peptide substrate as described in the Materials and methods section with 100, 30, 10, 3, 1, 0.3, 0.1, 0.03, 0.01 or 0.003 μM SB-747651A. Results are expressed as percentage activity compared with MSK activity in the absence of SB-747651A, and error bars represent the S.D. of duplicate assays. (C) FLAG-tagged MSK1 was transfected into HEK-293 cells. Cells were starved for 16 h and then treated with 5 μM SB-747651A for a further 1 h as indicated. Cells were then either left unstimulated or stimulated with UV-C (200 J/m2 followed by a 30 min incubation at 37°C) or PMA (400 ng/ml, 15 min). Cells were lysed and the levels of FLAG, phospho (p)-Ser212, -Ser360, Ser376, -Thr581 or -Ser750/Ser752 MSK1, phospho-p38 and phospho-ERK1/2 were determined by immunoblotting.

Figure 1
Inhibition of MSK1 by SB-747651A

(A) Chemical structure of SB-747651A is shown [37]. (B) MSK1 activity was measured using in vitro kinase assays against a peptide substrate as described in the Materials and methods section with 100, 30, 10, 3, 1, 0.3, 0.1, 0.03, 0.01 or 0.003 μM SB-747651A. Results are expressed as percentage activity compared with MSK activity in the absence of SB-747651A, and error bars represent the S.D. of duplicate assays. (C) FLAG-tagged MSK1 was transfected into HEK-293 cells. Cells were starved for 16 h and then treated with 5 μM SB-747651A for a further 1 h as indicated. Cells were then either left unstimulated or stimulated with UV-C (200 J/m2 followed by a 30 min incubation at 37°C) or PMA (400 ng/ml, 15 min). Cells were lysed and the levels of FLAG, phospho (p)-Ser212, -Ser360, Ser376, -Thr581 or -Ser750/Ser752 MSK1, phospho-p38 and phospho-ERK1/2 were determined by immunoblotting.

MSKs contain two kinase domains, and their activation mechanism is complex and involves multiple phosphorylation steps [10,40]. Initially, MSK1 is phosphorylated on three sites (Ser360, Thr581 and Thr700) by the upstream kinases ERK1/2 and p38α. This results in the activation of the C-terminal kinase domain, which then autophosphorylates three residues, including the T-loop (Ser212) and hydrophobic motif (Ser376) of the N-terminal domain. This in turn activates the N-terminal domain of MSK1, which is responsible for autophosphorylating three residues at the C-terminus of MSK1 (Ser750, Ser752 and Ser758) as well as phosphorylating MSK substrates [10,40].

To determine which kinase domain SB-747651A targets, the phosphorylation of the key activation residues was examined in the presence of SB-747651A. ERK1/2 and p38 phosphorylate Ser360 and Thr581 in MSK1 [10] and, as expected, the phosphorylation of these sites was induced by UV-C or PMA (Figure 1C). The UV-C-induced phosphorylation of these MAPK sites was not affected by pre-incubation with SB-747651A. However, unexpectedly, the PMA-induced phosphorylation of Thr581, and to a lesser extent that of Ser360, was reduced by pre-incubation with SB-747651A. One explanation of this could be that MSK inhibition promotes dephosphorylation of Thr581, although it is not clear why this effect was much more pronounced with PMA than with UV-C stimulation. Consistent with this, we have found previously that point mutants that inactivate MSK1 decrease the amount of Thr581 phosphorylation observed in cells following PMA stimulation [10,40]. Phosphorylation of Thr581 activates the C-terminal domain of MSK1, which then autophosphorylates Ser376 and Ser212 [10]. The phosphorylation of these sites induced by UV-C or PMA was not greatly affected by pre-incubation with SB-747651A, suggesting that this inhibitor did not target the C-terminal domain of MSK1. The N-terminal kinase domain of MSK1 has been shown to autophosphorylate Ser750 and Ser752 in the C-terminus of MSK1 [10]. The UV-C- and PMA-induced phosphorylation of these sites was inhibited by SB-747651A, consistent with this compound targeting the N-terminal kinase domain of MSK1.

Selectivity profile of SB-747651A

Interpretation of data generated with ATP-competitive kinase inhibitors requires a detailed understanding of the kinase target profile of the compound in question. To this end, the selectivity of SB-747651A was determined against a panel of 117 kinases in vitro. For comparison, the selectivity profiles of H89 and Ro 31-8220, two compounds previously described as MSK inhibitors, were also determined (Figure 2A and Table 2). At 1 μM, H89 showed reasonable selectivity, but limited potency, for MSK1. Additionally, six kinases were more strongly inhibited than MSK1 by H89. Ro 31-8220 showed poor selectivity for MSK1 and targeted many kinases in the screen. These results confirm and extend previously published selectivity data demonstrating the limitations of these compounds as MSK1 inhibitors [26,27]. In addition to MSK1, SB-747651A was also found to inhibit four other AGC kinases PRK2 (double-stranded-RNA-dependent protein kinase 2), ROCK (Rho-associated protein kinase), S6K1 and RSK to a similar degree as MSK1 (Table 2). SB-747651A also showed some activity against PKA (protein kinase A) and PKB as well as inhibiting three non-AGC kinases Pim-1 (provirus integration site for Moloney murine leukaemia virus-1), Pim-3 and MELK (maternal embryonic leucine zipper kinase). IC50 values were determined for SB-747651A against MSK, PKA, RSK, PKB, p70S6K, ROCK and PRK2 at ATP concentrations close to the Km of the kinase for ATP. IC50 values against MSK, RSK, p70S6K, PRK2 and ROCK-II were all found to be in the range 10–100 nM, whereas the IC50 values for PKB and PKA were 190 and 300 nM respectively (Figure 2B). This compares with an IC50 value of 0.05 μM for MSK1. Thus, although SB-747651A is a potent MSK1 inhibitor, it can also inhibit several other AGC kinases to a similar degree in vitro.

IC50 determination for SB-747651A against selected kinases

Figure 2
IC50 determination for SB-747651A against selected kinases

(A) SB-747651A, H89 and Ro 31-8220 were tested at 1 μM against a panel of 117 kinases as described in the Materials and methods section. The kinases were ranked in order of the percentage kinase activity remaining in the presence of the inhibitor and activity values were plotted against the 117 kinases. The position of MSK1 is indicated for each inhibitor. Data for individual kinases are shown in Table 2. (B) Kinase activity was measured using in vitro kinase assays against a peptide substrate as described in the Materials and methods section with 100, 30, 10, 3, 1, 0.3, 0.1, 0.03, 0.01 or 0.003 μM SB-747651A. Results are expressed as the percentage activity compared with kinase activity in the absence of SB-747651A, and error bars represent the S.D. of duplicate assays. Results for p70S6K, RSK2, PKBα, PKA, ROCK and PRK2 are shown. RSK1 and PKBΔPH (PH-domain-deleted mutant) gave similar results (not shown) to RSK2 and PKB respectively.

Figure 2
IC50 determination for SB-747651A against selected kinases

(A) SB-747651A, H89 and Ro 31-8220 were tested at 1 μM against a panel of 117 kinases as described in the Materials and methods section. The kinases were ranked in order of the percentage kinase activity remaining in the presence of the inhibitor and activity values were plotted against the 117 kinases. The position of MSK1 is indicated for each inhibitor. Data for individual kinases are shown in Table 2. (B) Kinase activity was measured using in vitro kinase assays against a peptide substrate as described in the Materials and methods section with 100, 30, 10, 3, 1, 0.3, 0.1, 0.03, 0.01 or 0.003 μM SB-747651A. Results are expressed as the percentage activity compared with kinase activity in the absence of SB-747651A, and error bars represent the S.D. of duplicate assays. Results for p70S6K, RSK2, PKBα, PKA, ROCK and PRK2 are shown. RSK1 and PKBΔPH (PH-domain-deleted mutant) gave similar results (not shown) to RSK2 and PKB respectively.

Table 2
Kinase selectivity profiling of SB-747651A, H89 and Ro 31-8220

Inhibitors were profiled in vitro against a panel of kinases as described in the Materials and methods section. The final concentration of the inhibitors in the assay was 1 μM, and results are expressed as the percentage activity remaining relative to control reactions without inhibitor. Kinases are ordered by their ability to inhibit MSK1. Results with less than 15% of activity remaining are in bold typeface. For definitions of kinase abbreviations, see http://www.kinase-screen.mrc.ac.uk/kinase-panel.htm/.

    SB-747651A H89 Ro 31-8220 
Kinase Species GenBank® accession number [ATP] (μM) Activity remaining (%) Range (n=2) Activity remaining (%) Range (n=2) Activity remaining (%) Range (n=2) 
MSK1 Human AF074393 20 5 25 1 
PRK2 Human S75548 5 14 3 
RSK1 Human NM_002953.3 50 6 32 4 
S6K1 Human NM_003161 20 6 9 2 
ROCK-II Rat U38481 20 7 9 70 
PKBα Human NM_001626 50 15 24 13 
PIM-1 Human NM_002648 20 18 91 6 
RSK2 Human NM_004586 50 19 70 10 1 
PKBβ Human NM_002742 50 24 49 13 
PIM-3 Human Q86V86 20 26 10 105 32 44 
MELK Human NM_014791 50 37 64 12 42 10 
PKA Human BC000479 38 5 21 
PKCζ Human NM_002730 20 52 87 24 6 
IGF-1R Human NM_000875 56 13 88 41 
IRR Human NM_014215 57 88 23 
DYRK1A Human NM_130437.2 50 59 83 4 
ERK8 Human AY065978 60 55 3 
PKCα Human NM_005030 63 93 4 
AMPK Human BC027464 63 17 67 14 39 13 
SGK1 Human NM_005627 20 64 64 6 
PKCγ Human NM_002739 20 65 53 39 
MARK3 Human U64205 67 10 93 11 80 37 
PAK6 Human Q9NQU5 20 67 89 78 11 
MLK1 Human NM_033141 20 68 91 66 43 
CHK2 Human NM_007194 20 68 58 34 
TTK Human NM_003318 20 69 10 75 35 
GSK3β Human L33801 69 99 1 
Aurora B Human AF533878 50 70 73 10 31 
BRSK1 Human NM_032430 20 71 85 38 
TAK1 Human NM_003188 72 87 37 
FGF-R1 Human M34641 20 73 90 10 40 24 
PKD1 Human NM_002737 20 74 80 38 
STK33 Human BC031231.1 50† 74 42 10 
MNK2 Human AF237775 50 74 25 122 33 107 
GCK Human BC047865 20 74 93 15 
PRAK Human AF032437 20 75 84 92 
MKK1 Rabbit Z30163 75 95 11 28 
MKK2 Human NM_030662 75 11 83 24 
MINK1 Human NM_015716 50 77 82 9 
p38δ MAPK Human Y10487 77 16 90 84 
JNK1 Human L26318 20 77 89 15 76 
MARK2 Human NM_004954 20 78 90 61 23 
MAPKAPK2 Human NM_032960 20 78 15 84 12 75 
CLK2 Human NM_003993.2 78 95 1 
CDK2–cyclin A Human NM_001798 20 79 85 4 
SYK Human AAH01645.1 20 79 96 69 
MST4 Human NM_016542 20 79 12 88 21 
VEGFR Human NM_002019.3 20 80 89 5 
NUAK1 Human NM_014840 20 80 18 19 
MEKK1 Human XM_042066 20 81 15 90 84 13 
DAPK1 Human NM_004938.2 81 94 43 
CK1 Human NM_001893 20 82 89 94 
MNK1 Human AB000409 50 83 94 94 
TAO1 Human NM_020791 20 83 12 87 34 
EPH-B1 Human NM_004441 20 83 97 83 
CK2 Human NM_001895 84 93 93 15 
IRAK4 Human BC013316.1 20 84 12 104 40 
BTK Human NP_00052.1 50 84 98 40 
ZAP70 Human NM_001079 84 16 107 73 
PIM2 Human U77735 84 10 91 14 
YES1 Human NM_005433 20 85 99 41 10 
Src Human NM_005417.3 50 85 100 89 
PAK5 Human Q9P286 20 86 11 104 11 75 
HER4 Human NM_005235 86 87 11 40 
EPH-B2 Human NM_004442 20 87 100 57 
BRSK2 Human AF533878 50 87 68 37 
HIPK1 Human NM_198268 20 87 96 23 
IKKβ Human XM_032491 88 94 84 
RIPK2 Human NM_003821 20 88 14 92 11 89 
TrkA Human NM_001007792.1 20 88 20 107 7 
IKKϵ Human NM_014002 50 88 105 75 
NEK6 Human NM_014397 50 89 89 10 85 12 
PDK1 Human X80590 50 89 84 30 
JNK3 Human NM_002753 20 89 87 11 91 
CAMK1 Human NM_003656 50 89 90 13 38 
DYRK3 Human AY590695 90 61 18 
EPH-B3 Human NM_004443 20 90 103 13 91 21 
Aurora A Human NM_032430 20 90 88 93 
MARK1 Human AF154845 20 90 95 75 
CHK1 Human AF016582 20 90 10 70 12 
HIPK2 Human AF326592 90 100 14 
JAK2 Human NP_004963.1 91 104 55 
NEK2a Human NM_002497 50 91 95 85 
PAK4 Human O96013 91 92 49 
CSK Human NM_004383 20 92 94 95 
EF2K Human AAH32665 92 109 15 79 
ABL Rat Tissue purified 50 92 94 88 
ERK1 Human BC013992 92 95 85 
EPH-A2 Human NM_004431 50 93 97 57 
IR Human NM_000208.2 20 94 102 19 101 
EPH-A4 Human NM_004438 50 94 97 53 
PAK2 Human NM_002577 20 94 97 84 13 
ERK2 Human NM_002745 20 95 94 88 
SRPK1 Human NM_003137 50 95 90 29 
p38β MAPK Human Y14440 20 96 87 92 
MST2 Human U60206 20 96 14 91 16 
MLK3 Human NM_002419 20 96 93 7 
CAMKKβ Human NM_153499 20 96 114 19 13 
MAPKAPK3 Human NM_004635 20 97 104 92 20 
PHK Human NM_002613 20 97 10 92 8 
BRK Human NP_00052.1 50 97 88 84 
DYRK2 Human NM_003583 50 97 99 86 
p38α MAPK Human L35264 50 97 103 85 
LKB1 Human NP_000446 20 98 122 77 
MKK6 Human NM_002758 50† 99 90 15 74 
SmMLCK Human NM_005965 50 99 101 11 
PLK1 Human NM_002744 101 97 95 13 
MPSK1 Human CR407675 50† 101 99 103 
ASK1 Human NM_004217 20 101 95 90 
TIE2 Human BC035514.1 20 102 117 89 
MARK4 Human AK075272 50 103 98 72 
TBK1 Human NM_013254 50 105 11 91 29 28 
JNK2 Human L31951 20 105 96 79 
Lck Mouse X03533 50 106 98 15 56 
EPH-B4 Human NP_004435.3 50 112 13 89 74 
HIPK3 Human NM_005734 20 120 14 108 47 
p38γ MAPK Human Y10488 128 53 87 15 91 
    SB-747651A H89 Ro 31-8220 
Kinase Species GenBank® accession number [ATP] (μM) Activity remaining (%) Range (n=2) Activity remaining (%) Range (n=2) Activity remaining (%) Range (n=2) 
MSK1 Human AF074393 20 5 25 1 
PRK2 Human S75548 5 14 3 
RSK1 Human NM_002953.3 50 6 32 4 
S6K1 Human NM_003161 20 6 9 2 
ROCK-II Rat U38481 20 7 9 70 
PKBα Human NM_001626 50 15 24 13 
PIM-1 Human NM_002648 20 18 91 6 
RSK2 Human NM_004586 50 19 70 10 1 
PKBβ Human NM_002742 50 24 49 13 
PIM-3 Human Q86V86 20 26 10 105 32 44 
MELK Human NM_014791 50 37 64 12 42 10 
PKA Human BC000479 38 5 21 
PKCζ Human NM_002730 20 52 87 24 6 
IGF-1R Human NM_000875 56 13 88 41 
IRR Human NM_014215 57 88 23 
DYRK1A Human NM_130437.2 50 59 83 4 
ERK8 Human AY065978 60 55 3 
PKCα Human NM_005030 63 93 4 
AMPK Human BC027464 63 17 67 14 39 13 
SGK1 Human NM_005627 20 64 64 6 
PKCγ Human NM_002739 20 65 53 39 
MARK3 Human U64205 67 10 93 11 80 37 
PAK6 Human Q9NQU5 20 67 89 78 11 
MLK1 Human NM_033141 20 68 91 66 43 
CHK2 Human NM_007194 20 68 58 34 
TTK Human NM_003318 20 69 10 75 35 
GSK3β Human L33801 69 99 1 
Aurora B Human AF533878 50 70 73 10 31 
BRSK1 Human NM_032430 20 71 85 38 
TAK1 Human NM_003188 72 87 37 
FGF-R1 Human M34641 20 73 90 10 40 24 
PKD1 Human NM_002737 20 74 80 38 
STK33 Human BC031231.1 50† 74 42 10 
MNK2 Human AF237775 50 74 25 122 33 107 
GCK Human BC047865 20 74 93 15 
PRAK Human AF032437 20 75 84 92 
MKK1 Rabbit Z30163 75 95 11 28 
MKK2 Human NM_030662 75 11 83 24 
MINK1 Human NM_015716 50 77 82 9 
p38δ MAPK Human Y10487 77 16 90 84 
JNK1 Human L26318 20 77 89 15 76 
MARK2 Human NM_004954 20 78 90 61 23 
MAPKAPK2 Human NM_032960 20 78 15 84 12 75 
CLK2 Human NM_003993.2 78 95 1 
CDK2–cyclin A Human NM_001798 20 79 85 4 
SYK Human AAH01645.1 20 79 96 69 
MST4 Human NM_016542 20 79 12 88 21 
VEGFR Human NM_002019.3 20 80 89 5 
NUAK1 Human NM_014840 20 80 18 19 
MEKK1 Human XM_042066 20 81 15 90 84 13 
DAPK1 Human NM_004938.2 81 94 43 
CK1 Human NM_001893 20 82 89 94 
MNK1 Human AB000409 50 83 94 94 
TAO1 Human NM_020791 20 83 12 87 34 
EPH-B1 Human NM_004441 20 83 97 83 
CK2 Human NM_001895 84 93 93 15 
IRAK4 Human BC013316.1 20 84 12 104 40 
BTK Human NP_00052.1 50 84 98 40 
ZAP70 Human NM_001079 84 16 107 73 
PIM2 Human U77735 84 10 91 14 
YES1 Human NM_005433 20 85 99 41 10 
Src Human NM_005417.3 50 85 100 89 
PAK5 Human Q9P286 20 86 11 104 11 75 
HER4 Human NM_005235 86 87 11 40 
EPH-B2 Human NM_004442 20 87 100 57 
BRSK2 Human AF533878 50 87 68 37 
HIPK1 Human NM_198268 20 87 96 23 
IKKβ Human XM_032491 88 94 84 
RIPK2 Human NM_003821 20 88 14 92 11 89 
TrkA Human NM_001007792.1 20 88 20 107 7 
IKKϵ Human NM_014002 50 88 105 75 
NEK6 Human NM_014397 50 89 89 10 85 12 
PDK1 Human X80590 50 89 84 30 
JNK3 Human NM_002753 20 89 87 11 91 
CAMK1 Human NM_003656 50 89 90 13 38 
DYRK3 Human AY590695 90 61 18 
EPH-B3 Human NM_004443 20 90 103 13 91 21 
Aurora A Human NM_032430 20 90 88 93 
MARK1 Human AF154845 20 90 95 75 
CHK1 Human AF016582 20 90 10 70 12 
HIPK2 Human AF326592 90 100 14 
JAK2 Human NP_004963.1 91 104 55 
NEK2a Human NM_002497 50 91 95 85 
PAK4 Human O96013 91 92 49 
CSK Human NM_004383 20 92 94 95 
EF2K Human AAH32665 92 109 15 79 
ABL Rat Tissue purified 50 92 94 88 
ERK1 Human BC013992 92 95 85 
EPH-A2 Human NM_004431 50 93 97 57 
IR Human NM_000208.2 20 94 102 19 101 
EPH-A4 Human NM_004438 50 94 97 53 
PAK2 Human NM_002577 20 94 97 84 13 
ERK2 Human NM_002745 20 95 94 88 
SRPK1 Human NM_003137 50 95 90 29 
p38β MAPK Human Y14440 20 96 87 92 
MST2 Human U60206 20 96 14 91 16 
MLK3 Human NM_002419 20 96 93 7 
CAMKKβ Human NM_153499 20 96 114 19 13 
MAPKAPK3 Human NM_004635 20 97 104 92 20 
PHK Human NM_002613 20 97 10 92 8 
BRK Human NP_00052.1 50 97 88 84 
DYRK2 Human NM_003583 50 97 99 86 
p38α MAPK Human L35264 50 97 103 85 
LKB1 Human NP_000446 20 98 122 77 
MKK6 Human NM_002758 50† 99 90 15 74 
SmMLCK Human NM_005965 50 99 101 11 
PLK1 Human NM_002744 101 97 95 13 
MPSK1 Human CR407675 50† 101 99 103 
ASK1 Human NM_004217 20 101 95 90 
TIE2 Human BC035514.1 20 102 117 89 
MARK4 Human AK075272 50 103 98 72 
TBK1 Human NM_013254 50 105 11 91 29 28 
JNK2 Human L31951 20 105 96 79 
Lck Mouse X03533 50 106 98 15 56 
EPH-B4 Human NP_004435.3 50 112 13 89 74 
HIPK3 Human NM_005734 20 120 14 108 47 
p38γ MAPK Human Y10488 128 53 87 15 91 

The calculated Km for ATP in these assays results in a poor signal-to-noise ratio, so assays are performed with an ATP concentration above the Km.

SB-747651A inhibits the action of MSKs in cells

The results for inhibitors from in vitro kinase assays do not always translate directly into their properties in cells. This can be due to differences in the ATP concentrations between the two systems and the ability of the inhibitor to cross the cell membrane.

MSK1 and MSK2 are known to be required for the phosphorylation of CREB and ATF1 downstream of ERK1/2 or p38 signalling. To determine whether SB-747651A was able to inhibit MSK1 and MSK2 activities in cells, serum-starved HeLa cells were incubated with concentrations of SB-747651A ranging from 0.1 to 10 μM and then stimulated with PMA, UV-C or anisomycin (Figure 3). PMA was found to activate ERK1/2, but not p38, in HeLa cells, and the activation of ERK1/2 was not affected by pre-incubation of the cells with SB-747651A. PMA treatment also resulted in the phosphorylation of the MSK substrates CREB and ATF1. These phosphorylation events were significantly reduced by pre-incubation of the cells with 10, 5 or 1 μM SB-747651A (Figure 3A). Anisomycin and UV-C were found to strongly activate the p38 and JNK MAPKs in HeLa cells, and the activation of these kinases, or the phosphorylation of the p38 substrate MAPKAPK2, were not affected by SB-747651A. Anisomycin and UV-C also stimulated CREB and ATF1 phosphorylation, and this was reduced to baseline levels by pre-incubation in 10 or 5 μM SB-747651A. Phosphorylation of CREB and ATF1 was also significantly reduced by 1 μM SB-747651A, whereas 0.5 and 0.1 μM were less effective (Figures 3B and 3C). Taken together, these data suggest that SB-747651A is effective at inhibiting the activity of MSKs in cells without affecting the upstream MAPK signalling pathways. Consistent with this, SB-747651A was also able to inhibit PMA-induced CREB phosphorylation in primary MEFs (Figure 4A). To confirm that SB-747651A could also inhibit MSK2 in cells, MEFs were isolated from MSK1-knockout mice, as in these cells the remaining PMA-induced CREB phosphorylation is catalysed predominantly by MSK2 [11]. SB-747651A was also able to inhibit CREB phosphorylation in these cells with a similar IC50 value to that seen in wild-type cells (Figure 4B).

SB-747651A inhibits MSK activity in cells

Figure 3
SB-747651A inhibits MSK activity in cells

HeLa cells were serum-starved for 16 h and then treated for a further 1 h with 0.1, 0.5, 1, 5 or 10 μM SB-747651A as indicated. Cells were then stimulated with 400 ng/ml PMA for 15 min (A), 200 J/m2 UV-C followed by 30 min at 37°C (B) or 10 mg/ml anisomycin for 30 min (C). Cells were then lysed and immunoblotted for total (t) ERK1/2, phospho (p)-ERK1/2, total p38α, phospho-p38α, phospho-JNK, phospho-RSK, phospho-MAPKAPK2, total CREB and phospho-CREB.

Figure 3
SB-747651A inhibits MSK activity in cells

HeLa cells were serum-starved for 16 h and then treated for a further 1 h with 0.1, 0.5, 1, 5 or 10 μM SB-747651A as indicated. Cells were then stimulated with 400 ng/ml PMA for 15 min (A), 200 J/m2 UV-C followed by 30 min at 37°C (B) or 10 mg/ml anisomycin for 30 min (C). Cells were then lysed and immunoblotted for total (t) ERK1/2, phospho (p)-ERK1/2, total p38α, phospho-p38α, phospho-JNK, phospho-RSK, phospho-MAPKAPK2, total CREB and phospho-CREB.

SB-747651A inhibits MSK1 and MSK2 in cells

Figure 4
SB-747651A inhibits MSK1 and MSK2 in cells

Primary MEFs were isolated from wild-type (A) and MSK1-knockout (KO) (B) mice. Following serum starvation for 16 h, cells were treated with the indicated concentrations of SB-747651A for 1 h. Cell were either then left unstimulated or stimulated with 400 ng/ml PMA for 15 min. Cells were lysed and the levels of total (t) ERK1/2, phospho (p)-ERK1/2, total CREB and phospho-Ser133 CREB were then determined by immunoblotting.

Figure 4
SB-747651A inhibits MSK1 and MSK2 in cells

Primary MEFs were isolated from wild-type (A) and MSK1-knockout (KO) (B) mice. Following serum starvation for 16 h, cells were treated with the indicated concentrations of SB-747651A for 1 h. Cell were either then left unstimulated or stimulated with 400 ng/ml PMA for 15 min. Cells were lysed and the levels of total (t) ERK1/2, phospho (p)-ERK1/2, total CREB and phospho-Ser133 CREB were then determined by immunoblotting.

SB-747651A can also inhibit PKB, RSK and p70S6K in cells

As SB-747651A was found to have off-target activity in vitro, including inhibition of PKA, PKB, RSK and p70S6K, the ability to inhibit these kinases in cells was also examined. PKA is activated by forskolin, which is able to elevate cAMP levels in cells. Analysis of the PKA substrate CREB after forskolin stimulation showed that concentrations of SB-747651A above 5 μM resulted in some inhibition of CREB phosphorylation (Figure 5A). This was not due to an effect of SB-747651A on MSK, which also phosphorylates CREB in response to other signals, as forskolin-induced CREB phosphorylation has been previously shown to be unaffected by knockout of MSK1 and MSK2 [11].

SB-747651A inhibits multiple AGC kinases in cells

Figure 5
SB-747651A inhibits multiple AGC kinases in cells

(A) HeLa cells were serum-starved for 16 h and then treated with the indicated concentrations of SB-747651A for 1 h before stimulation with 10 μM forskolin for 15 min. Levels of total (t) ERK1/2, phospho (p)-ERK1/2, phospho-p38α, total CREB and phospho-CREB were then determined by immunoblotting. (B) HeLa cells were transfected with a nur77 expression construct. Cells were serum-starved for 16 h and then treated with the indicated concentrations of SB-747651A for 1 h. Cells were then stimulated with 400 ng/ml PMA for 15 min. Levels of total Nur77, phospho-Ser354Nur77, total ERK1/2 and phospho-ERK1/2 were then determined by immunoblotting. (C) As in (A), but cells were stimulated with 400 ng/ml PMA for 15 min. Levels of total PKB, phospho-Thr308 or -Ser473 PKB, total RSK, phospho-RSK and phospho-GSK3 were then determined by immunoblotting. (D) As in (A), but cells were stimulated with 50 ng/ml IGF for 15 min. Levels of total PKB, phospho-Thr308 or -Ser473 PKB and phospho-GSK3 were then determined by immunoblotting. (E) As in (A), but cells were stimulated with 400 ng/ml PMA for 15 min. Levels of total p70, phospho-p70S6K and phospho-S6 were then determined by immunoblotting. (F) As in (A), but cells were stimulated with 50 ng/ml IGF for 15 min. Levels of total p70, phospho-p70S6K and phospho-S6 were then determined by immunoblotting.

Figure 5
SB-747651A inhibits multiple AGC kinases in cells

(A) HeLa cells were serum-starved for 16 h and then treated with the indicated concentrations of SB-747651A for 1 h before stimulation with 10 μM forskolin for 15 min. Levels of total (t) ERK1/2, phospho (p)-ERK1/2, phospho-p38α, total CREB and phospho-CREB were then determined by immunoblotting. (B) HeLa cells were transfected with a nur77 expression construct. Cells were serum-starved for 16 h and then treated with the indicated concentrations of SB-747651A for 1 h. Cells were then stimulated with 400 ng/ml PMA for 15 min. Levels of total Nur77, phospho-Ser354Nur77, total ERK1/2 and phospho-ERK1/2 were then determined by immunoblotting. (C) As in (A), but cells were stimulated with 400 ng/ml PMA for 15 min. Levels of total PKB, phospho-Thr308 or -Ser473 PKB, total RSK, phospho-RSK and phospho-GSK3 were then determined by immunoblotting. (D) As in (A), but cells were stimulated with 50 ng/ml IGF for 15 min. Levels of total PKB, phospho-Thr308 or -Ser473 PKB and phospho-GSK3 were then determined by immunoblotting. (E) As in (A), but cells were stimulated with 400 ng/ml PMA for 15 min. Levels of total p70, phospho-p70S6K and phospho-S6 were then determined by immunoblotting. (F) As in (A), but cells were stimulated with 50 ng/ml IGF for 15 min. Levels of total p70, phospho-p70S6K and phospho-S6 were then determined by immunoblotting.

In addition to MSKs, PMA also activates RSK downstream of ERK1/2 in HeLa cells. The activation of RSK was not blocked by SB-747651A, as judged by immunoblotting to detect the phosphorylation of RSK on Thr369. RSK is able to phosphorylate Nur77 on Ser354 [29]. As phosphorylation of endogenous Nur77 is hard to detect with the antibodies currently available, Nur77 was overexpressed in HeLa cells by transient transfection. The phosphorylation of Nur77 in response to PMA was also blocked by concentrations of SB-747651A over 5 μM (Figure 5B). GSK3 is a substrate for both RSK and PKB; however, it has been shown previously that in response to PMA, which is a strong activator of RSK but not of PKB, GSK3 phosphorylation requires RSK but not PKB [41]. PMA stimulation of GSK3 phosphorylation in HeLa cells was blocked by SB-747651A at concentrations of 1 μM or above (Figure 5C). In response to IGF (insulin-like growth factor), GSK3 is phosphorylated by PKB and not RSK, so the effect of SB-747651A on the IGF-stimulated GSK3 phosphorylation in HeLa cells was also examined [41]. Surprisingly, treatment with high concentrations of SB-747651A increased the phosphorylation of PKB on both Thr308 and Ser473, sites that correlate with the activation of PKB. Despite this, SB-747651A was able to inhibit the IGF-stimulated phosphorylation of the PKB substrate GSK3 at concentrations of 5 and 10 μM (Figure 5D).

Both IGF and PMA can activate S6K1 in HeLa cells. SB-747651A was able to greatly reduce the phosphorylation of the S6K substrate ribosomal S6 protein at concentrations down to 0.5 μM, lower than that required to inhibit CREB phosphorylation. At higher concentrations, SB-747651A also inhibited the phosphorylation of S6K itself in response to PMA, and to a lesser extent IGF (Figures 5E and 5F). This is probably due to the ability of SB-747651A to inhibit PKB and RSK, as both of these kinases have been reported to be involved in the activation of S6K [7,42,43].

SB-747651A inhibits MSK-dependent transcription

A major role of MSKs in cells is the transcriptional regulation of specific genes. The effect of SB-747651A on the induction of MSK1/2-dependent immediate-early genes was therefore examined in cells from both wild-type and MSK1/2-knockout mice. Stimulation of primary MEFs with anisomycin has been shown previously to activate MSK via the p38α pathway [11], and this is required for phosphorylation of CREB and the maximal induction of several immediate-early genes including c-fos, nur77 and Nor-1 [11,15]. Consistent with these previous reports, anisomycin was able to induce the transcription of these genes in wild-type MEFs, and this induction was significantly reduced in MSK1/2-knockout cells. Pre-incubation of the wild-type MEFs with SB-747651A was found to partially inhibit the induction of these genes in wild-type cells, and the remaining levels of mRNA for nur77, Nor-1 and c-fos were similar to those observed in anisomycin-stimulated knockout MEFs (Figure 6). SB-747651A did not have any significant effect on the induction of c-fos and nur77 in anisomycin-stimulated MSK1/2-knockout MEF cells, demonstrating that its effect was specific to MSKs and not the inhibition of an off-target kinase. SB-747651A did not have a general inhibitory effect on all immediate-early genes, as the induction of Egr1 (early growth response 1), a gene which is induced independently of MSK in response to anisomycin, was unaffected by pre-incubation of the cells with SB-747651A.

Effect of SB-747651A on immediate-early gene transcription in fibroblasts

Figure 6
Effect of SB-747651A on immediate-early gene transcription in fibroblasts

Primary MEF cells were isolated from wild-type or MSK1/2-double-knockout mice. Following serum-starvation for 16 h, cells were treated with 5 μM SB-747651A as indicated and then left unstimulated or stimulated with 10 μg/ml anisomycin for 60 min. Total RNA was then isolated from the cells as described in the Materials and methods section. Quantitative RT–PCR was then used to determine the levels of nur77 (A), nor-1 (B), c-fos (C) and Egr1 (D), using 18S levels as a loading control. Results are expressed as fold induction relative to the wild-type control sample, and error bars represent the S.E.M. of triplicate samples from one preparation of MEFs per genotype.

Figure 6
Effect of SB-747651A on immediate-early gene transcription in fibroblasts

Primary MEF cells were isolated from wild-type or MSK1/2-double-knockout mice. Following serum-starvation for 16 h, cells were treated with 5 μM SB-747651A as indicated and then left unstimulated or stimulated with 10 μg/ml anisomycin for 60 min. Total RNA was then isolated from the cells as described in the Materials and methods section. Quantitative RT–PCR was then used to determine the levels of nur77 (A), nor-1 (B), c-fos (C) and Egr1 (D), using 18S levels as a loading control. Results are expressed as fold induction relative to the wild-type control sample, and error bars represent the S.E.M. of triplicate samples from one preparation of MEFs per genotype.

SB-747651A mimics the effect of MSK1/2 knockout in macrophages

Previous work on MSK1/2-knockout macrophages has shown that MSKs regulate the transcription of several anti-inflammatory cytokines, including IL-10 and IL-1ra [13,23]. As a result, MSK1/2-knockout macrophages overproduce pro-inflammatory cytokines relative to wild-type cells, and MSK1/2-knockout mice are more sensitive to endotoxic shock. Although overall macrophage development appears normal in the MSK1/2-knockout mice, it is possible that the knockout phenotype could be affected by subtle differences in macrophage development rather than acute regulation of cytokine transcription by LPS. Therefore it was of interest to see whether pharmacological inhibition of MSK1/2 would have similar effects. Hence the effects of SB-747651A on LPS-induced transcription were examined. As a further comparison, H89 and Ro 31-8220 were tested in parallel. In wild-type macrophages, LPS induced the transcription of nur77, and this was greatly reduced by pre-incubation of the cells with SB-747651A, Ro 31-8220 or H89. As expected, MSK1/2 knockout resulted in a lower induction of nur77 by LPS than wild-type cells and the remaining induction was not significantly (P>0.05) affected by SB-747651A in the knockout cells. In contrast, H89 resulted in a significant increase in nur77 transcription in MSK1/2-knockout cells, whereas Ro 31-8220 blocked the residual induction of nur77 in MSK1/2-knockout cells (Figure 7A). Similar results were also obtained for c-fos (results not shown). SB-747651A also blocked IL-10 induction in response to LPS in wild-type but not MSK1/2-knockout macrophages, whereas Ro 31-8220 or H89 at 25 μM inhibited IL-10 transcription in both wild-type and MSK1/2-knockout cells (Figure 7B).

Effect of SB-747651A, H89 and Ro 31-8220 on LPS-induced transcription

Figure 7
Effect of SB-747651A, H89 and Ro 31-8220 on LPS-induced transcription

BMDMs were treated with 10 μM SB-747651A, 10 or 25 μM H89 or 5 μM Ro 31-8220 as indicated for 1 h and then stimulated with 100 ng/ml LPS for 6 h. Total RNA was isolated and quantitative RT–PCR was performed to determine the mRNA levels for Nur77 (A) IL-10 (B), IL-6 (C) and TNF (D), using 18S expression levels as a loading control. Results are shown as a fold induction relative to wild-type control samples, and error bars represent the S.E.M. of independent cultures from three mice per genotype. *P<0.05 (Student's t test) between inhibitor- and LPS-treated samples for either wild-type or MSK1/2 cultures. Ko, knockout.

Figure 7
Effect of SB-747651A, H89 and Ro 31-8220 on LPS-induced transcription

BMDMs were treated with 10 μM SB-747651A, 10 or 25 μM H89 or 5 μM Ro 31-8220 as indicated for 1 h and then stimulated with 100 ng/ml LPS for 6 h. Total RNA was isolated and quantitative RT–PCR was performed to determine the mRNA levels for Nur77 (A) IL-10 (B), IL-6 (C) and TNF (D), using 18S expression levels as a loading control. Results are shown as a fold induction relative to wild-type control samples, and error bars represent the S.E.M. of independent cultures from three mice per genotype. *P<0.05 (Student's t test) between inhibitor- and LPS-treated samples for either wild-type or MSK1/2 cultures. Ko, knockout.

SB-747651A also reduced the initial (Figure 7C), but not prolonged (results not shown), transcription of IL-6, which is consistent with the effect of MSK1/2 knockout on IL-6 transcription [13]. In contrast, both H89 and Ro 31-8220 strongly inhibited IL-6 transcription. This was due to inhibition of an enzyme other than MSK1 or MSK2 as it also occurred in MSK1/2-knockout cells (Figure 7C). TNF transcription was not significantly affected by SB-747651A or MSK1/2 knockout; however, similar to IL-6, both H89 and Ro 31-8220 inhibited TNF transcription in both wild-type and MSK1/2-knockout macrophages (Figure 7D).

MSK1/2 knockout has previously been shown to result in decreased IL-10 secretion as well as transcription in macrophages [13]. Consistent with this, pharmacological inhibition of MSKs with SB-747651A also inhibited IL-10 secretion (Figure 8A). MSK1/2 knockout has also been shown to result in increased secretion of TNF, due to a negative regulation of TNF translation by MSKs. SB-747651A increased TNF secretion in wild-type but not MSK1/2 knockouts in response to LPS stimulation (Figure 8B). In contrast, neither H89 nor Ro 31-8220 increased TNF secretion, possibly due to their MSK-independent effects on TNF transcription (Figure 7D)

SB-747651A modulates cytokine induction in response to LPS

Figure 8
SB-747651A modulates cytokine induction in response to LPS

BMDMs were isolated from wild-type (black bars) and MSK1/2-knockout mice (white bars). Macrophages were treated with 10 μM SB-747651A, 10 μM H89 or 5 μM Ro 31-8220 for 1 h before stimulation with 100 ng/ml LPS for 6 h. The levels of IL-10 (A), TNF (B), IL-12p40 (C) and IL-12p70 (D) secreted into the culture medium was measured using a Luminex-based multiplex assay as described in the Materials and methods section. Error bars represent the S.D. of independent cultures from four mice per genotype.

Figure 8
SB-747651A modulates cytokine induction in response to LPS

BMDMs were isolated from wild-type (black bars) and MSK1/2-knockout mice (white bars). Macrophages were treated with 10 μM SB-747651A, 10 μM H89 or 5 μM Ro 31-8220 for 1 h before stimulation with 100 ng/ml LPS for 6 h. The levels of IL-10 (A), TNF (B), IL-12p40 (C) and IL-12p70 (D) secreted into the culture medium was measured using a Luminex-based multiplex assay as described in the Materials and methods section. Error bars represent the S.D. of independent cultures from four mice per genotype.

IL-10 is a potent inhibitor of IL-12 production by macrophages. Previously, it has been shown that knockout of MSK1 and MSK2 results in elevated secretion of IL-12 in response to LPS, and that this is a result of the decreased IL-10 secretion by the MSK1/2 knockouts [13]. SB-747651A increased the secretion of IL-12p40 in wild-type macrophages stimulated by LPS to levels similar to that seen in MSK1/2-knockout cells. SB-747651A also increased IL-12p70 secretion in wild-type cells, but not to the levels seen in MSK1/2-knockout cells. This was probably due to an off-target effect of SB-747651A, as this compound was found to reduce IL-12 secretion in MSK1/2-knockout cells following LPS stimulation. Despite this, SB-747651A more closely mimicked the effect of MSK1/2 knockout on IL-12 production than either H89 or Ro 31-8220 (Figures 8C and 8D).

DISCUSSION

In the present paper, we describe the characterization of SB-747651A, an inhibitor of MSK1 and MSK2 that represents an improvement in terms of selectivity over previous compounds. The use of small-molecule inhibitors has proven to be a powerful method of dissecting the roles of signalling cascades in cells. However, care should be taken in the interpretation of these experiments since most inhibitors have additional off-target effects in cells. Additionally, the complexity of signalling networks can mean that inhibition of a particular kinase can lead to changes in either upstream or parallel pathways due to the modulation of feedback loops. Extensive characterization of an inhibitor is therefore required before its cellular effects can be properly understood. In the present study, we show that SB-747651A is an effective inhibitor of MSKs in cells and, despite some off-target effects, represents an improvement on the existing alternatives H-89 and Ro 31-8220.

SB-747651A was originally reported as a potent and selective inhibitor of MSK1 [38], with a reported 300-fold selectivity for MSK compared with RSK. In the present study, we have found that, although SB-747651A is a potent MSK inhibitor, it also inhibits several other kinases, including RSK and MSKs. In contrast with the first report [38], we did not observe significant selectivity for SB-747651A between MSK1 and RSK. The reason for this difference is unclear, but may relate to differences in the conditions used for the MSK and RSK assays in the different studies. SB-747651A targets the N-terminal kinase domain of MSK1, which is a member of the AGC kinase family. Interestingly, the other kinases (S6K, RSK, PKR2, ROCK, PKB and PKA) inhibited at a similar IC50 value to MSK are also members of the AGC family. SB-747651A also showed some weaker activity against two other AGC kinases in the panel [PKC (protein kinase C) and SGK (serum- and glucocorticoid-induced kinase)]; however, less activity was seen against the non-AGC kinases, suggesting that this inhibitor may target a motif common to the AGC family. This off-target activity was not restricted to in vitro assays, as we also found that SB-747651A could block the actions of PKA, RSK, PKB and S6K in cells at similar concentrations to those required to inhibit MSK1.

SB-747651A was found to affect the activation of several kinases downstream of PI3K (phosphoinositide 3-kinase) signalling, notably PKB and S6K. SB-747651A was able to inhibit the phosphorylation of p70S6K in response to PMA and, to a lesser extent, IGF. This effect is probably due to the ability of SB-747651A to inhibit RSK and PKB. p70S6K is activated by phosphorylation of its hydrophobic motif by mTOR (mammalian target of rapamycin), which then allows the recruitment of PDK1 (phosphoinositide-dependent kinase 1), which in turn phosphorylates the T-loop of p70S6K. The activation of mTOR requires Rheb GTPase, which in turn is dependent on the phosphorylation of TSC2 (tuberous sclerosis complex 2). Downstream of IGF, TSC2 is phosphorylated by PKB, whereas RSK can also phosphorylate TSC2 downstream of mitogens [7,4246]. Thus the ability of SB-747651A to block PKB and RSK in cells could inhibit p70S6K phosphorylation by preventing the phosphorylation of TSC2. SB-747651A also increased PKB phosphorylation at both Thr308 and Ser473 in response to IGF, which could be due to a negative-feedback loop from p70S6K to IGF signalling. p70S6K can phosphorylate and inhibit the activity of IRS-1 (insulin receptor substrate-1), and so the ability of SB-747651A to inhibit p70S6K (preventing IRS-1 phosphorylation) may promote IGF-mediated activation of PI3K, which as a result increases PKB phosphorylation [47].

Despite the caveats regarding off-target activities, SB-747651A provides a significant improvement on the previous alternatives. Both Ro 31-8220 and H89 have been used as MSK inhibitors. SB-747651A shows a better selectivity profile for MSK1 compared with Ro 31-8220 in vitro (Table 2). In addition, analysis of Ro 31-8220 action in macrophages shows multiple effects that could not be attributed to inhibition of MSKs (Figures 7 and 8, and results not shown). In vitro, 1 μM H89 showed better selectivity than Ro 31-8220; however, at this concentration MSK1 inhibition was only 75%. A further drawback is that H89 is a more potent inhibitor of PKA than MSKs, and PKA shares in vivo targets such as CREB, ATF1, RARα and p65/RelA with MSKs [21,48,49]. In addition to its actions as a kinase inhibitor, H89 has also been reported to act as an antagonist of β-adrenergic receptors and to modulate the activity of certain Ca2+ and K+ channels [28,50]. In the present study, we show that H89 also affects transcription and cytokine production that are independent of MSKs (Figures 7 and 8).

Analysis of LPS-induced transcription and cytokine production in macrophages (Figures 7 and 8) demonstrated that SB-747651A more closely replicated the effect of MSK1/2 knockout than H89 and Ro 31-8220. Despite this, as shown in Figure 4, it is not without off-target activities. To confirm that an effect of SB-747651A in cells was due to inhibition of MSK, additional experiments could be used. Several commercially available inhibitors could help to distinguish MSK from PKB and S6K. Rapamycin inhibits mTOR and blocks the activation of S6K, whereas Akti (Akt inhibitor) can block PKB activation [26]. It has been shown previously that MSK is not directly inhibited by any of these inhibitors [26,27,39]. Alternatively, a combination of PD184352 and SB-203580 (which inhibit the ERK1/2 and p38 MAPK pathways respectively) will block MSK activation [40], but they do not normally affect PI3K signalling pathways. Therefore, if a process is insensitive to rapamycin and Akti but sensitive to SB-747651A as well as to a combination of PD184352 and SB203580, PKB and S6K can be excluded. Distinguishing between MSK and RSK is still problematic as, like MSKs, it is activated by ERK1/2. One possibility would be the use of recently described RSK inhibitors, which do not affect MSK activity [32,33]. A second complementary approach would be the use of RNAi (RNA interference) knockdown or gene-targeted mice.

In summary, in the present study we show that SB-747651A is an effective inhibitor of MSKs in cells and, although it has some off-target effects, it does replicate many of the effects of MSK1/2 knockout in cells.

Abbreviations

     
  • Akti

    Akt inhibitor

  •  
  • ATF1

    activating transcription factor 1

  •  
  • BMDM

    bone-marrow-derived macrophage

  •  
  • CREB

    cAMP-response-element-binding protein

  •  
  • Egr1

    early growth response 1

  •  
  • ERK

    extracellular-signal-regulated kinase

  •  
  • FBS

    fetal bovine serum

  •  
  • GSK

    glycogen synthase kinase

  •  
  • HEK

    human embryonic kidney

  •  
  • IGF

    insulin-like growth factor

  •  
  • IL

    interleukin

  •  
  • IL-1ra

    IL-1 receptor antagonist

  •  
  • IRS

    insulin receptor substrate

  •  
  • JNK

    c-Jun N-terminal kinase

  •  
  • LPS

    lipopolysaccharide

  •  
  • MAPK

    mitogen-activated protein kinase

  •  
  • MAPKAP

    MAPK-activated protein

  •  
  • MAPKAPK

    MAPKAP kinase

  •  
  • MEF

    murine embryonic fibroblast

  •  
  • MKK

    MAPK kinase

  •  
  • MSK

    mitogen- and stress-activated kinase

  •  
  • mTOR

    mammalian target of rapamycin

  •  
  • PI3K

    phosphoinositide 3-kinase

  •  
  • Pim

    provirus integration site for Moloney murine leukaemia virus

  •  
  • PKA

    protein kinase A

  •  
  • PKB

    protein kinase B

  •  
  • PKC

    protein kinase C

  •  
  • PRK2

    double-stranded-RNA-dependent protein kinase 2

  •  
  • RAR

    retinoic acid receptor

  •  
  • ROCK

    Rho-associated protein kinase

  •  
  • RSK

    ribosomal S6 kinase

  •  
  • RT

    reverse transcription

  •  
  • S6K

    S6 kinase

  •  
  • TNF

    tumour necrosis factor

  •  
  • TSC

    tuberous sclerosis complex

AUTHOR CONTRIBUTION

Shaista Naqvi carried out the work in macrophages and MSK2 knockouts, Joanne Darragh analysed the gene induction in MEFs, and Andrew Macdonald and Claire McCoy carried out the work to characterize the mechanism and off-target effects of SB-747651A. Alastair Reith was responsible for screening campaigns to identify MSK inhibitors and selection of SB-747651A. Simon Arthur co-ordinated and designed the study. All authors contributed to writing the paper.

We thank the National Centre for Protein Kinase Profiling (http://www.kinasescreen.mrc.ac.uk/) for help with the kinase selectivity screens.

FUNDING

This work was supported by the MRC.

References

References
1
Johnson
G. L.
Lapadat
R.
Mitogen-activated protein kinase pathways mediated by ERK, JNK, and p38 protein kinases
Science
2002
, vol. 
298
 (pg. 
1911
-
1912
)
2
Zarubin
T.
Han
J.
Activation and signaling of the p38 MAP kinase pathway
Cell Res.
2005
, vol. 
15
 (pg. 
11
-
18
)
3
Saklatvala
J.
The p38 MAP kinase pathway as a therapeutic target in inflammatory disease
Curr. Opin. Pharmacol.
2004
, vol. 
4
 (pg. 
372
-
377
)
4
Cuenda
A.
Alessi
D. R.
Use of kinase inhibitors to dissect signaling pathways
Methods Mol. Biol.
2000
, vol. 
99
 (pg. 
161
-
175
)
5
Sebolt-Leopold
J. S.
Herrera
R.
Targeting the mitogen-activated protein kinase cascade to treat cancer
Nat. Rev. Cancer
2004
, vol. 
4
 (pg. 
937
-
947
)
6
Kumar
S.
Boehm
J.
Lee
J. C.
p38 MAP kinases: key signalling molecules as therapeutic targets for inflammatory diseases
Nat. Rev. Drug Discovery
2003
, vol. 
2
 (pg. 
717
-
726
)
7
Roux
P. P.
Ballif
B. A.
Anjum
R.
Gygi
S. P.
Blenis
J.
Tumor-promoting phorbol esters and activated Ras inactivate the tuberous sclerosis tumor suppressor complex via p90 ribosomal S6 kinase
Proc. Natl. Acad. Sci. U.S.A.
2004
, vol. 
101
 (pg. 
13489
-
13494
)
8
Roux
P. P.
Blenis
J.
ERK and p38 MAPK-activated protein kinases: a family of protein kinases with diverse biological functions
Microbiol. Mol. Biol. Rev.
2004
, vol. 
68
 (pg. 
320
-
344
)
9
Gaestel
M.
MAPKAP kinases – MKs – two's company, three's a crowd
Nat. Rev. Mol. Cell Biol.
2006
, vol. 
7
 (pg. 
120
-
130
)
10
McCoy
C. E.
Campbell
D. G.
Deak
M.
Bloomberg
G. B.
Arthur
J. S.
MSK1 activity is controlled by multiple phosphorylation sites
Biochem. J.
2005
, vol. 
387
 (pg. 
507
-
517
)
11
Wiggin
G. R.
Soloaga
A.
Foster
J. M.
Murray-Tait
V.
Cohen
P.
Arthur
J. S.
MSK1 and MSK2 are required for the mitogen- and stress-induced phosphorylation of CREB and ATF1 in fibroblasts
Mol. Cell. Biol.
2002
, vol. 
22
 (pg. 
2871
-
2881
)
12
Deak
M.
Clifton
A. D.
Lucocq
L. M.
Alessi
D. R.
Mitogen- and stress-activated protein kinase-1 (MSK1) is directly activated by MAPK and SAPK2/p38, and may mediate activation of CREB
EMBO J.
1998
, vol. 
17
 (pg. 
4426
-
4441
)
13
Ananieva
O.
Darragh
J.
Johansen
C.
Carr
J. M.
McIlrath
J.
Park
J. M.
Wingate
A.
Monk
C. E.
Toth
R.
Santos
S. G.
, et al. 
The kinases MSK1 and MSK2 act as negative regulators of Toll-like receptor signaling
Nat. Immunol.
2008
, vol. 
9
 (pg. 
1028
-
1036
)
14
Beardmore
V. A.
Hinton
H. J.
Eftychi
C.
Apostolaki
M.
Armaka
M.
Darragh
J.
McIlrath
J.
Carr
J. M.
Armit
L. J.
Clacher
C.
, et al. 
Generation and characterization of p38β (MAPK11) gene-targeted mice
Mol. Cell. Biol.
2005
, vol. 
25
 (pg. 
10454
-
10464
)
15
Darragh
J.
Soloaga
A.
Beardmore
V. A.
Wingate
A. D.
Wiggin
G. R.
Peggie
M.
Arthur
J. S.
MSKs are required for the transcription of the nuclear orphan receptors Nur77, Nurr1 and Nor1 downstream of MAPK signalling
Biochem. J.
2005
, vol. 
390
 (pg. 
749
-
759
)
16
Chandramohan
Y.
Droste
S. K.
Arthur
J. S.
Reul
J. M.
The forced swimming-induced behavioural immobility response involves histone H3 phospho-acetylation and c-Fos induction in dentate gyrus granule neurons via activation of the N-methyl-D-aspartate/extracellular signal-regulated kinase/mitogen- and stress-activated kinase signalling pathway
Eur. J. Neurosci.
2008
, vol. 
27
 (pg. 
2701
-
2713
)
17
Chwang
W. B.
Arthur
J. S.
Schumacher
A.
Sweatt
J. D.
The nuclear kinase mitogen- and stress-activated protein kinase 1 regulates hippocampal chromatin remodeling in memory formation
J. Neurosci.
2007
, vol. 
27
 (pg. 
12732
-
12742
)
18
Soloaga
A.
Thomson
S.
Wiggin
G. R.
Rampersaud
N.
Dyson
M. H.
Hazzalin
C. A.
Mahadevan
L. C.
Arthur
J. S.
MSK2 and MSK1 mediate the mitogen- and stress-induced phosphorylation of histone H3 and HMG-14
EMBO J.
2003
, vol. 
22
 (pg. 
2788
-
2797
)
19
Park
J. M.
Greten
F. R.
Wong
A.
Westrick
R. J.
Arthur
J. S.
Otsu
K.
Hoffmann
A.
Montminy
M.
Karin
M.
Signaling pathways and genes that inhibit pathogen-induced macrophage apoptosis – CREB and NF-κB as key regulators
Immunity
2005
, vol. 
23
 (pg. 
319
-
329
)
20
Arthur
J. S.
Fong
A. L.
Dwyer
J. M.
Davare
M.
Reese
E.
Obrietan
K.
Impey
S.
Mitogen- and stress-activated protein kinase 1 mediates cAMP response element-binding protein phosphorylation and activation by neurotrophins
J. Neurosci.
2004
, vol. 
24
 (pg. 
4324
-
4332
)
21
Bruck
N.
Vitoux
D.
Ferry
C.
Duong
V.
Bauer
A.
de The
H.
Rochette-Egly
C.
A coordinated phosphorylation cascade initiated by p38MAPK/MSK1 directs RARα to target promoters
EMBO J.
2009
, vol. 
28
 (pg. 
34
-
47
)
22
Vermeulen
L.
De Wilde
G.
Van Damme
P.
Vanden Berghe
W.
Haegeman
G.
Transcriptional activation of the NF-κB p65 subunit by mitogen- and stress-activated protein kinase-1 (MSK1)
EMBO J.
2003
, vol. 
22
 (pg. 
1313
-
1324
)
23
Darragh
J.
Ananieva
O.
Courtney
A.
Elcombe
S.
Arthur
J. S.
MSK1 regulates the transcription of IL-1ra in response to TLR activation in macrophages
Biochem. J.
2010
, vol. 
425
 (pg. 
595
-
602
)
24
Remenyi
J.
Hunter
C. J.
Cole
C.
Ando
H.
Impey
S.
Monk
C. E.
Martin
K. J.
Barton
G. J.
Hutvagner
G.
Arthur
J. S.
Regulation of the miR-212/132 locus by MSK1 and CREB in response to neurotrophins
Biochem. J.
2010
, vol. 
428
 (pg. 
281
-
291
)
25
Schuck
S.
Soloaga
A.
Schratt
G.
Arthur
J. S.
Nordheim
A.
The kinase MSK1 is required for induction of c-fos by lysophosphatidic acid in mouse embryonic stem cells
BMC Mol. Biol.
2003
, vol. 
4
 pg. 
6
 
26
Bain
J.
Plater
L.
Elliott
M.
Shpiro
N.
Hastie
C. J.
McLauchlan
H.
Klevernic
I.
Arthur
J. S.
Alessi
D. R.
Cohen
P.
The selectivity of protein kinase inhibitors: a further update
Biochem. J.
2007
, vol. 
408
 (pg. 
297
-
315
)
27
Davies
S. P.
Reddy
H.
Caivano
M.
Cohen
P.
Specificity and mechanism of action of some commonly used protein kinase inhibitors
Biochem. J.
2000
, vol. 
351
 (pg. 
95
-
105
)
28
Murray
A. J.
Pharmacological PKA inhibition: all may not be what it seems
Sci. Signalling
2008
, vol. 
1
 pg. 
re4
 
29
Wingate
A. D.
Campbell
D. G.
Peggie
M.
Arthur
J. S.
Nur77 is phosphorylated in cells by RSK in response to mitogenic stimulation
Biochem. J.
2006
, vol. 
393
 (pg. 
715
-
724
)
30
Drobic
B.
Perez-Cadahia
B.
Yu
J.
Kung
S. K.
Davie
J. R.
Promoter chromatin remodeling of immediate-early genes is mediated through H3 phosphorylation at either serine 28 or 10 by the MSK1 multi-protein complex
Nucleic Acids Res.
2010
, vol. 
38
 (pg. 
3196
-
3208
)
31
Beck
I. M.
Vanden Berghe
W.
Vermeulen
L.
Bougarne
N.
Vander Cruyssen
B.
Haegeman
G.
De Bosscher
K.
Altered subcellular distribution of MSK1 induced by glucocorticoids contributes to NF-κB inhibition
EMBO J.
2008
, vol. 
27
 (pg. 
1682
-
1693
)
32
Smith
J. A.
Poteet-Smith
C. E.
Xu
Y.
Errington
T. M.
Hecht
S. M.
Lannigan
D. A.
Identification of the first specific inhibitor of p90 ribosomal S6 kinase (RSK) reveals an unexpected role for RSK in cancer cell proliferation
Cancer Res.
2005
, vol. 
65
 (pg. 
1027
-
1034
)
33
Cohen
M. S.
Zhang
C.
Shokat
K. M.
Taunton
J.
Structural bioinformatics-based design of selective, irreversible kinase inhibitors
Science
2005
, vol. 
308
 (pg. 
1318
-
1321
)
34
Sapkota
G. P.
Cummings
L.
Newell
F. S.
Armstrong
C.
Bain
J.
Frodin
M.
Grauert
M.
Hoffmann
M.
Schnapp
G.
Steegmaier
M.
, et al. 
BI-D1870 is a specific inhibitor of the p90 RSK (ribosomal S6 kinase) isoforms in vitro and in vivo
Biochem. J.
2007
, vol. 
401
 (pg. 
29
-
38
)
35
Revesz
L.
Schlapbach
A.
Aichholz
R.
Dawson
J.
Feifel
R.
Hawtin
S.
Littlewood-Evans
A.
Koch
G.
Kroemer
M.
Mobitz
H.
, et al. 
In vivo and in vitro SAR of tetracyclic MAPKAP-K2 (MK2) inhibitors. Part II
Bioorg. Med. Chem. Lett.
2010
, vol. 
20
 (pg. 
4719
-
4723
)
36
Mourey
R. J.
Burnette
B. L.
Brustkern
S. J.
Daniels
J. S.
Hirsch
J. L.
Hood
W. F.
Meyers
M. J.
Mnich
S. J.
Pierce
B. S.
Saabye
M. J.
, et al. 
A benzothiophene inhibitor of mitogen-activated protein kinase-activated protein kinase 2 inhibits tumor necrosis factor α production and has oral anti-inflammatory efficacy in acute and chronic models of inflammation
J. Pharmacol. Exp. Ther.
2010
, vol. 
333
 (pg. 
797
-
807
)
37
Bamford
M. J.
Alberti
M. J.
Bailey
N.
Davies
S.
Dean
D. K.
Gaiba
A.
Garland
S.
Harling
J. D.
Jung
D. K.
Panchal
T. A.
, et al. 
(1H-imidazo[4,5-c]pyridin-2-yl)-1,2,5-oxadiazol-3-ylamine derivatives: a novel class of potent MSK-1-inhibitors
Bioorg. Med. Chem. Lett.
2005
, vol. 
15
 (pg. 
3402
-
3406
)
38
Bamford
M. J.
Bailey
N.
Davies
S.
Dean
D. K.
Francis
L.
Panchal
T. A.
Parr
C. A.
Sehmi
S.
Steadman
J. G.
Takle
A. K.
, et al. 
(1H-imidazo[4,5-c]pyridin-2-yl)-1,2,5-oxadiazol-3-ylamine derivatives: further optimisation as highly potent and selective MSK-1-inhibitors
Bioorg. Med. Chem. Lett.
2005
, vol. 
15
 (pg. 
3407
-
3411
)
39
Bain
J.
McLauchlan
H.
Elliott
M.
Cohen
P.
The specificities of protein kinase inhibitors: an update
Biochem. J.
2003
, vol. 
371
 (pg. 
199
-
204
)
40
McCoy
C. E.
macdonald
A.
Morrice
N. A.
Campbell
D. G.
Deak
M.
Toth
R.
McIlrath
J.
Arthur
J. S.
Identification of novel phosphorylation sites in MSK1 by precursor ion scanning MS
Biochem. J.
2007
, vol. 
402
 (pg. 
491
-
501
)
41
Shaw
M.
Cohen
P.
Role of protein kinase B and the MAP kinase cascade in mediating the EGF-dependent inhibition of glycogen synthase kinase 3 in Swiss 3T3 cells
FEBS Lett.
1999
, vol. 
461
 (pg. 
120
-
124
)
42
Potter
C. J.
Pedraza
L. G.
Xu
T.
Akt regulates growth by directly phosphorylating Tsc2
Nat. Cell Biol.
2002
, vol. 
4
 (pg. 
658
-
665
)
43
Inoki
K.
Li
Y.
Zhu
T.
Wu
J.
Guan
K. L.
TSC2 is phosphorylated and inhibited by Akt and suppresses mTOR signalling
Nat. Cell Biol.
2002
, vol. 
4
 (pg. 
648
-
657
)
44
Tee
A. R.
Anjum
R.
Blenis
J.
Inactivation of the tuberous sclerosis complex-1 and -2 gene products occurs by phosphoinositide 3-kinase/Akt-dependent and -independent phosphorylation of tuberin
J. Biol. Chem.
2003
, vol. 
278
 (pg. 
37288
-
37296
)
45
Tee
A. R.
Blenis
J.
Proud
C. G.
Analysis of mTOR signaling by the small G-proteins, Rheb and RhebL1
FEBS Lett.
2005
, vol. 
579
 (pg. 
4763
-
4768
)
46
McManus
E. J.
Collins
B. J.
Ashby
P. R.
Prescott
A. R.
Murray-Tait
V.
Armit
L. J.
Arthur
J. S.
Alessi
D. R.
The in vivo role of PtdIns(3,4,5)P3 binding to PDK1 PH domain defined by knockin mutation
EMBO J.
2004
, vol. 
23
 (pg. 
2071
-
2082
)
47
Gual
P.
Le Marchand-Brustel
Y.
Tanti
J. F.
Positive and negative regulation of insulin signaling through IRS-1 phosphorylation
Biochimie
2005
, vol. 
87
 (pg. 
99
-
109
)
48
Gaillard
E.
Bruck
N.
Brelivet
Y.
Bour
G.
Lalevee
S.
Bauer
A.
Poch
O.
Moras
D.
Rochette-Egly
C.
Phosphorylation by PKA potentiates retinoic acid receptor alpha activity by means of increasing interaction with and phosphorylation by cyclin H/cdk7
Proc. Natl. Acad. Sci. U.S.A.
2006
, vol. 
103
 (pg. 
9548
-
9553
)
49
Arthur
J. S.
MSK activation and physiological roles
Front. Biosci.
2008
, vol. 
13
 (pg. 
5866
-
5879
)
50
Lochner
A.
Moolman
J. A.
The many faces of H89: a review
Cardiovasc. Drug Rev.
2006
, vol. 
24
 (pg. 
261
-
274
)

Author notes

1

These authors contributed equally to this work.

2

Present address: Institute of Molecular and Cellular Biology, Faculty of Biological Sciences, University of Leeds, Leeds LS2 9JT, U.K.

3

Present address: Monash Institute of Medical Research, 27–31 Wright St, Clayton, VIC 3168, Australia.