The formation of intracellular nitrogen-based oxidants has important physiological and pathological consequences. CK (creatine kinase), which plays a key role in intracellular energy metabolism, is a main target of low concentrations of oxidative and nitrative stresses. In the present study, the interaction between cytosolic CKs [MM-CK (muscle-type CK) and BB-CK (brain-type CK)] and MTs [metallothioneins; hMT2A (human MT-IIA) and hMT3 (human MT-III)] were characterized by both in vitro and intact-cell assays. MTs could successfully protect the cytosolic CKs against inactivation induced by low concentrations of PN (peroxynitrite) and NO both in vitro and in hMT2A-overexpressing H9c2 cells and hMT3-knockdown U-87 MG cells. Under high PN concentrations, CK formed granule-like structures, and MTs were well co-localized in these aggregated granules. Further analysis indicated that the number of cells containing the CK aggregates negatively correlated with the expression levels of MTs. In vitro experiments indicated that MTs could effectively protect CKs against aggregation during refolding, suggesting that MT might function as a chaperone to assist CK re-activation. The findings of the present study provide direct evidence of the connection between the two well-characterized intracellular systems: the precisely balanced energy homoeostasis by CKs and the oxidative-stress response system using MTs.

INTRODUCTION

In eukaryotic cells, the ATP level is usually maintained at a relatively constant level. When there is high energy demand, the depletion of ATP is supplied by the PCr (phosphocreatine)–CK (creatine kinase) system [1]. CK (EC 2.7.3.2) catalyses the reversible reaction from MgATP and creatine to MgADP and PCr. Two isoforms of CK, cytosolic homodimeric CK and mitochondrial octomeric CK, form the energy shuttle system between the microdomains of ATP production and consumption. There are two cytosolic forms, MM-CK (muscle-type CK) and BB-CK (brain-type CK). The former is present in striated muscle, whereas the latter exists in brain and many other tissues. At sites of high ATP turnover, cytosolic CK uses PCr to buffer the fluctuation in the intracellular ATP/ADP ratio, thus maintaining energy homoeostasis [2].

Dysfunction of CK, which interferes with the energy homoeostasis of the cell, has been related to many diseases and aging. Particularly, CK is known to be very susceptible to free radical damage induced by H2O2, NO and PN (peroxynitrite). MM-CK has been shown to be the main target of ROS (reactive oxygen species) in a skinned cardiac muscle fibre assay [3]. MM-CK may also be a physiologically important target for NO in cardiac muscle [4]. PN, a highly cytotoxic nitrogen-based oxidant, is formed in the near-instantaneous reaction of nitrogen oxide with superoxide anion. Both Mt-CK (mitochondrial CK) and MM-CK are highly sensitive to inactivation when exposed to physiologically relevant concentrations of PN, as characterized by both in vitro and animal models [5,6]. BB-CK was shown to be one of the prominent oxidatively modified proteins in brains of people with AD (Alzheimer's disease) [7]. A compromised CK system has been implicated in the aetiology and pathology of many heart and neurodegenerative diseases, such as CHF (congestive heart failure) [5,8], Huntington's disease [9], AD (for a review, see [10]) and amyotrophic lateral sclerosis [11], all of which were related to increased oxidative or nitrative stress.

To survive the oxidative or nitrative damage, cells have evolved various antioxidant systems. MT (metallothionein) is a low-molecular-mass, cysteine-rich and highly inducible protein. As its name implies, the primary function of MT identified thus far is to maintain metal homoeostasis [12] and provide non-essential metal detoxification. Previous studies showed that MT also plays an important role in many other biological processes, including antioxidation and cell proliferation [13]. MT was demonstrated to be able to quench a wide range of ROS or RNS (reactive nitrogen species), including H2O2, NO and PN, at a higher efficiency than well-identified antioxidants, such as SOD (superoxide dismutase) and GSH [14]. There are four identified MT isoforms, MT-I–MT-IV. MT-I and MT-II are ubiquitously expressed in all tissues, whereas MT-III is central-nervous-system-specific [15] and MT-IV is expressed mainly in squamous epithelia [16]. Although the protective role against oxidative stress associated with MTs has been widely documented, the underlying molecular mechanism remains elusive. Moreover, it is unclear whether the antioxidative function of MTs is ubiquitous or target-specific.

A previous study showed that in mouse brain, BB-CK and MT-III exist in a macromolecular complex and interact directly with each other [17]. However, the physiological implication of this interaction remains elusive. In the present study, we identified a possible physical interaction between human MM-CK and hMT2A (human MT-IIA) by yeast two-hybrid screening. The interactions between the cytosolic CKs and MTs were further identified by both in vitro and intact-cell assays. Furthermore, we found that MTs could efficiently protect cytosolic CKs against inactivation induced by PN stress in vitro as well as in H9c2 and U-87 MG cells. Interestingly, MTs could also protect CK against aggregation and function as a molecular chaperone.

EXPERIMENTAL

Materials

Mouse anti-MM-CK antibody, anti-FLAG antibody, M2-agarose affinity gel, SIN-1 (3-morpholinosydonimine), SNAP (S-nitroso-N-acetyl-DL-penicillamine), collagen, Triton X-100, NP-40 (Nonidet P40), leupeptin, PMSF and GdnHCl (guanidinium chloride) were obtained from Sigma. Rabbit MM-CK antibody was from Bioworld. Mouse monoclonal MT-I/II antibody was from Dako (E9). Anti-HA antibody and Protein A/G Plus–agarose beads were purchased from Santa Cruz Biotechnology. Anti-Myc antibody was from Cell Signaling Technology. Mouse GST (glutathione transferase) antibody was purchased from MBL (Medical and Biological Laboratories Co.). Anti-vinculin antibody (MH24) was from the Developmental Studies Hybridoma Bank. Glutathione–Sepharose 4B, Superdex G-200 and PreScission protease were from Amersham Pharmacia Biotech. The transfection reagent VigoFect was purchased from Vigorous and Lipofectamine™ 2000 was from Invitrogen. PN and decomposed PN were Upstate Biotechnology products. G418, Hygromycin B, and Hoechst 33342 were from Invitrogen. ATP, ADP, PCr and AMP were from Ameresco. All other chemicals were of analytical grade.

Antibody preparation

MT3 antibody was produced following the procedure of Garrett et al. [18]. Mouse BB-CK antibody was generated using full-length recombinant protein following standard procedures. All polyclonal antibodies were subjected to an affinity-purification process and the specificities were confirmed by Western blotting.

Yeast two-hybrid screening

The yeast two-hybrid screening was performed using the same protocol as that described previously [19].

Protein expression and purification

Human MM-CK and BB-CK were cloned, overexpressed and purified as described previously [20]. The coding sequence of hMT2A and hMT3 (human MT-III) was cloned into pGEX 6P-1 (Amersham Biosciences). The GST-tagged proteins were purified on a glutathione–Sepharose 4B column according to standard protocols. PreScission protease was used to release the recombinant hMT2A and hMT3. The proteins were further separated by a Superdex G-200 gel filtration column. The concentrations of CK, GST–hMT2A and GST–hMT3 were determined by the Bradford method [21], whereas the concentrations of hMT2A and hMT3 were determined using Ellman's reagent {DTNB [5,5′-dithiobis-(2-nitrobenzoic acid)]} in 3 M GdnHCl as described previously [22].

GST-pulldown assay

The GST-pulldown assay was performed in 500 μl of binding solution (20 mM Mops, pH 7.0, 25 mM NaCl, 0.2% NP-40 and 10% glycerol) with 10 μl of washed glutathione beads, 75 μg of MM-CK or BB-CK, and 100 μg of GST, GST–hMT2A or GST–hMT3 fusion proteins. After incubating for 6 h at 4°C, the beads were carefully rinsed three times using the binding solution. The products were analysed by Western blotting using the anti-GST, anti-MM-CK and anti-BB-CK antibodies.

Cell culture

HEK (human embryonic kidney)-293T, CHO (Chinese-hamster ovary) and H9c2 cell lines (A.T.C.C.) were maintained in DMEM (Dulbecco's modified Eagle's medium; Gibco) with 10% FBS (fetal bovine serum; Gibco). U-87 MG (human brain glioblastoma–astrocytoma cell line; A.T.C.C.) cells were cultured in MEM (minimal essential medium; Gibco) supplemented with 10% FBS. Cells were maintained in 5% CO2/95% air at 37°C in a humidified incubator.

Co-IP (co-immunoprecipitation) assays

The coding sequences of hMT2A, hMT3, MM-CK and BB-CK were subcloned into pcDNA3.1 (Invitrogen) containing Myc or FLAG tags (substitution of Myc tag with FLAG tag in the pcDNA3.1-Myc-His plasmid). The co-IP assay was performed following the protocol described previously [19]. The IP lysis buffer contained 20 mM Mops, pH 7.0, 25 mM NaCl, 1% NP-40, 10% glycerol, 1 mM PMSF and 1 μg/ml leupeptin. Both supernatants and pellets of the cell lysates were examined by immunoblotting using anti-FLAG and anti-Myc antibodies.

Establishment of stable transfectants

H9c2 was transfected either with Myc–hMT2A or with pcDNA3.1 control vector using Lipofectamine™ 2000 and selected with 500 μg/ml G418. Stable down-regulation of endogenous hMT3 expression was conducted by siRNA. The target site within the hMT3 gene was from a previous study [23]. The oligonucleotides encoding the hMT3 shRNA (small hairpin RNA) were as follows: 5′-GATCCATGCACCTCCTGCAAGAAGTTCAAGAGACTTCTTGCAGGAGGTGCATTTTTTTGGAAA-3′ (sense); and 5′-AGCTTTTCCAAAAAAATGCACCTCCTGCAAGAAGTCTCTTGAACTTCTTGCAGGAGGTGCATG-3′ (antisense). The shRNA oligonucleotides were cloned into the linearized vector pSilencer hygro (Ambion) and then transfected into U-87 MG cells using Lipofectamine™ 2000. The pSilencer hygro negative control plasmid was as supplied within the kit (Ambion). The cells were placed under selective pressure in medium containing 0.025 mg/ml Hygromycin B for 15–20 days. The expression of hMT2A or the specificity and efficiency of the knockdown were verified by semi-quantitative RT (reverse transcription)–PCR and Western blot analysis.

RNA isolation and RT–PCR

RNA extraction from cells was conducted using a Qiagen RNA extraction kit. A 1 μg portion of the total RNA was reverse-transcribed using an M-MLV (Moloney murine leukaemia virus) cDNA synthesis system (Invitrogen), and the reverse-transcribed DNA was subjected to PCR. The primers were as follows: MM-CK forward, 5′-GGGCTACACGTTGCCCCCAC-3′, and MM-CK reverse, 5′-ACGCAGGCGGGTGAGGATCT-3′, designed to amplify a 535 bp region; BB-CK forward, 5′-GCCCATCCAACCTGGGCACC-3′, and BB-CK reverse, 5′-CCCTGCTCCAGCCGCTGTTC-3′, designed to amplify a 262 bp region; hMT2A forward, 5′-ATGGATCCCAACTGCTCCTGC-3′, and hMT2A reverse, 5′- TCAGGCGCAGCAGCTGCACTT -3′, which amplified a 186 bp product; hMT3 forward, 5′-CCGTTCACCGCCTCCAG-3′, and hMT3 reverse, 5′-CACCAGCCACACTTCACCACA-3′, which amplified a 325 bp product. Rat MT-I and MT-II, hMT-I and hMT-II were designed as decribed in previous studies [23,24]. 18S rRNA forward, 5′-CAGCCACCCGAGATTGAGCA-3′, and 18S rRNA reverse, 5′-TAGTAGCGACGGGCGGTGTG -3′, were designed to amplify a 252 bp region.

PN, SIN-1 and SNAP treatment

PN was quantified spectrophotometrically prior to experimentation (extinction coefficient at 302 nm=1670 M−1·cm−1) [25]. Stimulation of cells with PN was performed as described previously [26]. Control experiments were conducted by exposing the cells to decomposed PN. The CK enzymes treated with given concentrations of PN with or without 10 μM purified hMT2A or hMT3 were incubated at 25°C for 10 min, and then the enzyme activities were measured. MM-CK or BB-CK was incubated with 20 μM SIN-1 in the presence or absence of 10 μM hMT2A or hMT3 at 25°C. Time-course inactivation was obtained by measuring the residual activity of a 10 μl sample at given time intervals. SNAP was diluted in PBS buffer (pH 7.4) and the concentration was determined spectrophotometrically with an extinction coefficient at 335 nm of 519 M−1·cm−1 [27] just before use. The CK enzymes were incubated with SNAP in the presence or absence of 10 μM hMT2A or hMT3 at 25°C for 10 min and then their activities were measured.

MS analysis

MM-CK and BB-CK were treated with increasing concentrations of PN (0, 10, 50 and 100 μM), subjected to SDS/PAGE (10% gel) and digested by adding trypsin at an enzyme/protein ratio of 1:100. Mass spectra were performed using standard procedures on an LTQ orbitrap Velos mass spectrometer (Thermo Fisher Scientific).

CK activity

The activity of purified CK was measured using the standard pH-colorimetry method at 25°C [28]. CK activity of cell lysates was measured using a coupled enzyme reaction system [29]. All of the measurements were performed on a PerkinElmer Life Sciences Lambda Bio UV spectrophotometer. The activity data were the average of at least three results and were normalized by the total cell protein concentrations determined by the Lowry method [30].

Re-activation and aggregation during CK refolding

MM-CK or BB-CK with a final concentration of 484 μM was denatured for 1 h in 3 M GdnHCl at 25°C. Refolding was initiated by a fast 121-fold dilution of the denatured enzyme into the refolding buffer (30 mM Tris/HCl buffer, pH 8.0). Time-course re-activation was performed by measuring the recovered activity of 10 μl of sample taken at given time intervals using the pH-colorimetry method. Protein aggregation was monitored by recording the turbidity at 400 nm on a PerkinElmer Life Sciences Lambda Bio UV spectrophotometer at 25°C. All measurements were repeated at least three times.

Renilla luciferase activity

The Renilla luciferase expression plasmid RL-TK (Promega; 1 μg) was co-transfected with FLAG–MM-CK or FLAG–BB-CK (20 μg) into the H9c2 or U-87 MG stable transfectants. A dual-luciferase assay was performed according to the protocol of the Dual-Lucy Assay kit (Vigorous).

Antioxidant enzyme determination

The total SOD (MnSOD and Zn/CuSOD) activity in the cell lysates was measured by the pyrogallol auto-oxidation assay according to a procedure described previously [31]. One SOD unit is defined as the amount that reduces the pyrogallol auto-oxidation rate by 50%. The GSH-Px (glutathione peroxidase) activity was assayed according to the procedure described elsewhere with a slight modification [32]. The consumption rate of NADPH at 25°C was monitored at 340 nm in the presence of 0.07 units of glutathione reductase, 2 mM GSH and 0.3 mM tert-BuOOH. One unit is defined as the amount of enzyme required to consume 1 μM NADPH in 1 min. The activities were normalized to the cell protein contents.

Immunofluorescence staining

CHO cells were seeded on glass coverslips and transfected with 1 μg of GFP–MM-CK (GFP is green fluorescent protein) (or GFP–BB-CK) and 4 μg of Myc–hMT2A (or Myc–hMT3) using Lipofectamine™ 2000. H9c2 and U-87 MG stable transfectants were seeded on collagen-coated coverslips and transfected with 4 μg of FLAG–MM-CK or FLAG–BB-CK. After 21 h of incubation, cells were treated with decomposed PN or 750 μM PN for 30 min, and recovered in growth medium for 5 h. Subsequently, the cells were subjected to fixing in methanol (−20°C) for 3 min and blocking in PBS buffer containing 10% goat serum for 1 h. Immunostaining was carried out using anti-Myc (1:2000 dilution) or anti-FLAG (1:1000 dilution) antibody. The nuclei were counterstained with Hoechst 33342. Images were obtained with a Carl Zeiss LSM 710 confocal microscope system.

Immunohistochemistry assay

For preparation of skeletal muscle paraffin sections, the mouse soleus muscle was dissected from the hind limbs. Animal experimentation was conducted in the animal facility of Tsinghua University and approved by the Institutional Animal Care and Use Committee of Tsinghua University. The mouse skeletal muscle sections and human normal brain transverse slides (ChaoYing Biotechnology Co. Ltd) were manipulated and immunostained following procedures described previously [19]. For muscle tissue sections, double-staining was carried out overnight with rabbit anti-MM-CK antibody (1:100 dilution) and mouse E9 antibody against MT-I/II or anti-vinculin antibody (MH24) at a 1:100 dilution. For human normal brain sections, mouse anti-BB-CK antibody and rabbit antibody against MT3 were applied at a 1:100 dilution.

Statistical analysis

Statistical analysis was performed using GraphPad Prism software. The unpaired two-tailed Student's t test was used to compare the sets of data assuming a Gaussian distribution, and a P value less than 0.05 was considered significant.

RESULTS

MTs interact with cytosolic CKs

In yeast two-hybrid screening, four colonies could grow well on a −Ade/−Leu/−Trp/−His plate, which was further confirmed by α-galactosidase assay (Figure 1A). The cDNA from the colonies was identified by sequencing to encode the whole coding sequence of hMT2A. Since MM-CK and BB-CK are highly homologous, we further investigated whether the binding of MTs to cytosolic CKs was general or isoform-specific by reciprocal co-IP assays in HEK-293T cells. As shown in Figure 1(B), both hMT2A and hMT3 co-precipitated with either MM-CK or BB-CK. The same results were obtained when co-IP was performed in the opposite direction (Figure 1C). A GST-pulldown assay (Figure 1D) indicated that both hMT2A and hMT3 could pull down MM-CK or BB-CK. Considering the tissue distributions of the proteins, we mainly focused on two pairs of interaction with physiological relevance, MM-CK–hMT2A and BB-CK–hMT3.

Identification of the interaction between MM-CK, BB-CK, and hMT2A and hMT3

Figure 1
Identification of the interaction between MM-CK, BB-CK, and hMT2A and hMT3

(A) Interaction between MM-CK and hMT2A identified by yeast two-hybrid assay. The four positive clones (clones 2, 25, 31 and 37), which contain MM-CK and hMT2A genes, grow in the stringent selective −Ade/−Leu/−Trp/−His plates and show a positive X-α-Gal (5-bromo-4-chloroindol-3-yl α-D-galactopyranoside) blue colouration. The yeast cells with MM-CK and a non-specific prey protein (NSP) or the bait gene MM-CK alone were used as the control. (B) Confirmation of the interaction between MTs and CKs by co-IP in HEK-293T cells. IB, immunoblot using anti-FLAG antibody (top panel); IP, immunoprecipitation using anti-FLAG-tag antibodies. A Myc-specific antibody was used to detect the presence of Myc–hMT2A or Myc–hMT3 co-immunoprecipitated in the pellets (middle panel) or the total cell lysates (TCL, bottom panel). The asterisk indicates the Ig light chain. (C) Co-IP assay conducted in the opposite direction. IP was carried out using antibodies against the Myc tag. The asterisk indicates the Ig heavy chain. (D) Protein interaction confirmed by GST-pulldown assay. IB was performed by using the anti-MM-CK or anti-BB-CK antibodies to detect the CK proteins precipitated in the pellets (top panels), and the GST-specific antibody to detect the existence of GST, GST–hMT2A or GST–hMT3 fusion proteins (bottom panel). The asterisk indicates GST. (E) Co-localization of the proteins in tissues. a–c, immunohistochemistry assays were performed in longitudinal and transverse sections of mouse skeletal muscles, which were co-stained with anti-MM-CK antibody (green) and anti-MT-I/II (E9) or anti-vinculin (MH24) antibodies (red). In the high-magnification images, the arrowheads indicate the staining in the I-band and the arrows point to the staining along the sarcolemma region. d–e, double staining for BB-CK and MT3 in human normal brain sections was conducted with anti-BB-CK (red) and anti-MT3 (green) antibody. Merged and high-magnification images are shown. Arrows indicate the BB-CK- and MT3-positive cells. The adjacent serial sections were stained with haematoxylin and eosin (H&E) to demonstrate the shape and size of tissue cells. Scale bars: a and c, 10 μm; b and e, 20 μm; d, 50 μm; high-magnification images in d and e, 10 μm.

Figure 1
Identification of the interaction between MM-CK, BB-CK, and hMT2A and hMT3

(A) Interaction between MM-CK and hMT2A identified by yeast two-hybrid assay. The four positive clones (clones 2, 25, 31 and 37), which contain MM-CK and hMT2A genes, grow in the stringent selective −Ade/−Leu/−Trp/−His plates and show a positive X-α-Gal (5-bromo-4-chloroindol-3-yl α-D-galactopyranoside) blue colouration. The yeast cells with MM-CK and a non-specific prey protein (NSP) or the bait gene MM-CK alone were used as the control. (B) Confirmation of the interaction between MTs and CKs by co-IP in HEK-293T cells. IB, immunoblot using anti-FLAG antibody (top panel); IP, immunoprecipitation using anti-FLAG-tag antibodies. A Myc-specific antibody was used to detect the presence of Myc–hMT2A or Myc–hMT3 co-immunoprecipitated in the pellets (middle panel) or the total cell lysates (TCL, bottom panel). The asterisk indicates the Ig light chain. (C) Co-IP assay conducted in the opposite direction. IP was carried out using antibodies against the Myc tag. The asterisk indicates the Ig heavy chain. (D) Protein interaction confirmed by GST-pulldown assay. IB was performed by using the anti-MM-CK or anti-BB-CK antibodies to detect the CK proteins precipitated in the pellets (top panels), and the GST-specific antibody to detect the existence of GST, GST–hMT2A or GST–hMT3 fusion proteins (bottom panel). The asterisk indicates GST. (E) Co-localization of the proteins in tissues. a–c, immunohistochemistry assays were performed in longitudinal and transverse sections of mouse skeletal muscles, which were co-stained with anti-MM-CK antibody (green) and anti-MT-I/II (E9) or anti-vinculin (MH24) antibodies (red). In the high-magnification images, the arrowheads indicate the staining in the I-band and the arrows point to the staining along the sarcolemma region. d–e, double staining for BB-CK and MT3 in human normal brain sections was conducted with anti-BB-CK (red) and anti-MT3 (green) antibody. Merged and high-magnification images are shown. Arrows indicate the BB-CK- and MT3-positive cells. The adjacent serial sections were stained with haematoxylin and eosin (H&E) to demonstrate the shape and size of tissue cells. Scale bars: a and c, 10 μm; b and e, 20 μm; d, 50 μm; high-magnification images in d and e, 10 μm.

The association of MM-CK with MT2A, as well as that of BB-CK with MT3, was further investigated in mouse skeletal muscles. In longitudinal sections of skeletal muscles (Figure 1E, a), MT-I and MT-II demonstrated a transverse banding pattern and staining along the periphery of the fibre at the sarcolemma. MM-CK mainly localized at the I-band of adjacent sarcomeres and the flanking area, which is consistent with that described previously [33]. MM-CK also localized along the sarcolemma region. In transverse sections (Figure 1E, b), MTs and MM-CK were mainly localized at the sarcolemma and in the cytoplasm. MM-CK and MTs overlapped with each other at the I-band in longitudinal sections (indicated by an arrowhead) and at the sarcolemma in both sections (indicated by arrows). Sections were further co-stained with MM-CK and vinculin, a marker protein in the I-band. The results (Figure 1E, c) suggested that MM-CK localized in the I-band, although the staining pattern appeared broader than vinculin. The human normal brain sections were employed to investigate the co-localization of BB-CK and MT3. As shown in Figure 1(E, d and e), the cells with high BB-CK immunoreactivity also show positive staining of MT3 (indicated by arrows), indicating that the two proteins co-existed well with each other.

MT prevents CK from PN- or NO-induced inactivation in vitro

Purified MM-CK and BB-CK was bolus-administered with authentic PN (0.5–320 μM) with or without 10 μM purified hMT2A or hMT3. As shown in Figure 2(A), PN caused a concentration-dependent inhibition of CKs with an IC50 of 19.2 μM for MM-CK and 14.6 μM for BB-CK. MS analysis (see Supplementary Figure S1 at http://www.BiochemJ.org/bj/441/bj4410623add.htm) suggested that the inactivation was associated with the nitration of Trp228 in both MM-CK and BB-CK, which was essential for CK activity [2]. Tyr14 and Tyr20, which are isoenzyme-specific residues in MM-CK, were also modified by nitration. However, the N-terminus of CK is far away from the active site and the modification seems to contribute little to the inactivation induced by PN. Pre-treatment of CKs with 10 μM hMT2A or hMT3 significantly reduced the rate of CK inactivation by increasing the IC50 ~2-fold and ~5-fold respectively. Similar protection effects were observed for CK inactivation induced by the other two nitrogen-based oxidants, SIN-1 and SNAP (see Supplementary Figure S2 at http://www.BiochemJ.org/bj/441/bj4410623add.htm). According to a previous observation, 100 μM SNAP produces approximately 1.4 μM NO per min and follows a linear relationship over a wide SNAP concentration range [34]. Thus the IC50 values for NO-induced CK inactivation could be calculated to be 15.4 μM for MM-CK and 12.6 μM for BB-CK respectively. The addition of MTs to the SNAP-inactivated CK solutions could partially re-activate the NO-inactivated CK activity (Supplementary Figure 2B), whereas the post-treatment of PN-inactivated CKs with MTs could not (results not shown).

Effects of MTs on MM-CK and BB-CK inactivation induced by PN

Figure 2
Effects of MTs on MM-CK and BB-CK inactivation induced by PN

A 0.2 mg/ml concentration of MM-CK (A) or BB-CK (B) was exposed to bolus administration of PN (0.5–320 μM) in the absence (●) or presence of 10 μM hMT2A (Δ) or hMT3 (■). Results are presented as means±S.D. (n≥3).

Figure 2
Effects of MTs on MM-CK and BB-CK inactivation induced by PN

A 0.2 mg/ml concentration of MM-CK (A) or BB-CK (B) was exposed to bolus administration of PN (0.5–320 μM) in the absence (●) or presence of 10 μM hMT2A (Δ) or hMT3 (■). Results are presented as means±S.D. (n≥3).

MT protects CK against PN-induced oxidative stress in cells

We used stable cell lines to further verify the protective effects of MTs on CK inactivation by nitrogen-based oxidants. The H9c2 cell, an immortalized rat myoblast cell line containing the lowest level of MTs and a high MM-CK level compared with that from the other tissues [24,35], was used to establish a stable hMT2A-overexpressing cell line. U-87 MG, a human brain glioblastoma–astrocytoma cell line with high expression levels of hMT3 and BB-CK, was used for the hMT3-knockdown analysis. The quality of the stable transfectants was evaluated by the MT expression level (Figures 3A and 4A), the maximal preservation of the wild-type morphology and the cell growth (results not shown). PN treatment did not significantly affect the endogenous rat MT-I and MT-II levels in H9c2 cells (Figure 3B) or the endogenous hMT-II and hMT3 content in U-87 MG cells (Figure 4B). Meanwhile, the overexpression of hMT2A or the down-regulation of hMT3 did not affect the activities of the other endogenous antioxidant enzymes, such as SOD and GSH-Px (see Supplementary Table S1 at http://www.BiochemJ.org/bj/441/bj4410623add.htm).

hMT2A protected MM-CK against PN in H9c2 stable lines

Figure 3
hMT2A protected MM-CK against PN in H9c2 stable lines

(A) Confirmation of hMT2A expression in the H9c2 stable line by RT–PCR. Total RNA was isolated from empty-vector-transfected cells (pcDNA3.1) and hMT2A-transfected stable lines (MT2A-1–MT2A-4). mRNA levels were evaluated by semi-quantitative RT–PCR using the hMT2A-specific primer for 35 cycles and 18S rRNA for 15 cycles. (B) Endogenous rat MT-I and MT-II expression under PN treatment. H9c2-pcDNA3.1 and H9c2-MT2A-2 stable cell lines were bolus-administered PN (0–750 μM) for 20 min. mRNA levels were tested by semi-quantitative RT–PCR using the rat MT-I, MT-II and 18S rRNA primers. (C and D) CK (C) and Renilla luciferase (D) activity under PN stress. FLAG–MM-CK (20 μg) was transiently co-transfected with RL-TK plasmid (1 μg) into the H9c2 stable transfectants. After treatment for 20 min with PN at the concentrations shown and replacement into DMEM for 5 h, cells were harvested, aliquotted and subjected to total protein quantification. A 50 μg portion of total cell lysates were used for measuring CK activity and luciferase activity respectively. Results are presented as means±S.D. (n≥3). *P<0.05. (E) H9c2 stable cell lines were treated as described in (C and D). mRNA levels of MM-CK were tested using the MM-CK-specific primer. A 50 μg portion of the total protein was used for Western blot analysis. Anti-Myc and anti-FLAG antibodies were used to detect the hMT2A and MM-CK expression respectively. The detection of β-actin was used as the loading control.

Figure 3
hMT2A protected MM-CK against PN in H9c2 stable lines

(A) Confirmation of hMT2A expression in the H9c2 stable line by RT–PCR. Total RNA was isolated from empty-vector-transfected cells (pcDNA3.1) and hMT2A-transfected stable lines (MT2A-1–MT2A-4). mRNA levels were evaluated by semi-quantitative RT–PCR using the hMT2A-specific primer for 35 cycles and 18S rRNA for 15 cycles. (B) Endogenous rat MT-I and MT-II expression under PN treatment. H9c2-pcDNA3.1 and H9c2-MT2A-2 stable cell lines were bolus-administered PN (0–750 μM) for 20 min. mRNA levels were tested by semi-quantitative RT–PCR using the rat MT-I, MT-II and 18S rRNA primers. (C and D) CK (C) and Renilla luciferase (D) activity under PN stress. FLAG–MM-CK (20 μg) was transiently co-transfected with RL-TK plasmid (1 μg) into the H9c2 stable transfectants. After treatment for 20 min with PN at the concentrations shown and replacement into DMEM for 5 h, cells were harvested, aliquotted and subjected to total protein quantification. A 50 μg portion of total cell lysates were used for measuring CK activity and luciferase activity respectively. Results are presented as means±S.D. (n≥3). *P<0.05. (E) H9c2 stable cell lines were treated as described in (C and D). mRNA levels of MM-CK were tested using the MM-CK-specific primer. A 50 μg portion of the total protein was used for Western blot analysis. Anti-Myc and anti-FLAG antibodies were used to detect the hMT2A and MM-CK expression respectively. The detection of β-actin was used as the loading control.

Down-regulation of hMT3 affected BB-CK under PN treatment in U-87 MG stable lines

Figure 4
Down-regulation of hMT3 affected BB-CK under PN treatment in U-87 MG stable lines

(A) Confirmation of hMT3 knockdown in U-87 MG cells. U-87 MG cells were transfected with the pSilencer hygro negative-control plasmid (psilencer) or hMT3-specific siRNA oligonucleotides inserted into pSilencer hygro plasmid (MT3-1–MT3-3). Semi-quantitative RT–PCR was conducted using the hMT3- and 18S rRNA-specific primers. (B) Endogenous human MT-II and MT3 expression under PN treatment. mRNA levels were tested using the human MT-II, MT3 and 18S rRNA primers. (C and D) CK (C) and Renilla luciferase (D) activity under PN stress. Cell treatment and enzyme activity measurement were conducted as described for Figures 3(C) and 3(D). Results are presented as means±S.D. (n≥3). *P<0.05. (E) U-87 MG stable cell lines were treated as described for Figures 3(C) and 3(D). BB-CK and 18S rRNA were amplified by RT–PCR. The hMT3 and BB-CK protein expression levels were evaluated by using anti-hMT3 and anti-FLAG antibodies.

Figure 4
Down-regulation of hMT3 affected BB-CK under PN treatment in U-87 MG stable lines

(A) Confirmation of hMT3 knockdown in U-87 MG cells. U-87 MG cells were transfected with the pSilencer hygro negative-control plasmid (psilencer) or hMT3-specific siRNA oligonucleotides inserted into pSilencer hygro plasmid (MT3-1–MT3-3). Semi-quantitative RT–PCR was conducted using the hMT3- and 18S rRNA-specific primers. (B) Endogenous human MT-II and MT3 expression under PN treatment. mRNA levels were tested using the human MT-II, MT3 and 18S rRNA primers. (C and D) CK (C) and Renilla luciferase (D) activity under PN stress. Cell treatment and enzyme activity measurement were conducted as described for Figures 3(C) and 3(D). Results are presented as means±S.D. (n≥3). *P<0.05. (E) U-87 MG stable cell lines were treated as described for Figures 3(C) and 3(D). BB-CK and 18S rRNA were amplified by RT–PCR. The hMT3 and BB-CK protein expression levels were evaluated by using anti-hMT3 and anti-FLAG antibodies.

For both the H9c2 (Figure 3C) and U-87 MG (Figure 4C) cells, PN treatment resulted in a dramatic decrease in CK activity when the hMT2A or hMT3 level was low, whereas no significant change was observed, even on treatment with 750 μM PN, when the MT level was high. As a control, the Renilla luciferase activity did not change on treatment with various concentrations of PN in all of the stable transfectants (Figures 3D and 4D). Semi-quantitative RT–PCR results revealed that the mRNA level of the cytosolic CK was not influenced under the present conditions (Figures 3E and 4E). However, the amounts of the CK proteins decreased in a PN-concentration-dependent manner in cells with a low MT level, but remained constant in cells with a high MT level. These results indicate that the cytosolic CK activity and protein level were closely correlated with the amounts of hMT2A or hMT3 in cells.

MT co-localizes with CK aggregates in cells and prevents it from aggregation in cells and in vitro

The co-localization of MT with CK was investigated by an immunofluorescence assay in CHO cells. As shown in Figure 5(A, a and c), the cytosolic CKs (green) mainly localized in the cytoplasm, whereas MTs (red) were distributed in both the nucleus and the cytoplasm. When the cells were treated with 750 μM PN, approximately 40% of the transfected cells had an alteration in the distribution patterns of the overexpressed proteins (Figure 5A, b and d). In these cells, CKs formed several granule-like structures. Meanwhile, hMT2A or hMT3 exhibited a similar distribution pattern with some dense staining in granular forms and faint nuclear staining. CKs and MTs co-localized well with each other in the granules (indicated by arrows), suggesting that MT might play a role in response of CK under stress. To quantitatively reflect the effect of MTs on CK stabilization, the number of CK aggregate-positive cells was determined in both H9c2 and U-87 MG stable transfectants. In the H9c2 stable line, the overexpression of hMT2A efficiently suppressed the formation of MM-CK aggregate-like structures upon PN administration (Figure 5B), whereas in U-87 MG cells, the downregulation of the endogenous hMT3 significantly increased the number of BB-CK aggregate-positive cells under the stress of 750 μM PN (Figure 5C).

MTs co-localized with CK aggregates in CHO cells, and MT expression level affected CK aggregate formation in H9c2 and U-87 MG cells

Figure 5
MTs co-localized with CK aggregates in CHO cells, and MT expression level affected CK aggregate formation in H9c2 and U-87 MG cells

(A) Immunostaining of cytosolic CKs and MTs in CHO cells. CHO cells were co-transfected with GFP–MM-CK and Myc–hMT2A (a and b) or GFP–BB-CK and Myc–hMT3 (c and d). After administration of control (degraded PN) or 750 μM PN, cells were stained to recognize hMT2A (red), MM-CK (green) and nuclei (Hoechst 33342, blue). In approximately 40% of the PN-treated cells, CKs and MTs formed granule-like structures and co-localized with each other (indicated by arrows). Scale bar, 5 μm. (B) Suppression of MM-CK aggregation formation in H9c2 hMT2A-overexpressing cells. The H9c2-MT2A-2 and negative-control stable lines were transfected with FLAG–MM-CK and treated with degraded PN or 750 μM PN. Results are means±S.D. of three independent experiments, in which the number of aggregate-positive cells was analysed by counting 200 transfected cells of each experiment. (C) Down-regulation of hMT3 in U-87 MG cells increased the BB-CK aggregate-positive cell numbers. The stable clones U87-MT3-1 and the negative control U87-psilencer were transfected with FLAG–BB-CK and manipulated as described above. Results are means±S.D. *P<0.05.

Figure 5
MTs co-localized with CK aggregates in CHO cells, and MT expression level affected CK aggregate formation in H9c2 and U-87 MG cells

(A) Immunostaining of cytosolic CKs and MTs in CHO cells. CHO cells were co-transfected with GFP–MM-CK and Myc–hMT2A (a and b) or GFP–BB-CK and Myc–hMT3 (c and d). After administration of control (degraded PN) or 750 μM PN, cells were stained to recognize hMT2A (red), MM-CK (green) and nuclei (Hoechst 33342, blue). In approximately 40% of the PN-treated cells, CKs and MTs formed granule-like structures and co-localized with each other (indicated by arrows). Scale bar, 5 μm. (B) Suppression of MM-CK aggregation formation in H9c2 hMT2A-overexpressing cells. The H9c2-MT2A-2 and negative-control stable lines were transfected with FLAG–MM-CK and treated with degraded PN or 750 μM PN. Results are means±S.D. of three independent experiments, in which the number of aggregate-positive cells was analysed by counting 200 transfected cells of each experiment. (C) Down-regulation of hMT3 in U-87 MG cells increased the BB-CK aggregate-positive cell numbers. The stable clones U87-MT3-1 and the negative control U87-psilencer were transfected with FLAG–BB-CK and manipulated as described above. Results are means±S.D. *P<0.05.

To elucidate whether MT plays a role in the inhibition of CK aggregation from misfolded proteins, in vitro aggregation assays were carried out by using thermal- and chemical denaturant-induced aggregation as models. The thermal aggregation of the cytosolic CKs was similar to that reported previously [36], and the addition of hMT2A or hMT3 did not affect the rate or extent of CK thermal aggregation (results not shown). Similar to rabbit MM-CK, extensive aggregation occurred during the renaturation of human MM-CK from the GdnHCl-denatured state [37], but no detectable aggregates were formed during the dilution-initiated refolding of BB-CK (results not shown). By adding hMT2A (Figure 6A, left-hand panel) or hMT3 (Figure 6A, right-hand panel) into the refolding buffer, the aggregation of MM-CK was dramatically suppressed in a concentration-dependent manner. As a control, the effect of GST was insignificant on MM-CK aggregation. EDTA alone did not affect the aggregation extent of CK (Figure 6B), whereas combined addition of MT3 and 10 μM EDTA decreased the aggregation-inhibition ability of MT3. This might be due to the higher binding affinity of the metal ions with EDTA than MT. The addition of both Zn2+ and MT3 also slightly increased CK aggregation when compared with addition of MT3 alone.

MTs prevented MM-CK from aggregation and assisted re-activation of CKs in vitro

Figure 6
MTs prevented MM-CK from aggregation and assisted re-activation of CKs in vitro

(A) Effect of hMT2A and hMT3 on the aggregation of GdnHCl-denatured MM-CK. MM-CK was completely denatured in 3 M GdnHCl and refolded by dilution into 30 mM Tris/HCl buffer (pH 8.0). The aggregation process during refolding was monitored by recording the turbidity at 400 nm. GST (24 μM) was used as a control of MTs. The molar ratios of hMT2A (left-hand panel) or hMT3 (right-hand panel) to MM-CK were 0 (■), 2 (○), 4(▲) and 6 (▼) respectively. (B) Effect of EDTA and ZnCl2 on the aggregation of MM-CK. The molar ratios of hMT3 to MM-CK were 0 (■) and 4 (∇) respectively. The final concentrations of EDTA and ZnCl2 were 10 μM. (C) Effect of hMT2A on the re-activation of MM-CK denatured by GdnHCl. MM-CK was denatured and re-activated as described in (A). The molar ratios of hMT2A to MM-CK were 0 (■), 2 (○), 4 (▲) and 6 (∇) respectively. The right-hand panel indicates a hMT2A to MM-CK molar ratio of 6:1 most significantly re-activated MM-CK. (D) Effect of hMT3 on the re-activation of BB-CK denatured by GdnHCl. The same procedures as in (C) were performed. The molar ratios of hMT3 to BB-CK were 0 (■), 2 (○) and 4 (▲), respectively. The right-hand panel shows that BB-CK re-activated to its highest level when the molar ratio of hMT3 to BB-CK was 4:1. All results are presented as means±S.D.

Figure 6
MTs prevented MM-CK from aggregation and assisted re-activation of CKs in vitro

(A) Effect of hMT2A and hMT3 on the aggregation of GdnHCl-denatured MM-CK. MM-CK was completely denatured in 3 M GdnHCl and refolded by dilution into 30 mM Tris/HCl buffer (pH 8.0). The aggregation process during refolding was monitored by recording the turbidity at 400 nm. GST (24 μM) was used as a control of MTs. The molar ratios of hMT2A (left-hand panel) or hMT3 (right-hand panel) to MM-CK were 0 (■), 2 (○), 4(▲) and 6 (▼) respectively. (B) Effect of EDTA and ZnCl2 on the aggregation of MM-CK. The molar ratios of hMT3 to MM-CK were 0 (■) and 4 (∇) respectively. The final concentrations of EDTA and ZnCl2 were 10 μM. (C) Effect of hMT2A on the re-activation of MM-CK denatured by GdnHCl. MM-CK was denatured and re-activated as described in (A). The molar ratios of hMT2A to MM-CK were 0 (■), 2 (○), 4 (▲) and 6 (∇) respectively. The right-hand panel indicates a hMT2A to MM-CK molar ratio of 6:1 most significantly re-activated MM-CK. (D) Effect of hMT3 on the re-activation of BB-CK denatured by GdnHCl. The same procedures as in (C) were performed. The molar ratios of hMT3 to BB-CK were 0 (■), 2 (○) and 4 (▲), respectively. The right-hand panel shows that BB-CK re-activated to its highest level when the molar ratio of hMT3 to BB-CK was 4:1. All results are presented as means±S.D.

The efficiency of CK re-activation was also greatly enhanced by the addition of MT. The refolding yield of MM-CK was enhanced approximately 2-fold at the optimal hMT2A concentration (Figure 6C), with an hMT2A/MM-CK molar ratio of 6:1, which was consistent with the aggregation results. To elucidate whether the increase in the activity recovery of CK was associated with the aggregation-blocking properties of MT, the effect of hMT3 on BB-CK re-activation was also examined (Figure 6D). Surprisingly, hMT3 could also increase the re-activation yield of BB-CK with an optimal molar ratio of 4:1, although no obvious aggregation occurred.

DISCUSSION

The formation of nitrogen-based oxidants in cells may have important physiological and pathological consequences. They are produced by a variety of mammalian cells, including endothelial cells, neutrophils and macrophages [38,39]. PN is formed during CHF and induces CK inactivation in a mouse model [5], and CK has been found to be among the S-nitrosylated proteins in the endogenous state [40]. These studies suggested that the oxidative or nitrative damage of CK has physiological or pathological importance. Previous studies have demonstrated that CK was susceptible to PN-induced oxidation and nitration [5] Consistently, we also found that the cytosolic CK was extremely sensitive to RNS in vitro and in cells. Using MS analysis, it was found that Trp228 of CK was nitrated by PN, which is compatible with enzyme inactivation due to the fact that Trp228 is an essential part of the binding pocket of CK substrates [2]. Mutagenesis of this residue was reported to lead to the inactivation of the enzyme [41]. Moreover, our results suggested that under high PN concentrations, the severely oxidized proteins may form large aggregates due to increased surface hydrophobicity. It seems that the inhibition of the CK system may be an early and initiating event in the energetic deficit and contractile dysfunction. Considering the high reactivity and short half-life of the RNS, the proximity between MTs and the production site of radicals or RNS-target proteins, which act as a protective system to exclude possible oxidative disturbance in normal tissues, may be physiologically significant.

A survey of the literature provided us with some clues in further understanding the physiological/pathological relevance of the protective effect of MTs on CKs. The main tissue in which MM-CK is distributed, the skeletal muscle, has been shown to have an increase in the production of ROS after exercise [42], which is accompanied by an up-regulation in MT-I and MT-II expression [43]. Moreover, a decrease in BB-CK activity and content in the AD brain correlates well with the hallmark of neurodegeneration in severely affected regions [44]. Concurrently, the lack of hMT3 in AD brains was associated with its contribution to the pathogenesis of this disease [45]. However, no data are available yet for the clinical relevance of CKs and MTs. The significance of the functional coupling of CKs and MTs might become clear if the level of both CKs and MTs could be monitored clinically in future disease-related research.

It is worth noting that cells also utilize small reduced reagents such as GSH (reduced glutathione) and CYS (free 1-cysteine) for redox balance to avoid damage of macromolecules. However, the rate constant for the reaction of MTs with hydroxyl radicals is more than 100-fold higher than that of GSH, and about 50-fold more effective in protecting DNA [46]. In addition, the substrates of well-characterized enzymatic antioxidants such as SOD and GSH-Px are specific and limited to the ROS types, whereas the MTs have a broad spectrum of ROS and RNS scavenging activity. In light of these observations, the close proximity of MTs and CKs provides a more effective and potent way to defend against both ROS and RNS than the above-mentioned small organic compounds and enzymatic antioxidants.

From a biophysical perspective, the most striking finding of the present study is that MTs could act as molecular chaperones to prevent the aggregation of CK and assist it to refold into its native state in a saturable manner. Although MTs have been proposed to have chaperone-like activity to assist the synthesis of metalloproteins [47], it mainly assists the folding of metalloproteins by acting as a metal reservoir. However, in the present study, metal is not essential for the structure and stability of CK. CK utilizes MgATP during catalysis, and low concentrations of zinc or copper impedes CK refolding by accelerating the aggregation pathway [37,48]. Thus it is impossible for MTs to act as a metal donor during CK refolding. Our results also indicated that the metal-binding property of MTs contributed little to its ability in inhibiting CK aggregation. The involvement of MTs in the misfolding pathway of CKs was also characterized in intact cells. Under a pathological concentration of PN, CKs formed aggregate-like structures in CHO cells, and a co-localization of the MTs in the aggregates could be clearly observed. A preliminary screen indicated that MTs could successfully suppress the aggregation during refolding of the GdnHCl-denatured χ-globulin and the DTT (dithiothreitol)-induced insulin aggregation (see Supplementary Figure S3 at http://www.BiochemJ.org/bj/441/bj4410623add.htm), but did not influence the aggregation of some proteins such as human and bovine carbonic anhydrase, lactate dehydrogenase and the DTT-induced κ-casein fibril formation. This implied that the chaperone activity of MTs might not be universal to all cytosolic proteins. It is unclear how MTs achieve their chaperone-like activity since they are rather small molecules when compared with well-characterized chaperones and foldases. It is worth noting that MTs could form larger granule-like structures in CHO cells, which implied that conformational or oligomeric state changes might occur for the chaperone-like activity of MTs. Lahti et al. [17] found that Hsp70 (heat-shock protein 70) and Hsp84 co-immunoprecipitated with MT-III together with BB-CK in a large macromolecular complex, which provided us with a clue that hMT3 might also co-operate with other chaperones to achieve its optimum function in vivo. The relatively modest effects of MTs in the in vitro experiments compared with the more dramatic effects in the cell-based studies also suggested that this might be the case in physiological conditions. Nonetheless, our results clearly indicated that MTs alone could prevent CK aggregation and facilitate its re-activation during refolding in vitro. Further research is needed to elucidate the underlying molecular mechanism of the chaperone-like activity of MTs.

Abbreviations

     
  • AD

    Alzheimer's disease

  •  
  • BB-CK

    brain-type creatine kinase

  •  
  • CHF

    congestive heart failure

  •  
  • CHO

    Chinese hamster ovary

  •  
  • CK

    creatine kinase

  •  
  • co-IP

    co-immunoprecipitation

  •  
  • DMEM

    Dulbecco's modified Eagle's medium

  •  
  • DTT

    dithiothreitol

  •  
  • FBS

    fetal bovine serum

  •  
  • GdnHCl

    guanidinium chloride

  •  
  • GFP

    green fluorescent protein

  •  
  • GSH-Px

    glutathione peroxidase

  •  
  • GST

    glutathione transferase

  •  
  • Hsp

    heat-shock protein

  •  
  • HEK

    human embryonic kidney

  •  
  • MM-CK

    muscle-type creatine kinase

  •  
  • MT

    metallothionein

  •  
  • hMT2A

    human MT-IIA

  •  
  • hMT3

    human MT-III

  •  
  • NP-40

    Nonidet P40

  •  
  • PCr

    phosphocreatine

  •  
  • PN

    peroxynitrite

  •  
  • RNS

    reactive nitrogen species

  •  
  • ROS

    reactive oxygen species

  •  
  • RT

    reverse transcription

  •  
  • SIN-1

    3-morpholinosydonimine

  •  
  • SNAP

    S-nitroso-N-acetyl-DL-penicillamine

  •  
  • SOD

    superoxide dismutase

AUTHOR CONTRIBUTION

Zhe Chen, Yong-Bin Yan and Hai-Meng Zhou conceived the study. Zhe Chen, Yong-Bin Yan and Hai-Meng Zhou designed the experiments. Zhe Chen, Tong-Jin Zhao, Xu-Hui Li, Fan-Guo Meng and Hang Mu performed the in vitro experiments. Zhe Chen and Jie Li performed the experiments in intact cells. Zhe Chen, Yong-Bin Yan and Hai-Meng Zhou analysed the data. Zhe Chen and Yong-Bin Yan wrote the paper.

FUNDING

This work was supported by the National Key Basic Research and Development (973) Program of China [grant numbers 2007CB914401 and 2010CB912402], the National Natural Science Foundation of China [grant numbers 30970635 and 31170732] and the Natural Science Foundation of Zhejiang Province [grant number Y2101329].

References

References
1
Wallimann
T.
Wyss
M.
Brdiczka
D.
Nicolay
K.
Eppenberger
H. M.
Intracellular compartmentation, structure and function of creatine kinase isoenzymes in tissues with high and fluctuating energy demands: the ‘phosphocreatine circuit’ for cellular energy homeostasis
Biochem. J.
1992
, vol. 
281
 (pg. 
21
-
40
)
2
McLeish
M. J.
Kenyon
G. L.
Relating structure to mechanism in creatine kinase
Crit. Rev. Biochem. Mol. Biol.
2005
, vol. 
40
 (pg. 
1
-
20
)
3
Mekhfi
H.
Veksler
V.
Mateo
P.
Maupoil
V.
Rochette
L.
Ventura-Clapier
R.
Creatine kinase is the main target of reactive oxygen species in cardiac myofibrils
Circ. Res.
1996
, vol. 
78
 (pg. 
1016
-
1027
)
4
Gross
W. L.
Bak
M. I.
Ingwall
J. S.
Arstall
M. A.
Smith
T. W.
Balligand
J. L.
Kelly
R. A.
Nitric oxide inhibits creatine kinase and regulates rat heart contractile reserve
Proc. Natl. Acad. Sci. U.S.A.
1996
, vol. 
93
 (pg. 
5604
-
5609
)
5
Mihm
M. J.
Coyle
C. M.
Schanbacher
B. L.
Weinstein
D. M.
Bauer
J. A.
Peroxynitrite induced nitration and inactivation of myofibrillar creatine kinase in experimental heart failure
Cardiovasc. Res.
2001
, vol. 
49
 (pg. 
798
-
807
)
6
Mihm
M. J.
Yu
F.
Weinstein
D. M.
Reiser
P. J.
Bauer
J. A.
Intracellular distribution of peroxynitrite during doxorubicin cardiomyopathy: evidence for selective impairment of myofibrillar creatine kinase
Br. J. Pharmacol.
2002
, vol. 
135
 (pg. 
581
-
588
)
7
Aksenov
M. Y.
Aksenova
M. V.
Butterfield
D. A.
Geddes
J. W.
Markesbery
W. R.
Protein oxidation in the brain in Alzheimer's disease
Neuroscience
2001
, vol. 
103
 (pg. 
373
-
383
)
8
Singh
N.
Dhalla
A. K.
Seneviratne
C.
Singal
P. K.
Oxidative stress and heart failure
Mol. Cell. Biochem.
1995
, vol. 
147
 (pg. 
77
-
81
)
9
Ferrante
R. J.
Andreassen
O. A.
Jenkins
B. G.
Dedeoglu
A.
Kuemmerle
S.
Kubilus
J. K.
Kaddurah-Daouk
R.
Hersch
S. M.
Beal
M. F.
Neuroprotective effects of creatine in a transgenic mouse model of Huntington's disease
J. Neurosci.
2000
, vol. 
20
 (pg. 
4389
-
4397
)
10
Beal
M. F.
Oxidative metabolism
Ann. N. Y. Acad. Sci.
2000
, vol. 
924
 (pg. 
164
-
169
)
11
Klivenyi
P.
Ferrante
R. J.
Matthews
R. T.
Bogdanov
M. B.
Klein
A. M.
Andreassen
O. A.
Mueller
G.
Wermer
M.
Kaddurah-Daouk
R.
Beal
M. F.
Neuroprotective effects of creatine in a transgenic animal model of amyotrophic lateral sclerosis
Nat. Med.
1999
, vol. 
5
 (pg. 
347
-
350
)
12
Nath
R.
Kumar
D.
Li
T.
Singal
P. K.
Metallothioneins, oxidative stress and the cardiovascular system
Toxicology
2000
, vol. 
155
 (pg. 
17
-
26
)
13
Cai
L.
Klein
J. B.
Kang
Y. J.
Metallothionein inhibits peroxynitrite-induced DNA and lipoprotein damage
J. Biol. Chem.
2000
, vol. 
275
 (pg. 
38957
-
38960
)
14
Thornalley
P. J.
Vasak
M.
Possible role for metallothionein in protection against radiation-induced oxidative stress. Kinetics and mechanism of its reaction with superoxide and hydroxyl radicals
Biochim. Biophys. Acta
1985
, vol. 
827
 (pg. 
36
-
44
)
15
Palmiter
R. D.
Findley
S. D.
Whitmore
T. E.
Durnam
D. M.
MT-III, a brain-specific member of the metallothionein gene family
Proc. Natl. Acad. Sci. U.S.A.
1992
, vol. 
89
 (pg. 
6333
-
6337
)
16
Quaife
C. J.
Findley
S. D.
Erickson
J. C.
Froelick
G. J.
Kelly
E. J.
Zambrowicz
B. P.
Palmiter
R. D.
Induction of a new metallothionein isoform (MT-IV) occurs during differentiation of stratified squamous epithelia
Biochemistry
1994
, vol. 
33
 (pg. 
7250
-
7259
)
17
Lahti
D. W.
Hoekman
J. D.
Tokheim
A. M.
Martin
B. L.
Armitage
I. M.
Identification of mouse brain proteins associated with isoform 3 of metallothionein
Protein. Sci.
2005
, vol. 
14
 (pg. 
1151
-
1157
)
18
Garrett
S. H.
Sens
M. A.
Shukla
D.
Nestor
S.
Somji
S.
Todd
J. H.
Sens
D. A.
Metallothionein isoform 3 expression in the human prostate and cancer-derived cell lines
Prostate
1999
, vol. 
41
 (pg. 
196
-
202
)
19
Chen
Z.
Zhao
T. J.
Li
J.
Gao
Y. S.
Meng
F. G.
Yan
Y. B.
Zhou
H. M.
Slow skeletal muscle myosin-binding protein-C (MyBPC1) mediates recruitment of muscle-type creatine kinase (CK) to myosin
Biochem. J.
2011
, vol. 
436
 (pg. 
437
-
445
)
20
Guo
S. Y.
Wang
Z.
Ni
S. W.
Wang
X. C.
Consequences of a six residual deletion from the N-terminal of rabbit muscle creatine kinase
Biochimie
2003
, vol. 
85
 (pg. 
999
-
1005
)
21
Bradford
M. M.
A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding
Anal. Biochem.
1976
, vol. 
72
 (pg. 
248
-
254
)
22
Riddles
P. W.
Blakeley
R. L.
Zerner
B.
Reassessment of Ellman's reagent
Methods Enzymol.
1983
, vol. 
91
 (pg. 
49
-
60
)
23
Jeong
H. G.
Youn
C. K.
Cho
H. J.
Kim
S. H.
Kim
M. H.
Kim
H. B.
Chang
I. Y.
Lee
Y. S.
Chung
M. H.
You
H. J.
Metallothionein-III prevents gamma-ray-induced 8-oxoguanine accumulation in normal and hOGG1-depleted cells
J. Biol. Chem.
2004
, vol. 
279
 (pg. 
34138
-
34149
)
24
Xue
W.
Liu
Q.
Cai
L.
Wang
Z.
Feng
W.
Stable overexpression of human metallothionein-IIA in a heart-derived cell line confers oxidative protection
Toxicol. Lett.
2009
, vol. 
188
 (pg. 
70
-
76
)
25
Radi
R.
Beckman
J. S.
Bush
K. M.
Freeman
B. A.
Peroxynitrite oxidation of sulfhydryls. The cytotoxic potential of superoxide and nitric oxide
J. Biol. Chem.
1991
, vol. 
266
 (pg. 
4244
-
4250
)
26
van der Vliet
A.
Hristova
M.
Cross
C. E.
Eiserich
J. P.
Goldkorn
T.
Peroxynitrite induces covalent dimerization of epidermal growth factor receptors in A431 epidermoid carcinoma cells
J. Biol. Chem.
1998
, vol. 
273
 (pg. 
31860
-
31866
)
27
Fehsel
K.
Kroncke
K. D.
Kolb-Bachofen
V.
Assay for detection of nitric oxide-induced apoptosis
Methods Enzymol.
1996
, vol. 
269
 (pg. 
426
-
434
)
28
Yao
Q. Z.
Zhou
H. M.
Hou
L. X.
Zou
C. G.
A comparison of denaturation and inactivation rates of creatine kinase in guanidine solutions
Sci. Sin. B.
1982
, vol. 
25
 (pg. 
1296
-
1802
)
29
Rosalki
S. B.
An improved procedure for serum creatine phosphokinase determination
J. Lab. Clin. Med.
1967
, vol. 
69
 (pg. 
696
-
705
)
30
Hartree
E. F.
Determination of protein: a modification of the Lowry method that gives a linear photometric response
Anal. Biochem.
1972
, vol. 
48
 (pg. 
422
-
427
)
31
Marklund
S.
Marklund
G.
Involvement of the superoxide anion radical in the autoxidation of pyrogallol and a convenient assay for superoxide dismutase
Eur. J. Biochem.
1974
, vol. 
47
 (pg. 
469
-
474
)
32
Flohe
L.
Gunzler
W. A.
Assays of glutathione peroxidase
Methods Enzymol.
1984
, vol. 
105
 (pg. 
114
-
121
)
33
Kraft
T.
Hornemann
T.
Stolz
M.
Nier
V.
Wallimann
T.
Coupling of creatine kinase to glycolytic enzymes at the sarcomeric I-band of skeletal muscle: a biochemical study in situ
J. Muscle Res. Cell Motil.
2000
, vol. 
21
 (pg. 
691
-
703
)
34
Feelisch
M.
The biochemical pathways of nitric oxide formation from nitrovasodilators: appropriate choice of exogenous NO donors and aspects of preparation and handling of aqueous NO solutions
J. Cardiovasc. Pharmacol.
1991
, vol. 
17
 (pg. 
S25
-
S33
)
35
Nakajima
K.
Suzuki
K.
Otaki
N.
Kimura
M.
Detection of metallothionein in brain
Methods Enzymol.
1991
, vol. 
205
 (pg. 
387
-
395
)
36
Gao
Y. S.
Zhao
T. J.
Chen
Z.
Li
C.
Wang
Y.
Yan
Y. B.
Zhou
H. M.
Isoenzyme-specific thermostability of human cytosolic creatine kinase
Int. J. Biol. Macromol.
2010
, vol. 
47
 (pg. 
27
-
32
)
37
Feng
S.
Yan
Y. B.
Effects of glycerol on the compaction and stability of the wild type and mutated rabbit muscle creatine kinase
Proteins
2008
, vol. 
71
 (pg. 
844
-
854
)
38
Rosen
G. M.
Freeman
B. A.
Detection of superoxide generated by endothelial cells
Proc. Natl. Acad. Sci. U.S.A.
1984
, vol. 
81
 (pg. 
7269
-
7273
)
39
Moncada
S.
Palmer
R. M.
Higgs
E. A.
Nitric oxide: physiology, pathophysiology, and pharmacology
Pharmacol. Rev.
1991
, vol. 
43
 (pg. 
109
-
142
)
40
Jaffrey
S. R.
Erdjument-Bromage
H.
Ferris
C. D.
Tempst
P.
Snyder
S. H.
Protein S-nitrosylation: a physiological signal for neuronal nitric oxide
Nat. Cell. Biol.
2001
, vol. 
3
 (pg. 
193
-
197
)
41
Gross
M.
Furter-Graves
E. M.
Wallimann
T.
Eppenberger
H. M.
Furter
R.
The tryptophan residues of mitochondrial creatine kinase: roles of Trp-223, Trp-206, and Trp-264 in active-site and quaternary structure formation
Protein Sci.
1994
, vol. 
3
 (pg. 
1058
-
1068
)
42
Davies
K. J.
Quintanilha
A. T.
Brooks
G. A.
Packer
L.
Free radicals and tissue damage produced by exercise
Biochem. Biophys. Res. Commun.
1982
, vol. 
107
 (pg. 
1198
-
1205
)
43
Penkowa
M.
Keller
P.
Keller
C.
Hidalgo
J.
Giralt
M.
Pedersen
B. K.
Exercise-induced metallothionein expression in human skeletal muscle fibres
Exp. Physiol.
2005
, vol. 
90
 (pg. 
477
-
486
)
44
Hensley
K.
Hall
N.
Subramaniam
R.
Cole
P.
Harris
M.
Aksenov
M.
Aksenova
M.
Gabbita
S. P.
Wu
J. F.
Carney
J. M.
, et al. 
Brain regional correspondence between Alzheimer's disease histopathology and biomarkers of protein oxidation
J. Neurochem.
1995
, vol. 
65
 (pg. 
2146
-
2156
)
45
Uchida
Y.
Takio
K.
Titani
K.
Ihara
Y.
Tomonaga
M.
The growth inhibitory factor that is deficient in the Alzheimer's disease brain is a 68 amino acid metallothioneinlike protein
Neuron
1991
, vol. 
7
 (pg. 
337
-
347
)
46
Chubatsu
L. S.
Meneghini
R.
Metallothionein protects DNA from oxidative damage
Biochem. J.
1993
, vol. 
291
 (pg. 
193
-
198
)
47
Palmiter
R. D.
The elusive function of metallothioneins
Proc. Natl. Acad. Sci. U.S.A.
1998
, vol. 
95
 (pg. 
8428
-
8430
)
48
Li
S.
Xu
Z.
Zhou
H.-M.
Effect of Zn2+ during reactivation and refolding of urea-denatured creatine kinase
Biochemistry
2002
, vol. 
67
 (pg. 
753
-
760
)

Author notes

1

Present address: The University of Texas Southwestern Medical Center, 5323 Harry Hines Boulevard, Dallas, TX 75390, U.S.A.

Supplementary data