A critical cis-regulatory element for the CFTR (cystic fibrosis transmembrane conductance regulator) gene is located in intron 11, 100 kb distal to the promoter, with which it interacts. This sequence contains an intestine-selective enhancer and associates with enhancer signature proteins, such as p300, in addition to tissue-specific TFs (transcription factors). In the present study we identify critical TFs that are recruited to this element and demonstrate their importance in regulating CFTR expression. In vitro DNase I footprinting and EMSAs (electrophoretic mobility-shift assays) identified four cell-type-selective regions that bound TFs in vitro. ChIP (chromatin immunoprecipitation) identified FOXA1/A2 (forkhead box A1/A2), HNF1 (hepatocyte nuclear factor 1) and CDX2 (caudal-type homeobox 2) as in vivo trans-interacting factors. Mutation of their binding sites in the intron 11 core compromised its enhancer activity when measured by reporter gene assay. Moreover, siRNA (small interfering RNA)-mediated knockdown of CDX2 caused a significant reduction in endogenous CFTR transcription in intestinal cells, suggesting that this factor is critical for the maintenance of high levels of CFTR expression in these cells. The ChIP data also demonstrate that these TFs interact with multiple cis-regulatory elements across the CFTR locus, implicating a more global role in intestinal expression of the gene.

INTRODUCTION

The recruitment of TFs (transcription factors) and chromatin remodellers to cis-regulatory elements is fundamental to the mechanisms that control gene expression. ChIP-seq (chromatin immunoprecipitation followed by deep sequencing) has generated specific chromatin signatures for many different types of regulatory elements found in non-coding regions of the genome [15]. For example, enhancer elements are often enriched for the histone acetyltransferase p300, and are marked by H3 histones monomethylated on Lys4 (H3K4me1), but lack H3K4me3 (H3 histones trimethylated on Lys4)-modified histones [35]. Activity of distal enhancers is often facilitated by long-range interactions between these elements and their target promoters, causing tissue-specific chromatin looping events and associated transcriptional activation (reviewed in [6]). Although the location of many tissue-specific enhancers can be identified through mapping regions of open chromatin genome-wide [7], it remains a challenge to identify trans-acting factors responsible for enhancer activity.

The 189 kb CFTR [CF (cystic fibrosis) transmembrane conductance regulator] gene shows a complex pattern of expression, driven in part by cell-type-specific enhancers in non-coding regions of the locus. Mutations in CFTR cause the common autosomal recessive disorder CF [8]. In the present study, we aimed to characterize the factors that regulate the activity of a cell-type-selective enhancer element located in a region of open chromatin in intron 11 of the gene [9]. CFTR is expressed in specialized epithelial cells of many endoderm-derived tissues, including the airway, pancreas, small intestine and male genital duct, and also in some non-epithelial cell types [1013]. However, the mechanisms governing CFTR expression are cell-type-dependent, and differ in the intestinal and airway epithelium [9,14]. This selectivity is apparently achieved, at least in part, by the utilization of different cis-regulatory elements within the locus. The transcriptional pathways that co-ordinate these elements are not fully defined (reviewed in [15]). In the present study our goal was to establish the network of transcription factors that activate CFTR intronic enhancers in the intestine.

The intestine-selective enhancer in intron 11 at 1811+0.8 kb (where 1811 is the last coding base in exon 11) was identified by DNase-chip within a 1.5 kb DHS (DNase I hypersensitive site). This DHS contains a cis-acting element that recruits p300, and co-operates with other intestinal enhancer elements within CFTR [9]. Moreover, the intron 11 element associates closely with the CFTR promoter by direct chromatin looping, demonstrated by 3C (chromosome conformation capture) [9]. In the present study, in vitro DNase I footprinting was used to identify sequences within the intron 11 DHS element that bound nuclear factors in a cell-type-selective manner. Next, bioinformatic predictions of candidate TF interactors were evaluated by EMSA (electrophoretic mobility-shift assay) in vitro and ChIP in vivo. These studies reveal a TF complex interacting with the intron 11 DHS element core that includes FOXA1/A2 (forkhead box A1/A2), HNF1 (hepatocyte nuclear factor 1) and CDX2 (caudal-type homeobox 2).

FOXA1/A2, important regulators of liver development and differentiation, are expressed in many endoderm-derived tissues [16,17] and can act as pioneer factors that facilitate binding of additional TFs to enhancers (reviewed in [18]). FOXA family members remodel histones in a SWI/SNF-independent manner by interacting with H3 and H4 histones, and subsequently displacing H1-linker histones [19]. HNF1 was implicated in intestinal control of CFTR expression through its interactions with other cis-acting regulatory elements in introns 1, 10, 17a and 20 [20,21]. Hnf1α is also required for normal expression of Cftr in the mouse intestine [20]. In the present study we show its recruitment to the intron 11 DHS element in vivo [9]. CDX2, a master regulator of gut development and differentiation [22], is known to co-ordinate gene expression with HNF1α [2330]. In vitro studies previously implicated CDX2 as a candidate TF interacting with CFTR cis-regulatory elements in intestinal and pancreatic cells; however, no evidence was obtained for its role in vivo [31]. We now show interaction of CDX2 with the intron 11 DHS element in vitro and in vivo, and also demonstrate its recruitment to adjacent cis-regulatory elements. Moreover, a decrease in CFTR mRNA levels following siRNA (small interfering RNA)-mediated depletion of CDX2 confirms the importance of this factor in regulating CFTR expression in vivo. Thus activity of the CFTR locus in intestinal epithelial cells may be co-ordinated by the interaction of pioneer factors with the intron 11 DHS core element, and subsequent recruitment of a network of intestinal-selective TFs that bind to multiple cis-regulatory elements across the locus.

EXPERIMENTAL

Plasmids and expression vectors

Reporter constructs containing the 787 bp minimal CFTR promoter and the 1.5 kb full-length DHS11 enhancer fragment were described previously [21,32,33]. Mutagenesis of plasmids was performed using the QuikChange® II XL or Lightning Multi Site-Directed Mutagenesis kits (Agilent Technologies) according to the manufacturer's protocol with primers listed in Supplementary Table S1 (at http://www.BiochemJ.org/bj/446/bj4460203add.htm). Rat HNF1A cDNA was PCR-amplified from rHNF1α-CMV4 (a gift of Riccardo Cortese), subcloned into pRCII (Invitrogen), and cloned into pcDNA3.1(−) using BamHI and XbaI to generate the HNF1α expression plasmid. The CDX2 [31], CUX1 (cut-like homeobox 1) p110 and p200 [34], and mFOXA1 [35] expression plasmids have been described previously. The rat FOXA2 expression plasmid was made by cloning rFOXA2 cDNA [35] into pcDNA3.1(−) using XhoI and BamHI. The HOXB7 (homeobox protein 7) expression plasmid was purchased from Addgene (plasmid 8537) [36].

Cell culture and transient reporter assays

The human colon carcinoma cell lines Caco2 and HT29, and primary skin fibroblasts (GM08333) were grown in DMEM (Dulbecco's modified Eagle's medium) supplemented with 10% FBS (fetal bovine serum). Caco2 cells were co-transfected with the luciferase reporter constructs and Renilla expression vector (Promega), in 24-well plates with Lipofectin® (Invitrogen), using standard methods. Cells were lysed after 48 h and luciferase assays were performed as reported previously [21]. Data from at least two independent plasmid preparations of each construct were consistent.

DNase I footprinting

Overlapping 200–300 bp fragments of the DHS11 region were PCR amplified with Pfu DNA polymerase and primers in Supplementary Table S1, and cloned into pSC-B in the reverse orientation using the StrataClone Blunt PCR Cloning kit (Agilent Technologies). Probes were gel-purified following excision from vectors using ClaI and SmaI or KpnI and SpeI, to label the sense or antisense strands respectively. Nuclear extracts were generated and DNase I footprinting reactions were carried out as described previously [20].

EMSAs

EMSA reactions were performed using standard protocols using double-stranded probes and competitors detailed in Supplementary Table S1. IVT (in vitro translated) proteins were produced using TNT® T7 or SP6 Quick Coupled Reticulocyte System (Promega), and confirmed by Western blot analysis. Antibodies against HNF-1 (Santa Cruz Biotechnology, catalogue number sc-8986x), FOXA2 (Santa Cruz Biotechnology, catalogue number sc-6554x), FOXA1 (Abcam, catalogue number ab5089), CDX2 (Bethyl Laboratories, catalogue number A300-691A), CUX1 1300 [37], FLAG® M2 (Sigma–Aldrich, catalogue number F3165), BARX2 (BARX homeobox 2) (Santa Cruz Biotechnology, catalogue number sc-9128X), PDX1 (pancreatic duodenal homeobox-1 protein; Santa Cruz Biotechnology, catalogue number sc-14662X), and PBX1 (pre-B-cell leukaemia TF 1; Santa Cruz Biotechnology, catalogue number sc-889X) were used for supershifts analysis.

ChIP

ChIP was performed using standard methods. Chromatin was sonicated using a Bioruptor® Plus device (Diagenode) to an average size of 500 bp. Immunoprecipitations were performed with antibodies against FOXA1, FOXA2, CDX2 (Bethyl Laboratories, catalogue number A300-691A), HNF1, normal goat IgG (Santa Cruz Biotechnology, catalogue number sc-2028) or normal rabbit IgG (Millipore, catalogue number 12-370). Enrichment was analysed relative to IgG using SYBR® Green qPCR (quantitative PCR) with primers listed in Supplementary Table S1.

Transient siRNA knockdown and rescue

For siRNA knockdown only, Caco2 cells were reverse-transfected with Lipofectamine™ RNAiMAX (Invitrogen) according to the manufacturer's protocol in 24-well plates using 20 nM hCDX2 (Santa Cruz Biotechnology, catalogue number sc-43680), hHNF1α (Santa Cruz Biotechnology, catalogue number sc-35567) or control (Santa Cruz Biotechnology, catalogue number sc-37007) siRNA. For rescue experiments Caco2 cells were plated 48 h before forward transfection with Lipofectamine™ 2000 (Invitrogen) according to the manufacturer's protocol using 10 nM hCDX2 or control siRNA and 0.8 μg of pRC-CMV or pRC-mCdx2 expression plasmid [31]. Mock-transfected cells were treated with transfection reagent only. Cells were lysed after 48 h for assay of protein and mRNA expression.

Western blot analysis

Cells were lysed by standard protocols and protein levels were assayed by Western blot analysis with antibodies against CDX2 (Bethyl Laboratories, catalogue number A300-692A), HNF1, FOXA1, FOXA2 and β-tubulin (Sigma–Aldrich, catalogue number T4026). Protein quantification was performed using ImageJ software (NIH).

qRT–PCR (quantitative reverse transcription–PCR)

Total RNA was extracted using TRIzol® (Invitrogen), and TaqMan® reverse-transcription reactions were performed (Applied Biosytems). CFTR expression was measured using the TaqMan® primer/probe set spanning CFTR exons 5 and 6, and normalized to endogenous 18S rRNA [38].

RESULTS

In vitro DNase I footprinting reveals binding of multiple nuclear proteins to the CFTR intron 11 DHS enhancer region

The intron 11 (1811+0.8 kb) enhancer was originally identified within a DHS that encompassed approximately 1.5 kb of genomic DNA (see Table 1 for all relevant CFTR DHS co-ordinates). The DHS was evident in CFTR-expressing intestinal epithelial cells (Caco2 and HT29, colon carcinoma) (Figure 1A) and primary epididymis cells, but not in skin fibroblasts that do not express CFTR [9]. To characterize sequences within the intron 11 DHS region that contribute to enhancer activity, in vitro DNase I footprinting was performed. Four overlapping 250–300 bp fragments (C–F) were designed to span the central core of the DHS region (Figure 1B). Sense and antisense strands of these fragments were radiolabelled and used as probes for DNase I footprinting with Caco2 nuclear extracts. These experiments identified four DNA sequences that were protected from DNase I digestion [PR (protected region)], two each in fragments 11D (PR1 and PR2) and 11F (PR3 and PR4) (Figures 1C–1E). The trans-acting factors that generate the PRs show some cell-type-specificity, as the PRs were not observed using nuclear extracts from 16HBE14o− cells (human bronchial epithelial cells; CFTR+) or skin fibroblasts (CFTR−) (results not shown).

Table 1
CFTR DHS locations
DHS Location in CFTR locus hg17 co-ordinates 
−20.9 kb*† 5′ chr7:116693001–116693396 
185+10 kb Intron 1 chr7:116723600–116724700 
1716+13.2/13.7 kb Intron 10 (ab) chr7:116806300–116807600 
1716+23 kb Intron 10 (c) chr7:116816300–116817000 
1811+0.8 kb Intron 11 chr7:116822000–116823400 
3271+0.7 kb† Intron 17a chr7:116844713–116845585 
4005+3.7 kb† Intron 20 chr7:116878911–116881521 
4374+1.3 kb Intron 23 chr7:116899700–116901100 
+6.8 kb‡ 3′ chr7:116907887–116908087 
+15.6 kb‡ 3′ chr7:116916600–116918100 
DHS Location in CFTR locus hg17 co-ordinates 
−20.9 kb*† 5′ chr7:116693001–116693396 
185+10 kb Intron 1 chr7:116723600–116724700 
1716+13.2/13.7 kb Intron 10 (ab) chr7:116806300–116807600 
1716+23 kb Intron 10 (c) chr7:116816300–116817000 
1811+0.8 kb Intron 11 chr7:116822000–116823400 
3271+0.7 kb† Intron 17a chr7:116844713–116845585 
4005+3.7 kb† Intron 20 chr7:116878911–116881521 
4374+1.3 kb Intron 23 chr7:116899700–116901100 
+6.8 kb‡ 3′ chr7:116907887–116908087 
+15.6 kb‡ 3′ chr7:116916600–116918100 
*

Distance upstream of CFTR translational start site.

DHS identified through Southern blotting, not detected by DNase-chip.

Distance downstream of last coding base of CFTR transcript.

Identification of multiple sites of DNA–protein interaction in the intron 11 DHS region of CFTR

Figure 1
Identification of multiple sites of DNA–protein interaction in the intron 11 DHS region of CFTR

(A) DHS regions identified across the CFTR locus in Caco2 cells by DNase-chip [9] including the 1.5 kb region in intron 11 (DHS11). Distances along the locus are relative to the first base of exon 1 of CFTR. (B) Four overlapping 250–300 bp probes spanning DHS11 were used for DNase I footprinting which revealed four regions protected from DNase I (PRs 1–4) on the sense strand of DHS11 fragment D (C) and fragment F (D) probes. The AG ladder shows sequence reference, and probes were incubated alone or with DNase I as controls, or with DNase I plus 30 or 60 μg of Caco2 nuclear extract (NE). (E) Sense strand sequences (5′→3′) are shown for the four PRs.

Figure 1
Identification of multiple sites of DNA–protein interaction in the intron 11 DHS region of CFTR

(A) DHS regions identified across the CFTR locus in Caco2 cells by DNase-chip [9] including the 1.5 kb region in intron 11 (DHS11). Distances along the locus are relative to the first base of exon 1 of CFTR. (B) Four overlapping 250–300 bp probes spanning DHS11 were used for DNase I footprinting which revealed four regions protected from DNase I (PRs 1–4) on the sense strand of DHS11 fragment D (C) and fragment F (D) probes. The AG ladder shows sequence reference, and probes were incubated alone or with DNase I as controls, or with DNase I plus 30 or 60 μg of Caco2 nuclear extract (NE). (E) Sense strand sequences (5′→3′) are shown for the four PRs.

Prediction of candidate transcription factors that interact with the enhancer core

In silico analysis of the PR sequences using MatInspector (http://www.genomatix.de) identified an extensive list of potential TFBSs (TF-binding sites), and this was used to generate a subset of candidate TFs on the basis of cell specificity and probable functional relevance (Table 2). These candidates include TFs expressed in epithelial cell types that are relevant to CF, those that have previously been shown to co-ordinate regulation of CFTR expression, and those that recruit chromatin remodellers. Included in this list are FOXA2, FOXF2, CDX2, HNF1, MECOM (MDS1 and EVI1 complex locus), C/EBPα (CCAAT/enhancer-binding protein α) and HOXB7, among others (see Table 2).

Table 2
Candidate transcription factors predicted to bind PRs 1–4

Uppercase letters indicate the core sequence comprising the most conserved consecutive positions of the matrix. HMGA1, high-mobility group AT-hook 1; SOX9, sex determining region Y box 9; STAT5, signal transducer and activator of transcription 5.

(a) PR1: TGTCAAAGAGATGTAAATATAGATAATGTATGTCA 
Factor name Matrix Matrix similarity Sequence (strand) 
MECOM V$EVI1.04 0.734 aagagatgtaaaTATAg (+) 
FOXA2 V$XFD1.01 0.931 gagatgTAAAtatagat (+) 
CUX1 V$CLOX.01 0.871 cattATCTatatttacatc (−) 
(b) PR2: TTTGTGGTTAAACTGTAACTTTCAGTTTAAACAATTATTGGTGACT 
Factor name Matrix Matrix similarity Sequence (strand) 
HNF1α V$HNF1.01 0.809 aGTTAcagtttaaccac (−) 
FOXF2 V$FREAC2.01 0.904 tcagttTAAAcaattat (+) 
HOXB7 V$HOXB7.01 0.841 accaatAATTgtttaaact (−) 
BARX2 V$BARX2.02 0.929 gtttaaacAATTattggtg (+) 
(c) PR3: GTAAGGCAATAAATCAATAGATACGGATAATTCACAGG 
Factor name Matrix Matrix similarity Sequence (strand) 
HOXB8 V$HOXB8.01 0.897 taaggcaATAAatcaatag (+) 
CDX2 V$CDX2.03 0.995 ctattgatTTATtgcctta (−) 
HNF6 V$HNF6.01 0.979 gcaataaaTCAAtagat (+) 
SOX9 V$SOX9.01 0.905 ataaatCAATagatacggataattc (+) 
CUX1 V$CLOX.01 0.865 ataaATCAatagatacgga (+) 
HMGA1 V$HMGIY.01 0.929 cctgtgAATTatccgtatctattga (−) 
HOXB5 V$HOXB5.01 0.849 cctgtGAATtatccgtatc (−) 
  0.843 acggaTAATtcacaggctt (+) 
(d) PR4: TTCTAAGAATTCCACAAATTTAGA 
Factor name Matrix Matrix similarity Sequence (strand) 
STAT5(α/β) V$STAT5.01 0.966 cttaTTCTaagaattccac (+) 
C/EBPα V$CEBPA.01 0.972 aaatttgtGGAAttc (−) 
(a) PR1: TGTCAAAGAGATGTAAATATAGATAATGTATGTCA 
Factor name Matrix Matrix similarity Sequence (strand) 
MECOM V$EVI1.04 0.734 aagagatgtaaaTATAg (+) 
FOXA2 V$XFD1.01 0.931 gagatgTAAAtatagat (+) 
CUX1 V$CLOX.01 0.871 cattATCTatatttacatc (−) 
(b) PR2: TTTGTGGTTAAACTGTAACTTTCAGTTTAAACAATTATTGGTGACT 
Factor name Matrix Matrix similarity Sequence (strand) 
HNF1α V$HNF1.01 0.809 aGTTAcagtttaaccac (−) 
FOXF2 V$FREAC2.01 0.904 tcagttTAAAcaattat (+) 
HOXB7 V$HOXB7.01 0.841 accaatAATTgtttaaact (−) 
BARX2 V$BARX2.02 0.929 gtttaaacAATTattggtg (+) 
(c) PR3: GTAAGGCAATAAATCAATAGATACGGATAATTCACAGG 
Factor name Matrix Matrix similarity Sequence (strand) 
HOXB8 V$HOXB8.01 0.897 taaggcaATAAatcaatag (+) 
CDX2 V$CDX2.03 0.995 ctattgatTTATtgcctta (−) 
HNF6 V$HNF6.01 0.979 gcaataaaTCAAtagat (+) 
SOX9 V$SOX9.01 0.905 ataaatCAATagatacggataattc (+) 
CUX1 V$CLOX.01 0.865 ataaATCAatagatacgga (+) 
HMGA1 V$HMGIY.01 0.929 cctgtgAATTatccgtatctattga (−) 
HOXB5 V$HOXB5.01 0.849 cctgtGAATtatccgtatc (−) 
  0.843 acggaTAATtcacaggctt (+) 
(d) PR4: TTCTAAGAATTCCACAAATTTAGA 
Factor name Matrix Matrix similarity Sequence (strand) 
STAT5(α/β) V$STAT5.01 0.966 cttaTTCTaagaattccac (+) 
C/EBPα V$CEBPA.01 0.972 aaatttgtGGAAttc (−) 

As an additional approach to identify sites of functional DNA–protein interactions with the intron 11 DHS region, we analysed the predicted TFBSs in regions of high cross-species conservation within the element, as these sequences often encompass sites that are subject to positive selection. In total, 15 peaks of high conservation were identified from the 17 vertebrate species multiz alignment and conservation track available on the UCSC genome browser [3941] (Supplementary Figure S1 at http://www.BiochemJ.org/bj/446/bj4460203add.htm). MatInspector analysis of the 15 CRs (conserved regions) identified 152 potential TFBSs, including general and tissue-specific TFs (data available from A.H. upon request). Most notably, there were additional sites for some of the candidate factors predicted to bind the PRs, including CDX2 (three sites), HNF1 (five sites) and FOXA2 (one site). The interaction of these factors with the intron 11 DHS region is evaluated further below.

Identification of factors that interact in vitro with PR1 and PR2 sequences

The in vitro potential of the candidate TFs (Table 2) to bind their predicted cognate sites in DHS11 PR1 and PR2 was investigated using EMSAs (Figure 2). Double-stranded DNA probes corresponding to the individual PRs (Supplementary Table S1) were radiolabelled and used in EMSA reactions with nuclear extracts from Caco2 cells. Nuclear proteins bound to both PR1 and PR2 in vitro, and the specificity of these interactions was shown by self-competition (10× and 100× molar excess of the probe) and by competition experiments with oligonucleotides corresponding to consensus binding sites of the candidate TFs.

In vitro interactions of FOXA1/A2, HNF1 and CDX2 with the intron 11 DHS enhancer

Figure 2
In vitro interactions of FOXA1/A2, HNF1 and CDX2 with the intron 11 DHS enhancer

EMSAs using probes for PR1 (A and B), PR2 (C and D) or PR3 (E and F) sequences of the DHS11 enhancer. PR1 interacts with IVT FOXA1 (A) and FOXA2 (B), complex (i). Competition with 10× or 100× molar excess of unlabelled oligonucleotides are shown. A supershift is seen with FOXA1-specific (A) or FOXA2-specific (B) antibody (ii), but not with isotype-matched PDX1 antibody. (C and D) PR2 generates a major complex with Caco2 nuclear extracts (i in C) or IVT HNF1α (iii in D). Competition with unlabelled oligonucleotides is shown. A supershift is seen with the HNF1-specific antibody (ii in C, iv in D), but not with isotype-matched anti-PBX1 antibody. (E and F) Protein complexes form between PR3 and Caco2 nuclear extracts (i and ii in E) or IVT CDX2 (v in F). Competition with unlabelled oligonucleotides is shown. Supershifts are seen with the CDX2-specific antibody (iii and iv in E, vi in F), and the HNF1-specific antibody (iv in E), but not with isotype-matched PBX1 antibody. NE, nuclear extract.

Figure 2
In vitro interactions of FOXA1/A2, HNF1 and CDX2 with the intron 11 DHS enhancer

EMSAs using probes for PR1 (A and B), PR2 (C and D) or PR3 (E and F) sequences of the DHS11 enhancer. PR1 interacts with IVT FOXA1 (A) and FOXA2 (B), complex (i). Competition with 10× or 100× molar excess of unlabelled oligonucleotides are shown. A supershift is seen with FOXA1-specific (A) or FOXA2-specific (B) antibody (ii), but not with isotype-matched PDX1 antibody. (C and D) PR2 generates a major complex with Caco2 nuclear extracts (i in C) or IVT HNF1α (iii in D). Competition with unlabelled oligonucleotides is shown. A supershift is seen with the HNF1-specific antibody (ii in C, iv in D), but not with isotype-matched anti-PBX1 antibody. (E and F) Protein complexes form between PR3 and Caco2 nuclear extracts (i and ii in E) or IVT CDX2 (v in F). Competition with unlabelled oligonucleotides is shown. Supershifts are seen with the CDX2-specific antibody (iii and iv in E, vi in F), and the HNF1-specific antibody (iv in E), but not with isotype-matched PBX1 antibody. NE, nuclear extract.

FOXA1/A2 interact in vitro with PR1

As FOXA1 and FOXA2 have identical consensus binding sequences, we investigated the in vitro potential of both of these factors to bind PR1. A shift in the migration of PR1 oligonucleotide was observed upon incubation with IVT FOXA1 or FOXA2 protein (Figures 2A and 2B, lane 2, complex i). Self-competition with 10× and 100× molar excess of PR1 or with a FOXA consensus oligonucleotide inhibited formation of this complex (Figures 2A and 2B; self, lanes 3 and 4; consensus, lanes 7 and 8). Competition with a PR1 oligonucleotide containing a mutation in the predicted FOXA-binding site did not inhibit complex i (Figures 2A and 2B, lanes 5 and 6). Moreover, inclusion of an antibody specific for either FOXA1 or FOXA2 in the EMSA reaction resulted in a supershift of the PR1 probe (Figures 2A and 2B, lane 9, complex ii). Although these results demonstrate an interaction of IVT FOXA1/A2 with PR1, equivalent data were not obtained with nuclear extracts from Caco2 cells, which also express both FOXA1 and FOXA2, as shown by Western blot (Supplementary Figure S2A at http://www.BiochemJ.org/bj/446/bj4460203add.htm). This suggests that, in the complex mixture of nuclear proteins in Caco2 cells, there may be other factors that compete with FOXA1/A2 at this site.

HNF1 interacts in vitro with PR2

EMSA experiments using PR2 as a probe and Caco2 nuclear extracts generated multiple complexes (Figure 2C). Although these were all specific, as shown by their complete loss upon competition with 100× excess of unlabelled PR2, only the slowest mobility complex (i) apparently contains HNF1 protein. Loss of complex i occurs upon competition with HNF1 consensus oligonucleotide (Figure 2C, lanes 5 and 6), but not with unlabelled PR2 oligonucleotide that contains a mutation in the predicted HNF1-binding site (Figure 2C, lane 7). Co-incubation of Caco2 nuclear extracts, PR2 probe and an antibody specific for HNF1 resulted in a supershift of complex i (Figure 2C, lane 8, complex ii). Equivalent EMSA experiments with IVT HNF1α confirmed the in vitro binding of this factor to PR2 (Figure 2D). Thus HNF1α is a major factor in the complex that interacts with PR2 in vitro. Although additional proteins appear to interact specifically with this probe, as demonstrated by the complexes of different mobility seen in Figure 2(C), at present these have not been characterized.

Other candidate factors

The other candidate TFBS in PR1 (MECOM and CUX1) and PR2 (FOXF2, HOXB7 and BARX2) were also investigated by EMSA using Caco2 nuclear extracts (results not shown). Competition with MECOM consensus oligonucleotide did not compete with protein complexes formed with PR1. While these complexes partially competed with CUX1 consensus oligonucleotide, IVT p110 or p200 CUX1 isoforms did not interact strongly with the PR1 probe. Protein complexes generated with PR2 were not destabilized with FOXF2 consensus oligonucleotide. Both HOXB7 and BARX2 consensus oligonucleotides partially competed PR2 protein complexes, however, no interaction was observed upon addition of BARX2-specific antibody and IVT HOXB7 did not complex with PR2 probe. These results suggested that further investigation of the interaction of these factors with PR1 and PR2 was not warranted.

An in vitro interaction of CDX2 with PR3

Of the seven factors predicted to bind PR3 (Table 2), CDX2 was pursued due to its probable functional importance, and our previous work showing an in vitro interaction of CDX2 with other cis-regulatory elements in CFTR [31]. EMSA experiments using PR3 as a probe and Caco2 nuclear extracts demonstrated multiple interacting proteins (Figure 2E). Competition with excess PR3 showed that these complexes were specific (Figure 2E, lanes 3 and 4). A CDX2 consensus oligonucleotide was used in competition experiments to reveal which complex, if any, included CDX2 protein. A fast migrating complex was specifically competed in these experiments (Figure 2E, lanes 6 and 7, complex i). Competition with excess unlabelled PR3 oligonucleotide containing a mutation in the CDX2 consensus binding site did not destabilize complex i (Figure 2E, lane 5). Moreover, addition of an antibody specific for CDX2 to the EMSA reaction caused a supershift of complex i (Figure 2E, lane 10, complex iii). IVT CDX2 generated an EMSA profile with PR3 that supported the characterization of complex i (Figure 2F): a single complex was formed (v) at the mobility predicted from complex i (Figure 2E), and this supershifted with CDX2-specific antibody (Figure 2F, lane 9, complex vi).

Since multiple protein complexes were seen with PR3 and Caco2 nuclear extracts, and it is known that HNF1 and CDX2 co-regulate the transcription of many genes [2330], we next evaluated the potential contribution of HNF1 to these complexes, despite lack of a predicted binding site for this factor in PR3. Interestingly, upon competition with excess HNF1 consensus oligonucleotide, complex ii is competed more effectively than with the CDX2 consensus (Figure 2E, lane 9 compared with lane 7), whereas complex i is only partially inhibited (Figure 2E, lanes 8 and 9). Additionally, the supershift that is caused by interaction of an antibody specific for HNF1 appears to be mainly from complex ii (Figure 2E, lane 11, complex iv). Interestingly IVT HNF1α, alone or in combination with IVT CDX2, did not generate protein complexes with PR3 (results not shown), suggesting that although HNF1 contributes to the complex binding at PR3 in vivo, it requires additional partners in a multi-protein complex to form stable interactions.

Mutation of FOXA, HNF1 or CDX2 consensus binding sites reduces the activity of the intron 11 DHS enhancer element

Using reporter constructs in which the CFTR basal promoter drives luciferase expression, we evaluated the contribution of the FOXA, HNF1 and CDX2 motifs in PRs 1–3 to the enhancer activity of the intron 11 DHS element reported previously [9]. The consensus motifs in the full-length DHS 11 element were destroyed by site-directed mutagenesis, constructs were transiently transfected into Caco2 cells and luciferase activity was measured (Figure 3). Disruption of the FOXA consensus site core sequence in PR1 reduced enhancer activity by 34%, whereas mutation of the predicted HNF1 and CDX2 site cores, in PR2 and PR3 respectively, reduced enhancer activity by over 60%. When both the HNF1 and CDX2 sites were mutated in the same construct, an 87% reduction of activity was observed. These results suggest that FOXA1/A2, HNF1 and CDX2 contribute to the enhancer activity of the DHS11 element.

FOXA, HNF1 and CDX2 sites contribute to the enhancer activity of the DHS11 region in vitro

Figure 3
FOXA, HNF1 and CDX2 sites contribute to the enhancer activity of the DHS11 region in vitro

Caco2 cells were transfected with pGL3B luciferase reporter vectors containing the 787 bp basal CFTR promoter and the 1.5 kb DHS11 region cloned into the enhancer site of the vector. Mutations were made in FOXA, HNF1 or CDX2 predicted consensus sequences, alone or in combination. Renilla luciferase vector was used as a transfection efficiency control. Luciferase expression is shown relative to the CFTR basal promoter-only vector. Values are means±S.E.M. (n=9). **P<0.01; ***P<0.001, comparing the mutant vectors to the wild-type DHS11-containing vector using an unpaired Student's t test.

Figure 3
FOXA, HNF1 and CDX2 sites contribute to the enhancer activity of the DHS11 region in vitro

Caco2 cells were transfected with pGL3B luciferase reporter vectors containing the 787 bp basal CFTR promoter and the 1.5 kb DHS11 region cloned into the enhancer site of the vector. Mutations were made in FOXA, HNF1 or CDX2 predicted consensus sequences, alone or in combination. Renilla luciferase vector was used as a transfection efficiency control. Luciferase expression is shown relative to the CFTR basal promoter-only vector. Values are means±S.E.M. (n=9). **P<0.01; ***P<0.001, comparing the mutant vectors to the wild-type DHS11-containing vector using an unpaired Student's t test.

FOXA1/A2 interact in vivo with CFTR cis-regulatory elements

The interaction of FOXA1 and FOXA2 with the CFTR locus in vivo was investigated by ChIP, followed by SYBR Green qPCR (Figure 4). PCR primer sets were within multiple defined cis-regulatory elements across the CFTR locus and other non-regulatory regions (Supplementary Table S1). In Caco2 cells, the DHS element in intron 11 was highly enriched for both FOXA1 and FOXA2 (~4–8-fold relative to IgG). These factors were also similarly enriched at nearby cis-regulatory elements that lack enhancer activity at DHS in intron 10 (DHS10a,b, 1716+13.2 kb/13.7 kb) [9], and slightly enriched (~2-fold) at other CFTR cis-regulatory enhancer elements, including those in introns 1 (185+10 kb) and 23 (4374+1.3 kb) (FOXA2 only) [14,32,42]. FOXA2 was enriched at many of the same regions in HT29 cells, an additional intestinal cell line that expresses similar amounts of CFTR [9] and FOXA2 (Supplementary Figures S2A and S2B). No FOXA2 enrichment was observed in the CFTR (−) skin fibroblasts (Supplementary Figure S2C). These data indicate that FOXA proteins interact directly and/or indirectly at many locations across the CFTR locus in intestinal cells. The most prominent interactions are at regions of open chromatin in introns 10 and 11, close to the centre of the locus.

FOXA1/A2 interact with CFTR regulatory elements in vivo

Figure 4
FOXA1/A2 interact with CFTR regulatory elements in vivo

ChIP with FOXA1- (A) or FOXA2- (B) specific antibodies and Caco2 chromatin. Primer sets spanning the CFTR locus (Supplementary Table S1 at http://www.BiochemJ.org/bj/446/bj4460203add.htm) were used to assay enrichment by SYBR Green qPCR analysis. Results were normalized to 18S rRNA levels, and compared with goat IgG enrichment at the same site (broken line). Values are means±S.E.M. for two PCRs per primer set. Results are shown from a representative ChIP experiment, alhough consistent results were obtained in three independent experiments.

Figure 4
FOXA1/A2 interact with CFTR regulatory elements in vivo

ChIP with FOXA1- (A) or FOXA2- (B) specific antibodies and Caco2 chromatin. Primer sets spanning the CFTR locus (Supplementary Table S1 at http://www.BiochemJ.org/bj/446/bj4460203add.htm) were used to assay enrichment by SYBR Green qPCR analysis. Results were normalized to 18S rRNA levels, and compared with goat IgG enrichment at the same site (broken line). Values are means±S.E.M. for two PCRs per primer set. Results are shown from a representative ChIP experiment, alhough consistent results were obtained in three independent experiments.

HNF1 interacts in vivo with CFTR regulatory elements

We previously showed that HNF1 is necessary for normal CFTR expression levels in the mouse intestinal epithelium [20] and interacts with multiple cis-regulatory elements across the CFTR locus [9]. These interactions were confirmed by ChIP in the current series of experiments (Supplementary Figure S3A at http://www.BiochemJ.org/bj/446/bj4460203add.htm). We next used an siRNA approach to efficiently knockdown 90% of endogenous HNF1α protein in Caco2 cells, but this did not effect levels of CFTR mRNA expression as measured by qRT–PCR (Supplementary Figures S3B–S3D).

CDX2 interacts in vivo with CFTR regulatory elements, and contributes to CFTR expression in intestinal epithelial cells

Next, we used ChIP followed by qPCR to investigate the interaction of CDX2 with the CFTR locus in Caco2 cells (Figure 5A). Enrichment (~9-fold) of CDX2 was seen at the intron 11 element, and at equivalent levels at DHS elements in intron 1 and intron 10 (DHS10c, 1716+23 kb). A much higher enrichment (~23-fold) of CDX2 was seen at the DHS10a,b cis-elements. Moreover, slight enrichment of CDX2 (4–9-fold) was also evident at well-characterized enhancer-blocking insulator elements associated with the −20.9 kb DHS upstream of the CFTR translational start site and two others at +6.8 kb and +15.6 kb downstream from the CFTR translational stop site, and at the CFTR promoter. Thus CDX2 associates with CFTR in vivo at multiple genomic locations.

CDX2 interacts with CFTR regulatory elements and contributes to CFTR expression in vivo

Figure 5
CDX2 interacts with CFTR regulatory elements and contributes to CFTR expression in vivo

(A) Caco2 ChIP with a CDX2-specific antibody; enrichment was detected and calculated as described in Figure 4, relative to rabbit IgG. (BD) Caco2 cells were reverse-transfected for 48 h with negative control (NC) siRNA, siRNA targeting human CDX2 or transfection reagent only (mock). (EG) Caco2 cells were forward-transfected for 48 h with combinations of NC siRNA, hCDX2 siRNA, empty pRC-CMV vector (V.C.) or pRC-mCdx2 vector (mCdx2). (B and E) Western blots of whole-cell lysate for total CDX2, or β-tubulin as a loading control. CDX2 protein levels were quantified from three independent experiments; results were normalized to β-tubulin, and are shown relative to the NC sample (C) or mock-transfected (F). CFTR mRNA levels measured by Taqman qRT–PCR from total RNA. Results were normalized to 18S rRNA levels, and are shown relative to the NC siRNA transfected (D) or mock-transfected (G) cells. Values are means±S.E.M., n=8 or 9; ***P<0.001, **P<0.01 and N.S., not significant, using an unpaired Student's t test.

Figure 5
CDX2 interacts with CFTR regulatory elements and contributes to CFTR expression in vivo

(A) Caco2 ChIP with a CDX2-specific antibody; enrichment was detected and calculated as described in Figure 4, relative to rabbit IgG. (BD) Caco2 cells were reverse-transfected for 48 h with negative control (NC) siRNA, siRNA targeting human CDX2 or transfection reagent only (mock). (EG) Caco2 cells were forward-transfected for 48 h with combinations of NC siRNA, hCDX2 siRNA, empty pRC-CMV vector (V.C.) or pRC-mCdx2 vector (mCdx2). (B and E) Western blots of whole-cell lysate for total CDX2, or β-tubulin as a loading control. CDX2 protein levels were quantified from three independent experiments; results were normalized to β-tubulin, and are shown relative to the NC sample (C) or mock-transfected (F). CFTR mRNA levels measured by Taqman qRT–PCR from total RNA. Results were normalized to 18S rRNA levels, and are shown relative to the NC siRNA transfected (D) or mock-transfected (G) cells. Values are means±S.E.M., n=8 or 9; ***P<0.001, **P<0.01 and N.S., not significant, using an unpaired Student's t test.

To determine the functional relevance of these CDX2 interactions within the CFTR locus we used a pool of three siRNAs to knockdown CDX2 protein. Figures 5(B) and 5(C) show that the CDX2-targeted siRNAs efficiently depleted CDX2 in Caco2 cells. Knockdown of CDX2 caused CFTR expression levels to fall by approximately 25% in the same cells (Figure 5D). Overexpression of mouse Cdx2 upon knockdown of endogenous CDX2 protein in Caco2 cells partially restored CDX2 protein levels (Figures 5E–5F). This resulted in a comparable increase in CFTR expression (Figure 5G). These data confirm the important role of CDX2 in achieving maximal CFTR expression in Caco2 intestinal epithelial cells.

DISCUSSION

The ability to map regions of open chromatin genome-wide has the potential to rapidly identify novel regulatory cis-acting regulatory elements. However, confirming the function of these elements and identifying trans-acting factors remains challenging. We previously identified multiple cis-acting regulatory elements for the CFTR gene, located within open chromatin. In an effort to identify transcriptional networks that co-ordinate expression of this epithelial chloride channel in the intestine, we now investigate the TFs that bind to an intestine-selective enhancer in intron 11 of the gene. We identify FOXA1/A2, HNF1 and CDX2 as important factors that interact with this element, and other cis-regulatory sequences across the locus. Moreover, we show by mutation of their predicted binding sites and siRNA knockdown of CDX2 that these factors are critical for the maintenance of high levels of CFTR mRNA in intestinal epithelial cells.

FOXA1/A2, HNF1 and CDX2 are key regulators of gene expression in endoderm-derived tissues [16,17,22,43], including many that express CFTR, such as the intestine, pancreas and airway. These factors, and others such as GATAs 4–6, HNF4α and CDX1, comprise a transcriptional network that co-regulates the expression of many genes in the intestinal epithelium [2330]. In the case of CFTR, the recruitment of FOXA1/A2, HNF1 and CDX2 to multiple intestinal cis-regulatory elements may co-ordinate their interaction with the gene promoter by altering local chromatin structure. TF binding and subsequent chromatin modifications may facilitate looping of the locus [9] either directly or indirectly through recruitment of additional chromatin remodellers such as p300 [4446].

Members of the FOX family of TFs regulate chromatin remodelling through their activity as pioneer factors and classic TFs [47]. To date, FOXA, FOXE and FOXO classes have been described as pioneer factors due to their ability to bind within condensed chromatin, an environment from which many other TFs are excluded. The bound FOX factors locally remodel chromatin to provide access to other TFs, for example by their SWI/SNF-independent histone remodelling activity, which displaces H1-linker histones (reviewed in [18]). Although not yet identified as a pioneer factor, FOXI1 repressed the CFTR promoter in a transgene construct introduced into a vas deferens cell line, and this repression was greater in CFTR promoter variants associated with CBAVD (congenital bilateral absence of the vas deferens) [48]. In contrast, the results of the present study suggest that FOXA factors positively regulate CFTR expression through binding to intronic enhancers, including the one in intron 11. FOXA proteins may remodel chromatin at these sites, facilitating the recruitment of other transcription factors and co-factors.

The results of the present study also demonstrate that HNF1 is one of the TFs that populate the remodelled chromatin, along with p300 with which it interacts [44]. Although we previously showed enrichment of both factors in vivo at sites across the CFTR locus in intestinal cells [9], we now identify a critical HNF1-binding site in the intron 11 enhancer. To further examine the in vivo role of HNF1, we used a pool of three siRNAs to knockdown HNF1α in Caco2 cells. Although 90% knockdown was achieved as estimated by Western blot analysis, this had no effect on CFTR mRNA expression levels. This observation is consistent with our previous data showing that an antisense HNF1α ribozyme, which stably depleted HNF1α was ineffective in reducing CFTR expression in Caco2 cells, but inhibited CFTR in Capan-1 pancreatic adenocarcinoma cells, where endogenous levels of HNF1α are much lower [20]. In Caco2 cells, the small amount of HNF1α protein persisting after knockdown may be sufficient to support HNF1-mediated CFTR expression. Moreover, the low levels of HNF1β in Caco2 cells may compensate for the depleted HNF1α, since both factors bind the same consensus sequence.

CDX2 can interact with different classes of the SWI/SNF chromatin-remodelling complex to regulate expression of target genes. In mouse blastocysts, Cdx2 and Brg1 physically interact to repress Oct4 expression [49]. In contrast, villin expression in human intestinal cells is dependent on CDX-mediated targeting of the Brm-type SWI/SNF complex to the promoter [50]. We demonstrate in the present study that CDX2 is enriched in vivo at the intron 11 enhancer and at other cis-regulatory elements across the CFTR locus in Caco2 cells. Moreover, effective siRNA inhibition of CDX2 significantly reduced CFTR mRNA expression levels in these cells. ChIP-chip, ChIP-seq and further data from other groups support an important role for CDX2 in cis-regulatory element-mediated control of CFTR in Caco2 cells [5154]. Although the siRNA depleted more than 95% of CDX2 protein, we only observed a 25% reduction in CFTR expression. However, as multiple cis-regulatory elements interact with the CFTR promoter and recruit diverse factors, loss of a single factor would be unlikely to totally destroy CFTR promoter activity. Moreover, while the intron 11 enhancer and other cis-regulatory elements contribute to the high level of CFTR expression observed in the intestinal epithelium, previous evidence suggests that loss of a single enhancer does not abolish CFTR expression [55].

The more global role for transcriptional networks that are co-ordinated by FOXA1/A2, HNF1 and CDX2 in epithelial function warrants further discussion. Foxa1 was recently implicated in the regulation of genes encoding other ion transporters in the sweat glands of mice [56]. These transporters, Nkcc1/Slc12a2 (Na+-K+-Cl co-transporter 1) and Best2 (Bestrophin 2), are also expressed in the intestine and colon, where the Best2 anion channel has been shown to regulate bicarbonate transport [57,58]. In Caco2 cells, multiple sites of CDX2 enrichment are evident across SLC12A2 and the SLC26A3 locus [5153], which encodes a Cl/HCO3 exchanger. Moreover, HNF1 regulates the expression of SLC26A3 in the intestinal epithelium [59], and CFTR and SLC26A3 are thought to functionally interact to regulate HCO3 secretion [60]. These data, together with the results of the present study, suggest that this group of TFs may play a more general role in regulating expression of ion transporters in the intestine. It is probable that other TFs such as GATAs 4–6 and HNF4α also play a critical role in these networks [52].

The involvement of multiple transcriptional networks in co-ordinating the expression of ion channel/transporter genes has implications for the nuclear organization on which this depends. It is possible that the critical TFs reside in specialized transcription factories that efficiently co-ordinate high levels of gene expression. However, the mechanism whereby genes would be selected for targeting to these sites and migrate there remains unclear (reviewed in [61,62]). It is known that CFTR associates with different nuclear regions depending on its expression status [63]. The locus moves to the nuclear interior when it is expressed and this relocation might enable interaction with specialized transcription factories. In intestinal cells these transcription factories would probably be enriched for HNF1, CDX2, FOXA1/A2 and other members of the same networks.

Abbreviations

     
  • BARX2

    BARX homeobox 2

  •  
  • Best2

    Bestrophin 2

  •  
  • CDX2

    caudal-type homeobox 2

  •  
  • CF

    cystic fibrosis

  •  
  • CFTR

    CF transmembrane conductance regulator

  •  
  • ChIP

    chromatin immunoprecipitation

  •  
  • ChIP-seq

    ChIP followed by deep sequencing

  •  
  • CUX1

    cut-like homeobox 1

  •  
  • DHS

    DNase I hypersensitive site

  •  
  • EMSA

    electrophoretic mobility-shift assay

  •  
  • FOX

    Forkhead box

  •  
  • HNF1

    hepatocyte nuclear factor 1

  •  
  • HOXB7

    homeobox B7

  •  
  • IVT

    in vitro translated

  •  
  • MECOM

    MDS1 and EVI1 complex locus

  •  
  • Nkcc1/Slc12a2

    Na+-K+-Cl co-transporter 1

  •  
  • PBX1

    pre-B-cell leukaemia homeobox 1

  •  
  • PDX1

    pancreatic and duodenal homeobox 1

  •  
  • PR

    protected region

  •  
  • qPCR

    quantitative PCR

  •  
  • qRT–PCR

    quantitative reverse transcription–PCR

  •  
  • siRNA

    small interfering RNA

  •  
  • TF

    transcription factor

  •  
  • TFBS

    TF-binding site

AUTHOR CONTRIBUTION

Jenny Kerschner and Ann Harris designed the experiments, which were carried out by Jenny Kerschner. Both authors wrote the paper. The project was conceived and directed by Ann Harris.

We thank Dr R. Cortese (CEINGE, Naples, Italy), Dr R. Matusik (Vanderbilt University, Nashville, TN, U.S.A.) and Dr A. Nepveu (McGill University, Montreal, QC, Canada) for their donation of plasmids and antibody reagents, and Dr C. Ott for generating the HNF1α expression plasmid.

FUNDING

This work was supported by the Cystic Fibrosis Foundation (Harris11G0), the National Institutes of Health [grant numbers R01HL094585 and R01HD68901 (to A.H.)] and a Northwestern University Cellular and Molecular Basis of Disease Training Grant (to J.L.K.).

References

References
1
Birney
E.
Stamatoyannopoulos
J. A.
Dutta
A.
Guigo
R.
Gingeras
T. R.
Margulies
E. H.
Weng
Z.
Snyder
M.
Dermitzakis
E. T.
Thurman
R. E.
, et al. 
Identification and analysis of functional elements in 1% of the human genome by the ENCODE pilot project
Nature
2007
, vol. 
447
 (pg. 
799
-
816
)
2
Wendt
K. S.
Yoshida
K.
Itoh
T.
Bando
M.
Koch
B.
Schirghuber
E.
Tsutsumi
S.
Nagae
G.
Ishihara
K.
Mishiro
T.
, et al. 
Cohesin mediates transcriptional insulation by CCCTC-binding factor
Nature
2008
, vol. 
451
 (pg. 
796
-
801
)
3
Visel
A.
Blow
M. J.
Li
Z.
Zhang
T.
Akiyama
J. A.
Holt
A.
Plajzer-Frick
I.
Shoukry
M.
Wright
C.
Chen
F.
, et al. 
ChIP-seq accurately predicts tissue-specific activity of enhancers
Nature
2009
, vol. 
457
 (pg. 
854
-
858
)
4
Heintzman
N. D.
Hon
G. C.
Hawkins
R. D.
Kheradpour
P.
Stark
A.
Harp
L. F.
Ye
Z.
Lee
L. K.
Stuart
R. K.
Ching
C. W.
, et al. 
Histone modifications at human enhancers reflect global cell-type-specific gene expression
Nature
2009
, vol. 
459
 (pg. 
108
-
112
)
5
Heintzman
N. D.
Ren
B.
Finding distal regulatory elements in the human genome
Curr. Opin. Genet. Dev.
2009
, vol. 
19
 (pg. 
541
-
549
)
6
Miele
A.
Dekker
J.
Long-range chromosomal interactions and gene regulation
Mol. Biosyst.
2008
, vol. 
4
 (pg. 
1046
-
1057
)
7
Song
L.
Zhang
Z.
Grasfeder
L. L.
Boyle
A. P.
Giresi
P. G.
Lee
B. K.
Sheffield
N. C.
Graf
S.
Huss
M.
Keefe
D.
, et al. 
Open chromatin defined by DNaseI and FAIRE identifies regulatory elements that shape cell-type identity
Genome Res.
2011
, vol. 
21
 (pg. 
1757
-
1767
)
8
Rommens
J. M.
Iannuzzi
M. C.
Kerem
B.
Drumm
M. L.
Melmer
G.
Dean
M.
Rozmahel
R.
Cole
J. L.
Kennedy
D.
Hidaka
N.
, et al. 
Identification of the cystic fibrosis gene: chromosome walking and jumping
Science
1989
, vol. 
245
 (pg. 
1059
-
1065
)
9
Ott
C. J.
Blackledge
N. P.
Kerschner
J. L.
Leir
S. H.
Crawford
G. E.
Cotton
C. U.
Harris
A.
Intronic enhancers coordinate epithelial-specific looping of the active CFTR locus
Proc. Natl. Acad. Sci. U.S.A.
2009
, vol. 
106
 (pg. 
19934
-
19939
)
10
McCarthy
V. A.
Harris
A.
The CFTR gene and regulation of its expression
Pediatr. Pulmonol.
2005
, vol. 
40
 (pg. 
1
-
8
)
11
Mulberg
A. E.
Weyler
R. T.
Altschuler
S. M.
Hyde
T. M.
Cystic fibrosis transmembrane conductance regulator expression in human hypothalamus
NeuroReport
1998
, vol. 
9
 (pg. 
141
-
144
)
12
Yoshimura
K.
Nakamura
H.
Trapnell
B. C.
Chu
C. S.
Dalemans
W.
Pavirani
A.
Lecocq
J. P.
Crystal
R. G.
Expression of the cystic fibrosis transmembrane conductance regulator gene in cells of non-epithelial origin
Nucleic Acids Res.
1991
, vol. 
19
 (pg. 
5417
-
5423
)
13
Davies
W. L.
Vandenberg
J. I.
Sayeed
R. A.
Trezise
A. E.
Cardiac expression of the cystic fibrosis transmembrane conductance regulator involves novel exon 1 usage to produce a unique amino-terminal protein
J. Biol. Chem.
2004
, vol. 
279
 (pg. 
15877
-
15887
)
14
Zhang
Z.
Ott
C. J.
Lewandowska
M. A.
Leir
S. H.
Harris
A.
Molecular mechanisms controlling CFTR gene expression in the airway
J. Cell. Mol. Med.
2012
, vol. 
16
 (pg. 
1321
-
1330
)
15
Gillen
A. E.
Harris
A.
Transcriptional regulation of CFTR gene expression
Front. Biosci.
2012
, vol. 
4
 (pg. 
587
-
592
)
16
Lai
E.
Prezioso
V. R.
Smith
E.
Litvin
O.
Costa
R. H.
Darnell
J. E.
Jr
HNF-3A, a hepatocyte-enriched transcription factor of novel structure is regulated transcriptionally
Genes Dev.
1990
, vol. 
4
 (pg. 
1427
-
1436
)
17
Friedman
J. R.
Kaestner
K. H.
The Foxa family of transcription factors in development and metabolism
Cell. Mol. Life Sci.
2006
, vol. 
63
 (pg. 
2317
-
2328
)
18
Zaret
K. S.
Carroll
J. S.
Pioneer transcription factors: establishing competence for gene expression
Genes Dev.
2011
, vol. 
25
 (pg. 
2227
-
2241
)
19
Cirillo
L. A.
Lin
F. R.
Cuesta
I.
Friedman
D.
Jarnik
M.
Zaret
K. S.
Opening of compacted chromatin by early developmental transcription factors HNF3 (FoxA) and GATA-4
Mol. Cell
2002
, vol. 
9
 (pg. 
279
-
289
)
20
Mouchel
N.
Henstra
S. A.
McCarthy
V. A.
Williams
S. H.
Phylactides
M.
Harris
A.
HNF1α is involved in tissue-specific regulation of CFTR gene expression
Biochem. J.
2004
, vol. 
378
 (pg. 
909
-
918
)
21
Ott
C. J.
Suszko
M.
Blackledge
N. P.
Wright
J. E.
Crawford
G. E.
Harris
A.
A complex intronic enhancer regulates expression of the CFTR gene by direct interaction with the promoter
J. Cell. Mol. Med.
2009
, vol. 
13
 (pg. 
680
-
692
)
22
Silberg
D. G.
Swain
G. P.
Suh
E. R.
Traber
P. G.
Cdx1 and cdx2 expression during intestinal development
Gastroenterology
2000
, vol. 
119
 (pg. 
961
-
971
)
23
Balakrishnan
A.
Stearns
A. T.
Rhoads
D. B.
Ashley
S. W.
Tavakkolizadeh
A.
Defining the transcriptional regulation of the intestinal sodium-glucose cotransporter using RNA-interference mediated gene silencing
Surgery
2008
, vol. 
144
 (pg. 
168
-
173
)
24
Boudreau
F.
Rings
E. H.
van Wering
H. M.
Kim
R. K.
Swain
G. P.
Krasinski
S. D.
Moffett
J.
Grand
R. J.
Suh
E. R.
Traber
P. G.
Hepatocyte nuclear factor-1α, GATA-4, and caudal related homeodomain protein Cdx2 interact functionally to modulate intestinal gene transcription. Implication for the developmental regulation of the sucrase-isomaltase gene
J. Biol. Chem.
2002
, vol. 
277
 (pg. 
31909
-
31917
)
25
Escaffit
F.
Boudreau
F.
Beaulieu
J. F.
Differential expression of claudin-2 along the human intestine: implication of GATA-4 in the maintenance of claudin-2 in differentiating cells
J. Cell. Physiol.
2005
, vol. 
203
 (pg. 
15
-
26
)
26
Mitchelmore
C.
Troelsen
J. T.
Spodsberg
N.
Sjostrom
H.
Noren
O.
Interaction between the homeodomain proteins Cdx2 and HNF1α mediates expression of the lactase-phlorizin hydrolase gene
Biochem. J.
2000
, vol. 
346
 (pg. 
529
-
535
)
27
Valente
A. J.
Zhou
Q.
Lu
Z.
He
W.
Qiang
M.
Ma
W.
Li
G.
Wang
L.
Banfi
B.
Steger
K.
, et al. 
Regulation of NOX1 expression by GATA, HNF-1α, and Cdx transcription factors
Free Radical Biol. Med.
2008
, vol. 
44
 (pg. 
430
-
443
)
28
Fang
R.
Olds
L. C.
Sibley
E.
Spatio-temporal patterns of intestine-specific transcription factor expression during postnatal mouse gut development
Gene Expression Patterns
2006
, vol. 
6
 (pg. 
426
-
432
)
29
Wang
L.
Klopot
A.
Freund
J. N.
Dowling
L. N.
Krasinski
S. D.
Fleet
J. C.
Control of differentiation-induced calbindin-D9k gene expression in Caco-2 cells by cdx-2 and HNF-1α
Am. J. Physiol. Gastrointest. Liver Physiol.
2004
, vol. 
287
 (pg. 
G943
-
G953
)
30
Jonckheere
N.
Vincent
A.
Perrais
M.
Ducourouble
M. P.
Male
A. K.
Aubert
J. P.
Pigny
P.
Carraway
K. L.
Freund
J. N.
Renes
I. B.
Van Seuningen
I.
The human mucin MUC4 is transcriptionally regulated by caudal-related homeobox, hepatocyte nuclear factors, forkhead box A, and GATA endodermal transcription factors in epithelial cancer cells
J. Biol. Chem.
2007
, vol. 
282
 (pg. 
22638
-
22650
)
31
McCarthy
V. A.
Ott
C. J.
Phylactides
M.
Harris
A.
Interaction of intestinal and pancreatic transcription factors in the regulation of CFTR gene expression
Biochim. Biophys. Acta
2009
, vol. 
1789
 (pg. 
709
-
718
)
32
Smith
A. N.
Barth
M. L.
McDowell
T. L.
Moulin
D. S.
Nuthall
H. N.
Hollingsworth
M. A.
Harris
A.
A regulatory element in intron 1 of the cystic fibrosis transmembrane conductance regulator gene
J. Biol. Chem.
1996
, vol. 
271
 (pg. 
9947
-
9954
)
33
Phylactides
M.
Rowntree
R.
Nuthall
H.
Ussery
D.
Wheeler
A.
Harris
A.
Evaluation of potential regulatory elements identified as DNase I hypersensitive sites in the CFTR gene
Eur. J. Biochem.
2002
, vol. 
269
 (pg. 
553
-
559
)
34
Truscott
M.
Denault
J. B.
Goulet
B.
Leduy
L.
Salvesen
G. S.
Nepveu
A.
Carboxyl-terminal proteolytic processing of CUX1 by a caspase enables transcriptional activation in proliferating cells
J. Biol. Chem.
2007
, vol. 
282
 (pg. 
30216
-
30226
)
35
Yu
X.
Gupta
A.
Wang
Y.
Suzuki
K.
Mirosevich
J.
Orgebin-Crist
M. C.
Matusik
R. J.
Foxa1 and Foxa2 interact with the androgen receptor to regulate prostate and epididymal genes differentially
Ann. N.Y. Acad. Sci.
2005
, vol. 
1061
 (pg. 
77
-
93
)
36
Shen
W. F.
Largman
C.
Lowney
P.
Corral
J. C.
Detmer
K.
Hauser
C. A.
Simonitch
T. A.
Hack
F. M.
Lawrence
H. J.
Lineage-restricted expression of homeobox-containing genes in human hematopoietic cell lines
Proc. Natl. Acad. Sci. U.S.A.
1989
, vol. 
86
 (pg. 
8536
-
8540
)
37
Moon
N. S.
Premdas
P.
Truscott
M.
Leduy
L.
Berube
G.
Nepveu
A.
S phase-specific proteolytic cleavage is required to activate stable DNA binding by the CDP/Cut homeodomain protein
Mol. Cell. Biol.
2001
, vol. 
21
 (pg. 
6332
-
6345
)
38
Mouchel
N.
Broackes-Carter
F.
Harris
A.
Alternative 5′ exons of the CFTR gene show developmental regulation
Hum. Mol. Genet.
2003
, vol. 
12
 (pg. 
759
-
769
)
39
Kent
W. J.
Sugnet
C. W.
Furey
T. S.
Roskin
K. M.
Pringle
T. H.
Zahler
A. M.
Haussler
D.
The human genome browser at UCSC
Genome Res.
2002
, vol. 
12
 (pg. 
996
-
1006
)
40
Fujita
P. A.
Rhead
B.
Zweig
A. S.
Hinrichs
A. S.
Karolchik
D.
Cline
M. S.
Goldman
M.
Barber
G. P.
Clawson
H.
Coelho
A.
, et al. 
The UCSC Genome Browser database: update 2011
Nucleic Acids Res.
2011
, vol. 
39
 (pg. 
D876
-
D882
)
41
Lander
E. S.
Linton
L. M.
Birren
B.
Nusbaum
C.
Zody
M. C.
Baldwin
J.
Devon
K.
Dewar
K.
Doyle
M.
FitzHugh
W.
, et al. 
Initial sequencing and analysis of the human genome
Nature
2001
, vol. 
409
 (pg. 
860
-
921
)
42
Ott
C. J.
Suszko
M.
Blackledge
N. P.
Wright
J. E.
Crawford
G. E.
Harris
A.
A complex intronic enhancer regulates expression of the CFTR gene by direct interaction with the promoter
J. Cell. Mol. Med.
2009
, vol. 
13
 (pg. 
680
-
692
)
43
Kuo
C. J.
Conley
P. B.
Hsieh
C. L.
Francke
U.
Crabtree
G. R.
Molecular cloning, functional expression, and chromosomal localization of mouse hepatocyte nuclear factor 1
Proc. Natl. Acad. Sci. U.S.A.
1990
, vol. 
87
 (pg. 
9838
-
9842
)
44
Ban
N.
Yamada
Y.
Someya
Y.
Miyawaki
K.
Ihara
Y.
Hosokawa
M.
Toyokuni
S.
Tsuda
K.
Seino
Y.
Hepatocyte nuclear factor-1α recruits the transcriptional co-activator p300 on the GLUT2 gene promoter
Diabetes
2002
, vol. 
51
 (pg. 
1409
-
1418
)
45
Hussain
M. A.
Habener
J. F.
Glucagon gene transcription activation mediated by synergistic interactions of pax-6 and cdx-2 with the p300 co-activator
J. Biol. Chem.
1999
, vol. 
274
 (pg. 
28950
-
28957
)
46
Liu
Y. N.
Lee
W. W.
Wang
C. Y.
Chao
T. H.
Chen
Y.
Chen
J. H.
Regulatory mechanisms controlling human E-cadherin gene expression
Oncogene
2005
, vol. 
24
 (pg. 
8277
-
8290
)
47
Lalmansingh
A. S.
Karmakar
S.
Jin
Y.
Nagaich
A. K.
Multiple modes of chromatin remodeling by Forkhead box proteins
Biochim. Biophys. Acta
2012
, vol. 
1819
 (pg. 
707
-
715
)
48
Lopez
E.
Viart
V.
Guittard
C.
Templin
C.
Rene
C.
Mechin
D.
Des Georges
M.
Claustres
M.
Romey-Chatelain
M. C.
Taulan
M.
Variants in CFTR untranslated regions are associated with congenital bilateral absence of the vas deferens
J. Med. Genet.
2011
, vol. 
48
 (pg. 
152
-
159
)
49
Wang
K.
Sengupta
S.
Magnani
L.
Wilson
C. A.
Henry
R. W.
Knott
J. G.
Brg1 is required for Cdx2-mediated repression of Oct4 expression in mouse blastocysts
PLoS ONE
2010
, vol. 
5
 pg. 
e10622
 
50
Yamamichi
N.
Inada
K.
Furukawa
C.
Sakurai
K.
Tando
T.
Ishizaka
A.
Haraguchi
T.
Mizutani
T.
Fujishiro
M.
Shimomura
R.
, et al. 
Cdx2 and the Brm-type SWI/SNF complex cooperatively regulate villin expression in gastrointestinal cells
Exp. Cell Res.
2009
, vol. 
315
 (pg. 
1779
-
1789
)
51
Verzi
M. P.
Hatzis
P.
Sulahian
R.
Philips
J.
Schuijers
J.
Shin
H.
Freed
E.
Lynch
J. P.
Dang
D. T.
Brown
M.
, et al. 
TCF4 and CDX2, major transcription factors for intestinal function, converge on the same cis-regulatory regions
Proc. Natl. Acad. Sci. U.S.A.
2010
, vol. 
107
 (pg. 
15157
-
15162
)
52
Verzi
M. P.
Shin
H.
He
H. H.
Sulahian
R.
Meyer
C. A.
Montgomery
R. K.
Fleet
J. C.
Brown
M.
Liu
X. S.
Shivdasani
R. A.
Differentiation-specific histone modifications reveal dynamic chromatin interactions and partners for the intestinal transcription factor CDX2
Dev. Cell
2010
, vol. 
19
 (pg. 
713
-
726
)
53
Boyd
M.
Hansen
M.
Jensen
T. G.
Perearnau
A.
Olsen
A. K.
Bram
L. L.
Bak
M.
Tommerup
N.
Olsen
J.
Troelsen
J. T.
Genome-wide analysis of CDX2 binding in intestinal epithelial cells (Caco-2)
J. Biol. Chem.
2010
, vol. 
285
 (pg. 
25115
-
25125
)
54
Paul
T.
Li
S.
Khurana
S.
Leleiko
N. S.
Walsh
M. J.
The epigenetic signature of CFTR expression is co-ordinated via chromatin acetylation through a complex intronic element
Biochem. J.
2007
, vol. 
408
 (pg. 
317
-
326
)
55
Rowntree
R. K.
Vassaux
G.
McDowell
T. L.
Howe
S.
McGuigan
A.
Phylactides
M.
Huxley
C.
Harris
A.
An element in intron 1 of the CFTR gene augments intestinal expression in vivo
Hum. Mol. Genet.
2001
, vol. 
10
 (pg. 
1455
-
1464
)
56
Cui
C. Y.
Childress
V.
Piao
Y.
Michel
M.
Johnson
A. A.
Kunisada
M.
Ko
M. S.
Kaestner
K. H.
Marmorstein
A. D.
Schlessinger
D.
Forkhead transcription factor FoxA1 regulates sweat secretion through Bestrophin 2 anion channel and Na-K-Cl cotransporter 1
Proc. Natl. Acad. Sci. U.S.A.
2012
, vol. 
109
 (pg. 
1199
-
1203
)
57
Payne
J. A.
Xu
J. C.
Haas
M.
Lytle
C. Y.
Ward
D.
Forbush
B.
3rd
Primary structure, functional expression, and chromosomal localization of the bumetanide-sensitive Na-K-Cl cotransporter in human colon
J. Biol. Chem.
1995
, vol. 
270
 (pg. 
17977
-
17985
)
58
Qu
Z.
Hartzell
H. C.
Bestrophin Cl− channels are highly permeable to HCO3
Am. J. Physiol. Cell Physiol.
2008
, vol. 
294
 (pg. 
C1371
-
C1377
)
59
D'Angelo
A.
Bluteau
O.
Garcia-Gonzalez
M. A.
Gresh
L.
Doyen
A.
Garbay
S.
Robine
S.
Pontoglio
M.
Hepatocyte nuclear factor 1α and β control terminal differentiation and cell fate commitment in the gut epithelium
Development
2010
, vol. 
137
 (pg. 
1573
-
1582
)
60
Greeley
T.
Shumaker
H.
Wang
Z.
Schweinfest
C. W.
Soleimani
M.
Downregulated in adenoma and putative anion transporter are regulated by CFTR in cultured pancreatic duct cells
Am. J. Physiol. Gastrointest. Liver Physiol.
2001
, vol. 
281
 (pg. 
G1301
-
G1308
)
61
Schoenfelder
S.
Clay
I.
Fraser
P.
The transcriptional interactome: gene expression in 3D
Curr. Opin. Genet. Dev.
2010
, vol. 
20
 (pg. 
127
-
133
)
62
Razin
S. V.
Gavrilov
A. A.
Pichugin
A.
Lipinski
M.
Iarovaia
O. V.
Vassetzky
Y. S.
Transcription factories in the context of the nuclear and genome organization
Nucleic Acids Res.
2011
, vol. 
39
 (pg. 
9085
-
9092
)
63
Zink
D.
Amaral
M. D.
Englmann
A.
Lang
S.
Clarke
L. A.
Rudolph
C.
Alt
F.
Luther
K.
Braz
C.
Sadoni
N.
, et al. 
Transcription-dependent spatial arrangements of CFTR and adjacent genes in human cell nuclei
J. Cell Biol.
2004
, vol. 
166
 (pg. 
815
-
825
)

Supplementary data