Hydrogen sulfide (H2S) has been implicated to exhibit antioxidative properties in many models. CSE (cystathionine γ-lyase) is an important enzyme responsible for endogenous H2S production in mammalian systems, but little is known about the modulation of endogenous H2S production and its antioxidative activity. We found that inhibiting CSE activity with PAG (propargylglycine) or silencing CSE expression using an siRNA approach resulted in a greater reduction in cell viability under exposure to the oxidizing agent hydrogen peroxide (H2O2). Cellular oxidative stress also increased significantly upon PAG inhibition or CSE knockdown. Further experiments using an activity-null Y60A mutant, a hyperactive E339A mutant and a control E349A mutant demonstrated that modulation of CSE catalytic activity altered its antioxidative activity. The increased sensitivity towards H2O2-induced cytotoxicity in CSE-siRNA-transfected cells was associated with a decreased glutathione concentration (GSH) and glutathione ratio (GSH/GSSG). Incubation of cells with exogenous H2S increased the GSH concentration and GSH/GSSG ratio. Moreover, exogenous H2S preserved the cellular glutathione status under BSO (buthionine sulfoximine)-induced glutathione depletion. Taken together, the results of the present study provide molecular insights into the antioxidative activity of CSE and highlights the importance of the CSE/H2S system in maintaining cellular glutathione status.

INTRODUCTION

Hydrogen sulfide (H2S) is produced endogenously in the mammalian system via several enzymatic pathways. CBS (cystathionine β-synthase; EC 4.2.1.22) and CSE (cystathionine γ-lyase; EC 4.4.1.1) are the two main enzymes catalysing L-cysteine to produce H2S along the reverse trans-sulfuration pathway [1]. These two enzymes have been characterized to exhibit different tissue distributions, in which CBS is predominantly responsible for H2S production in the brain and nervous systems, and CSE is mainly expressed in peripheral tissues such as liver, kidney and smooth muscle [1]. Previously it has been shown that a mitochondrial-localized enzyme known as 3-MPST (3-mercaptopyruvate sulfurtransferase; EC 2.8.1.2) was found to be responsible for H2S production in brain and vascular endothelium [2,3].

Upon identification of the physiological production of H2S, many studies have shown that this molecule plays many crucial roles in biological processes, including vasorelaxation activity by activating KATP channels in vascular smooth muscle cells [4,5], a neuromodulatory function in the central nervous system and intracellular signal transduction [6]. Nonetheless, H2S has a common role in which it may serve as a protective agent in physiological systems. It is well established that endogenous H2S acts as a cardioprotective agent against injury caused by myocardial infarction and ischaemia/reperfusion events [79]. Rats treated with sodium hydrosulfide (NaHS), which is an exogenous H2S donor, showed a significant decrease in the infarct size of necrotic tissue and in induction of mortality by acute myocardial infarction [8]. Using human articular chondrocytes and mesenchymal progenitor cells, researchers showed that CSE expression and activity were induced by pro-inflammatory cytokines, and exogenous H2S could inhibit lipopolysaccharide-induced cell death [10]. H2S was also found to protect neurons against hypoxic injury by preventing widespread irreversible neuronal death [11,12].

Many of these studies have attributed the cytoprotective effects to the direct or indirect antioxidant properties of H2S [13,14]. Oxidative stress is defined by an imbalance between intracellular antioxidants and the heavy burden of pro-oxidants, with the latter favoured [15]. Many different oxidative species are produced in the cellular systems, such as superoxide anions and hydrogen peroxide (H2O2). Excess ROS (reactive oxygen species) can react with biomacromolecules such as DNA, proteins and lipids, resulting in damage and even cell death in severe conditions [16]. Research using conventional H2S sodium salts, either NaHS or Na2S, has identified H2S as having the ability to scavenge oxidants such as H2O2 and superoxide [17,18]. In a murine hepatic/ischaemia model, an increase in the level of glutathione (GSH) was observed upon exposure to H2S, [19]. GSH is a tripeptide small molecule consisting of glutamic acid-cysteine-glycine via a γ-linkage and is commonly known to serve as the first-line antioxidative defence mechanism [20]. An increase in GSH level due to H2S exposure would thus render the cells with a stronger antioxidant defence against ROS. In fact, a study using CSE-knockout mice suggested that CSE is a critical factor in regulating GSH synthesis, presumably in the liver and kidneys [21]. Taken together, the ability of H2S to either scavenge oxidant species or increase the level of antioxidant species indicates the great potential of this molecule to be exploited as a cytoprotective agent.

Previous studies of H2S have used exogenous H2S donors to demonstrate the antioxidative activity of the gas, but the molecular details and antioxidative activity of the endogenous H2S system have not been well elucidated. In the present study, we examined the role of CSE in contributing to cellular antioxidative mechanisms in cell lines of peripheral tissue origin, including the transformed HEK (human embryonic kidney) cell line (HEK-293), the human hepatocellular carcinoma cell line (HepG2) and human diploid lung fibroblast primary cells (IMR90). Cellular oxidative markers were examined upon the silencing of CSE expression or inhibition of CSE enzymatic activities using the pharmacological inhibitor PAG (DL-propargylglycine). Previously, by combining crystal structure and site-directed mutagenesis studies of the CSE protein, our group identified several important residues that are involved in the determination of the CSE functional tetramer conformation and its catalytic activity [22]. Using this knowledge, we investigated the importance of CSE catalytic activity in maintaining cellular redox balance using different CSE mutants. Lastly, we explored the potential of using exogenous H2S in maintaining cellular redox balance, particularly in respect to glutathione homoeostasis.

MATERIALS AND METHODS

Cell culture and treatment

Transformed HEK-293 cells, HepG2 cells and IMR90 cells (A.T.C.C.) were cultured as monolayers at 37°C in a humidified incubator with 95% air and 5% CO2 in DMEM (Dulbecco's modified Eagle's medium, Invitrogen) supplemented with 10% FBS (Gibco) and 2 mM L-glutamine (Sigma). PAG (Sigma) was dissolved in sterile water into a stock concentration of 200 mM before dilution into appropriate working concentrations using culture media. H2O2 (Sigma) was stored as a stock concentration of 100 mM and diluted into the indicated working concentrations using culture media. Exposure time to PAG was 2 h before H2O2 incubation (8 h), and PAG was not removed throughout the H2O2 incubation to ensure continuous inhibition of CSE activity. GYY4137 was freshly dissolved into an 80 mM stock concentration before treatments and was diluted into corresponding working concentrations using culture media. BSO (buthionine sulfoximine, Sigma) was dissolved with PBS into a 1 M stock concentration and diluted with culture media. Cells were treated with GYY4137 for 24 h and BSO for 6 h.

CSE gene silencing

CSE-specific siRNA (ORF: sense, 5′-GGUUAUUUAUCCU-GGGCUGdTdT-3′, and antisense, 5′-CAGCCCAGGAUAAA-UAACCdTdT-3′; 3′-UTR: sense, 5′-CCUGUGAAGAUCAA AUCUUdTdT-3′, and antisense, 5′-AAGAUUUGAUCUUCAC AGGdTdT-3′) was designed to target against either the ORF or the 3′-UTR of the CSE mRNA (HGNC approved symbol CTH). Cells were seeded to reach 20–40% confluency at the point of transfection depending on the doubling time of the cell line. Forward transfection was carried out using Lipofectamine™ RNAiMAX (Invitrogen) according to the manufacturer's protocol. Transfected cells were incubated in a 5% CO2 incubator at 37°C for 48 h for HEK-293 and HepG2 cells, and 72 h for IMR90 cells before collection for Western blot analysis.

Protein analysis

Cells were harvested and lysed in RIPA lysis buffer [20 mM Tris/HCl (pH 7.4), 137 mM NaCl, 0.1% SDS, 0.5% deoxycholate, 1% Triton X-100 and 2 mM EDTA]. The amount of protein was quantified using the Bradford protein assay (Bio-Rad Laboratories). Rabbit polyclonal anti-hCSE (human CSE; 1:1000 dilution, Santa Cruz Biotechnology), mouse anti-GCL (glutamyl-cysteine ligase; 1:400 dilution, Abcam), mouse anti-GSS (glutathione synthetase; 1:1000 dilution, Santa Cruz Biotechnology), rabbit anti-GR (glutathione reductase; 1:1000 dilution, Santa Cruz Biotechnology), rabbit anti-SOD1 (superoxide dismutase 1; 1:1000 dilution, Santa Cruz Biotechnology) and mouse anti-α-tubulin (1:1000 dilution, Sigma) antibodies were used for immunoblotting.

Cell survival assay

End point cell survival was assessed using a Crystal Violet assay [23]. Adherent live cells fixed with 100% methanol were stained with 5% (w/v) Crystal Violet solution before being solubilized with 1% (v/v) SDS solution. Absorbance at 570 nm was read with a spectrophotometer (Tecan Ultra 384).

DHE (dihydroethidine) and DCF (2′,7′-dichlorofluorescein) fluorescence measurements

DHE (Sigma) and DCFH-DA (2′,7′-dichlorodihydrofluorescein diacetate, Sigma) probes reacted with cellular ROS and their fluorescence readings were used as a reflective measurement of the cellular oxidative state [24,25]. Cells pretreated with CSE-siRNA or 1 mM PAG were incubated with 20 μM DHE or DCFH-DA in DMEM for 1 h. Antimycin A (Sigma) was used as a positive control at a final concentration of 1 μM. The fluorescence intensity of DHE was read by a SPECTRAmax GEMINI XS microplate spectrofluorometer with an λex520em610 setting. DCFH was read at λex498/ λem 522.

Glutathione assay

An in vitro glutathione assay was used to detect and measure the total glutathione concentration, and the ratio of intracellular reduced glutathione to oxidized glutathione (GSH/GSSG). Cells with different treatments were lysed in ice-cold 5% MPA (metaphosphoric acid) to preserve the glutathione in its native state. The samples were stored at −80°C until analysis. Enzymatic reactions for measurement of total glutathione were performed in a final condition of 1.7 mM DTNB [5,5′-dithiobis-(2-nitrobenzoic acid), Sigma], 0.4 mM NADPH (Sigma) and 1 unit/ml GR (Sigma). On the other hand, to measure the oxidized glutathione level, 5% MPA lysate was added to 40 mM 4-VP (4-vinylpyridine) and incubated at room temperature (25°C) for 1 h. The 4-VP reacts with the free thiol groups, including the endogenous GSH existing in the sample, leaving only endogenous GSSG for detection in the subsequent reaction. After incubation, a final concentration of 30 mM triethylamine was added to neutralize the excess 4-VP. Samples were then subjected to an enzymatic reaction using the above-mentioned conditions. The glutathione level of each sample was normalized to the corresponding amount of protein obtained using the Bradford assay.

CSE plasmid construction and transfection

The CSE coding region (GenBank® accession number NM_001902) was cloned into the pcDNA3.1(+) vector (Invitrogen) in-frame with EcoRI and XhoI. Site-directed mutagenesis was performed using PfuTurbo DNA polymerase (Stratagene) with the primers listed in Table 1. The plasmids constructed were purified using an E.Z.N.A plasmid Midiprep kit (Omega Bio-Tek). The calcium phosphate transfection method was used to deliver the plasmids into HEK-293 cells. The cells were first transfected with 3′-UTR-siRNA of CSE for 8 h and then with the pEGFP-C1 or pcDNA3.1-FLAG-CSE expression plasmid. The GFP-positive cell population was sorted with a fluidic cell sorter (Beckman Coulter). Analysis was performed 48 h post-transfection.

Table 1
Site-directed mutagenesis primer sequences
Mutant Sense/antisense Sequence (5′→3′) 
Y60A Sense CCAGCACTCGGGTTTTGAAGCTAGCCGTTCTGGAAA 
 Antisense TTTCCAGAACGGCTAGCTTCAAAACCCGAGTGCTGG 
Y114A Sense TTGTATGGATGATGTGGCTGGAGGTACAAACAGGTACTTC 
 Antisense GAAGTACCTGTTTGTACCTCCAGCCACATCATCCATACAA 
E339A Sense CTATTTACTCTGGCCGCGAGCTTGGGAGGATTC 
 Antisense GAATCCTCCCAAGCTCGCGGCCAGAGTAAATAG 
E349A Sense CTATTTACTCTGGCCGCGAGCTTGGGAGGATTC 
 Antisense GAATCCTCCCAAGCTCGCGGCCAGAGTAAATAG 
Mutant Sense/antisense Sequence (5′→3′) 
Y60A Sense CCAGCACTCGGGTTTTGAAGCTAGCCGTTCTGGAAA 
 Antisense TTTCCAGAACGGCTAGCTTCAAAACCCGAGTGCTGG 
Y114A Sense TTGTATGGATGATGTGGCTGGAGGTACAAACAGGTACTTC 
 Antisense GAAGTACCTGTTTGTACCTCCAGCCACATCATCCATACAA 
E339A Sense CTATTTACTCTGGCCGCGAGCTTGGGAGGATTC 
 Antisense GAATCCTCCCAAGCTCGCGGCCAGAGTAAATAG 
E349A Sense CTATTTACTCTGGCCGCGAGCTTGGGAGGATTC 
 Antisense GAATCCTCCCAAGCTCGCGGCCAGAGTAAATAG 

Expression and purification of GST-tagged CSE proteins

Mutant and wild-type GST-tagged CSE proteins were expressed and purified in a bacterial system as described previously [22]. The protein was purified with glutathione–Sepharose beads (Sigma) and eluted with 1 mM reduced glutathione (Sigma) in buffer comprising 20 mM Tris (pH 8.0), 50 mM NaCl and 1 mM DTT. The protein concentration was determined using the Bradford protein assay (Bio-Rad Laboratories).

H2S production assay

Purified GST-tagged CSE protein (5 μg) was incubated in 100 μl of reaction mixture comprising 50 mM sodium phosphate buffer (pH 8.2), 20 mM NaCl, 0.5 mM PLP (pyridoxal 5′-phosphate, Sigma) and 2.75 mM L-cystathionine (Sigma). Parafilmed tubes were incubated at 37°C for 30 min. To measure the amount of H2S produced, a 100 μl mixture of 0.85% zinc acetate/3% NaOH was added to each tube. A final concentration of 2.5 mM NNDPD (N,N-dimethyl-p-phenylene-diamine-dihydrochloride dye, Sigma) and 3.3 mM FeCl3 was added to derive Methylene Blue, and absorbance measurements at 670 nm were read (Tecan Ultra 384 spectrophotometer). The amount of H2S produced was calculated from a NaHS-generated calibration curve.

Statistical analysis

All of the assays were carried out in at least three replicates. All data are expressed as means±S.D. Statistical significance was analysed using the Student's t test. P<0.05 was considered statistically significant.

RESULTS

CSE gene silencing with an RNAi approach

HEK-293, HepG2 and IMR90 cells were transfected with siRNA duplex targeting CSE mRNA and the protein expression level was assessed by Western blotting at 48 h (HEK-293 and HepG2 cells) or 72 h (IMR90 cells) post-transfection. Two different siRNAs targeting either the ORF or 3′-UTR of CSE were used to validate the specificity of siRNA. CSE expression was successfully suppressed as shown by the loss of the protein band (at least 90% efficacy) at 45 kDa in the siRNA-transfected samples as compared with the scrambled-siRNA negative control (Figure 1A).

Silencing of CSE expression using an RNAi approach

Figure 1
Silencing of CSE expression using an RNAi approach

(A) Transfection of scrambled or CSE-specific siRNAs targeting an ORF or 3′-UTR of CSE mRNA was carried out in HEK-293, HepG2 (both for 48 h) and IMR90 (72 h) cells. The endogenous CSE protein level was examined by Western blotting (WB). α-Tubulin was used as a loading control. (B) Cell survival upon CSE gene silencing with siRNA. Cell survival was assessed with a Crystal Violet survival assay after transfection of scrambled- (SC) or CSE-siRNA for 48 h. There was no significant difference in the percentages of cell survival in CSE-siRNA-treated cells as compared with scrambled-siRNA-treated cells. Values are means±S.D. (n=3). (C) H2O2-induced cytotoxicity in different cell lines. HEK-293, HepG2 and IMR90 cells were exposed to increasing concentrations of H2O2, incubated for 8 h, and the cell survival was assessed with a Crystal Violet survival assay. The H2O2 induced increasing cytotoxicity in all three cell lines in a dose-dependent manner. Values are means±S.D. (n=3).

Figure 1
Silencing of CSE expression using an RNAi approach

(A) Transfection of scrambled or CSE-specific siRNAs targeting an ORF or 3′-UTR of CSE mRNA was carried out in HEK-293, HepG2 (both for 48 h) and IMR90 (72 h) cells. The endogenous CSE protein level was examined by Western blotting (WB). α-Tubulin was used as a loading control. (B) Cell survival upon CSE gene silencing with siRNA. Cell survival was assessed with a Crystal Violet survival assay after transfection of scrambled- (SC) or CSE-siRNA for 48 h. There was no significant difference in the percentages of cell survival in CSE-siRNA-treated cells as compared with scrambled-siRNA-treated cells. Values are means±S.D. (n=3). (C) H2O2-induced cytotoxicity in different cell lines. HEK-293, HepG2 and IMR90 cells were exposed to increasing concentrations of H2O2, incubated for 8 h, and the cell survival was assessed with a Crystal Violet survival assay. The H2O2 induced increasing cytotoxicity in all three cell lines in a dose-dependent manner. Values are means±S.D. (n=3).

PAG inhibition or silencing of CSE expression sensitizes cells to H2O2-induced cytotoxicity

Knockdown of CSE did not result in significant spontaneous cell death (Figure 1B), indicating that CSE is not vital for cell survival, at least in the three cell lines used in the present study. To investigate the importance of CSE in the cellular antioxidative system, oxidative stress was induced in the three cell lines by treating them with H2O2, a strong oxidizing agent. HEK-293, HepG2 and IMR90 cells were exposed to H2O2 and then incubated for 8 h, and cell viability was assessed using a Crystal Violet cell survival assay. H2O2 induced cytotoxicity in a concentration-dependent manner with the approximate EC50 found to be 500 μM for both HEK-293 and HepG2 cells, and 300 μM for IMR90 cells (Figure 1C).

To show that the reduction in CSE expression or activity predisposes the cells to increased sensitivity towards H2O2-induced oxidative stress, CSE activity was inhibited by the irreversible inhibitor PAG for 2 h before the H2O2 challenge. PAG-treated cells showed reduced cell viability as compared with non-treated cells after the addition of H2O2 (Figure 2). PAG-treated HEK-293 cells displayed 70% viability, whereas non-treated cells displayed 85% cell viability after exposure to 200 μM H2O2. At 600 μM H2O2, cell viability of HEK-293 cells decreased by an additional 13% with PAG treatment as compared with non-treated cells. Similar sensitizing effects were also observed in CSE-knockdown cells. CSE-siRNA-treated HEK-293 cells exposed to 200 μM H2O2 had only 68% cell viability as compared with 84% cell viability in the scrambled-siRNA control group. PAG treatment or CSE silencing in HepG2 and IMR90 cell lines displayed a similar trend of increased sensitivity to H2O2 as compared with non-treated or scrambled-siRNA-treated cells. Taken together, these observations suggested that inhibition of CSE activity by PAG or lack of CSE expression results in higher susceptibility to oxidative stress-induced cell death.

Silencing of CSE expression or inhibition of CSE activity with PAG sensitized different cell lines to H2O2-induced cytotoxicity

Figure 2
Silencing of CSE expression or inhibition of CSE activity with PAG sensitized different cell lines to H2O2-induced cytotoxicity

HEK-293, HepG2 (both 48 h of knockdown) and IMR90 (72 h of knockdown) cells were exposed to H2O2 and incubated for 8 h. PAG (1 mM) was added to the cells 2 h before H2O2 exposure to ensure complete inhibition of the CSE activity. Cells inhibited with PAG or transfected with CSE-siRNA showed increased toxicity as compared with scrambled-siRNA-treated (SC) or non-treated (NT) cells. ORF, siRNA targeting the CSE ORF region. 3′-UTR, siRNA targeting the CSE 3′-UTR. Values are means ± S.D. (n=3). *P<0.05 and **P<0.01.

Figure 2
Silencing of CSE expression or inhibition of CSE activity with PAG sensitized different cell lines to H2O2-induced cytotoxicity

HEK-293, HepG2 (both 48 h of knockdown) and IMR90 (72 h of knockdown) cells were exposed to H2O2 and incubated for 8 h. PAG (1 mM) was added to the cells 2 h before H2O2 exposure to ensure complete inhibition of the CSE activity. Cells inhibited with PAG or transfected with CSE-siRNA showed increased toxicity as compared with scrambled-siRNA-treated (SC) or non-treated (NT) cells. ORF, siRNA targeting the CSE ORF region. 3′-UTR, siRNA targeting the CSE 3′-UTR. Values are means ± S.D. (n=3). *P<0.05 and **P<0.01.

CSE silencing or PAG inhibition results in increased levels of DHE and DCF fluorescence

Next, we examined whether the changes in cellular redox state contributed to H2O2-induced cell death. The levels of ROS production have been widely used as an oxidative stress marker and an indication of the cellular redox state. Two fluorescent probes, DHE and DCFH, were used to reflect the cellular oxidative state of CSE-knockdown or PAG-treated cells [26,27]. DHE reacts with oxidant species to form fluorescent products that bind to nucleic acids including ethidium and 2-hydroxyethidium. DCFH reacts with peroxides to form highly fluorescent DCF.

The results show that the cellular oxidative state significantly increased upon CSE silencing or PAG treatment in all three cell lines (Figure 3A). DHE fluorescence readings in CSE-knockdown cells increased significantly by 71% in HEK-293 cells, 36% in HepG2 cells and 64% in IMR90 cells as compared with scrambled-siRNA-treated cells. With respect to the DCF fluorescence level, we observed increases of 15, 55 and 38% in CSE-siRNA-treated HEK-293, HepG2 and IMR90 cells respectively. Similarly, oxidative stress was increased significantly with CSE inhibition with PAG, ranging from an increment of 33–56% for DHE and 14–177% for DCF fluorescence levels. Antimycin A, an inhibitor that targets the mitochondrial electron transport chain and is known to result in high oxidative stress, was used as a positive control in the assay.

Loss of CSE expression or activity increased cellular oxidative stress

Figure 3
Loss of CSE expression or activity increased cellular oxidative stress

(A) CSE silencing or PAG inhibition resulted in increased DHE and DCF fluorescence levels. Cells were incubated with DHE or DCFH-DA for 1 h before measurement of fluorescence with a spectrophotometer to assess the cellular oxidative state. Antimycin A (AA, 1 μM) served as a positive control. (B) Reintroduction of CSE expression reduced DHE and DCF fluorescence levels. Endogenous CSE in HEK-293 cells was first silenced with CSE-siRNA prior to co-transfection with pEGFP-C1 and pcDNA3.1-CSE. The positively transfected population was collected and subjected to DHE and DCF fluorescence measurement. Western blot (WB) analysis using anti-CSE and anti-FLAG antibodies showed the expression level of the endogenous and overexpressed FLAG–CSE respectively. Exogenous CSE reverted the increment of oxidative stress caused by loss of endogenous CSE. SC, scrambled-siRNA negative control; CSE, CSE-siRNA transfected; NT, non-treated; RFU, relative fluorescence unit. Values are means±S.D. (n=3). *P<0.05 and **P<0.01.

Figure 3
Loss of CSE expression or activity increased cellular oxidative stress

(A) CSE silencing or PAG inhibition resulted in increased DHE and DCF fluorescence levels. Cells were incubated with DHE or DCFH-DA for 1 h before measurement of fluorescence with a spectrophotometer to assess the cellular oxidative state. Antimycin A (AA, 1 μM) served as a positive control. (B) Reintroduction of CSE expression reduced DHE and DCF fluorescence levels. Endogenous CSE in HEK-293 cells was first silenced with CSE-siRNA prior to co-transfection with pEGFP-C1 and pcDNA3.1-CSE. The positively transfected population was collected and subjected to DHE and DCF fluorescence measurement. Western blot (WB) analysis using anti-CSE and anti-FLAG antibodies showed the expression level of the endogenous and overexpressed FLAG–CSE respectively. Exogenous CSE reverted the increment of oxidative stress caused by loss of endogenous CSE. SC, scrambled-siRNA negative control; CSE, CSE-siRNA transfected; NT, non-treated; RFU, relative fluorescence unit. Values are means±S.D. (n=3). *P<0.05 and **P<0.01.

Reintroduction of CSE protein expression in CSE-knockdown cells reduced the DHE and DCF fluorescence levels

To further verify whether the increased oxidative stress observed in CSE-knockdown cells was indeed a consequence of the loss of CSE, we examined whether exogenous overexpression of CSE in CSE-siRNA-treated cells would lessen the cellular oxidative stress. HEK-293 cells were first transfected with CSE-siRNA targeting the 3′-UTR of CSE mRNA to silence endogenous CSE expression. This was followed by reintroduction of CSE expression exogenously with co-transfection of pcDNA3.1-CSE and pEGFP-C1 plasmids. The pEGFP-C1 plasmid encoded for enhanced GFP and hence facilitated the sorting of the positively transfected population. The cells were then subjected to flow cytometric analysis and the GFP-positive cell population was collected for DHE and DCF fluorescence measurements.

As shown in Figure 3(B), DHE fluorescence in CSE-siRNA-treated cells showed an increase from 10 to 15 RFUs (relative fluorescence units). Overexpression of exogenous CSE in CSE-siRNA-treated cells successfully reduced the DHE fluorescence to a level similar to that in the scrambled-siRNA-treated group. A similar rescue effect was observed for the DCF fluorescence reading. Taken together, these data provide evidence that CSE possesses antioxidant activity.

Enzymatic activity of CSE modulates its antioxidative activity

We previously identified several amino acids that were crucial for modulation of CSE enzymatic activity [22]. Tyr60 is an evolutionarily conserved amino acid among CSE homologues and trans-sulfuration enzymes. Mutation of Tyr60 would disrupt the CSE active-site interface and fail to form the functional CSE tetramer. In contrast, Glu339 determines CSE catalytic activity, and mutation of this residue into a more hydrophobic amino acid, such as alanine or tyrosine, would significantly increase H2S production. Glu349 is not engaged in the enzyme catalytic reaction, therefore mutation to alanine (E349A) maintains the CSE activity as in wild-type protein. To elucidate the effects of modulation of the H2S-producing activity of CSE on the cellular antioxidative property at the molecular level, we constructed CSE mutants (Y60A, E339A and E349A) and compared their antioxidative activities with wild-type CSE protein.

The endogenous CSE expression was silenced in HEK-293 cells for 24 h, following by reintroduction of the wild-type and various CSE mutants for another 48 h before the fluorescence was measured. The results showed that both wild-type and the E349A mutant successfully reduced the increment of DHE and DCF fluorescence readings induced by CSE-siRNA treatment (Figure 4A). However, the inactive mutant Y60A, which failed in H2S production, exhibited a similar level of fluorescence readings as those in the CSE-siRNA-treated group, suggesting that the Y60A mutant could not provide antioxidative activity, unlike the wild-type or E339A mutant (Figure 4A). Importantly, the hyperactive E339A mutant, displaying a 4-fold greater H2S production (Figure 4B), not only reduced the fluorescence readings as with wild-type CSE, but also decreased the fluorescent probe reading to an even lower level than scrambled-siRNA-treated cells. This implies that E339A possesses better antioxidant activity than wild-type CSE, providing strong evidence that the endogenous H2S produced by CSE is essential for its antioxidative activity. We next examined the expression levels of several proteins known to be involved in the cellular antioxidative defence mechanism, including GCL, GSS, GR and cytosolic SOD1. GCL conjugates glutamic acid with a cysteine residue, which is the rate-limiting step of de novo glutathione synthesis. GSS then catalyses the final step of glutathione synthesis. GR, however, is essential in recycling the GSSG back into its reduced form. SOD1 acts as a superoxide scavenger, particularly in cytosolic compartments. No significant changes in the expression level of these antioxidative proteins were observed in CSE-knockdown cells (Figure 4C). This led us to suggest that CSE might regulate cellular redox by altering levels of small molecule oxidant scavengers.

Enzymatic activity of CSE to produce H2S is essential for its antioxidative property

Figure 4
Enzymatic activity of CSE to produce H2S is essential for its antioxidative property

(A) The CSE enzymatic activity-null mutant Y60A lost the ability to revert the increased DHE and DCF fluorescence. Mutant E339A had a marked reduction in fluorescence levels as compared with wild-type CSE. Control mutant E349A possessed similar fluorescence levels as the wild-type CSE. Western blot insets show the expression level of overexpressed wild-type and mutant FLAG–CSE. (B) In vitro H2S production by CSE mutants. The activity-null mutant Y60A produced no detectable H2S, whereas the mutant E339A which had a higher catalytic efficiency produced a much higher amount of H2S. The control mutant E349A did not show a significant difference in H2S production as compared with wild-type. RFU, relative fluorescence unit. Values are means±S.D. (n=3). *P<0.05 and **P<0.01. (C) Western blot analysis of antioxidative proteins. Protein expression of GCL, GSS, GR and SOD1 in cells treated with CSE-siRNA were examined. α-Tubulin was used as a loading control. SC, scrambled-siRNA negative control; CSE, CSE-siRNA transfected; WB, Western blot; WT, wild-type.

Figure 4
Enzymatic activity of CSE to produce H2S is essential for its antioxidative property

(A) The CSE enzymatic activity-null mutant Y60A lost the ability to revert the increased DHE and DCF fluorescence. Mutant E339A had a marked reduction in fluorescence levels as compared with wild-type CSE. Control mutant E349A possessed similar fluorescence levels as the wild-type CSE. Western blot insets show the expression level of overexpressed wild-type and mutant FLAG–CSE. (B) In vitro H2S production by CSE mutants. The activity-null mutant Y60A produced no detectable H2S, whereas the mutant E339A which had a higher catalytic efficiency produced a much higher amount of H2S. The control mutant E349A did not show a significant difference in H2S production as compared with wild-type. RFU, relative fluorescence unit. Values are means±S.D. (n=3). *P<0.05 and **P<0.01. (C) Western blot analysis of antioxidative proteins. Protein expression of GCL, GSS, GR and SOD1 in cells treated with CSE-siRNA were examined. α-Tubulin was used as a loading control. SC, scrambled-siRNA negative control; CSE, CSE-siRNA transfected; WB, Western blot; WT, wild-type.

CSE maintains cellular glutathione status

As mentioned, GSH forms the first line of cellular antioxidative defence whereby two GSH molecules react with an oxidant species to reduce the oxidant to a less-oxidized and toxic form. Consequently, the two GSH molecules are oxidized into a GSSG molecule. Once GSSG is formed, it can be reduced by GR to form two molecules of GSH. Hence, the pool of GSH molecules is replenished and is ready to serve as a cellular antioxidant [16,20]. Previous studies have suggested that H2S might elevate the cellular GSH level, and GSH is known to be important for cellular antioxidative defence [28,29]. We thus speculated that the attenuation of antioxidative capacity observed upon the loss of CSE may be related to changes in glutathione status.

We measured cellular total glutathione concentration (both the reduced and oxidized forms) using an in vitro glutathione assay. Cells transfected with CSE-siRNA or treated with PAG were harvested with MPA to preserve cellular glutathione in its native state. Lysate was then subjected to an in vitro enzymatic assay. The total glutathione concentration was significantly decreased with both the CSE-siRNA and PAG treatment (Figure 5A). Compared with the scrambled-siRNA-treated cells, a reduction of 27, 23 and 29% in the total glutathione concentration was observed in HEK-293, HepG2 and IMR90 cells respectively treated with CSE-siRNA. A similar trend was also observed in PAG-treated cells as compared with non-treated cells. It was of note that the changes in total glutathione observed in CSE-siRNA and PAG-treated cells were mainly caused by a reduction in the GSH concentration, which in turn led to a decrease in the GSH/GSSG ratio. CSE-siRNA treatment resulted in a decrease in the cellular GSH/GSSG ratio of 50% in HEK-293 cells, 47% in HepG2 cells and 56% in IMR90 cells, as compared with scrambled-siRNA-treated cells, whereas PAG treatment also resulted in a lower GSH/GSSG ratio as compared with non-treated cells (24% in HEK-293 cells, 46% in HepG2 cells and 20% in IMR90 cells, Figure 5B). H2O2 treatment was included as a positive control. When we used the same approach described in Figure 3(B), the total glutathione concentration and GSH/GSSG ratio increased significantly with CSE re-expression, as compared with that in CSE-knockdown cells (Figure 5C). These results indicate that the loss of CSE decreases cellular glutathione concentration, thus predisposing the cells to oxidative stress-induced cytotoxicity.

CSE maintains cellular glutathione status

Figure 5
CSE maintains cellular glutathione status

(A) Loss of CSE decreased the total glutathione concentration. The total glutathione concentration is shown as the sum of oxidized glutathione (GSSG, white bar) and reduced glutathione (GSH, black bar). Percentages of differences in total glutathione concentration among samples are shown. (B) Silencing of CSE expression or inhibition of CSE activity decreased the GSH/GSSG ratio. The ratio of reduced glutathione to oxidized glutathione was determined using a glutathione assay. H2O2 (200 μM, 2 h) served as a positive control. Percentages of differences in the glutathione ratio are shown. (C) Reintroduction of exogenous CSE restored the cellular total glutathione concentration and GSH/GSSG ratio. A higher total glutathione concentration and GSH/GSSG ratio was observed in HEK-293 cells transfected with pcDNA3.1-CSE as compared with that in CSE-knockdown cells. Western blot analysis using anti-CSE and anti-FLAG antibodies showed the expression level of the endogenous and overexpressed FLAG–CSE respectively. Values are means±S.D. (n=3). *P<0.05 and **P<0.01. SC, scrambled-siRNA; NT, non-treated; WB, Western blot.

Figure 5
CSE maintains cellular glutathione status

(A) Loss of CSE decreased the total glutathione concentration. The total glutathione concentration is shown as the sum of oxidized glutathione (GSSG, white bar) and reduced glutathione (GSH, black bar). Percentages of differences in total glutathione concentration among samples are shown. (B) Silencing of CSE expression or inhibition of CSE activity decreased the GSH/GSSG ratio. The ratio of reduced glutathione to oxidized glutathione was determined using a glutathione assay. H2O2 (200 μM, 2 h) served as a positive control. Percentages of differences in the glutathione ratio are shown. (C) Reintroduction of exogenous CSE restored the cellular total glutathione concentration and GSH/GSSG ratio. A higher total glutathione concentration and GSH/GSSG ratio was observed in HEK-293 cells transfected with pcDNA3.1-CSE as compared with that in CSE-knockdown cells. Western blot analysis using anti-CSE and anti-FLAG antibodies showed the expression level of the endogenous and overexpressed FLAG–CSE respectively. Values are means±S.D. (n=3). *P<0.05 and **P<0.01. SC, scrambled-siRNA; NT, non-treated; WB, Western blot.

H2S increases the cellular glutathione pool

H2S is the end-product of CSE enzymatic activity. It is estimated that the systemic concentration of H2S ranges from 20 to 300 μM [30], and the presence of this low amount of H2S might be responsible for its physiological antioxidative properties. Hence, to better mimic the physiological level of H2S, HEK-293 cells were incubated with a slow-releasing H2S donor, GYY4137 [31]. The total glutathione level and GSH/GSSG ratio were measured using an in vitro glutathione assay after 24 h of GYY4137 incubation. A concentration of 400 μM GYY4137 significantly induced a 30% increase in cellular total glutathione concentration, predominantly in the GSH form, and a 21% increment in the GSH/GSSG ratio (Figure 6A). Moreover, the total glutathione concentration and GSH/GSSG ratio measured in the GYY4137-treated cells increased in a concentration-dependent manner, suggesting that the cytoprotective effects of H2S might occur through glutathione homoeostasis.

H2S increased the glutathione pool and preserved glutathione status

Figure 6
H2S increased the glutathione pool and preserved glutathione status

(A) Exogenous H2S increased the cellular total glutathione concentration and GSH/GSSG ratio. The total glutathione concentration and GSH/GSSG ratio of HEK-293 cells were examined after incubation with a slow-releasing H2S donor GYY4137. GYY4137 increased the total glutathione concentration and the GSH/GSSG ratio in a concentration-dependent manner. Percentages of differences are shown. (B) Exogenous H2S protected cells from BSO-induced glutathione depletion. BSO (200 μM) inhibited de novo glutathione synthesis, thus inducing glutathione depletion in HEK-293 cells. Exogenous H2S significantly maintained a higher level of remaining glutathione pool in the GYY4137-treated cells as compared with non-treated cells. (C) Exogenous H2S maintained a higher total glutathione concentration and GSH/GSSG ratio in the cells exposed to BSO. Percentages of differences are shown. Values are means±S.D. (n=3). *P<0.05 and **P<0.01.

Figure 6
H2S increased the glutathione pool and preserved glutathione status

(A) Exogenous H2S increased the cellular total glutathione concentration and GSH/GSSG ratio. The total glutathione concentration and GSH/GSSG ratio of HEK-293 cells were examined after incubation with a slow-releasing H2S donor GYY4137. GYY4137 increased the total glutathione concentration and the GSH/GSSG ratio in a concentration-dependent manner. Percentages of differences are shown. (B) Exogenous H2S protected cells from BSO-induced glutathione depletion. BSO (200 μM) inhibited de novo glutathione synthesis, thus inducing glutathione depletion in HEK-293 cells. Exogenous H2S significantly maintained a higher level of remaining glutathione pool in the GYY4137-treated cells as compared with non-treated cells. (C) Exogenous H2S maintained a higher total glutathione concentration and GSH/GSSG ratio in the cells exposed to BSO. Percentages of differences are shown. Values are means±S.D. (n=3). *P<0.05 and **P<0.01.

Next, HEK-293 cells were pretreated with GYY4137 followed by incubation with BSO (500 μM) for 6 h. BSO is an inhibitor of γ-glutamylcysteine synthase that inhibits de novo GSH synthesis. By blocking glutathione synthesis, the endogenous glutathione pool is depleted over time. Using BSO to induce gluta-thione depletion, we could examine the role of H2S in glutathione homoeostasis. GYY4137 incubation steadily maintained a higher remaining glutathione pool upon BSO insult (Figure 6B), an additional 6, 11 and 22% in 400, 600 and 800 μM GYY4137-treated cells respectively, as compared with non-treated cells. This implied that the BSO-induced glutathione depletion rate was lower in the presence of exogenous H2S. Within the remaining glutathione pool there was a consistently higher proportion of GSH reflected as a 37–147% increase in the GSH/GSSG ratio (Figure 6C). Taken together, these results show that H2S increases the GSH concentration and maintains a higher GSH/GSSG ratio, which are attributed to its protective role in a glutathione-depleted condition.

DISCUSSION

An increasing number of reports have highlighted the important role of H2S in pathophysiological and physiological processes, especially in cardiovascular and neurology fields [6,17,18,32]. Owing to the basic chemistry of the H2S molecule, which is a strong reducing agent, many of these studies have suggested that the protective role of H2S is thought to be antioxidative [13]. We elucidated the antioxidative role of the CSE/H2S system by examining the cellular redox state upon inhibition of endogenous CSE activity through CSE-siRNA knockdown or PAG treatment. The antioxidative property of CSE was apparent when the cells were exposed to the H2O2 oxidizing agent. Inhibition of CSE activity with PAG demonstrated a sensitization effect towards H2O2-induced cytotoxicity (Figure 2). Silencing of CSE expression also resulted in a comparable or even higher sensitivity towards oxidative stress. In parallel with enhanced cytotoxicity to H2O2, we observed increased levels of oxidative stress in CSE-knockdown or PAG-treated cells (Figure 3). This combination of data provide evidence that the CSE/H2S system serves as a basal cellular oxidative defence mechanism. Whether two other H2S-producing enzymes (CBS and 3-MPST) have similar regulatory functions is unclear at this moment; however, we did not observe similar sensitization effects towards H2O2 challenge in the same cell lines we tested for CSE (results not shown).

Using CSE mutants, we provided direct molecular evidence that the antioxidative property of CSE was largely contributed by its catalytic activity in H2S production (Figure 4). Tyr60 is located at the interactive phase between CSE monomers and is important for CSE tetramerization. Therefore mutagenesis of Tyr60 into a non-active alanine residue completely disrupted the CSE catalytic function and resulted in a significant increase in oxidative stress. However, increasing the hydrophobicity of residue 339 was shown to enhance the rate of α,β-elimination; thus the mutant E339A produces a higher amount of H2S compared with wild-type CSE. The higher level of H2S production of the E339A mutant exhibits better antioxidant activity than wild-type CSE as revealed by the marked reduction in DHE and DCF fluorescence (Figure 4). This new perspective highlights the significance of the CSE/H2S system in cellular oxidative biology.

Loss of CSE activity resulted in a reduction in the cellular total glutathione concentration, particularly of the GSH form (Figure 5). The significant decrease in GSH content led to a decrease in GSH/GSSG ratio, suggesting the involvement of the CSE/H2S system in maintaining cellular glutathione status. To demonstrate the importance of H2S in glutathione homoeostasis, we treated the cells with GYY4137, a slow-releasing H2S donor. In contrast with the conventionally used sulfide salts, GYY4137 releases H2S in a low and slow manner and can sustain H2S release in culture over a long period of time [31,33], thus serving as a better mimic of physiological H2S exposure. Exposure to GYY4137 increased the cellular GSH concentration, and maintained the cells in a more reduced state in a concentration-dependent manner (Figure 6). Because glutathione is the cellular first line of defence against oxidative challenges, depletion of glutathione is often associated with disease [34]. We examined whether H2S exerts a protective role in the presence of the glutathione synthase inhibitor BSO, which inhibits de novo glutathione synthesis, thus resulting in exhaustion of the endogenous glutathione pool. With no new glutathione synthesis, we could examine the effects of H2S on maintaining the cellular glutathione status. Indeed, H2S increased the GSH concentration significantly with no obvious changes in GSSG content. The GSH/GSSG ratio hence was maintained at a higher level as compared with those in the control group. These data provide evidence that the H2S molecule is an important species in the maintenance of cellular redox balance and might protect cells from oxidative insult in disease-induced glutathione depletion.

In response to the presence of ROS, GSH serves as the first-line defence mechanism. We showed CSE/H2S to be an important molecule that facilitates the maintenance of GSH status. Inhibition of the CSE/H2S system decreases the cellular GSH concentration, of which a decrease in the GSH/GSSG ratio follows as a consequence. Oxidized glutathione needs to be channelled into a chained recycling system involving GR-thioredoxin enzymes by using NADPH as consumable reductants [35]. Therefore, being a strong reducing thiol, H2S might also act through the thioredoxin or NADPH system to exert its antioxidative property, as both the GSH and thioredoxin mechanisms are interconnected and thiol-based [36]. Although the underlying mechanism of how H2S undergoes disulfide exchange with oxidized glutathione is inconclusive, our data showing that the cells exposed to H2S had a higher GSH portion as compared with the non-treated control (Figure 6) may suggest that the glutathione recycling rate is enhanced. CSE/H2S might also act on the NADPH/NADP-GSH/GSSG systemic balance to exert its antioxidative activity. Future exploration of the role of CSE/H2S in oxidative biology will shed light on its potential clinical application.

Abbreviations

     
  • BSO

    buthionine sulfoximine

  •  
  • CBS

    cystathionine β-synthase

  •  
  • CSE

    cystathionine γ-lyase

  •  
  • DCF

    2′,7′-dichlorofluorescein

  •  
  • DCFH-DA

    2′,7′-dichlorodihydrofluorescein diacetate

  •  
  • DHE

    dihydroethidine

  •  
  • DMEM

    Dulbecco’s modified Eagle’s medium

  •  
  • GCL

    glutamyl-cysteine ligase

  •  
  • GR

    glutathione reductase

  •  
  • GSS

    glutathione synthetase

  •  
  • HEK

    human embryonic kidney

  •  
  • MPA

    metaphosphoric acid

  •  
  • 3-MPST

    3-mercaptopyruvate sulfurtransferase

  •  
  • PAG

    propargylglycine

  •  
  • ROS

    reactive oxygen species

  •  
  • SOD1

    superoxide dismutase 1

  •  
  • 4-VP

    4-vinylpyridine

AUTHOR CONTRIBUTION

Lih-Wen Deng conceived and contributed to the study design. Zheng-Wei Lee, Yi-Lian Low and Tianxiao Wang performed the experiments. Shufen Huang established the H2S assay and purified CSE proteins. Zheng-Wei Lee and Lih-Wen Deng analysed the data, and wrote and revised the paper.

We thank Dr T. Hagen and Dr Y.H. Gan (both from the Department of Biochemistry, National University of Singapore, Singapore) for providing DHE, DCFH and BSO, Dr W.S. Yew (Department of Biochemistry, National University of Singapore, Singapore) for use of the spectrophotometer, and Dr P.K. Moore (Department of Pharmacology, National University of Singapore, Singapore) for helpful discussion.

FUNDING

This work was supported, in part, by an A*STAR Nutrition and Food Science grant [grant number R-183-000-313-305] and a National University Health System Bench-to-Bedside grant [grant number R183-000-312-515] (to L.W.D.) Z.W.L. is a recipient of Research Scholarship from the Yong Loo Lin School of Medicine, National University of Singapore, Singapore.

References

References
1
Kimura
H.
Hydrogen sulfide: its production, release and functions
Amino Acids
2011
, vol. 
41
 (pg. 
113
-
121
)
[PubMed]
2
Shibuya
N.
Mikami
Y.
Kimura
Y.
Nagahara
N.
Kimura
H.
Vascular endothelium expresses 3-mercaptopyruvate sulfurtransferase and produces hydrogen sulfide
J. Biochem.
2009
, vol. 
146
 (pg. 
623
-
626
)
[PubMed]
3
Shibuya
N.
Tanaka
M.
Yoshida
M.
Ogasawara
Y.
Togawa
T.
Ishii
K.
Kimura
H.
3-Mercaptopyruvate sulfurtransferase produces hydrogen sulfide and bound sulfane sulfur in the brain
Antioxid. Redox Signal.
2009
, vol. 
11
 (pg. 
703
-
714
)
[PubMed]
4
Hosoki
R.
Matsuki
N.
Kimura
H.
The possible role of hydrogen sulfide as an endogenous smooth muscle relaxant in synergy with nitric oxide
Biochem. Biophys. Res. Commun.
1997
, vol. 
237
 (pg. 
527
-
531
)
[PubMed]
5
Zhao
W.
Zhang
J.
Lu
Y.
Wang
R.
The vasorelaxant effect of H2S as a novel endogenous gaseous KATP channel opener
EMBO J.
2001
, vol. 
20
 (pg. 
6008
-
6016
)
[PubMed]
6
Hu
L. F.
Lu
M.
Hon Wong
P. T.
Bian
J. S.
Hydrogen sulfide: neurophysiology and neuropathology
Antioxid. Redox Signal.
2011
, vol. 
15
 (pg. 
405
-
419
)
[PubMed]
7
Calvert
J. W.
Elston
M.
Nicholson
C. K.
Gundewar
S.
Jha
S.
Elrod
J. W.
Ramachandran
A.
Lefer
D. J.
Genetic and pharmacologic hydrogen sulfide therapy attenuates ischemia-induced heart failure in mice
Circulation
2010
, vol. 
122
 (pg. 
11
-
19
)
[PubMed]
8
Zhu
Y. Z.
Wang
Z. J.
Ho
P.
Loke
Y. Y.
Zhu
Y. C.
Huang
S. H.
Tan
C. S.
Whiteman
M.
Lu
J.
Moore
P. K.
Hydrogen sulfide and its possible roles in myocardial ischemia in experimental rats
J. Appl. Physiol.
2007
, vol. 
102
 (pg. 
261
-
268
)
[PubMed]
9
Sivarajah
A.
McDonald
M. C.
Thiemermann
C.
The production of hydrogen sulfide limits myocardial ischemia and reperfusion injury and contributes to the cardioprotective effects of preconditioning with endotoxin, but not ischemia in the rat
Shock
2006
, vol. 
26
 (pg. 
154
-
161
)
[PubMed]
10
Fox
B.
Schantz
J. T.
Haigh
R.
Wood
M. E.
Moore
P. K.
Viner
N.
Spencer
J. P.
Winyard
P. G.
Whiteman
M.
Inducible hydrogen sulfide synthesis in chondrocytes and mesenchymal progenitor cells: is H2S a novel cytoprotective mediator in the inflamed joint?
J. Cell. Mol. Med.
2012
, vol. 
16
 (pg. 
896
-
910
)
[PubMed]
11
Tay
A. S.
Hu
L. F.
Lu
M.
Wong
P. T. H.
Bian
J. S.
Hydrogen sulfide protects neurons against hypoxic injury via stimulation of ATP-sensitive potassium channel/protein kinase C/extracellular signal-regulated kinase/heat shock protein90 pathway
Neuroscience
2010
, vol. 
167
 (pg. 
277
-
286
)
[PubMed]
12
Zhang
L.-M.
Jiang
C.-X.
Liu
D.-W.
Hydrogen sulfide attenuates neuronal injury induced by vascular dementia via inhibiting apoptosis in rats
Neurochem. Res.
2009
, vol. 
34
 (pg. 
1984
-
1992
)
[PubMed]
13
Calvert
J. W.
Coetzee
W. A.
Lefer
D. J.
Novel insights into hydrogen sulfide-mediated cytoprotection
Antioxid. Redox Signal.
2010
, vol. 
12
 (pg. 
1203
-
1217
)
[PubMed]
14
Whiteman
M.
Winyard
P. G.
Hydrogen sulfide and inflammation: the good, the bad, the ugly and the promising
Exp. Rev. Clin. Pharm.
2010
, vol. 
4
 (pg. 
13
-
32
)
15
Sies
H.
Keaney
J.
Jr
What is oxidative stress?
Oxidative Stress and Vascular Disease
2000
Springer
(pg. 
1
-
8
)
16
Jones
D. P.
Redefining oxidative stress
Antioxid. Redox Signal.
2006
, vol. 
8
 (pg. 
1865
-
1879
)
[PubMed]
17
Ali
M. Y.
Ping
C. Y.
Mok
Y. Y.
Ling
L.
Whiteman
M.
Bhatia
M.
Moore
P. K.
Regulation of vascular nitric oxide in vitro and in vivo: a new role for endogenous hydrogen sulphide?
Br. J. Pharmacol.
2006
, vol. 
149
 (pg. 
625
-
634
)
[PubMed]
18
Muzaffar
S.
Shukla
N.
Bond
M.
Newby
A. C.
Angelini
G. D.
Sparatore
A.
Del Soldato
P.
Jeremy
J. Y.
Exogenous hydrogen sulfide inhibits superoxide formation, NOX-1 expression and Rac1 activity in human vascular smooth muscle cells
J. Vasc. Res.
2008
, vol. 
45
 (pg. 
521
-
528
)
[PubMed]
19
Jha
S.
Calvert
J. W.
Duranski
M. R.
Ramachandran
A.
Lefer
D. J.
Hydrogen sulfide attenuates hepatic ischemia-reperfusion injury: role of antioxidant and antiapoptotic signaling
Am. J. Physiol. Heart Circ. Physiol.
2008
, vol. 
295
 (pg. 
H801
-
H806
)
[PubMed]
20
Forman
H. J.
Zhang
H.
Rinna
A.
Glutathione: overview of its protective roles, measurement, and biosynthesis
Mol. Asp. Med.
2009
, vol. 
30
 (pg. 
1
-
12
)
21
Dickhout
J. G.
Carlisle
R. E.
Jerome
D. E.
Mohammed-Ali
Z.
Jiang
H.
Yang
G.
Mani
S.
Garg
S. K.
Banerjee
R.
Kaufman
R. J.
, et al. 
Integrated stress response modulates cellular redox state via induction of cystathionine γ-lyase: cross-talk between integrated stress response and thiol metabolism
J. Biol. Chem.
2012
, vol. 
287
 (pg. 
7603
-
7614
)
[PubMed]
22
Huang
S.
Chua
J. H.
Yew
W. S.
Sivaraman
J.
Moore
P. K.
Tan
C.-H.
Deng
L.-W.
Site-directed mutagenesis on human cystathionine-γ-lyase reveals insights into the modulation of H2S production
J. Mol. Biol.
2010
, vol. 
396
 (pg. 
708
-
718
)
[PubMed]
23
Bonnekoh
B.
Wevers
A.
Jugert
F.
Merk
H.
Mahrle
G.
Colorimetric growth assay for epidermal cell cultures by their crystal violet binding capacity
Arch. Dermatol. Res.
1989
, vol. 
281
 (pg. 
487
-
490
)
[PubMed]
24
Wardman
P.
Fluorescent and luminescent probes for measurement of oxidative and nitrosative species in cells and tissues: progress, pitfalls, and prospects
Free Radic. Biol. Med.
2007
, vol. 
43
 (pg. 
995
-
1022
)
[PubMed]
25
Winterbourn
C. C.
The challenges of using fluorescent probes to detect and quantify specific reactive oxygen species in living cells
Biochim. Biophys. Acta
2014
, vol. 
1840
 (pg. 
730
-
738
)
[PubMed]
26
Negre-Salvayre
A.
Augé
N.
Duval
C.
Robbesyn
F.
Thiers
J.-C.
Nazzal
D.
Benoist
H.
Salvayre
R.
Detection of intracellular reactive oxygen species in cultured cells using fluorescent probes
Methods Enzymol.
2002
, vol. 
352
 (pg. 
62
-
71
)
[PubMed]
27
Robinson
J. P.
Bruner
L. H.
Bassoe
C. F.
Hudson
J. L.
Ward
P. A.
Phan
S. H.
Measurement of intracellular fluorescence of human monocytes relative to oxidative metabolism
J. Leukocyte Biol.
1988
, vol. 
43
 (pg. 
304
-
310
)
28
Kimura
Y.
Goto
Y.
Kimura
H.
Hydrogen sulfide increases glutathione production and suppresses oxidative stress in mitochondria
Antioxid. Redox Signal.
2010
, vol. 
12
 (pg. 
1
-
13
)
[PubMed]
29
Wei
H. L.
Zhang
C. Y.
Jin
H. F.
Tang
C. S.
Du
J. B.
Hydrogen sulfide regulates lung tissue-oxidized glutathione and total antioxidant capacity in hypoxic pulmonary hypertensive rats
Acta Pharmacol. Sin.
2008
, vol. 
29
 (pg. 
670
-
679
)
[PubMed]
30
Olson
K. R.
The therapeutic potential of hydrogen sulfide: separating hype from hope
Am. J. Physiol. Regul. Integr. Comp. Physiol.
2011
, vol. 
301
 (pg. 
R297
-
R312
)
[PubMed]
31
Li
L.
Whiteman
M.
Guan
Y. Y.
Neo
K. L.
Cheng
Y.
Lee
S. W.
Zhao
Y.
Baskar
R.
Tan
C.-H.
Moore
P. K.
Characterization of a novel, water-soluble hydrogen sulfide-releasing molecule (GYY4137): new insights into the biology of hydrogen sulfide
Circulation
2008
, vol. 
117
 (pg. 
2351
-
2360
)
[PubMed]
32
Pan
L. L.
Liu
X. H.
Gong
Q. H.
Yang
H. B.
Zhu
Y. Z.
Role of cystathionine γ-lyase/hydrogen sulfide pathway in cardiovascular disease: a novel therapeutic strategy?
Antioxid. Redox Signal.
2012
, vol. 
17
 (pg. 
106
-
118
)
[PubMed]
33
Lee
Z. W.
Zhou
J.
Chen
C.-S.
Zhao
Y.
Tan
C.-H.
Li
L.
Moore
P. K.
Deng
L.-W.
The slow-releasing hydrogen sulfide donor, GYY4137, exhibits novel anti-cancer effects in vitro and in vivo
PLoS ONE
2011
, vol. 
6
 pg. 
e21077
 
[PubMed]
34
Ballatori
N.
Krance
S. M.
Notenboom
S.
Shi
S.
Tieu
K.
Hammond
C. L.
Glutathione dysregulation and the etiology and progression of human diseases
Biol. Chem.
2009
, vol. 
390
 (pg. 
191
-
214
)
[PubMed]
35
Lushchak
V. I.
Glutathione homeostasis and functions: potential targets for medical interventions
J. Amino Acids
2012
, vol. 
2012
 pg. 
736837
 
36
Nordberg
J.
Arnér
E. S. J.
Reactive oxygen species, antioxidants, and the mammalian thioredoxin system
Free Radic. Biol. Med.
2001
, vol. 
31
 (pg. 
1287
-
1312
)
[PubMed]