Down-regulation of Kv4.3 K+ channels commonly occurs in multiple diseases, but the understanding of the regulation of Kv4.3 K+ channels and the role of Kv4.3 K+ channels in pathological conditions are limited. HEK (human embryonic kidney)-293T cells are derived from HEK-293 cells which are transformed by expression of the large T-antigen. In the present study, by comparing HEK-293 and HEK-293T cells, we find that HEK-293T cells express more Kv4.3 K+ channels and more transcription factor Sp1 (specificity protein 1) than HEK-293 cells. Inhibition of Sp1 with Sp1 decoy oligonucleotide reduces Kv4.3 K+ channel expression in HEK-293T cells. Transfection of pN3-Sp1FL vector increases Sp1 protein expression and results in increased Kv4.3 K+ expression in HEK-293 cells. Since the ultimate determinant of the phenotype difference between HEK-293 and HEK-293T cells is the large T-antigen, we conclude that the large T-antigen up-regulates Kv4.3 K+ channel expression through an increase in Sp1. In both HEK-293 and HEK-293T cells, inhibition of Kv4.3 K+ channels with 4-AP (4-aminopyridine) or Kv4.3 small interfering RNA induces cell apoptosis and necrosis, which are completely rescued by the specific CaMKII (calcium/calmodulin-dependent protein kinase II) inhibitor KN-93, suggesting that Kv4.3 K+ channels contribute to cell apoptosis and necrosis through CaMKII activation. In summary, we establish: (i) the HEK-293 and HEK-293T cell model for Kv4.3 K+ channel study; (ii) that large T-antigen up-regulates Kv4.3 K+ channels through increasing Sp1 levels; and (iii) that Kv4.3 K+ channels contribute to cell apoptosis and necrosis through activating CaMKII. The present study provides deep insights into the mechanism of the regulation of Kv4.3 K+ channels and the role of Kv4.3 K+ channels in cell death.

INTRODUCTION

Voltage-dependent Kv4.3 K+ channels, the major component of Ito (transient outward current) in cardiomyocytes and A-type K+ currents in neurons, are associated with many diseases. In hypertrophic failing hearts or rapid pacing cardiomyocytes, Kv4.3 K+ currents and channel expression decrease [14]. In dogs with ventricular tachypacing-induced CHF (congestive heart failure), Kv4.3 protein expression in Purkinje fibres decreases [5]. In a rat model of Type 1 diabetes, the protein density in Kv4.3 in the left ventricular myocytes decreases [6]. Inversely, the decrease in Kv4.3 expression leads to certain consequences. The down-regulation of Kv4.3 K+ currents and channel expression enhances sympathoexcitation in hypertrophic or failing hearts [7]. Reduction of Kv4.2/Kv4.3-based Ito prolongs action potential duration, resulting in cardiac hypertrophy [8]. Lebeche et al. [9] found that in vivo gene transfer of Kv4.3 restores the down-regulation of Ito and abrogates the hypertrophic response. On the other hand, it has been recently reported that genetically enhanced KCND3-encoded Kv4.3 Ito participates in the pathogenesis of Brugada syndrome [10]. In the neural field, Kv4.3 K+ currents participate in the rhythmic activity in hippocampal interneurons [11], and nerve injury down-regulates Kv4.3 expression in dorsal root ganglion [12]. Although Kv4.3 K+ channels are associated with many diseases, the understanding of the signal pathway that regulates Kv4.3 expression and the pathological contribution of Kv4.3 are still limited.

In the present study, we use electrophysiological studies of HEK (human embryonic kidney)-293 and HEK-293T cells and find that HEK-293T cells express a type of native K+ current which is increased in HEK-293T cells compared with HEK-293 cells. Then we identify it as Kv4.3 K+ channels. The HEK-293 cell is a cell line derived from HEK cells. The HEK-293T cell is derived from the HEK-293 cell line by the addition of the SV40 (simian virus 40) large T-antigen. Both HEK-293 and HEK-293T cells are commonly used as tools to exogenously express active proteins. It is of note that there is a difference in Kv4.3 K+ channel expression between HEK-293 and HEK-293T cells, which will lead to further investigation of the potential mechanism of Kv4.3 K+ channel regulation and the role of Kv4.3 K+ channels in cell biological processes. In the present study, we find that the large T-antigen up-regulates Kv4.3 K+ channel expression through increasing the levels of the transcription factor Sp1 (specificity protein 1), and Kv4.3 K+ channels contribute to cell apoptosis and necrosis by activating CaMKII (calcium/calmodulin-dependent protein kinase II). The present study puts forward new insights into the mechanism of the regulation of Kv4.3 K+ channels and the role of Kv4.3 K+ channels in cell death.

MATERIALS AND METHODS

Materials

Anti-Kv1.4, -Kv4.2 and -Kv4.3 K+ channel antibodies were purchased from Alomone. Anti-CaMKII and -p-CaMKII antibodies were purchased from Promage. Anti-Sp1 antibody was purchased from Cell Signaling Technology. Anti-caspase-3, -(large T-antigen), -Bax and -Bcl-2 antibodies were purchased from Santa Cruz Biotechnology. Anti-GAPDH (glyceraldehyde-3-phosphate dehydrogenase) antibody was purchased from Kangchen. pN3-Sp1FL vector was provided by Dr Guntram Suske (Institut für Molekularbiologie und Tumorforschung, Philipps-Universität Marburg, Marburg, Germany). 4-AP (4-aminopyridine) was purchased from Sigma. The medium containing different concentrations of 4-AP was adjusted to pH 7.35. siRNAkv4.3 (KCND3) (siRNA is small interfering RNA) was ordered from Invitrogen (Stealth SiRNA). Decoy oligonucleotide was dissolved in TNE buffer (10 mM Tris/HCl, 0.2 M NaCl and 1.0 mM EDTA, pH 7.4). The sequence of siRNA Kv4.3 was: sense, 5′-UGCAGUUCUGCUCAAACAUCUGCUC-3′; antisense, 5′-GAGCAGAUGUUUGAGCAGAACUGCA-3′. The sequence of scrambled siRNA was: sense, 5′-UUCUCCGAACGUGUCACGUTT-3′; antisense, 5′-ACGUGACACGUUCGGAGAATT-3′. The real-time PCR primers and Sp1 decoy sequences are shown in Tables 1 and 2.

Table 1
Human gene-specific primers for real-time PCR
Gene name Accession number Forward primer (5′–3′) Reverse primer (5′–3′) 
GAPDH XM_001068276.2 AAGAAGGTGGTGAAGCAGGC TCCACCACCCAGTTGCTGTA 
Kv1.3 NM_002232 AGCACCTCTCCTCTTCAGC GGGATTATTGTTCGTGGTGC 
Kv1.4 NM_002233 CCATCACTGTAGGGGGCAAG GGGAGGTATGGACAACTGAC 
Kv1.5 NM_002234 AGCATCCCTGACGCCTTCTG ACAGGCAGGGCAATGGTGAG 
Kv4.2 NM_012281 GAGGCAGGAGAGGAAAAGG GCTGAGTTTCTGGGTGGTAG 
Kv4.3 NM_004980 TTCAACGAGGACACCAAGGA TTCTCCCTCTTGCGGTCCTT 
Kv10.1 (EAG1) NM_172362 GATTGGCTCACTTCTCTATGC CTCGCTCACTCAATCCTTT 
HERG NM_172056 CCGCACCATTAGCAAGATTC GTGGGTTCGCTCCTTTATC 
Gene name Accession number Forward primer (5′–3′) Reverse primer (5′–3′) 
GAPDH XM_001068276.2 AAGAAGGTGGTGAAGCAGGC TCCACCACCCAGTTGCTGTA 
Kv1.3 NM_002232 AGCACCTCTCCTCTTCAGC GGGATTATTGTTCGTGGTGC 
Kv1.4 NM_002233 CCATCACTGTAGGGGGCAAG GGGAGGTATGGACAACTGAC 
Kv1.5 NM_002234 AGCATCCCTGACGCCTTCTG ACAGGCAGGGCAATGGTGAG 
Kv4.2 NM_012281 GAGGCAGGAGAGGAAAAGG GCTGAGTTTCTGGGTGGTAG 
Kv4.3 NM_004980 TTCAACGAGGACACCAAGGA TTCTCCCTCTTGCGGTCCTT 
Kv10.1 (EAG1) NM_172362 GATTGGCTCACTTCTCTATGC CTCGCTCACTCAATCCTTT 
HERG NM_172056 CCGCACCATTAGCAAGATTC GTGGGTTCGCTCCTTTATC 
Table 2
Sp1 decoy sequence
Gene name Sense (5′–3′) Antisense (5′–3′) 
Sp1 decoy ATTACGAGGCGGGGGGGCTAC GTAGCCCCCCCGCCTCGTAAT 
Sp1 (mutant) ATTACCGGTAGGTAGGGCTAC GTAGCCCTATCTACCGGTAAT 
Gene name Sense (5′–3′) Antisense (5′–3′) 
Sp1 decoy ATTACGAGGCGGGGGGGCTAC GTAGCCCCCCCGCCTCGTAAT 
Sp1 (mutant) ATTACCGGTAGGTAGGGCTAC GTAGCCCTATCTACCGGTAAT 

Cell culture

HEK-293 and HEK-293T cells were grown in DMEM (Dulbecco's modified Eagle's medium) supplemented with 10% heat-inactivated fetal bovine serum, 200 μM G418, 100 units/ml penicillin and 100 μg/ml streptomycin.

Patch-clamp experiments

Currents were recorded in the whole-cell voltage-clamp mode with an Axopatch-200B amplifier (Axon Instruments) as described in our previous study [13]. Borosilicate glass electrodes had tip resistances of 2–3 mΩ. The normal internal solution contained 130 mM KCl, 1 mM MgCl2, 5 mM Mg-ATP, 10 mM EGTA and 10 mM Hepes (pH 7.3). The normal extracellular (Tyrode) solution contained 136 mM NaCl, 5.4 mM KCl, 1 mM CaCl2, 1 mM MgCl2, 10 mM glucose and 10 mM Hepes (adjusted to pH 7.4 with NaOH). Experiments were conducted at room temperature (22–25°C).

Western blot

Cells were washed with ice-cold PBS and centrifuged at 950 g for 10 min, then extracted in lysis buffer which contained 1% protease inhibitor solution. The cell lysates were subsequently incubated on ice for 15 min and centrifuged at 19000 g for 15 min. A BCA (bichinchoninic acid) Protein Assay Kit (Bio-Rad) was used to quantify the total protein concentration. The samples were subjected to SDS/PAGE (10% gels) and the separated proteins were transferred to nitrocellulose membranes. The membranes were blocked in 5% (w/v) non-fat dried skimmed milk powder for 2 h at room temperature, then incubated with the appropriate primary antibody at the indicated dilution: Kv1.4, Kv4.2 and Kv4.3, 1:200; p-CaMKII, 1:5000; Sp1, 1:1000; caspase-3, CaMKII and large T-antigen, 1:200; and GAPDH, 1:200. After washing, membranes were incubated with fluorescence-conjugated goat anti-rabbit IgG or goat anti-mouse IgG secondary antibody (1:10000; Invitrogen). The band densities were quantified by densitometry using Odyssey v3.0 software.

Real-time PCR

Total RNA was extracted using the TRIzol® reagent (Invitrogen) according to the manufacturer's instructions. The cDNAs were synthesized using the Reverse Transcription Kit (ABI); 1 μg of total RNA was reverse transcribed in a 20 μl reaction with random primers. The reaction was performed with the following parameters: 10 min at 25°C, 120 min at 37°C, 5 min at 85°C, and 4°C until use. Real-time PCR was performed using the SYBR-Green Kit (ABI) with a 20 μl volume reaction containing 1 μl of reverse transcription product, 10 μl of SYBR-Green, 1 μl of PCR Forward Primer, 1 μl of PCR Reverse Primer and 7 μl of double-distilled water. The reactions were run on an ABI PRISM™ 7500 Sequence Detection System (Applied Biosystems) and incubated in 96-well plates at 95°C for 10 min, followed by 40 cycles, and then ramped from 66°C to 95°C to obtain the melting curve. GAPDH was the loading control. Data were analysed using Sequence Detection Software version 1.3 (Applied Biosystems).

Cell viability assay using MTT [3-(4,5-dimethylthiazol-2-yl)2,5-diphenyl-2H-tetrazolium bromide]

The viability of cells cultured in the 96-well culture plates was assessed by measuring the mitochondrial dehydrogenase activity using the colorimetric MTT assay.

LDH (lactate dehydrogenase) measurement

Cell necrosis was determined by measuring the release of LDH from cells (LDH assay kit, Nanjing Jiancheng Bioengineering Institute). Briefly, HEK-293 cells and HEK-293T cells were seeded in a six-well plate at a density of 3.75×104 per well and incubated overnight at 37°C in a humidified 5% CO2 incubator. The cells were treated with 4-AP or siRNA-Kv4.3 for 24 h. The medium was collected and the absorbance of LDH was measured at 440 nm with a microplate reader according to the manufacturer's instructions (Tecan).

Live- and dead-cell staining

The LIVE/DEAD® Viability/Cytotoxicity Assay Kit (Invitrogen) was used to detect live and dead cells. Briefly, HEK-293 cells and HEK-293T cells were grown on coverslips at a density of 3.75×104/ml and incubated overnight at 37°C in a humidified 5% CO2 incubator. The cells were treated with 4-AP or siRNA-Kv4.3 for 24 h. The cells were then washed with PBS and dyed according to the manufacturer's instructions. The labelled cells were photographed under a fluorescence microscope. The live cells fluoresce green and dead cells fluoresce red.

Flow cytometry analysis

HEK-293 and HEK-293T cells were stained with FITC–annexin V and PI (propidium iodide) to evaluate cell apoptosis and necrosis by using flow cytometry (FACSCalibur, Becton Dickinson). The dot plots in quadrants quantified the percentage of cells.

Data analysis

Data are presented as means±S.E.M. Significance was determined by using one-way ANOVA in SigmaStat analysis software. P<0.05 was considered significant.

RESULTS

HEK-293T cells express large T-antigen and proliferate faster than HEK-293 cells

HEK-293T cells are derived from HEK-293 cells and stably express the SV40 large T-antigen. Large T-antigen binds to several proteins involved in the cell cycle, thus resulting in the faster growth of HEK-293T cells. We first examined the large T-antigen expression in HEK-293 and HEK-293T cells. As shown in Figure 1(A), HEK-293T cells expressed abundant large T-antigen, but no large T-antigen was detected in HEK-293 cells. Next, we examined the cell growth of HEK-293 and HEK-293T cells. As shown in the photographs in Figure 1(B), HEK-293T cells proliferated significantly faster than HEK-293 cells at 24 h and 48 h after the same density of HEK-293 and HEK-293T cells were seeded. The cell viability was measured using the MTT method and the analysed data are shown in Figure 1(C), indicating that HEK-293T cells proliferate faster than HEK-293 cells.

HEK-293T cells express large T-antigen and proliferate faster than HEK-293 cells

Figure 1
HEK-293T cells express large T-antigen and proliferate faster than HEK-293 cells

(A) Representative Western blots of large T-antigen in HEK-293 and HEK-293T cells. HEK-293T cells expressed abundant large T-antigen, but no large T-antigen was detected in HEK-293 cells. (B) Photographs of HEK-293 and HEK-293T cells at 8, 24 and 48 h after the same density of HEK-293 and HEK-293T cells were seeded. (C) Cell viability was measured using the MTT assay. **P<0.01 compared with HEK-293 cells.

Figure 1
HEK-293T cells express large T-antigen and proliferate faster than HEK-293 cells

(A) Representative Western blots of large T-antigen in HEK-293 and HEK-293T cells. HEK-293T cells expressed abundant large T-antigen, but no large T-antigen was detected in HEK-293 cells. (B) Photographs of HEK-293 and HEK-293T cells at 8, 24 and 48 h after the same density of HEK-293 and HEK-293T cells were seeded. (C) Cell viability was measured using the MTT assay. **P<0.01 compared with HEK-293 cells.

HEK-293T cells express more Kv4.3 K+ channels than HEK-293 cells

By using a patch-clamp technique with 140 mM K+ in the pipette (intracellular solution), we found a depolarization-induced outward current (Io, IOutward) in HEK-293 and HEK-293T cells bathed in 5 mM K+ tyrode solution (Figure 2A). This kind of current was significantly larger in HEK-293T cells than in HEK-293 cells (right-hand panel of Figure 2A). In order to identify the type of current, we replaced 5 mM K+ with 140 mM K+ in extracellular solution (Figure 2B, panel a), and replaced K+ with an equal molar concentration of Cs+ in the pipette and extracellular solution (Figure 2B, panel b). Under these conditions, the depolarization-induced outward currents in both HEK-293 and HEK-293T cells were significantly inhibited, indicating that the depolarization-induced outward currents were K+ currents. This type of K+ current in HEK-293 and HEK-293T cells was inhibited by 2 mM 4-AP and restored partially after 4-AP washout (Figure 2C, panels a and b). The net 4-AP-sensitive K+ currents were obtained by subtracting the currents recorded in the presence of 4-AP from the control currents. As shown in Figure 2(C, panel c), compared with HEK-293 cells, HEK-293T cells had significantly larger 4-AP-sensitive K+ currents.

HEK-293T cells expressed more voltage-dependent 4-AP-sensitive K+ currents than HEK-293 cells

Figure 2
HEK-293T cells expressed more voltage-dependent 4-AP-sensitive K+ currents than HEK-293 cells

(A) Left-hand panel, the representative recordings of depolarization-induced outward currents (Io, IOutward) in HEK-293 and HEK-293T cells. Right-hand panel, the analysed results. (B) Panel (a), current recordings under the conditions where 140 mM K+ was in the pipette (intracellular solution) and cells were bathed in 5 mM K+ tyrode solution. Panel (b), current recordings under the conditions where K+ in the pipette and bath solution was replaced with an equal molar concentration of Cs+. (C) The voltage-dependent K+ currents recorded in HEK-293 and HEK-293T cells were sensitive to 4-AP. The net 4-AP sensitive K+ currents were obtained by subtracting the currents recorded in the presence of 4-AP from the control currents (panels a and b). Compared with HEK-293 cells, HEK-293T cells had significantly larger 4-AP-sensitive K+ currents (c).

Figure 2
HEK-293T cells expressed more voltage-dependent 4-AP-sensitive K+ currents than HEK-293 cells

(A) Left-hand panel, the representative recordings of depolarization-induced outward currents (Io, IOutward) in HEK-293 and HEK-293T cells. Right-hand panel, the analysed results. (B) Panel (a), current recordings under the conditions where 140 mM K+ was in the pipette (intracellular solution) and cells were bathed in 5 mM K+ tyrode solution. Panel (b), current recordings under the conditions where K+ in the pipette and bath solution was replaced with an equal molar concentration of Cs+. (C) The voltage-dependent K+ currents recorded in HEK-293 and HEK-293T cells were sensitive to 4-AP. The net 4-AP sensitive K+ currents were obtained by subtracting the currents recorded in the presence of 4-AP from the control currents (panels a and b). Compared with HEK-293 cells, HEK-293T cells had significantly larger 4-AP-sensitive K+ currents (c).

The properties of 4-AP-sensitive K+ currents recorded in HEK-293 and HEK-293T cells were much like the transient outward K+ currents encoded by Kv4.3, Kv4.2 or Kv1.4 genes. Therefore, we compared the Kv4.3, Kv4.2 and Kv1.4 mRNA expression in HEK-293 and HEK-293T cells. Meanwhile, we also compared other K+ channel gene expression, such as HERG (human ether-a-go-go-related gene), eag1, Kv1.3 and Kv1.5 K+ channels. As shown in Figure 3(A), among these K+ channel genes, only the Kv4.3 mRNA expression was increased in HEK-293T cells compared with HEK-293 cells (P<0.01). Next, we compared the Kv4.3, Kv4.2 and Kv1.4 protein levels in HEK-293 and HEK-293T cells. There was no difference in Kv1.4 and Kv4.2 protein expression between HEK-293 and HEK-293T cells, but the Kv4.3 protein level was much higher in HEK-293T cells than in HEK-293 cells (Figure 3B). Furthermore, we used siRNA against Kv4.3 (siRNA-Kv4.3) to confirm the Kv4.3 K+ channel expression in HEK-293T cells. As shown in Figures 3(C) and 3(D), siRNA-Kv4.3 significantly down-regulated the Kv4.3 mRNA and protein expression. Taken together, these data suggest that HEK-293T cells express more Kv4.3 K+ channels than HEK-293 cells.

HEK-293T cells expressed more Kv4.3 K+ channels than HEK-293 cells

Figure 3
HEK-293T cells expressed more Kv4.3 K+ channels than HEK-293 cells

(A) mRNA levels of HERG, eag1, Kv1.3, Kv1.5, Kv4.3, Kv4.2 and Kv1.4 K+ channels in HEK-293 and HEK-293T cells. **P<0.01 compared with HEK-293 cells. (B) Protein levels of Kv4.3, Kv4.2 and Kv1.4 K+ channels in HEK-293 and HEK-293T cells. The left-hand panel shows the representative Western blots and the right-hand panel is the summarized data. **P<0.01 compared with HEK-293 cells. (C and D) siRNA of the Kv4.3 gene (siRNA-Kv4.3) (20 nM) down-regulated Kv4.3 mRNA and protein expression. **P<0.01 compared with scrambled siRNA.

Figure 3
HEK-293T cells expressed more Kv4.3 K+ channels than HEK-293 cells

(A) mRNA levels of HERG, eag1, Kv1.3, Kv1.5, Kv4.3, Kv4.2 and Kv1.4 K+ channels in HEK-293 and HEK-293T cells. **P<0.01 compared with HEK-293 cells. (B) Protein levels of Kv4.3, Kv4.2 and Kv1.4 K+ channels in HEK-293 and HEK-293T cells. The left-hand panel shows the representative Western blots and the right-hand panel is the summarized data. **P<0.01 compared with HEK-293 cells. (C and D) siRNA of the Kv4.3 gene (siRNA-Kv4.3) (20 nM) down-regulated Kv4.3 mRNA and protein expression. **P<0.01 compared with scrambled siRNA.

The increase in Sp1 levels leads to more Kv4.3 expression in HEK-293T cells

The large T-antigen is a powerful oncoprotein capable of perturbing the retinoblastoma (pRB) and p53 tumour suppressors, and binding to several cellular factors, including Sp1, AP-1 (activator protein 1) and p300, which may contribute to large T-antigen transformation function. The transcription factor Sp1 has been found to regulate Kv1.5 [14], KCNQ2, KCNQ3 [15] and BK [16] K+ channel expression. In the human Kv4.3 promoter (−1000 to 299 bp), the computational analysis showed that there were three Sp1-binding sites: (−413)TCCCCACCCC(−404); (−138)TCCCCGCCCC(−129) and (−122)GCCGCGCCCC(−113). We speculated that Sp1 might be the candidate substrate of large T-antigen and that Sp1 regulates Kv4.3 K+ channel expression. Western blot results showed that HEK-293T cells expressed more Sp1 than HEK-293 cells (Figure 4A) and the Sp1 decoy significantly decreased Kv4.3 expression in HEK-293T cells (Figure 4B). Overexpression of Sp1 by transfecting the pN3-Sp1FL vector increased Sp1 (Figure 4C) and Kv4.3 (Figure 4D) protein expression in HEK-293 cells, which had a reduced basal Kv4.3 level. We have proved that Sp1 was the pivotal factor in large T-antigen-induced Kv4.3 expression, and established that the large T-antigen up-regulated Kv4.3 K+ channel expression by increasing Sp1.

Sp1 regulates Kv4.3 K+ channel expression

Figure 4
Sp1 regulates Kv4.3 K+ channel expression

(A) Sp1 protein expression was higher in HEK-293T cells than HEK-293 cells. **P<0.01 compared with HEK-293 cells. (B) Sp1 decoy decreased the Kv4.3 protein expression in HEK-293T cells. **P<0.01 compared with Sp1-mutant. (C) Transfection of the Sp1 vector increased Sp1 protein expression in HEK-293 cells. **P<0.01 compared with pN3-Ctrl. (D) Overexpression of Sp1 increased Kv4.3 protein expression in HEK-293 cells. **P<0.01 compared with pN3-Ctrl. Ctrl/ctrl, control.

Figure 4
Sp1 regulates Kv4.3 K+ channel expression

(A) Sp1 protein expression was higher in HEK-293T cells than HEK-293 cells. **P<0.01 compared with HEK-293 cells. (B) Sp1 decoy decreased the Kv4.3 protein expression in HEK-293T cells. **P<0.01 compared with Sp1-mutant. (C) Transfection of the Sp1 vector increased Sp1 protein expression in HEK-293 cells. **P<0.01 compared with pN3-Ctrl. (D) Overexpression of Sp1 increased Kv4.3 protein expression in HEK-293 cells. **P<0.01 compared with pN3-Ctrl. Ctrl/ctrl, control.

Inhibition of Kv4.3 K+ channels by 4-AP and siRNA-Kv4.3 induces HEK-293 and HEK-293T cell apoptosis and necrosis

Since HEK-293T cells express more Kv4.3 K+ channels and proliferate faster than HEK-293 cells, we investigated the role of Kv4.3 K+ channels in the cell biological processes further. As shown in Figures 5(A) and 5(B), 4-AP, the Kv4.3 K+ channel blocker, significantly reduced HEK-293 and HEK-293T cell viability after a 24 h treatment in a dose-dependent manner. Figure 5(C) shows the representative photographs of the live and dead HEK-293 and HEK-293T cells treated with different concentrations of 4-AP for 24 h. It is apparent that 4-AP induces HEK-293 and HEK-293T cell death. Compared with HEK-293 cells, HEK-293T cells were more vulnerable to 4-AP (Figure 5D).

Kv4.3 K+ channel blocker 4-AP induced HEK-293 and HEK-293T cell apoptosis and necrosis

Figure 5
Kv4.3 K+ channel blocker 4-AP induced HEK-293 and HEK-293T cell apoptosis and necrosis

(A and B) 4-AP dose-dependently reduced the cell viability of HEK-293 and HEK-293T cells. *P<0.05 and **P<0.01 compared with control. n=7 in each group. (C) Representative photographs of the live and dead assay of HEK-293 and HEK-293T cells treated with different concentrations of 4-AP for 24 h. (D) The cell viability of HEK-293T cells was more vulnerable to 4-AP than HEK-293 cells. n=7, *P<0.05 and **P<0.01 compared with HEK-293 cells. (E) Flow cytometric analysis showing that 4-AP (4 mM) treatment for 24 h induced both apoptosis and necrosis in HEK-293 and HEK-293T cells with annexin V/PI staining. A total of 10000 cells were analysed in each group. The right lower quadrant indicates the apoptotic cells; the right upper quadrant indicates the late apoptotic and necrotic cells. (F and G) 4-AP treatment increased cleaved caspase-3 expression and caspase-3 activity in both HEK-293 and HEK-293T cells. *P<0.05 and **P<0.01 compared with control. Molecular masses are indicated in kDa to the right-hand side of (F). (H) 4-AP treatment increased LDH release in both HEK-293 and HEK-293T cells. *P<0.05 and **P<0.01 compared with control.

Figure 5
Kv4.3 K+ channel blocker 4-AP induced HEK-293 and HEK-293T cell apoptosis and necrosis

(A and B) 4-AP dose-dependently reduced the cell viability of HEK-293 and HEK-293T cells. *P<0.05 and **P<0.01 compared with control. n=7 in each group. (C) Representative photographs of the live and dead assay of HEK-293 and HEK-293T cells treated with different concentrations of 4-AP for 24 h. (D) The cell viability of HEK-293T cells was more vulnerable to 4-AP than HEK-293 cells. n=7, *P<0.05 and **P<0.01 compared with HEK-293 cells. (E) Flow cytometric analysis showing that 4-AP (4 mM) treatment for 24 h induced both apoptosis and necrosis in HEK-293 and HEK-293T cells with annexin V/PI staining. A total of 10000 cells were analysed in each group. The right lower quadrant indicates the apoptotic cells; the right upper quadrant indicates the late apoptotic and necrotic cells. (F and G) 4-AP treatment increased cleaved caspase-3 expression and caspase-3 activity in both HEK-293 and HEK-293T cells. *P<0.05 and **P<0.01 compared with control. Molecular masses are indicated in kDa to the right-hand side of (F). (H) 4-AP treatment increased LDH release in both HEK-293 and HEK-293T cells. *P<0.05 and **P<0.01 compared with control.

Next, we investigated whether the cell death was via apoptosis or necrosis. Flow cytometric analysis showed that 4 mM 4-AP induced both apoptosis and necrosis in HEK-293 and HEK-293T cells with annexin V/PI staining (Figure 5E). 4-AP (4 mM) treatment significantly increased cleaved caspase-3 expression (Figure 5F) and caspase-3 activity (Figure 5G) in both HEK-293 and HEK-293T cells. LDH release generally reflects an increase in cell necrosis [17]. 4-AP (4 mM) treatment increased LDH release in both HEK-293 and HEK-293T cells (Figure 5H). It was noticeable that the basal caspase-3 activity of HEK-293T cells was higher than that of HEK-293 cells (see Supplementary Figure S1 at http://www.BiochemJ.org/bj/441/bj4410859add.htm). Moreover, the quantity of LDH release in 4-AP-treated HEK-293T cells was 1.357±0.058-fold, which was higher than that in 4-AP-treated HEK-293 cells (1.15±0.049-fold, P<0.05) (Figure 5H). These results were consistent with the results in Figures 5(C) and 5(D), which showed that 4-AP induced more HEK-293T cell death.

4-AP-induced apoptosis and necrosis in HEK-293 and HEK-293T cells were further evaluated by transmission electron microscopy. As shown in Figures 6(A) and 6(C), the normal HEK-293 and HEK-293T cells showed a clear nucleolus and smooth nuclear membrane. 4-AP-treated HEK-293 cells showed typical apoptosis characterizations, including chromatin condensation and disruption of mitochondrial cristae (Figure 6B). 4-AP-treated HEK-293T cells showed typical necrosis characteristics, including dissolved cell membrane, nuclear condensation, disruption of mitochondrial cristae, more lipid droplets and autophagosomes (Figure 6D).

Evaluation of 4-AP-induced apoptosis and necrosis in HEK-293 and HEK-293T cells by transmission electron microscopy

Figure 6
Evaluation of 4-AP-induced apoptosis and necrosis in HEK-293 and HEK-293T cells by transmission electron microscopy

(A and C) The normal HEK-293 and HEK-293T cells showed a clear nucleolus and smooth nuclear membrane. (B) 4-AP-treated HEK-293 cells showed typical apoptosis characteristics, including chromatin condensation and disruption of mitochondrial cristae. (D) 4-AP-treated HEK-293T cells showed typical necrosis characteristics, including a dissolved cell membrane, nuclear condensation, disruption of mitochondrial cristae, more lipid droplets and autophagosomes. NM, nuclear membrane; PM, plasma membrane.

Figure 6
Evaluation of 4-AP-induced apoptosis and necrosis in HEK-293 and HEK-293T cells by transmission electron microscopy

(A and C) The normal HEK-293 and HEK-293T cells showed a clear nucleolus and smooth nuclear membrane. (B) 4-AP-treated HEK-293 cells showed typical apoptosis characteristics, including chromatin condensation and disruption of mitochondrial cristae. (D) 4-AP-treated HEK-293T cells showed typical necrosis characteristics, including a dissolved cell membrane, nuclear condensation, disruption of mitochondrial cristae, more lipid droplets and autophagosomes. NM, nuclear membrane; PM, plasma membrane.

We investigated further the effect of inhibition of Kv4.3 K+ channels by silencing Kv4.3 with siRNA (siRNA-Kv4.3) on apoptosis and necrosis of HEK-293 and HEK-293T cells. The live and dead assay results showed that siRNA-Kv4.3 induced significant HEK-293 and HEK-293T cell death, and the amount of HEK-293T cell death was increased compared with HEK-293 cells (Figure 7A, live cells are green and dead cells are red). siRNA-Kv4.3 induced increased caspase-3 activity and LDH release in both HEK-293 and HEK-293T cells (Figures 7B and 7C), indicating that the induction of cell apoptosis and necrosis by siRNA-Kv4.3 was similar to that of direct inhibition of Kv4.3 channels by 4-AP. The basal caspase-3 activity of HEK-293T cells was higher than that of HEK-293 cells when both cells were treated with scrambled siRNA (see Supplementary Figure S2 at http://www.BiochemJ.org/bj/441/bj4410859add.htm). We used two methods, 4-AP and siRNA-Kv4.3, to inhibit Kv4.3 K+ channels. Both methods showed similar results, indicating that Kv4.3 K+ channels contribute to cell apoptosis and necrosis.

Inhibition of Kv4.3 K+ channels by siRNA-Kv4.3 induced HEK-293 and HEK-293T cell apoptosis and necrosis

Figure 7
Inhibition of Kv4.3 K+ channels by siRNA-Kv4.3 induced HEK-293 and HEK-293T cell apoptosis and necrosis

(A) Live and dead assay showing that siRNA-Kv4.3 (20 nM) induced HEK-293 and HEK-293T cell death and that HEK-293T cell death was increased compared with HEK-293 cells. n=8 in each group. **P<0.01 compared with control. #P<0.05 compared with HEK-293 cells. The live cells were stained green and dead cells were stained red. (B and C) siRNA-Kv4.3 (20 nM) induced increased caspase-3 activity and LDH release in both HEK-293 and HEK-293T cells. **P<0.01 compared with scrambled siRNA.

Figure 7
Inhibition of Kv4.3 K+ channels by siRNA-Kv4.3 induced HEK-293 and HEK-293T cell apoptosis and necrosis

(A) Live and dead assay showing that siRNA-Kv4.3 (20 nM) induced HEK-293 and HEK-293T cell death and that HEK-293T cell death was increased compared with HEK-293 cells. n=8 in each group. **P<0.01 compared with control. #P<0.05 compared with HEK-293 cells. The live cells were stained green and dead cells were stained red. (B and C) siRNA-Kv4.3 (20 nM) induced increased caspase-3 activity and LDH release in both HEK-293 and HEK-293T cells. **P<0.01 compared with scrambled siRNA.

Bcl-2 and Bax, the key anti-apoptotic and pro-apoptotic proteins, influence caspase-3 activation. We investigated further whether caspase-3 activation induced by inhibition of Kv4.3 K+ channels was related to the changes of Bcl-2 and Bax expression in HEK-293 and HEK-293T cells. 4-AP had no significant effect on Bax and Bcl-2 protein expression in both HEK-293 and HEK-293T cells (see Supplementary Figure S3 at http://www.BiochemJ.org/bj/441/bj4410859add.htm), indicating that the caspase-3 activation induced by the inhibition of the Kv4.3 K+ channel might not be related to Bcl-2 and Bax.

Inhibition of Kv4.3 K+ channels induces cell apoptosis and necrosis through activating CaMKII

CaMKII has been shown previously to mediate cell apoptosis and necrosis [1719]. Recent studies show that CaMKII is coupled with Kv4.3 K+ channels [20,21], and inhibition of Kv4.3 K+ channels leads to substantial CaMKII activation [21]. We hypothesized that inhibition of Kv4.3 K+ channels induced apoptosis and necrosis of HEK-293 and HEK-293T cells through activating CaMKII. HEK-293 and HEK-293T cells expressed an equal amount level of CaMKII protein (Figure 8A). 4-AP (4 mM) treatment increased the CaMKII autophosphorylation in HEK-293 and HEK-293T cells, indicating that inhibition of Kv4.3 K+ channels led to CaMKII activation (Figure 8A). Furthermore, the autophosphorylation level was higher in HEK-293T cells than HEK-293 cells after treatment of the same concentration of 4-AP (4 mM) (Figure 8A). We then used KN-93 to specifically inhibit CaMKII with KN-92 as a negative control. The cell viability was evaluated using the MTT assay, cell apoptosis was evaluated by measurement of caspase-3 activity and cell necrosis by measurement of LDH release. The results showed that KN-93 abolished 4-AP (4 mM)-induced cell death (Figure 8B), and 4-AP (4 mM)- and siRNA-Kv4.3-induced cell apoptosis (Figure 8C) and necrosis (Figure 8D). Hence we established a new mechanism of the Kv4.3 K+ channel contributing to cell apoptosis and necrosis via CaMKII (Figure 8E).

Inhibition of Kv4.3 K+ channels induced cell apoptosis and necrosis through activating CaMKII

Figure 8
Inhibition of Kv4.3 K+ channels induced cell apoptosis and necrosis through activating CaMKII

(A) Western blot results showing that both HEK-293 and HEK-293T cells expressed CaMKII, and 4-AP (4 mM) treatment increased CaMKII phosphorylation in HEK-293 and HEK-293T cells. There was no difference of CaMKII protein expression between HEK-293 and HEK-293T cells. 4-AP (4 mM) treatment caused a larger increase in CaMKII phosphorylation in HEK-293T cells compared with HEK-293 cells. The protein level was normalized to those of HEK-293 cells. Molecular masses in kDa are shown to the right-hand side of the Western blot. (B) 4-AP (4 mM)-induced cell death was completely prevented by the CaMKII-specific inhibitor KN-93 but not by negative control KN-92 in HEK-293 and HEK-293T cells. **P<0.01 compared with control. ##P<0.01 compared with 4-AP. (C) The increased caspase-3 activity induced by 4-AP (4 mM) and siRNA-Kv4.3(20nM) was inhibited by the CaMKII-specific inhibitor KN-93, but not by negative control KN-92 in HEK-293 and HEK-293T cells. **P<0.01 compared with control. ##P<0.01 compared with 4-AP or siRNA-Kv4.3. (D) The increased LDH release induced by 4-AP (4 mM) and siRNA-Kv4.3 (20 nM) was inhibited by the CaMKII-specific inhibitor KN-93 but not by negative control KN-92 in HEK-293 and HEK-293T cells. *P<0.05 and **P<0.01 compared with control. #P<0.05 and ##P<0.01 compared with 4-AP or siRNA-Kv4.3. (E) A schematic diagram showing that inhibition of Kv4.3 K+ channels induced cell apoptosis and necrosis through activation of CaMKII.

Figure 8
Inhibition of Kv4.3 K+ channels induced cell apoptosis and necrosis through activating CaMKII

(A) Western blot results showing that both HEK-293 and HEK-293T cells expressed CaMKII, and 4-AP (4 mM) treatment increased CaMKII phosphorylation in HEK-293 and HEK-293T cells. There was no difference of CaMKII protein expression between HEK-293 and HEK-293T cells. 4-AP (4 mM) treatment caused a larger increase in CaMKII phosphorylation in HEK-293T cells compared with HEK-293 cells. The protein level was normalized to those of HEK-293 cells. Molecular masses in kDa are shown to the right-hand side of the Western blot. (B) 4-AP (4 mM)-induced cell death was completely prevented by the CaMKII-specific inhibitor KN-93 but not by negative control KN-92 in HEK-293 and HEK-293T cells. **P<0.01 compared with control. ##P<0.01 compared with 4-AP. (C) The increased caspase-3 activity induced by 4-AP (4 mM) and siRNA-Kv4.3(20nM) was inhibited by the CaMKII-specific inhibitor KN-93, but not by negative control KN-92 in HEK-293 and HEK-293T cells. **P<0.01 compared with control. ##P<0.01 compared with 4-AP or siRNA-Kv4.3. (D) The increased LDH release induced by 4-AP (4 mM) and siRNA-Kv4.3 (20 nM) was inhibited by the CaMKII-specific inhibitor KN-93 but not by negative control KN-92 in HEK-293 and HEK-293T cells. *P<0.05 and **P<0.01 compared with control. #P<0.05 and ##P<0.01 compared with 4-AP or siRNA-Kv4.3. (E) A schematic diagram showing that inhibition of Kv4.3 K+ channels induced cell apoptosis and necrosis through activation of CaMKII.

DISCUSSION

Kv4.3 K+ channels play an important role in physiological and pathological conditions in cardiac and neuronal systems [112], but the understanding of the regulation of Kv4.3 K+ channels is limited. The related HEK-293 and HEK-293T cells are commonly used in biological studies. Now this old acquaintance displays a new face for us. The novel findings of the present study are: (i) large T-antigen increases Kv4.3 K+ channel expression through increasing Sp1; and (ii) inhibition of Kv4.3 K+ channels induces cell apoptosis and necrosis through activating CaMKII. This work provides new insights into the mechanism of the regulation of Kv4.3 K+ channels and the role of Kv4.3 K+ channels in cell death.

Large T-antigen and Kv4.3 K+ channels

The large T-antigen was encoded in the early region of the polyomaviruses BK virus, JC virus and SV40 genome. The large T-antigen is capable of transforming a variety of cell lines. The transforming activity of the large T-antigen is mainly due to its perturbation of the retinoblastoma (pRB) and p53 tumour suppressor proteins; in addition, several other cellular factors, including the transcriptional coactivators p300/CBP [CREB (cAMP-response-element-binding protein)-binding protein] and AP-2, are also involved [22,23]. HEK-293T cells are derived from HEK-293 cells which stably express the large T-antigen, and thus show an increase in proliferative activity. The unique difference between HEK-293 and HEK-293T cells is the expression of the large T-antigen, which is the ultimate determinant of the phenotype difference between these two types of cells.

We have identified the different K+ currents between HEK-293 and HEK-293T cells and further identify them as Kv4.3 K+ currents. Since the ultimate difference between HEK-293 and HEK-293T cells is the large T-antigen, it must be the large T-antigen that leads to the increased Kv4.3 K+ channel expression. We aimed to find the intermediate link between the large T-antigen and Kv4.3 K+ channels and focused on the transcription factor Sp1. SV40 has been shown to stimulate Sp1 expression [24]. Sp1 has been reported to regulate some kinds of K+ channels, such as Kv1.5 [14]. We found that Sp1 and Kv4.3 K+ channel protein expression was significantly higher in HEK-293T cells than HEK-293 cells. The Sp1 decoy significantly decreased the Kv4.3 expression in HEK-293T cells. Overexpression of Sp1 increased Kv4.3 protein expression in HEK-293 cells, which have a decreased basal Kv4.3 level. We take advantage of the characterization difference between HEK-293 and HEK-293T cells and utilize another elaborate way to prove that the large T-antigen increases Kv4.3 K+ channel expression through Sp1. We have established the correlation between the large T-antigen with Sp1 and Kv4.3 expression. However, it is noteworthy that, as the large T-antigen stimulates or represses multiple gene or gene products [25], it is difficult to conclude unequivocally that the large T-antigen is directly responsible for the increases in Sp1 and Kv4.3 expression, and there might be other intermediate gene products involved in the process.

Kv4.3 K+ channels are down-regulated in many diseases such as heart hypertrophy, heart failure, cardiac infarction, atrial fibrillation and nerve injury, but the understanding of the signal pathway that increases Kv4.3 expression is limited. The present study provides a new pathway that up-regulates the decreased Kv4.3 K+ channels.

Role of Kv4.3 K+ channels in cell apoptosis and necrosis

The contribution of voltage-gated potassium channels to the regulation of apoptosis has been well reviewed [2628]. It is generally thought that K+ efflux leads to reduced intracellular K+ concentration, which promotes cytochrome c release, proteolytic cleavage of procaspase-3 and cell fragmentation. However, if it is the K+ channel activity that leads to cell apoptosis, the prerequisite of the contribution of K+ channels to cell apoptosis should be the channel activation. It has been reported that the membrane potential through the cell cycle ranges from −9 to −40 mV in MCF-7 cells [29], and the mean resting membrane potentials of bovine pulmonary artery endothelial cells are approximately −26 mV [30]. It is apparent that the resting membrane potential of cells is generally less than −10mV, and Kv4.3 K+ channels cannot be significantly activated under these membrane potentials (as shown in Figure 2). Therefore there might be another mechanism for the contribution of Kv4.3 K+ channels to cell apoptosis. Recently, Keskanokwong et al. [21] showed that blockade of Kv4.3 with 4-AP or Ad-Kv4.3 antisense induced CaMKII dissociation from the Kv4.3–CaMKII complex and subsequent activation of the dissociated CaMKII; in addition, these effects were independent of Kv4.3 K+ channel activation and action potential. Since CaMKII mediates cell apoptosis and necrosis, we speculated that inhibition of Kv4.3 K+ channels induced HEK-293 and HEK-293T cell death through CaMKII activation. Results from the present study showed that the CaMKII-specific inhibitor KN-93 abolished cell apoptosis and necrosis induced by Kv4.3 K+ channel inhibition (Figure 8), confirming our hypothesis.

As mentioned above, the down-regulation of Kv4.3 K+ channels occur in many diseases, but it is not clear whether the down-regulation of Kv4.3 K+ channels is only a consequence of disease or whether it can be an initiator to promote the disease process. We found that the CaMKII-specific inhibitor KN-93 abolished Kv4.3 inhibition-induced cell apoptosis and necrosis, indicating that inhibition of Kv4.3-induced cell death occurred through CaMKII activation, thus the down-regulation of Kv4.3 K+ channels could be regarded as a promoter for certain disease processes through activating CaMKII. Keskanokwong et al. [21] showed that blockade of Kv4.3 with 4-AP or Ad-Kv4.3 antisense induced CaMKII dissociation from the Kv4.3–CaMKII complex and subsequent activation of the dissociated CaMKII, which strongly supported our results from the present study. In cardiac hypertrophy, heart failure or cardiac infarction, Kv4.3 K+ channels generally decreased. We have put forward a new explanation for the pathological role of Kv4.3 K+ channels, namely, the down-regulation of Kv4.3 K+ channels worsens these disease processes through activating CaMKII, resulting in more cardiomyocyte hypertrophy and apoptosis/necrosis. A combination of the present study and that by Keskanokwong et al. [21] suggests that the activation of CaMKII by Kv4.3 K+ channel inhibition is a common cellular process. Although we have discovered the Kv4.3/CaMKII/cell death pathway in HEK-293 and HEK-293T cells, the relevance of the finding to physiology or pathophysiology of cardiomyocytes needs to be identified further.

Our results from the present study showed that the extent of apoptosis and necrosis in HEK-293 and HEK-293T cells was different. HEK-293T cells expressing more Kv4.3 K+ channels showed more necrosis (a more serious cell injury) when Kv4.3 K+ channels were inhibited. Since CaMKII is coupled to Kv4.3 K+ channels, we speculate that more Kv4.3 protein expression will couple more reserved CaMKII; when Kv4.3 K+ channels are inhibited, Kv4.3 uncoupling will release more CaMKII, leading to more CaMKII activation and an increase in the apoptosis–necrosis switch.

The polyomaviruses BK virus, JC virus and SV40 encode the large T-antigen, which induces tumours in various animal models and humans [31]. The present study suggests that inhibition of Kv4.3 K+ channels could be a potential method to treat polyomavirus-associated tumours.

Abbreviations

     
  • 4-AP

    4-aminopyridine

  •  
  • AP-1/-2

    activator protein 1/2

  •  
  • CaMKII

    calcium/calmodulin-dependent protein kinase II

  •  
  • GAPDH

    glyceraldehyde-3-phosphate dehydrogenase

  •  
  • HEK

    human embryonic kidney

  •  
  • HERG

    human ether-a-go-go-related gene

  •  
  • Ito

    transient outward current

  •  
  • LDH

    lactate dehydrogenase

  •  
  • MTT

    3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyl-2H-tetrazolium bromide

  •  
  • PI

    propidium iodide

  •  
  • siRNA

    small interfering RNA

  •  
  • Sp1

    specificity protein 1

  •  
  • SV40

    simian virus 40

AUTHOR CONTRIBUTION

Qi Li, Ying Zhang, Yue Sheng, Rong Huo, Bo Sun, Xue Teng and Na Li performed the cell culture, Western blot and cell viability assay experiments. Ying Zhang and Rong Huo performed the real-time PCR experiments. Ying Zhang, Qi Li and De-Li Dong performed the patch-clamp experiments. Bao-Feng Yang gave constructive suggestions. De-Li Dong designed the project, prepared the Figures, and wrote and revised the paper.

FUNDING

This work was supported by the Funds for Creative Research Groups of National Natural Science Foundation of China [grant number 81121003], the National Natural Science Foundation of China [grant number 81173049], the Chang Jiang Scholar Candidates Program for Provincial Universities in Heilongjiang [grant number 2011CJHB002] and the National Basic Research Program of China [grant number 2012CB517803].

References

References
1
Kääb
S.
Dixon
J.
Duc
J.
Ashen
D.
Näbauer
M.
Beuckelmann
D. J.
Steinbeck
G.
McKinnon
D.
Tomaselli
G. F.
Molecular basis of transient outward potassium current downregulation in human heart failure: a decrease in Kv4.3 mRNA correlates with a reduction in current density
Circulation
1998
, vol. 
98
 (pg. 
1383
-
1393
)
2
Zicha
S.
Xiao
L.
Stafford
S.
Cha
T. J.
Han
W.
Varro
A.
Nattel
S.
Transmural expression of transient outward potassium current subunits in normal and failing canine and human hearts
J. Physiol.
2004
, vol. 
561
 (pg. 
735
-
748
)
3
Xiao
L.
Coutu
P.
Villeneuve
L. R.
Tadevosyan
A.
Maguy
A.
Le Bouter
S.
Allen
B. G.
Nattel
S.
Mechanisms underlying rate-dependent remodeling of transient outward potassium current in canine ventricular myocytes
Circ. Res.
2008
, vol. 
103
 (pg. 
733
-
742
)
4
Liu
H. B.
Yang
B. F.
Dong
D. L.
Calcineurin and electrical remodeling in pathologic cardiac hypertrophy
Trends Cardiovasc. Med.
2010
, vol. 
20
 (pg. 
148
-
153
)
5
Maguy
A.
Le Bouter
S.
Comtois
P.
Chartier
D.
Villeneuve
L.
Wakili
R.
Nishida
K.
Nattel
S.
Ion channel subunit expression changes in cardiac Purkinje fibers: a potential role in conduction abnormalities associated with congestive heart failure
Circ. Res.
2009
, vol. 
104
 (pg. 
1113
-
1122
)
6
Qin
D.
Huang
B.
Deng
L.
El-Adawi
H.
Ganguly
K.
Sowers
J. R.
El-Sherif
N.
Downregulation of K+ channel genes expression in type I diabetic cardiomyopathy
Biochem. Biophys. Res. Commun.
2001
, vol. 
283
 (pg. 
549
-
553
)
7
Gao
L.
Li
Y.
Schultz
H. D.
Wang
W. Z.
Wang
W.
Finch
M.
Smith
L. M.
Zucker
I. H.
Downregulated Kv4.3 expression in the RVLM as a potential mechanism for sympathoexcitation in rats with chronic heart failure
Am. J. Physiol. Heart. Circ. Physiol.
2010
, vol. 
298
 (pg. 
H945
-
H955
)
8
Kassiri
Z.
Zobel
C.
Nguyen
T. T.
Molkentin
J. D.
Backx
P. H.
Reduction of Ito causes hypertrophy in neonatal rat ventricular myocytes
Circ. Res.
2002
, vol. 
90
 (pg. 
578
-
585
)
9
Lebeche
D.
Kaprielian
R.
del Monte
F.
Tomaselli
G.
Gwathmey
J. K.
Schwartz
A.
Hajjar
R. J.
In vivo cardiac gene transfer of Kv4.3 abrogates the hypertrophic response in rats after aortic stenosis
Circulation
2004
, vol. 
110
 (pg. 
3435
-
3443
)
10
Giudicessi
J. R.
Ye
D.
Tester
D. J.
Crotti
L.
Mugione
A.
Nesterenko
V. V.
Albertson
R. M.
Antzelevitch
C.
Schwartz
P. J.
Ackerman
M. J.
Transient outward current (Ito) gain-of-function mutations in the KCND3-encoded Kv4.3 potassium channel and Brugada syndrome
Heart Rhythm
2011
, vol. 
8
 (pg. 
1024
-
1032
)
11
Bourdeau
M. L.
Morin
F.
Laurent
C. E.
Azzi
M.
Lacaille
J. C.
Kv4.3-mediated A-type K+ currents underlie rhythmic activity in hippocampal interneurons
J. Neurosci.
2007
, vol. 
27
 (pg. 
1942
-
1953
)
12
Uchida
H.
Sasaki
K.
Ma
L.
Ueda
H.
Neuron-restrictive silencer factor causes epigenetic silencing of Kv4.3 gene after peripheral nerve injury
Neuroscience
2010
, vol. 
166
 (pg. 
1
-
4
)
13
Bai
Y. L.
Liu
H. B.
Sun
B.
Zhang
Y.
Li
Q.
Hu
C. W.
Zhu
J. X.
Gong
D. M.
Teng
X.
Zhang
Q.
, et al. 
HIV Tat protein inhibits hERG K+ channels: a potential mechanism of HIV infection induced LQTs
J. Mol. Cell. Cardiol.
2011
, vol. 
51
 (pg. 
876
-
880
)
14
Fountain
S. J.
Cheong
A.
Li
J.
Dondas
N. Y.
Zeng
F.
Wood
I. C.
Beech
D. J.
Kv1.5 potassium channel gene regulation by Sp1 transcription factor and oxidative stress
Am. J. Physiol. Heart. Circ. Physiol.
2007
, vol. 
293
 (pg. 
H2719
-
H2725
)
15
Mucha
M.
Ooi
L.
Linley
J. E.
Mordaka
P.
Dalle
C.
Robertson
B.
Gamper
N.
Wood
I. C.
Transcriptional control of KCNQ channel genes and the regulation of neuronal excitability
J. Neurosci.
2010
, vol. 
30
 (pg. 
13235
-
13245
)
16
Zhang
X. Y.
Wang
S.
Yan
Z.
Zhang
Y. Q.
Wan
Y.
Zhang
B.
Wang
L. F.
Chai
Y. B.
Wei
J. G.
Promoter cloning and characterization of the rabbit BK channel β1 subunit gene
Gene
2009
, vol. 
438
 (pg. 
33
-
39
)
17
Salas
M. A.
Valverde
C. A.
Sánchez
G.
Said
M.
Rodriguez
J. S.
Portiansky
E. L.
Kaetzel
M. A.
Dedman
J. R.
Donoso
P.
Kranias
E. G.
, et al. 
The signalling pathway of CaMKII-mediated apoptosis and necrosis in the ischemia/reperfusion injury
J. Mol. Cell. Cardiol.
2010
, vol. 
48
 (pg. 
1298
-
1306
)
18
Vila-Petroff
M.
Salas
M. A.
Said
M.
Valverde
C. A.
Sapia
L.
Portiansky
E.
Hajjar
R. J.
Kranias
E. G.
Mundiña-Weilenmann
C.
Mattiazzi
A.
CaMKII inhibition protects against necrosis and apoptosis in irreversible ischemia-reperfusion injury
Cardiovasc. Res.
2007
, vol. 
73
 (pg. 
689
-
698
)
19
Wright
S. C.
Schellenberger
U.
Ji
L.
Wang
H.
Larrick
J. W.
Calmodulin-dependent protein kinase II mediates signal transduction in apoptosis
FASEB. J.
1997
, vol. 
11
 (pg. 
843
-
849
)
20
El-Haou
S.
Balse
E.
Neyroud
N.
Dilanian
G.
Gavillet
B.
Abriel
H.
Coulombe
A.
Jeromin
A.
Hatem
S. N.
Kv4 potassium channels form a tripartite complex with the anchoring protein SAP97 and CaMKII in cardiac myocytes
Circ. Res.
2009
, vol. 
104
 (pg. 
758
-
769
)
21
Keskanokwong
T.
Lim
H. J.
Zhang
P.
Cheng
J.
Xu
L.
Lai
D.
Wang
Y.
Dynamic Kv4.3-CaMKII unit in heart: an intrinsic negative regulator for CaMKII activation
Eur. Heart. J.
2011
, vol. 
32
 (pg. 
305
-
315
)
22
Cho
S.
Tian
Y.
Benjamin
T. L.
Binding of p300/CBP co-activators by polyoma large T antigen
J. Biol. Chem.
2001
, vol. 
276
 (pg. 
33533
-
33539
)
23
Huang
Y.
Domann
F. E.
Transcription factor AP-2 mRNA and DNA binding activity are constitutively expressed in SV40-immortalized but not normal human lung fibroblasts
Arch. Biochem. Biophys.
1999
, vol. 
364
 (pg. 
241
-
246
)
24
Saffer
J. D.
Jackson
S. P.
Thurston
S. J.
SV40 stimulates expression of the transacting factor Sp1 at the mRNA level
Genes Dev.
1990
, vol. 
4
 (pg. 
659
-
666
)
25
Moens
U.
Seternes
O. M.
Johansen
B.
Rekvig
O. P.
Mechanisms of transcriptional regulation of cellular genes by SV40 large T- and small T-antigens
Virus Genes
1997
, vol. 
15
 (pg. 
135
-
154
)
26
Szabò
I.
Zoratti
M.
Gulbins
E.
Contribution of voltage-gated potassium channels to the regulation of apoptosis
FEBS Lett.
2010
, vol. 
584
 (pg. 
2049
-
2056
)
27
Burg
E.D
Remillard
C. V.
Yuan
J. X.
K+ channels in apoptosis
J. Membr. Biol.
2006
, vol. 
209
 (pg. 
3
-
20
)
28
Wang
Z.
Roles of K+ channels in regulating tumour cell proliferation and apoptosis
Pflugers Arch.
2004
, vol. 
448
 (pg. 
274
-
286
)
29
Wonderlin
W. F.
Woodfork
K. A.
Strobl
J. S.
Changes in membrane potential during the progression of MCF-7 human mammary tumor cells through the cell cycle
J. Cell. Physiol.
1995
, vol. 
165
 (pg. 
177
-
185
)
30
Voets
T.
Droogmans
G.
Nilius
B.
Membrane currents and the resting membrane potential in cultured bovine pulmonary artery endothelial cells
J. Physiol.
1996
, vol. 
497
 (pg. 
95
-
107
)
31
Barbanti-Brodano
G.
Sabbioni
S.
Martini
F.
Negrini
M.
Corallini
A.
Tognon
M.
BK virus, JC virus and simian virus 40 infection in humans, and association with human tumors
Adv. Exp. Med. Biol.
2006
, vol. 
577
 (pg. 
319
-
341
)

Author notes

1

These authors contributed equally to this work.

Supplementary data