The host-mediated RNAi pathways restrict replication of viruses in plant, invertebrate and vertebrate systems. However, comparatively little is known about the interplay between RNAi and various viral infections in mammalian hosts. We show in the present study that the siRNA-mediated silencing of Drosha, Dicer and Ago2 [argonaute RISC (RNA-induced silencing complex) catalytic component 2] transcripts in Huh7 cells resulted in elevated levels of HBV (hepatitis B virus)-specific RNAs and, conversely, we observed a decrease in mRNA and protein levels of same RNAi components in HepG2 cells infected with HBV. Similar reductions were also detectable in CHB (chronic hepatitis B) patients. Analysis of CHB liver biopsy samples, with high serum HBV DNA load (>log108 IU/ml), revealed a reduced mRNA and protein levels of Drosha, Dicer and Ago2. The low expression levels of key RNAi pathway components in CHB patient samples as well as hepatic cells established a link between HBV replication and RNAi components. The HBV proteins were also examined for RSS (RNA-silencing suppressor) properties. Using GFP-based reversion of silencing assays, in the present study we found that HBx is an RSS protein. Through a series of deletions and substitution mutants, we found that the full-length HBx protein is required for optimum RSS activity. The in vitro dicing assays revealed that the HBx protein inhibited the human Dicer-mediated processing of dsRNAs into siRNAs. Together, our results suggest that the HBx protein might function as RSS to manipulate host RNAi defence, in particular by abrogating the function of Dicer. The present study may have implications in the development of newer strategies to combat HBV infection.

INTRODUCTION

RNAi is a conserved eukaryotic pathway involved in gene regulation and is also emerging as an important antiviral mechanism [1,2]. The antiviral role of RNAi in plants was first established by observing the generation of viral siRNAs that subsequently targeted viral mRNAs [3]. Later, it was shown that RNAi plays an important part in the defence against viruses of diverse eukaryotic hosts such as Drosophila melanogaster and Caenorhabditis elegans [4,5]. Mutations affecting RNAi functions in these invertebrates resulted in increased susceptibility to infections by viruses. To combat the strong anti-viral response of RNAi in plants and other systems, viruses have adopted different strategies. Most importantly, viruses encode RSS (RNA-silencing suppressor) elements (RNA and protein factors) that suppress RNA silencing at various levels to offer a selective advantage for viral replication [6].

To date, RNA-silencing responses to viral infections have been demonstrated for all groups of plant viruses, and these viruses have been demonstrated to encode one or more RSSs, which also act as pathogenicity determinants by manipulating the host RNAi responses at multiple levels [7]. However, the existence of an analogous RSS system in vertebrates has been debated on the grounds of their advanced adaptive immunity to viral infection along with their IFN (interferon)-based anti-virus mechanism [8]. Pederson et al. [9] demonstrated a functional interplay between IFN and the silencing pathways and others have successfully demonstrated the appearance of viral siRNAs following infection of viruses in mammalian hosts [2,10,11]. Importantly, viral proteins that act as IFN antagonists have been shown to act as RSSs [12]. These viral suppressors are diverse within and across kingdoms, exhibiting little or no sequence similarities, and they act via different mechanisms. The SARS (severe acute respiratory syndrome) virus7a accessory protein, NS1 from influenza A virus, capsid and E2 proteins from hepatitis C virus, Tas protein of primate foamy virus, the VP35, VP30 and VP40 proteins of Ebola virus, NS4B protein of Dengue virus, and the B2 protein of Nodamura virus are some of the well-described mammalian RSS proteins [1317].

HBV (hepatitis B virus) is a small enveloped DNA virus that primarily infects hepatocytes and is one of the major causes of HCC (hepatocellular carcinoma) [18]. The HBV genome is approximately 3.2 kb in length and consists of four major ORFs, namely S, P, C and X. Of the four ORFs, the S ORF codes for three surface proteins [LHBs (large hepatitis B S protein), MHBs (middle hepatitis B S protein) and HBs (hepatitis B S protein)], and the C ORF codes for two forms of the core proteins (PreC/Core and Core). ORF X codes for the HBx protein and ORF P codes for the polymerase gene. The transcription map of ORF X is shown in Supplementary Figure S1 (http://www.biochemj.org/bj/462/bj4620347add.htm) [19,20]. Of these proteins, HBx is a multifunctional protein that regulates numerous signal transduction pathways, transcription factors, cell-cycle progression and apoptosis [21]. The relationship between RNAi and HBV has long been speculated. Indeed, HBV infection has been shown to alter various groups of cellular miRNAs, and the overexpression of the HBx protein alone has been reported to change the host miRNA profile [22,23]. A recent study showed that hepatic miRNAs and Ago2 [argonaute RISC (RNA-induced silencing complex) catalytic component 2], which is a component of the RNAi machinery, play crucial role(s) in HBV infection [24], thereby suggesting a link between HBV pathogenesis and host RNAi components.

We have identified and characterized RSSs of different animal viruses using the RNAi sensor lines developed in our laboratory. In the present study, we have analysed the role of the RNAi machinery in regulating HBV replication in mammalian cells and subsequently evaluated the different viral ORFs for RNAi suppressor activity. The results were evaluated by measuring the levels of human RNAi factors in HBV-infected mammalian cells and in liver biopsies of CHB (chronic hepatitis B) patients. Screening for HBV-encoded RSS proteins revealed that HBx could be an RNAi suppressor. Purified HBx protein showed an inhibitory effect over Dicer-mediated siRNA formation in an in vitro dicing assay. Together, our results provide further evidence for the antiviral function of the host RNAi machinery in HBV replication and reveals that the RNAi evasion strategy is operative in HBV.

MATERIALS AND METHODS

Cell culture and plasmid constructs

HEK (human embryonic kidney)-293T, HepG2 and Huh7 cells were grown in DMEM (Dulbecco's modified Eagle's medium) supplemented with 10% FBS, L-glutamine, pyruvic acid and 100 units of a penicillin/streptomycin mixture. Sf21 Spodoptera frugiperda insect cells were grown in TNMFH insect medium (Invitrogen).

HBV ORFs (except ORF P encoding polymerase) X, C and S and their internal genes, namely, HBx, Core, PreC/Core, HBs, MHBs and LHBs, were cloned individually into the pCDNA3.1+ vector using the primer sequences described in Table 1. The HBx gene was cloned into pIB/V5-HisTOPO-TA and pBI121 for expression in insect (Sf21) and plant systems respectively. The pGFP-V-RS series of vectors expressing tGFP (turbo GFP; an enhanced variant of GFP), tGFP+tGFP shRNA or tGFP+scrambled-shRNA were obtained from OriGene and renamed as pGFPVRS-1, pGFPVRS-2 and pGFPVRS-3 respectively. Plasmid construct with the complete HBV genome (pHBVX) and a plasmid containing complete HBV genome with a defect in the HBx gene to prevent its protein expression (pHBVΔX), as described previously [25,26], were used in transient HBV replication assays. The deletion and substitution mutants of HBx were generated using primers designed for their respective regions (Figures 3E and 3G) and are given in Table 1. The substitution mutants (Figure 3G) were generated using the QuikChange® site-directed mutagenesis kit (Agilent Technologies) according to the manufacturer's protocol.

Table 1
List of primers used for the cloning of HBV genes and HBx mutants
Primer Sequence (5′→3′) 
FP_LHBs TTTGGGGCTAGCATGGGGCAGAATCTTTCCACCAGC 
FP_MHBs TTTGGGGCTAGCATGGAGCAGTGGAATTCCACAACTTTC 
FP_HBs TTTGGGGCTAGCATGGAGAACATCACATCAGGATTC 
RP_HBs (LHBs, MHBs) GGGGTCGACTTAAATGTATACCCAAAGACAAAAGAA 
FP_PreC/Core GGGGTCGACTTAAATGTATACCCAAAGACAAAAGAA 
FP_Core TTTGGGGCTAGCATGGAACAACTTTTTCACCTCTGCCTA 
RP_Core (PreC/Core) GGGGTCGACCTAACATTGAGATTCCCGAGATTGAGA 
FP_HBx TTTGGGGCTAGCATGGCTGCTAGGCTGTGCTGCCAA 
RP_HBx GGGGTCGACTTAGGCAGAGGTGAAAAAGTTGCATGG 
FP_XA GGCTCTAGAGCCGCCATGGCTGCTAGGCTGTACTGCCAACTG 
RP_XA TAAGAGCTCTTAGACGGGGAGACCGCGTAAAGAGAGGTG 
FP_XA3 GCTAGCGCCATGGCCATGGCTGCTAGGCTGTACTGCCAA 
RP_XA3 GTCGACTTAAGGGGACGAGAGAGTCCCAAGCGG 
FP_XB GGCTCTAGAGCCGCCATGGGGCCGCTTGGGACTCTCTCGTCC 
RP_XB TAAGAGCTCTTACAGGATCTGATGGGCGTTCACGGTGGT 
FP_XB2 GCTAGCGCCATGGCCATGTCTCCGTCTGCCGTTTCG 
RP_XB2 GTCGACTTAGGGCAAGAAGTGGTGGGCGTTCAC 
FP_XC GGCTCTAGAGCCGCCATGGTCTGTGCCTTCTCATCTGCC 
RP_XC TAAGAGCTCTTAGGCAGAGGTGAAAAAGTTGCATGGTGC 
FP_XC2 GCTAGCGCCATGGCCATGAAGGTCTTACATAAGAGG 
RP_XC2 GTCGACTTAGGCAGAGGTGAAAAAGTTGCA 
FP_R13A CTGGATCCTGCGGCAGACGTCCTTTGT 
RP_R13A ACAAAGGACGTCTGCCGCAGGATCCAG 
FP_R19A GTCCTTTGTTTAGCCCCCGTCGGCGCT 
RP_R19A AGCGCCGACGGGGGCTAAACAAAGGAC 
FP_C6169T CTCCCCGTCACCGCCTTCTCATCTGCCGGACCGACCGCACTTCGC 
RP_C6169T GCGAAGTGCGGTCGGTCCGGCAGATGAGAAGGCGGTGACGGGGAG 
FP_H139D GGAGGCTGTAGGGATAAATTGGTCTGC 
RP_H139D GCAGACCAATTTATCCCTACAGCCTCC 
Primer Sequence (5′→3′) 
FP_LHBs TTTGGGGCTAGCATGGGGCAGAATCTTTCCACCAGC 
FP_MHBs TTTGGGGCTAGCATGGAGCAGTGGAATTCCACAACTTTC 
FP_HBs TTTGGGGCTAGCATGGAGAACATCACATCAGGATTC 
RP_HBs (LHBs, MHBs) GGGGTCGACTTAAATGTATACCCAAAGACAAAAGAA 
FP_PreC/Core GGGGTCGACTTAAATGTATACCCAAAGACAAAAGAA 
FP_Core TTTGGGGCTAGCATGGAACAACTTTTTCACCTCTGCCTA 
RP_Core (PreC/Core) GGGGTCGACCTAACATTGAGATTCCCGAGATTGAGA 
FP_HBx TTTGGGGCTAGCATGGCTGCTAGGCTGTGCTGCCAA 
RP_HBx GGGGTCGACTTAGGCAGAGGTGAAAAAGTTGCATGG 
FP_XA GGCTCTAGAGCCGCCATGGCTGCTAGGCTGTACTGCCAACTG 
RP_XA TAAGAGCTCTTAGACGGGGAGACCGCGTAAAGAGAGGTG 
FP_XA3 GCTAGCGCCATGGCCATGGCTGCTAGGCTGTACTGCCAA 
RP_XA3 GTCGACTTAAGGGGACGAGAGAGTCCCAAGCGG 
FP_XB GGCTCTAGAGCCGCCATGGGGCCGCTTGGGACTCTCTCGTCC 
RP_XB TAAGAGCTCTTACAGGATCTGATGGGCGTTCACGGTGGT 
FP_XB2 GCTAGCGCCATGGCCATGTCTCCGTCTGCCGTTTCG 
RP_XB2 GTCGACTTAGGGCAAGAAGTGGTGGGCGTTCAC 
FP_XC GGCTCTAGAGCCGCCATGGTCTGTGCCTTCTCATCTGCC 
RP_XC TAAGAGCTCTTAGGCAGAGGTGAAAAAGTTGCATGGTGC 
FP_XC2 GCTAGCGCCATGGCCATGAAGGTCTTACATAAGAGG 
RP_XC2 GTCGACTTAGGCAGAGGTGAAAAAGTTGCA 
FP_R13A CTGGATCCTGCGGCAGACGTCCTTTGT 
RP_R13A ACAAAGGACGTCTGCCGCAGGATCCAG 
FP_R19A GTCCTTTGTTTAGCCCCCGTCGGCGCT 
RP_R19A AGCGCCGACGGGGGCTAAACAAAGGAC 
FP_C6169T CTCCCCGTCACCGCCTTCTCATCTGCCGGACCGACCGCACTTCGC 
RP_C6169T GCGAAGTGCGGTCGGTCCGGCAGATGAGAAGGCGGTGACGGGGAG 
FP_H139D GGAGGCTGTAGGGATAAATTGGTCTGC 
RP_H139D GCAGACCAATTTATCCCTACAGCCTCC 

Reversal of tGFP silencing assay in mammalian (HEK-293T) cells

HEK-293T cells were seeded at a density of 4×105 cells/well in six-well plates 24 h before transfection. The HBV genes and their mutants that were cloned into pCDNA3.1+ were individually co-transfected with the pGFPVRS-2 construct using the jetPRIME transfection reagent (Polyplus) as per the manufacturer's protocol. The cells were suspended in 1×PBS 48 hpt (hours post-transfection) before analysing the cells using a flow cytometer (FACScalibur; BD Biosciences) against FL1-H. The percentage of cells that reverted tGFP expression was counted by specifically gating the region of control tGFP silencing using the Cell Quest Pro software (BD Biosciences).

Reversal of GFP silencing assay for HBx in insect (Sf21) cells

GFP reversion assays in insect systems were performed using Sf21 cells as described previously [27]. Briefly, Sf21 cells constitutively expressing GFP protein/GFP shRNA were generated by stably integrating the pIZT/V5-His+gfpshRNA construct into the Sf21 genome [27]. Cells were maintained in insect medium with 300 μg/ml zeocin antibiotic throughout the experiment, except during the 4 h transfection period, in serum-free media. The cells were seeded at a density of 4×105 cells/well in a six-well plate and transfected with the pIB/V5-His TOPO®TA construct either with HBx or FHV-B2 ORFs using Cellfectin II reagent (Invitrogen). The cells were suspended in 1×PBS 48 hpt and acquired/analysed using FACS, as described above for the HEK-293T cells.

Reversal of GFP silencing in tobacco plant (Nicotiana xanthi)

The suppression assay was performed in tobacco plants, N. xanthi, as described previously [15]. Briefly, HBx was transiently expressed from pBI121 by agro-infiltrating the recombinant plasmid into N. xanthi plant tissues expressing a GFP reporter gene and GFP shRNA, and the leaves were observed 8 dpi (days post-infiltration). As a control, the vector, pBI121, was agro-infiltrated into leaf tissues. Densitometric scanning of the intensities corresponding to each spot was performed by using ImageJ software (http://imagej.nih.gov/ij/) and the results were plotted as a histogram (Figure 3D, ii).

Transient HBV replication assays

Transient HBV replication assays were performed in the hepatoma cell lines HepG2 and Huh7. The cells were individually transfected with the scrambled siRNA or specific siRNAs targeting human Drosha, Dicer or Ago2. The siRNAs targeting human Drosha, Dicer and Ago2, described previously [28,29], were purchased from Ambion. Knockdown of specific genes was verified 48 h post-siRNA transfection by measuring the mRNA levels of specific genes and by Western blotting using specific antibodies, before the cells of the same set were transfected again with the plasmid encoding the full-length pHBVX. The qRT-PCR (quantitative reverse transcription–PCR) primers for Drosha, Dicer, Ago2, GAPDH (glyceraldehyde-3-phosphate dehydrogenase) and HBV viral RNA measurement, which were described previously [30,31], were ordered from Sigma. The cells were grown for 5 days before collecting either the cell culture supernatant to quantify the secreted HBeAg [extracellular HBcAg (HBV core antigen)] and HBV capsid DNA or the total cellular RNA to monitor the relative viral replication efficiency in terms of viral RNA.

The HBx-specific down-regulation of the key RNAi components Drosha, Dicer and Ago2 was measured by qRT-PCR of total RNA or by Western blotting of the total cell lysate prepared from HepG2 cells on day 6 post-transfection with the replication-competent pHBVX construct.

qRT-PCR

qRT-PCR was performed using the GENE-REAMix SYBR one-step kit (Genetix Biotech) as per the manufacturer's instructions. Briefly, 100–200 ng of total cellular RNA was added to each well, and the cycler was set for 42°C for 10 min for cDNA synthesis followed by 95°C for 10 min to activate/deactivate DNA polymerase/reverse transcriptase. qRT-PCR continued for 40 cycles of 95°C for 15 s, 60°C for 15 s, and 72°C for 15 s followed by melting curve analysis. A cycle threshold (CT) was taken into consideration and analysed using the 2−∆∆CT method.

The HBV replication efficiency was monitored for the transfected cells in terms of HBV pgRNA (pre-genomic RNA) and core transcripts using qRT-PCR of the total cellular RNA that was isolated using the TRIzol® method and treated with DNase I. The intracellular mRNA levels of Drosha, Dicer and Ago2 were measured using total cellular RNA isolated from differently transfected cells or from liver biopsy samples and normalized to GAPDH mRNA levels.

HBeAg and HBV capsid DNA measurement

HBeAg was measured quantitatively using the Abbott chemiluminescence immunoassay kit (Abbott Japan), and HBV DNA levels were determined using the Cobas TaqMan HBV standardized real-time PCR assay (Roche). The results are expressed in log10 IU/ml.

HBx protein expression and purification

The HBx ORF was cloned into pET28a plasmid vector and expressed with a His fusion tag in Escherichia coli BL21 (DE3) cells grown at 37°C and induced with 1 mM IPTG. Induction took place for 4 h, and the inclusion bodies were purified as described previously [32]. Purified inclusion bodies were solubilized in 50 mM CAPS buffer (pH 11) containing 1.5% N-lauryl sarkosine and 0.3 M NaCl for 30 min, and the solubilized protein was separated using centrifugation (12000 g for 30 min). Proteins were purified using affinity chromatography with Ni-NTA (Ni2+-nitrilotriacetate) agarose (Qiagen) and an imidazole gradient of 50 mM CAPS (pH 11), containing 0.3% N-lauryl sarkosine and 0.3 M NaCl. All protein-containing fractions were analysed by SDS/PAGE. Purified HBx fractions were concentrated using Amicon® Ultra-15 columns, as per the manufacturer's protocol.

Human dicing assay

The human dicing reaction kit (Genlantis) was purchased and the reaction was carried out as per the manufacturer's instructions. Briefly, the Dicer enzyme was incubated with dsRNA substrate, buffers and ATP at 37°C for 2 h before stopping the reaction and resolving its contents in a 2% agarose gel for the UV visualization. The substrate dsRNA was prepared by in vitro transcription using the riboprobe combination system SP6/T7 RNA polymerase (Promega) with the UP/RP primers, which covered the GFP gene that was cloned into the pGEMT-easy vector. The in vitro transcription reaction was treated with DNase I, and the dsRNA was purified from the reaction mixture using the TRIzol® method. A 0.7-μg aliquot of purified dsRNA was used as the substrate in the dicing assay. The purified HBx and MBP (maltose-binding protein) addition was tested in specific dicing reactions as shown in Figures 4(B) and 4(C). Different concentrations of the HBx protein were added to the dicing reactions to investigate the effect of HBx protein on the dicing process. MBP was used as a negative control to monitor non-specific protein addition to the dicing reaction. Densitometric scanning was performed using ImageJ software for the siRNA bands and for the region covering intermediate dicing products.

Western blotting

Liver tissue samples or cultured cells were lysed with repeated freeze–thaw cycles in ice-cold RIPA buffer supplemented with protease inhibitors (Complete; Roche). Whole-cell lysates were obtained by subsequent centrifugation at 10000 g for 10 min at 4°C, and protein concentrations were determined using the Bradford protein assay (Bio-Rad Laboratories) with BSA as a standard. Protein extracts (120 μg) were subjected to reducing 8% SDS/PAGE and transferred on to a nitrocellulose membrane, which was incubated overnight at 4°C with anti-Drosha, anti-Ago2 or anti-β-actin specific antibodies (Abcam and Cell Signaling Technology) that were prepared in 3% BSA dissolved in PBS (pH 7.4) at dilutions of 1:250, 1:250 and 1:2000 respectively. Subsequently, the blots were blocked with a 3% BSA-containing solution with 0.1% Tween 20 dissolved in PBS (pH 7.4). The membranes were subsequently exposed to a horseradish peroxidase-conjugated secondary goat anti-rabbit antibody (Sigma) for 45 min at room temperature, detected using chemiluminescence (SuperSignal West Pico; Pierce Biotechnology), imaged using a Fluorchem M imager (Protein Simple) and quantified by ImageJ for densitometric analysis.

Immunohistochemistry

Anti-Drosha, anti-Dicer and anti-Ago2 antibodies for IHC (immunohistochemistry) analysis were purchased from Abcam. IHC analysis was performed on formalin-fixed, paraffin-embedded liver biopsies of CHB patients using the LSAB (labelled streptavidin biotin) method (n=20, 10 with high viral load and 10 with low viral load). Histochemical staining with Shikata's Orcein for ground glass hepatocytes and HBsAg (HBV surface antigen) IHC were also performed in all cases. The liver biopsy samples of CHB patients that were used in the present study were approved by the Ethical Committee of the Institute of Liver and Biliary Sciences, New Delhi, India.

RESULTS

HBV replication is restricted by Drosha, Dicer and Ago2 of the RNAi pathway in Huh7/HepG2 cells

A number of reports have provided strong evidence for an antiviral role of the RNAi pathways in plant, invertebrate and a few vertebrate systems [33]. Many animal viruses have been demonstrated to replicate most effectively in cells after the knockdown of key RNAi factors, indicating that RNAi attempts to restrict viral replication [34]. In the present study, we silenced the expression of Drosha, Dicer and Ago2, the three major RNAi components, by transfecting Huh7 cells with their respective siRNAs. A scrambled siRNA was also transfected independently to serve as a control. The knockdown of the respective RNAi components at the mRNA level was measured at 48 hpt using qRT-PCR analysis (Figure 1A). The down-regulation of Drosha, Dicer and Ago2 mRNAs were 55%, 80% and 40% respectively. Such knockdowns also caused down-regulation of the corresponding proteins. The reduction in Drosha and Ago2 proteins is shown by representative examples of Western blots in Figure 1(B). To understand the effect of RNAi components in regulating HBV replication, Huh7 cells (having a primary knockdown for each of the three key RNAi factors) were transfected secondarily with pHBVX replicon and levels of HBV RNA (pgRNA and core mRNA) were measured on day 6 post-transfection. The qRT-PCR results revealed that Huh7 cells with the knockdown of any of the three RNAi components had more HBV RNA compared with the scrambled siRNA-transfected control Huh7 cells (Figure 1C). Therefore it becomes evident that host RNAi function to limit the HBV replication under cellular conditions. The HBV literature reveals that the quantification of HBV RNA levels (core and pgRNA) for HBV replication can be comparable with the levels of antigens such as HBsAg, HBeAg or extracellular capsid DNA [30]. Moreover, monitoring HBV RNA can be considered to be relevant here since the RNAi pathway, especially Dicer protein, is believed to target the viral RNAs to generate viral-specific siRNAs [2]. Interestingly, a similar increase in HBV replication was also observed in HepG2 cells upon knockdown of Dicer and Ago2 by RNAi (Supplementary Figure S2 http://www.biochemj.org/bj/462/bj4620347add.htm). The HepG2 cells were first transfected (primary transfection) with siRNAs targeting Dicer and Ago2 mRNA. The secondary transfection with pHBVX construct was carried out at 48 h post primary transfection. Total RNA was collected at 48 h post-secondary transfection and qRT-PCR was performed to compare the mRNA levels of Dicer and Ago2. As shown in Supplementary Figure S2, an increase in HBV viral RNA and an increase in the extracellular levels of HBeAg and HBV DNA were observed in HepG2 cells. The HepG2 cell culture supernatant was collected on day 6 post pHBVX replicon transfection to quantify HBsAg and capsid HBV DNA (Supplementary Figure S2). Hence the results in Huh7 and HepG2 cells establish the fact that host-mediated RNAi machinery negatively regulates HBV replication and also confirms the antiviral role of the RNAi pathway in mammalian cells.

Role of key RNAi pathway components in HBV replication

Figure 1
Role of key RNAi pathway components in HBV replication

(A) The qRT-PCR results of siRNA-mediated knockdown verification for RNAi components, namely Drosha, Dicer and Ago2, in Huh7 cells compared with the scrambled siRNA control (siSCR). (B) Western blot image representing down-regulation of Drosha and Ago2 proteins in Huh7 cells. (C) The qRT-PCR results of HBV RNA (HBV pgRNA and core RNA) levels in Huh7 cells transfected with a replication-competent pHBVX construct. (D) The qRT-PCR results of HBV RNA levels in HepG2 cells transfected with the pHBVX construct. Control represents mock transfection. (EG) The qRT-PCR results for the mRNA levels of human Drosha, Dicer and Ago2 in HepG2 cells transfected with the replication-competent pHBVX construct. The levels of mock-transfected cells were taken as 100. (H) Western blot images showing reduction of proteins like Drosha and Ago2 in HBV-transfected cells. The respective protein levels under mock transfection are shown as controls. All experiments were performed in triplicate and repeated at least three times. Results are means±S.D. #Samples were used as a calibrator to normalize the expression of specific mRNA levels to GAPDH mRNA levels in all replicates; hence, SD remains 0. *P<0.05. NS, not significant. DCR, Dicer.

Figure 1
Role of key RNAi pathway components in HBV replication

(A) The qRT-PCR results of siRNA-mediated knockdown verification for RNAi components, namely Drosha, Dicer and Ago2, in Huh7 cells compared with the scrambled siRNA control (siSCR). (B) Western blot image representing down-regulation of Drosha and Ago2 proteins in Huh7 cells. (C) The qRT-PCR results of HBV RNA (HBV pgRNA and core RNA) levels in Huh7 cells transfected with a replication-competent pHBVX construct. (D) The qRT-PCR results of HBV RNA levels in HepG2 cells transfected with the pHBVX construct. Control represents mock transfection. (EG) The qRT-PCR results for the mRNA levels of human Drosha, Dicer and Ago2 in HepG2 cells transfected with the replication-competent pHBVX construct. The levels of mock-transfected cells were taken as 100. (H) Western blot images showing reduction of proteins like Drosha and Ago2 in HBV-transfected cells. The respective protein levels under mock transfection are shown as controls. All experiments were performed in triplicate and repeated at least three times. Results are means±S.D. #Samples were used as a calibrator to normalize the expression of specific mRNA levels to GAPDH mRNA levels in all replicates; hence, SD remains 0. *P<0.05. NS, not significant. DCR, Dicer.

HBV replication is associated with reduced expression levels of key RNAi components in HepG2 cells

Viruses down-regulate RNAi components to achieve restriction-free replication [35]. We next investigated whether such a relationship exists in HBV-infected mammalian cells. HepG2 cells were transfected with either pHBVX or pHBVΔX constructs to establish HBV replication in HepG2 cells. Total RNA was isolated from the HepG2 cells on day 6 post-replicon transfection and qRT-PCR was performed. HBV replication was confirmed by qRT-PCR with the detection of HBV-specific RNAs (HBV pgRNA and core RNA) in pHBVX-transfected HepG2 cells (Figure 1D). The qRT-PCR results for Drosha, Dicer and Ago2 revealed reduced mRNA expression levels in HBV replicon-transfected HepG2 cells compared with the controls (Figures 1E–1G). Western blots were performed with anti-Drosha and anti-Ago2 antibodies and the results further confirmed that the HepG2 cells with HBV replication also have reduced expression levels of Drosha and Ago2 at the protein level (Figure 1H). Intriguingly, we observed a slight increase in the mRNA levels of the key RNAi components in cells transfected with the pHBVΔX construct (Figures 1E–1G), but no change was found at the protein expression level for these key RNAi components (results not shown). Thus the results suggest that the HBV replication manipulates three key RNAi factor expression levels, generating the cellular conditions favourable for viral RNA replication.

Drosha, Dicer and Ago2 levels in CHB patients are inversely correlated with HBV load

Next, we measured the mRNA and protein levels of the Drosha, Dicer and Ago2 in human patients infected with CHB. The demographic profiles of the patient samples that were used for real-time PCR are shown in Table 2. Six of the 14 patients had low HBV DNA, i.e. <log103 IU/ml, whereas eight patients had high HBV DNA, i.e. >log103 to log108 IU/ml. The qRT-PCR analysis showed that patients with high viral load had ~50–60% lower mRNA levels of Drosha, Dicer and Ago2 compared with patients with low viral loads (Figures 2A–2C). To determine whether the differential mRNA levels were also reflected at the protein level, we performed Western blot analysis of Drosha and Ago2 proteins using their respective antibodies. A representative example of the Western blots is shown in Figure 2(D). The densitometric analysis of the Western blot signals of 14 liver biopsy samples is shown in Figures 2(E) and 2(F). Patients with high viral load had approximately 50% and 30% lower protein levels of Drosha and Ago2 respectively, when compared with those with low viral loads (Figures 2E and 2F).

CHB liver biopsy samples show reduced expression of RNAi components

Figure 2
CHB liver biopsy samples show reduced expression of RNAi components

(AC) The qRT-PCR results of mRNA levels of human Drosha, Dicer and Ago2. The total RNA was isolated from two groups of CHB patient samples representing low (<log103 IU/ml) and high (>log103 to log108 IU/ml) serum HBV load. (D) Representative image of the Western blot results (n=6, two with low viral load and four with high viral load) of the RNAi components Drosha and Ago2 from CHB liver biopsy samples with low (<log103 IU/ml) or high (>log103 to log108 IU/ml) viral load. (E and F) Scatter charts showing the densitometric values obtained from the normalized band intensity of Drosha and Ago2 proteins found by Western blotting. Samples were from liver biopsies of CHB patients (n=14, six with low viral load and eight with high viral load). The densitometric values of the Drosha and Ago2 bands were normalized with the values of β-actin. (G) Panels i and ii: IHC staining using (i) anti-HBsAg antibody and (ii) Orcein special staining. Panels iii–v: IHC staining for key RNAi components in CHB patient tissue. The circled area in the image represents uninfected cells which stained intensely for the RNAi components. Non-circled area represents cells with HBV infection and less staining was observed for the respective RNAi component. (H) IHC was performed on CHB liver biopsy samples with high viral loads as one group and low viral load as the other group. Biopsy sections showed the expected differential expression of the RNAi machinery proteins. Expression levels of key RNAi component are high in low-viral-load CHB cases and low in high-viral-load CHB cases (see the Results section). All experiments were performed in triplicate and repeated at least three times. Results are means±S.D. #Samples were used as a calibrator to normalize the expression of specific mRNA levels to GAPDH mRNA levels in all replicates; hence, SD remains 0. **P<0.01.

Figure 2
CHB liver biopsy samples show reduced expression of RNAi components

(AC) The qRT-PCR results of mRNA levels of human Drosha, Dicer and Ago2. The total RNA was isolated from two groups of CHB patient samples representing low (<log103 IU/ml) and high (>log103 to log108 IU/ml) serum HBV load. (D) Representative image of the Western blot results (n=6, two with low viral load and four with high viral load) of the RNAi components Drosha and Ago2 from CHB liver biopsy samples with low (<log103 IU/ml) or high (>log103 to log108 IU/ml) viral load. (E and F) Scatter charts showing the densitometric values obtained from the normalized band intensity of Drosha and Ago2 proteins found by Western blotting. Samples were from liver biopsies of CHB patients (n=14, six with low viral load and eight with high viral load). The densitometric values of the Drosha and Ago2 bands were normalized with the values of β-actin. (G) Panels i and ii: IHC staining using (i) anti-HBsAg antibody and (ii) Orcein special staining. Panels iii–v: IHC staining for key RNAi components in CHB patient tissue. The circled area in the image represents uninfected cells which stained intensely for the RNAi components. Non-circled area represents cells with HBV infection and less staining was observed for the respective RNAi component. (H) IHC was performed on CHB liver biopsy samples with high viral loads as one group and low viral load as the other group. Biopsy sections showed the expected differential expression of the RNAi machinery proteins. Expression levels of key RNAi component are high in low-viral-load CHB cases and low in high-viral-load CHB cases (see the Results section). All experiments were performed in triplicate and repeated at least three times. Results are means±S.D. #Samples were used as a calibrator to normalize the expression of specific mRNA levels to GAPDH mRNA levels in all replicates; hence, SD remains 0. **P<0.01.

Table 2
Demographic profile of CHB patients

Values in parentheses represent the median range. ALT, alanine transaminase; HAI, histologic activity index.

Parameter Low HBV DNA (<log103 IU/ml) (n=6) High HBV DNA (>log103 IU/ml) (n=8) 
Males (%) 80.00 83.33 
Age (years) 30 (20–36) 30 (23–46) 
Bilirubin (mg/dl) 1.19 (0.6–1.5) 0.8 (0.5–1.3) 
Albumin (mg/dl) 4.05 (3.6–4.4) 4.3 (2.7–4.6) 
ALT (IU/l) 49 (28–71) 38 (11–131) 
Log10 HBV DNA (IU/Ml) 2.15 (0.78–2.65) 4.38 (3.05–8.04) 
Fibrosis stage 1 (0–1) 0 (0–2) 
HAI 2 (2–4) 3 (2–4) 
Parameter Low HBV DNA (<log103 IU/ml) (n=6) High HBV DNA (>log103 IU/ml) (n=8) 
Males (%) 80.00 83.33 
Age (years) 30 (20–36) 30 (23–46) 
Bilirubin (mg/dl) 1.19 (0.6–1.5) 0.8 (0.5–1.3) 
Albumin (mg/dl) 4.05 (3.6–4.4) 4.3 (2.7–4.6) 
ALT (IU/l) 49 (28–71) 38 (11–131) 
Log10 HBV DNA (IU/Ml) 2.15 (0.78–2.65) 4.38 (3.05–8.04) 
Fibrosis stage 1 (0–1) 0 (0–2) 
HAI 2 (2–4) 3 (2–4) 

To validate these results further, we performed IHC staining (Figures 2G and 2H) of the liver biopsy samples (n=14, 8 with high viral load and 6 with low viral load) using commercial anti-Dicer, anti-Drosha and anti-Ago2 antibodies. As shown in Figure 2(G) (i and ii), differential expression of HBsAg was observed in different hepatocytes, indicating different viral loads. For example, strong membranous staining of hepatocytes using IHC against HBsAg suggested the presence of high viral load. Low antibody staining for the RNAi components was observed in areas that showed higher viral load [Figure 2G (iii–v)]. A similar inverse relationship between viral load and staining for RNAi factors was also observed in individual hepatocytes at higher magnification. Hepatocytes with discrete cytoplasmic staining for HBsAg, indicating the presence of infective Dane particles, revealed negative to weak staining for RNAi factors. In comparison, hepatocytes [Figure 2G (iii–v), encircled] within the same tissue that did not show cytoplasmic inclusions of HBsAg (i.e. non-infected hepatocytes) showed intense staining by the same. In addition, the clinico-pathological correlation shown in the present study indicated that the high viral load was associated with low levels of RNAi factors as the low staining intensities for Drosha, Dicer and Ago2 were observed in comparison with the cases with a low viral load (Figure 2H). These results confirmed that the major RNAi components are negatively manipulated in CHB patients. The experiment also points out that host RNAi components are targeted by HBV in cell culture and under CHB conditions.

HBx functions as an RSS

It has been shown previously that many plant and animal viruses combat the anti-viral RNAi response of host cells by encoding viral suppressor proteins [6,36]. As HBV growth was found to be associated with down-regulation of human RNAi components, we wanted to examine if HBV would also encode the suppressor proteins. To screen for RNAi suppressor proteins, we carried out reversion of tGFP silencing assays in HEK-293T cells by transiently expressing the genes corresponding to the three major ORFs of the HBV genome (see the Materials and methods section). For this screening, the HBV ORFs were cloned into the pCDNA3.1+ plasmid and each plasmid was co-transfected with the pGFP-VRS-2 construct at a 1:1 molar ratio in HEK-293T cells. Figure 3(A) shows a schematic representation of the constructs used and the experimental flow diagram of the tGFP reversion assay. The pGFP-VRS-2 is a plasmid vector capable of expressing tGFP and tGFP-shRNA in mammalian cells and, thus, it maintains tGFP silencing. The expression of the HBV genes was confirmed using Western blot analysis of the cell lysates prepared from the transfected HEK-293T cells (results not shown). FACS analysis demonstrated that cells expressing HBx and HBV core showed reversion of tGFP expression in tGFP-silenced cells, whereas transfection with other HBV genes showed much lower reversion of tGFP silencing (Figure 3B). The HBx protein had at least 2-fold higher GFP reversion compared with the mock-transfected cells or HBs-, MHBs- or LHBs-transfected cells. Cells transfected with the pCDNA3.1+PreC/Core construct under similar conditions also showed reversion of tGFP silencing. However, HBx showed the highest levels of reversion in comparison with PreC/Core- or Core-transfected cells (Figure 3B) and hence might be a prominent antagonist of host-mediated RNAi.

Reversions of GFP silencing assays showing HBx as an RNAi suppressor

Figure 3
Reversions of GFP silencing assays showing HBx as an RNAi suppressor

(A) Schematic representation of constructs and principle applied for the tGFP reversion assay in HEK-293T cells with HBV genes. As depicted, the pGFP-VRS-2 construct, expressing tGFP protein along with tGFP shRNA, was co-transfected with pcDNA3.1+ vector harbouring any of the HBV genes. The transfected HEK-293T cells were observed at 48 hpt by FACS against the FL1-H filter for green fluorescence (from tGFP protein expression in this case). (B) The percentage of cells expressing tGFP as derived from the FACS data. The empty vector co-transfected with pGFP-VRS-2 was used as a control. (C) Similar FACS result of the GFP reversion assay with HBx and FHV-B2 (positive control) in the transgenic Sf21 (Spodoptera frugiperda insect system) cell line maintaining GFP silencing. The transgenic Sf21 cell line has been described earlier (see the Materials and methods section). Briefly, a plasmid construct, expressing GFP protein and GFP shRNA, was stably integrated in the genome of Sf21 cells. (D) Image of UV-illuminated transgenic N. xanthi plant leaves showing the result of reversion of GFP silencing assays. HBx and MYMIV-AC2 (AC2 ORF of plant virus MYMIV, used as the positive control) were cloned in pBI121 plasmid vector and expressed transiently in the plant leaves by the agro-infiltration-mediated method. The pBI121 empty vector was used as a negative control. All three spots (shown in panel i) of agro-infiltration were reported from the same leaf. The fluorescence intensities were measured and have been plotted in panel ii. (E) Schematic diagram of the deletion mutations of HBx. (F) Results from the FACS analysis of the reversion of tGFP silencing assay with HBx (wt) and the deletion mutants in HEK-293T cells. (G) Amino acid substitution mutations generated in HBx. (H) Histogram represents summary of the FACS result of reversion of tGFP silencing in HEK-293T cells with amino acid point mutants of HBx. All experiments were performed in triplicate and repeated at least three times. Results are means±S.D. *P<0.05.

Figure 3
Reversions of GFP silencing assays showing HBx as an RNAi suppressor

(A) Schematic representation of constructs and principle applied for the tGFP reversion assay in HEK-293T cells with HBV genes. As depicted, the pGFP-VRS-2 construct, expressing tGFP protein along with tGFP shRNA, was co-transfected with pcDNA3.1+ vector harbouring any of the HBV genes. The transfected HEK-293T cells were observed at 48 hpt by FACS against the FL1-H filter for green fluorescence (from tGFP protein expression in this case). (B) The percentage of cells expressing tGFP as derived from the FACS data. The empty vector co-transfected with pGFP-VRS-2 was used as a control. (C) Similar FACS result of the GFP reversion assay with HBx and FHV-B2 (positive control) in the transgenic Sf21 (Spodoptera frugiperda insect system) cell line maintaining GFP silencing. The transgenic Sf21 cell line has been described earlier (see the Materials and methods section). Briefly, a plasmid construct, expressing GFP protein and GFP shRNA, was stably integrated in the genome of Sf21 cells. (D) Image of UV-illuminated transgenic N. xanthi plant leaves showing the result of reversion of GFP silencing assays. HBx and MYMIV-AC2 (AC2 ORF of plant virus MYMIV, used as the positive control) were cloned in pBI121 plasmid vector and expressed transiently in the plant leaves by the agro-infiltration-mediated method. The pBI121 empty vector was used as a negative control. All three spots (shown in panel i) of agro-infiltration were reported from the same leaf. The fluorescence intensities were measured and have been plotted in panel ii. (E) Schematic diagram of the deletion mutations of HBx. (F) Results from the FACS analysis of the reversion of tGFP silencing assay with HBx (wt) and the deletion mutants in HEK-293T cells. (G) Amino acid substitution mutations generated in HBx. (H) Histogram represents summary of the FACS result of reversion of tGFP silencing in HEK-293T cells with amino acid point mutants of HBx. All experiments were performed in triplicate and repeated at least three times. Results are means±S.D. *P<0.05.

The RNAi suppressor properties of HBx were further evaluated using two independent heterologous RNAi sensor systems: the Sf21 insect cell-based RNAi sensor line and GFP-silenced transgenic tobacco leaf tissues [15,27]. These systems have been successfully used previously to define the two RNAi suppressors, namely FHV-B2 and NS4B [17,27]. As shown in Figure 3(C), Sf21 insect cell expressing HBx or FHV-B2 protein showed ~2- and ~2.5-fold reversion respectively in the expression levels of GFP compared with the control. To confirm the HBx's RNAi suppressor property, reversal of the silencing assay using agro-infiltration-mediated transient expression of HBx in leaf tissues of the GFP-silent tobacco line was performed. The infiltrated leaves showed reversal of GFP activity 8 days post-infiltration, whereas the empty control vector failed to show such a reversal (Figure 3D). Taken together, the results of three independent reversion assays demonstrated HBx as a potential RSS candidate capable of functioning across kingdoms such as for mammalian, insect and plant systems.

Full-length HBx is required for the RSS function of HBx in HEK-293T cells

HBx is a multi-tasking protein and is associated with other cellular proteins. The HBx protein has been described to have two major domains based on its functional properties: an N-terminal regulatory or transrepressor domain (residues 1–50) and a C-terminal transactivator domain (residues ~51–154) [37,38]. The transrepressor domain negatively regulates the C-terminal transactivator domain and is dispensable for the transactivation function of HBx. A previous report also identified the N-terminal domain as having a prominent role in HBx-mediated IFN-1 inhibition [39]. Having identified that HBx has RNAi suppression properties in HEK-293T cells, we next aimed to identify the domain crucial for the HBx's observed suppression activity. Six deletion mutants of HBx were generated in the two functional domains of HBx and reversion assays were performed using plasmids expressing the mutant HBx. Figure 3(E) shows a schematic representation of the deletion mutant constructs that were generated to delineate the regions of HBx that are required for its RNAi suppressor activity. The results showed that the observed RNAi reversion property was highest when the entire HBx protein was expressed and deletion mutants were less functional compared with full-length HBx (Figure 3F). We further generated a series of substitution mutants of the HBx protein to identify the important residues required for the RNAi suppressor activity. Amino acids at positions 61, 69 and 139 have been reported previously to be crucial for transcriptional transactivation of the HBx protein [40,41] and we therefore generated the mutants C61T, C69T and H139D. The initial 20 amino acids in the N-terminal region of HBx have been reported to be highly conserved and encompass the region of transrepression function [38]; therefore we substituted the arginines at positions 13 and 19 and generated the R13A and R19A mutants. Figure 3(G) shows the positions of the amino acid substitutions. The RNAi suppressor studies using these substitution mutants revealed that these amino acids were not critical for the observed reversal of the RNAi property of the HBx protein (Figure 3H). The HBx deletion and substitution mutants thus showed that the RSS activity of the HBx protein requires the HBx [wt (wild-type)] protein.

As HBx is a transactivator protein, the observed enhancement of tGFP reporter gene expression in the reversion assays could be a result of its transactivation function. Therefore we next analysed the direct effect of HBx protein on tGFP protein expression in HEK-293T cells. Supplementary Figure S3A (http://www.biochemj.org/bj/462/bj4620347add.htm) shows the vector maps of pGFP-VRS-1 and pGFP-VRS-3 used to mimic reversion of GFP silencing assays with HBx and two of its deletion mutants, XA and XC. Plasmid expression constructs of HBx and two of its deletion mutants (XA and XC) were co-transfected with pGFP-VRS-1 or pGFP-VRS-3 in HEK-293T cells (Supplementary Figure S3B). Cells expressing tGFP were quantified by using FACS. The results showed that the HBx protein-mediated tGFP enhancement was minor with the pGFP-VRS-1 construct. Also this minor enhancement was not comparable at all with the enhancement of GFP fluorescence caused by of the HBx-mediated reversion with the pGFP-VRS-2 construct (Figures 3B, 3F and 3H, and Supplementary Figure S3B). Together, these results suggested that the observed reversion of tGFP silencing was mainly due to HBx's RNAi suppression activity.

HBx protein inhibits human Dicer-mediated dsRNA processing into siRNAs in an in vitro assay

Studies on the mode of action of various viral suppressors have shown that different viral suppressor proteins act at different steps in siRNA biogenesis and function [13,14]. Since the tGFP silencing was reversed by HBx in the RNAi sensor lines (Figure 3), we wished to explore the processing of siRNA in the presence of HBx protein. To examine this step, we carried out the in-vitro dicing assay in the presence of HBx protein. The HBx protein was expressed in a heterologous E. coli expression system and was purified to near homogeneity using an Ni-NTA column. Figure 4(A) shows the SDS/PAGE analysis of the purified recombinant HBx protein. The commercially available human Dicer enzyme is an RNase III-like nuclease that generates siRNAs of ~22mers from dsRNAs substrates (Figure 4B, lanes 2 and 3). We performed the dicing assay with 1 unit of human Dicer enzyme and in vitro-synthesized dsRNA (~900 nt) in the presence of different concentrations of purified recombinant HBx protein. As shown in Figures 4(B) and 4(C), purified HBx protein inhibited the formation of 22mers in a dose-dependent manner. The dicer inhibitory effect of HBx protein was observable at 400 ng of HBx protein (Figures 4B and 4C, lane 6) and complete inhibition of dicing was observed with the addition of 600 ng of HBx protein. The control MBP failed to block siRNA formation, even when 1 μg was present. This control reveals that the mere addition of different amounts of protein into the dicing assay was not responsible for the inhibitory effect seen in case of HBx protein addition. Together, these results suggest that HBx also suppresses RNAi perhaps by inhibiting dicer-mediated siRNA formation in cellular conditions.

HBx inhibits the processing of dsRNA into siRNAs in vitro

Figure 4
HBx inhibits the processing of dsRNA into siRNAs in vitro

(A) SDS/PAGE gel image shows the purified fraction of His-tagged HBx protein expressed in E. coli BL21 (DE3) using the expression vector pET28a. (B) Agarose gel (1.8%) image of dicing assay. Following electrophoresis, the gel was stained with ethidium bromide, photographed and subjected to densitometric analysis. M, markers of 25–500 bp. Lane 1, RNA substrate ~900 bp as a control (in vitro transcribed); lane 2, (DC-Dicing control-1) dicing reaction with 0.5 unit of Dicer protein and 0.750 μg of RNA; lane 3, (DC-Dicing control-2) dicing reaction with 1 unit of human Dicer protein; lanes 4–9, dicing reaction with 1 unit of Dicer protein and 0.750 μg of RNA substrate added individually with 0.1, 0.2, 0.4, 0.6, 0.8 and 1 μg of HBx protein; and lane 10, dicing assay with the addition of 1 μg of MBP to monitor the non-specific effects of protein addition to the dicing assay. The banding positions of the dsRNA substrate (~900 bp), final diced product of 22 bp along with the intermediates of dicing are shown by arrows and bracket respectively. (C) The relative abundance of siRNA (~22mers) and intermediate RNAs of the dicing assay. The relative abundance was plotted by using the points generated of densitometric scan of siRNA and dicing intermediates. The intensity values obtained for the dsRNA control lane (corresponding to siRNA band and dicing intermediates, lane 1) was subtracted from the intensity values obtained for the respective regions in rest of the lanes (lanes 2–10). The x-axis represents the number corresponding to the specific dicing reactions as explained in Figure 4(B) and the y-axis represents the intensity values obtained for the siRNA and intermediate RNA regions from the gel. ImageJ software was used for the densitometric scan.

Figure 4
HBx inhibits the processing of dsRNA into siRNAs in vitro

(A) SDS/PAGE gel image shows the purified fraction of His-tagged HBx protein expressed in E. coli BL21 (DE3) using the expression vector pET28a. (B) Agarose gel (1.8%) image of dicing assay. Following electrophoresis, the gel was stained with ethidium bromide, photographed and subjected to densitometric analysis. M, markers of 25–500 bp. Lane 1, RNA substrate ~900 bp as a control (in vitro transcribed); lane 2, (DC-Dicing control-1) dicing reaction with 0.5 unit of Dicer protein and 0.750 μg of RNA; lane 3, (DC-Dicing control-2) dicing reaction with 1 unit of human Dicer protein; lanes 4–9, dicing reaction with 1 unit of Dicer protein and 0.750 μg of RNA substrate added individually with 0.1, 0.2, 0.4, 0.6, 0.8 and 1 μg of HBx protein; and lane 10, dicing assay with the addition of 1 μg of MBP to monitor the non-specific effects of protein addition to the dicing assay. The banding positions of the dsRNA substrate (~900 bp), final diced product of 22 bp along with the intermediates of dicing are shown by arrows and bracket respectively. (C) The relative abundance of siRNA (~22mers) and intermediate RNAs of the dicing assay. The relative abundance was plotted by using the points generated of densitometric scan of siRNA and dicing intermediates. The intensity values obtained for the dsRNA control lane (corresponding to siRNA band and dicing intermediates, lane 1) was subtracted from the intensity values obtained for the respective regions in rest of the lanes (lanes 2–10). The x-axis represents the number corresponding to the specific dicing reactions as explained in Figure 4(B) and the y-axis represents the intensity values obtained for the siRNA and intermediate RNA regions from the gel. ImageJ software was used for the densitometric scan.

DISCUSSION

Chronic infection with HBV is associated with several diseases, including hepatitis B, cirrhosis and HCC [42]. HBV X protein, a multifunctional regulator that modulates transcription, signal transduction and apoptosis, has long been associated with hepatic carcinogenesis. Although, some of the functions of HBx that contribute to the development of HCC have been characterized [21,43,44], much remains to be understood.

Recently strong evidence has emerged for an antiviral role of host RNAi towards plant, invertebrate and a few vertebrate viruses [5,45,46]. Animal viruses have also been shown to perturb endogenously produced small RNAs, called mRNAs, that may contribute to infectivity and pathogenesis [47]. Some viruses usurp the host RNAi machinery to process miRNA-like structures that are encoded by the viral genome and regulate virus/host gene expression [48]. The aim of the present study was to define a relationship between host RNAi factor(s) and HBV replication in vitro in HBV-infected mammalian cell lines as well as in biopsy samples of patients suffering from CHB.

Emerging evidence indicates that some animal viruses alter the expression of components of the RNAi machinery. For example, Dicer mRNA and protein expression levels were down-regulated in mammalian cells infected with influenza A virus or Dengue virus [35,49]. On the basis of these studies, it has been suggested that Drosha, Dicer and Ago2 regulate viral replication, which, in turn, is responsible for the miRNA-mediated regulation of multiple cellular pathways [50]. In the present study, we measured the mRNA levels of Drosha, Dicer and Ago2 using qRT-PCR in HBV-replicating Huh-7 or HepG2 cells. Down-regulation of all the three RNAi components was observed in HBV-infected HepG2 cells. Similar down-regulation of RNAi components has been reported for few other animal virus infections [35]. The inverse relationship between HBV replication and the levels of three major RNAi components was also observed in HBV infection. Increased HBV replic-ation was also observed in cells with specific knockdowns for RNAi components. Similar increases in replication have been reported for a number of animal viruses in mammalian systems lacking components of the RNAi machinery [34,35]. Taken together, these results provide strong evidence for a possible antiviral role of the RNAi machinery during HBV replication and the role of HBx in regulating the RNAi activation in mammalian host cells.

The clinical and functional significance of the RNAi machinery in various types of cancers is not well understood, but a limited number of studies have recently reported alterations in the expression of RNAi components in clinical isolates of different cancers. Two major regulators of miRNA biogenesis, Dicer and Drosha, have been shown to be down-regulated in endometrial, cell lung, ovarian, breast and neuroblastoma cancers [5155]. Reduced Dicer expression levels have also been observed in the cord blood of infants with severe respiratory syncytial virus disease [56]. In contrast, a recent study has shown the enhanced dependency of the HBV life cycle on the expression of Ago2 [24]. As we observed down-regulation of the components of the RNAi machinery in in vitro HBV-infected cells, we felt it worthwhile to measure the expression levels of these RNAi components in liver biopsy samples of patients clinically suffering from HBV-mediated chronic hepatitis and correlate those expressions with HBV titres. The expression of Drosha, Dicer and Ago2 were down-regulated at the mRNA and protein levels in these patients, and their levels inversely varied with viral titres. Together, the results from in vitro HBV replication analysis and liver biopsy samples of human patients suffering from CHB infection correlated well.

Many plant and animal viruses have been shown to encode and express RNAi suppressor proteins to combat the host RNAi response, and we have previously identified one such protein, NS4B, from Dengue virus. To identify such a protein from HBV, in the present study we screened different HBV genes/proteins for their RNAi suppression activities using reversion of GFP silencing assays, which have been successfully used by us to screen different RNAi suppressor proteins previously [17,27]. Among the different HBV ORFs that were screened, RNAi suppression by HBx was found to be highest. HBx is a multifunctional protein that is linked to hepatocarcinogenesis and is known to modulate a number of cellular pathways. To identify the HBx domain involved in RNAi suppression, a number of deletion and substitution mutants were generated and RNAi suppression analysis was carried out for each mutant. The results showed that the entire HBx sequence is required for efficient RNAi suppression activity. Considering the overlapping nature of the IFN and RNAi pathways [9,57,58], it is interesting to note that a previous report showed that full-length HBx is required for its anti-IFN activity [39].

Viral suppressors for different viruses do not have common sequence motifs and act at different steps of the RNAi pathway, although a few functional motifs, such as dsRNA-binding and/or GW repeat motifs, have been reported in few RSSs [45]. For example, NS4B acts at the Dicing step, whereas tombusvirus p19 and Fny-CMV2b proteins have been shown to act at the RISC steps [59]. The HBx protein does not harbour any GW motifs, but still has dsRNA-binding properties [60]. To understand the mode of RNAi suppression by the HBx protein, we tested its effect in an in vitro dicing assay using recombinant human Dicer, a dsRNA substrate and recombinant HBx protein. The results showed an effective block in siRNA formation by HBx, suggesting the involvement of HBx at the dicing step. This block could be due to various reasons, namely, inaccessibility of the Dicer at the substrate because of the HBx binding to the substrate RNA or the allosteric changes in the catalytic site of the Dicer due to its physical interaction with HBx. Clearly well-designed experiments are necessary to decipher the mechanistic details of the block.

In summary, the present study provides evidence for the role of components of the RNAi machinery in modulating HBV replication. The results also show a relationship between the major RNAi components and virus titres in liver biopsy samples of CHB-infected patients. Although HBV infection has been previously shown to alter miRNA expression [22,23], in the present study we provide evidence for the involvement of RNAi pathways in the regulation of HBV replication in mammalian cells or in natural infection. The present study further suggests a new biological role for the HBx protein as a suppressor of RNA silencing. This study also advocates the development of novel inhibitors against HBx as an antiviral strategy.

Abbreviations

     
  • Ago2

    argonaute RISC catalytic component 2

  •  
  • CHB

    chronic hepatitis B

  •  
  • GAPDH

    glyceraldehyde-3-phosphate dehydrogenase

  •  
  • HBeAg

    extracellular HBV core antigen

  •  
  • HBs

    hepatitis B S protein

  •  
  • HBsAg

    HBV surface antigen

  •  
  • HBV

    hepatitis B virus

  •  
  • HCC

    hepatocellular carcinoma

  •  
  • HEK

    human embryonic kidney

  •  
  • hpt

    hours post-transfection

  •  
  • IFN

    interferon

  •  
  • IHC

    immunohistochemistry

  •  
  • LHBs

    large hepatitis B S protein

  •  
  • MBP

    maltose-binding protein

  •  
  • MHBs

    middle hepatitis B S protein

  •  
  • Ni-NTA

    Ni2+-nitrilotriacetate

  •  
  • pgRNA

    pre-genomic RNA

  •  
  • qRT-PCR

    quantitative reverse transcription–PCR

  •  
  • RISC

    RNA-induced silencing complex

  •  
  • RSS

    RNA-silencing suppressor

  •  
  • tGFP

    turbo GFP

  •  
  • wt

    wild-type

AUTHOR CONTRIBUTION

Raj Kamal Bhatnagar, Sunil Kumar Mukherjee, Pawan Malhotra, Shiv Kumar Sarin, Avishek Kumar Singh and Mahendran Chinnappan conceived the study. Mahendran Chinnappan, Avishek Kumar Singh, Pavan Kumar Kakumani and Gautam Kumar made the constructs, performed cell line maintenance and performed the experiments. Archana Rastogi, Sheetalnath Babasaheb Rooge, Anupama Kumari and Aditi Varshney performed IHC and WB of the CHB samples. Ashok Kumar Singh and Shiv Kumar Sarin assisted in maintaining cell lines and provided valuable suggestions for the experiments. Raj Kamal Bhatnagar, Sunil Kumar Mukherjee, Pawan Malhotra and Mahendran Chinnappan analysed most of the data and prepared the paper. All of the authors approved the final version of the paper.

We thank Mr Ravinder Kumar (International Center for Genetic Engineering and Biotechnology, Delhi, India) for his assistance in making the Sf21 permanent cell line.

FUNDING

This work was supported by the Department of Biotechnology (DBT), India [grant number BT/PR10673/AGR/36/579/2008].

References

References
1
Agrawal
N.
Dasaradhi
P. V. N.
Mohmmed
A.
Malhotra
P.
Bhatnagar
R. K.
Mukherjee
S. K.
RNA interference: biology, mechanism, and applications
Microbiol. Mol. Biol. Rev.
2003
, vol. 
67
 (pg. 
657
-
685
)
[PubMed]
2
Parameswaran
P.
Sklan
E.
Wilkins
C.
Burgon
T.
Samuel
M. A.
Lu
R.
Ansel
K. M.
Heissmeyer
V.
Einav
S.
Jackson
W.
Six RNA viruses and forty-one hosts: viral small RNAs and modulation of small RNA repertoires in vertebrate and invertebrate systems
PLoS Pathog.
2010
, vol. 
6
 pg. 
e1000764
 
[PubMed]
3
Hamilton
A. J.
Baulcombe
D. C.
A species of small antisense RNA in posttranscriptional gene silencing in plants
Science
1999
, vol. 
286
 (pg. 
950
-
952
)
[PubMed]
4
Lu
R.
Maduro
M.
Li
F.
Li
H. W.
Broitman-Maduro
G.
Li
W. X.
Ding
S. W.
Animal virus replication and RNAi-mediated antiviral silencing in Caenorhabditis elegans
Nature
2005
, vol. 
436
 (pg. 
1040
-
1043
)
[PubMed]
5
Lee
Y. S.
Nakahara
K.
Pham
J. W.
Kim
K.
He
Z.
Sontheimer
E. J.
Carthew
R. W.
Distinct roles for Drosophila Dicer-1 and Dicer-2 in the siRNA/miRNA silencing pathways
Cell
2004
, vol. 
117
 (pg. 
69
-
81
)
[PubMed]
6
de Vries
W.
Berkhout
B.
RNAi suppressors encoded by pathogenic human viruses
Int. J. Biochem. Cell Biol.
2008
, vol. 
40
 (pg. 
2007
-
2012
)
[PubMed]
7
Duan
C.-G.
Fang
Y.-Y.
Zhou
B.-J.
Zhao
J.-H.
Hou
W.-N.
Zhu
H.
Ding
S.-W.
Guo
H.-S.
Suppression of Arabidopsis ARGONAUTE1-mediated slicing, transgene-induced RNA silencing, and DNA methylation by distinct domains of the Cucumber mosaic virus 2b protein
Plant Cell
2012
, vol. 
24
 (pg. 
259
-
274
)
[PubMed]
8
Kawai
T.
Akira
S.
Innate immune recognition of viral infection
Nat. Immunol.
2006
, vol. 
7
 (pg. 
131
-
137
)
[PubMed]
9
Pedersen
I. M.
Cheng
G.
Wieland
S.
Volinia
S.
Croce
C. M.
Chisari
F. V.
David
M.
Interferon modulation of cellular microRNAs as an antiviral mechanism
Nature
2007
, vol. 
449
 (pg. 
919
-
922
)
[PubMed]
10
Li
Y.
Lu
J.
Han
Y.
Fan
X.
Ding
S.-W.
RNA interference functions as an antiviral immunity mechanism in mammals
Science
2013
, vol. 
342
 (pg. 
231
-
234
)
[PubMed]
11
Maillard
P. V.
Ciaudo
C.
Marchais
A.
Li
Y.
Jay
F.
Ding
S. W.
Voinnet
O.
Antiviral RNA interference in mammalian cells
Science
2013
, vol. 
342
 (pg. 
235
-
238
)
[PubMed]
12
Li
W.-X.
Li
H.
Lu
R.
Li
F.
Dus
M.
Atkinson
P.
Brydon
E. W. A.
Johnson
K. L.
Garcia-Sastre
A.
Ball
L. A.
Interferon antagonist proteins of influenza and vaccinia viruses are suppressors of RNA silencing
Proc. Natl. Acad. Sci. U.S.A.
2004
, vol. 
101
 (pg. 
1350
-
1355
)
[PubMed]
13
Wang
Y.
Kato
N.
Jazag
A.
Dharel
N.
Otsuka
M.
Taniguchi
H.
Kawabe
T.
Omata
M.
Hepatitis C virus core protein is a potent inhibitor of RNA silencing-based antiviral response
Gastroenterology
2006
, vol. 
130
 (pg. 
883
-
892
)
[PubMed]
14
Ji
J.
Glaser
A.
Wernli
M.
Berke
J. M.
Moradpour
D.
Erb
P.
Suppression of short interfering RNA-mediated gene silencing by the structural proteins of hepatitis C virus
J. Gen. Virol.
2008
, vol. 
89
 (pg. 
2761
-
2766
)
[PubMed]
15
Karjee
S.
Minhas
A.
Sood
V.
Ponia
S. S.
Banerjea
A. C.
Chow
V. T. K.
Mukherjee
S. K.
Lal
S. K.
The 7a accessory protein of severe acute respiratory syndrome coronavirus acts as an RNA silencing suppressor
J. Virol.
2010
, vol. 
84
 (pg. 
10395
-
10401
)
[PubMed]
16
Fabozzi
G.
Nabel
C. S.
Dolan
M. A.
Sullivan
N. J.
Ebolavirus proteins suppress the effects of small interfering RNA by direct interaction with the mammalian RNA interference pathway
J. Virol.
2011
, vol. 
85
 (pg. 
2512
-
2523
)
[PubMed]
17
Kakumani
P. K.
Ponia
S. S.
Rajgokul
K. S.
Sood
V.
Chinnappan
M.
Banerjea
A. C.
Medigeshi
G.
Malhotra
P.
Mukherjee
S. K.
Bhatnagar
R. K.
Role of RNAi in dengue viral replication and identification of NS4B as a RNAi suppressor
J. Virol.
2013
, vol. 
87
 (pg. 
8870
-
8883
)
[PubMed]
18
Feitelson
M.
Hepatitis B virus infection and primary hepatocellular carcinoma
Clin. Microbiol. Rev.
1992
, vol. 
5
 (pg. 
275
-
301
)
[PubMed]
19
Schädler
S.
Hildt
E.
HBV life cycle: entry and morphogenesis
Viruses
2009
, vol. 
1
 (pg. 
185
-
209
)
[PubMed]
20
Beck
J.
Nassal
M.
Hepatitis B virus replication
World J. Gastroenterol.
2007
, vol. 
13
 pg. 
48
 
[PubMed]
21
Rawat
S.
Clippinger
A. J.
Bouchard
M. J.
Modulation of apoptotic signaling by the hepatitis B virus X protein
Viruses
2012
, vol. 
4
 (pg. 
2945
-
2972
)
[PubMed]
22
Wang
Y.
Lu
Y.
Toh
S. T.
Sung
W.-K.
Tan
P.
Chow
P.
Chung
A. Y. F.
Jooi
L. L. P.
Lee
C. G. L.
Lethal-7 is down-regulated by the hepatitis B virus x protein and targets signal transducer and activator of transcription 3
J. Hepatol.
2010
, vol. 
53
 (pg. 
57
-
66
)
[PubMed]
23
Wu
G.
Yu
F.
Xiao
Z.
Xu
K.
Xu
J.
Tang
W.
Wang
J.
Song
E.
Hepatitis B virus X protein downregulates expression of the miR-16 family in malignant hepatocytes in vitro
Brit. J. Cancer
2011
, vol. 
105
 (pg. 
146
-
153
)
24
Hayes
C. N.
Akamatsu
S.
Tsuge
M.
Miki
D.
Akiyama
R.
Abe
H.
Ochi
H.
Hiraga
N.
Imamura
M.
Takahashi
S.
Hepatitis B virus-specific miRNAs and argonaute2 play a role in the viral life cycle
PLoS ONE
2012
, vol. 
7
 pg. 
e47490
 
[PubMed]
25
Blum
H. E.
Galun
E.
Liang
T. J.
von Weizsacker
F.
Wands
J. R.
Naturally occurring missense mutation in the polymerase gene terminating hepatitis B virus replication
J. Virol.
1991
, vol. 
65
 (pg. 
1836
-
1842
)
[PubMed]
26
Blum
H. E.
Zhang
Z.-S.
Galun
E.
Von Weizsacker
F.
Garner
B.
Liang
T. J.
Wands
J. R.
Hepatitis B virus X protein is not central to the viral life cycle in vitro
J. Virol.
1992
, vol. 
66
 (pg. 
1223
-
1227
)
[PubMed]
27
Singh
G.
Popli
S.
Hari
Y.
Malhotra
P.
Mukherjee
S.
Bhatnagar
R. K.
Suppression of RNA silencing by Flock house virus B2 protein is mediated through its interaction with the PAZ domain of Dicer
FASEB J.
2009
, vol. 
23
 (pg. 
1845
-
1857
)
[PubMed]
28
Meister
G.
Landthaler
M.
Patkaniowska
A.
Dorsett
Y.
Teng
G.
Tuschl
T.
Human Argonaute2 mediates RNA cleavage targeted by miRNAs and siRNAs
Mol. Cell
2004
, vol. 
15
 (pg. 
185
-
197
)
[PubMed]
29
Han
J.
Pedersen
J. S.
Kwon
S. C.
Belair
C. D.
Kim
Y.-K.
Yeom
K.-H.
Yang
W.-Y.
Haussler
D.
Blelloch
R.
Kim
V. N.
Posttranscriptional crossregulation between Drosha and DGCR8
Cell
2009
, vol. 
136
 (pg. 
75
-
84
)
[PubMed]
30
Laras
A.
Koskinas
J.
Dimou
E.
Kostamena
A.
Hadziyannis
S. J.
Intrahepatic levels and replicative activity of covalently closed circular hepatitis B virus DNA in chronically infected patients
Hepatology
2006
, vol. 
44
 (pg. 
694
-
702
)
[PubMed]
31
Coley
W.
Van Duyne
R.
Carpio
L.
Guendel
I.
Kehn-Hall
K.
Chevalier
S.
Narayanan
A.
Luu
T.
Lee
N.
Klase
Z.
Absence of DICER in monocytes and its regulation by HIV-1
J. Biol. Chem.
2010
, vol. 
285
 (pg. 
31930
-
31943
)
[PubMed]
32
Jani
D.
Nagarkatti
R.
Beatty
W.
Angel
R.
Slebodnick
C.
Andersen
J.
Kumar
S.
Rathore
D.
HDP-a novel heme detoxification protein from the malaria parasite
PLoS Pathog.
2008
, vol. 
4
 pg. 
e1000053
 
[PubMed]
33
Berkhout
B.
Haasnoot
J.
The interplay between virus infection and the cellular RNA interference machinery
FEBS Lett.
2006
, vol. 
580
 (pg. 
2896
-
2902
)
[PubMed]
34
Wu
Z.
Zhu
Y.
Bisaro
D. M.
Parris
D. S.
Herpes simplex virus type 1 suppresses RNA-induced gene silencing in mammalian cells
J. Virol.
2009
, vol. 
83
 (pg. 
6652
-
6663
)
[PubMed]
35
Matskevich
A. A.
Moelling
K.
Dicer is involved in protection against influenza A virus infection
J. Gen. Vir.
2007
, vol. 
88
 (pg. 
2627
-
2635
)
36
Roth
B. M.
Pruss
G. J.
Vance
V. B.
Plant viral suppressors of RNA silencing
Virus Res.
2004
, vol. 
102
 (pg. 
97
-
108
)
[PubMed]
37
Murakami
S.
Cheong
J.
Kaneko
S.
Human hepatitis virus X gene encodes a regulatory domain that represses transactivation of X protein
J. Biol. Chem.
1994
, vol. 
269
 (pg. 
15118
-
15123
)
[PubMed]
38
Parashar Misra
K.
Mukherji
A.
Kumar
V.
The conserved amino-terminal region (amino acids 1–20) of the hepatitis B virus X protein shows a transrepression function
Virus Res.
2004
, vol. 
105
 (pg. 
157
-
165
)
[PubMed]
39
Jiang
J.
Tang
H.
Mechanism of inhibiting type I interferon induction by hepatitis B virus X protein
Protein Cell
2010
, vol. 
1
 (pg. 
1106
-
1117
)
[PubMed]
40
Kumar
V.
Jayasuryan
N.
Kumar
R.
A truncated mutant (residues 58–140) of the hepatitis B virus X protein retains transactivation function
Proc. Natl. Acad. Sci. U.S.A.
1996
, vol. 
93
 (pg. 
5647
-
5652
)
[PubMed]
41
Zhang
Z.
Torii
N.
Furusaka
A.
Malayaman
N.
Hu
Z.
Liang
T. J.
Structural and functional characterization of interaction between hepatitis B virus X protein and the proteasome complex
J. Biol. Chem.
2000
, vol. 
275
 (pg. 
15157
-
15165
)
[PubMed]
42
Park
N. H.
Song
I. H.
Chung
Y.-H.
Molecular pathogenesis of hepatitis-B-virus-associated hepatocellular carcinoma
Gut Liver
2007
, vol. 
1
 (pg. 
101
-
117
)
[PubMed]
43
Tang
H.
Oishi
N.
Kaneko
S.
Murakami
S.
Molecular functions and biological roles of hepatitis B virus x protein
Cancer Sci.
2006
, vol. 
97
 (pg. 
977
-
983
)
[PubMed]
44
Neuveut
C.
Wei
Y.
Buendia
M. A.
Mechanisms of HBV-related hepatocarcinogenesis
J. Hepatol.
2010
, vol. 
52
 (pg. 
594
-
604
)
[PubMed]
45
Bivalkar-Mehla
S.
Vakharia
J.
Mehla
R.
Abreha
M.
Kanwar
J. R.
Tikoo
A.
Chauhan
A.
Viral RNA silencing suppressors (RSS): novel strategy of viruses to ablate the host RNA interference (RNAi) defense system
Virus Res.
2011
, vol. 
155
 (pg. 
1
-
9
)
[PubMed]
46
Li
W. X.
Ding
S. W.
Viral suppressors of RNA silencing
Curr. Opin. Biotech.
2011
, vol. 
12
 (pg. 
150
-
154
)
47
Skalsky
R. L.
Cullen
B. R.
Viruses, microRNAs, and host interactions
Ann. Rev. Microbiol.
2010
, vol. 
64
 pg. 
123
 
48
Glazov
E. A.
Kongsuwan
K.
Assavalapsakul
W.
Horwood
P. F.
Mitter
N.
Mahony
T. J.
Repertoire of bovine miRNA and miRNA-like small regulatory RNAs expressed upon viral infection
PLoS ONE
2009
, vol. 
4
 pg. 
e6349
 
[PubMed]
49
Ren
M.
Qin
D.
Li
K.
Qu
J.
Wang
L.
Wang
Z.
Huang
A.
Tang
H.
Correlation between hepatitis B virus protein and microRNA processor Drosha in cells expressing HBV
Antivir. Res.
2012
, vol. 
94
 (pg. 
225
-
231
)
50
Jaronczyk
K.
Carmichael
J.
Hobman
T.
Exploring the functions of RNA interference pathway proteins: some functions are more RISCy than others?
Biochem. J.
2005
, vol. 
387
 (pg. 
561
-
571
)
[PubMed]
51
Lin
R.-J.
Lin
Y.-C.
Chen
J.
Kuo
H.-H.
Chen
Y.-Y.
Diccianni
M. B.
London
W. B.
Chang
C.-H.
Alice
L. Y.
microRNA signature and expression of Dicer and Drosha can predict prognosis and delineate risk groups in neuroblastoma
Cancer Res.
2010
, vol. 
70
 (pg. 
7841
-
7850
)
[PubMed]
52
Pampalakis
G.
Diamandis
E. P.
Katsaros
D.
Sotiropoulou
G.
Down-regulation of dicer expression in ovarian cancer tissues
Clin. Biochem.
2010
, vol. 
43
 (pg. 
324
-
327
)
[PubMed]
53
Dedes
K. J.
Natrajan
R.
Lambros
M. B.
Geyer
F. C.
Lopez-Garcia
M. A.
Savage
K.
Jones
R. L.
Reis-Filho
J. S.
Down-regulation of the miRNA master regulators Drosha and Dicer is associated with specific subgroups of breast cancer
Eur. J. Cancer.
2011
, vol. 
47
 (pg. 
138
-
150
)
[PubMed]
54
Torres
A.
Torres
K.
Paszkowski
T.
Jodlowska-Jedrych
B.
Radomanski
T.
Ksiazek
A.
Maciejewski
R.
Major regulators of microRNAs biogenesis Dicer and Drosha are down-regulated in endometrial cancer
Tumor Biol.
2011
, vol. 
32
 (pg. 
769
-
776
)
55
Diaz-Garcia
C. V.
Agudo-Lopez
A.
Perez
C.
Lopez-Martin
J. A.
Rodriguez-Peralto
J. L.
de Castro
J.
Cortijo
A.
Martinez-Villanueva
M.
Iglesias
L.
Garcia-Carbonero
R.
DICER1, DROSHA and miRNAs in patients with non-small cell lung cancer: implications for outcomes and histologic classification
Carcinogenesis
2013
, vol. 
34
 (pg. 
1031
-
1038
)
[PubMed]
56
Inchley
C. S.
Sonerud
T.
Fjaerli
H. O.
Nakstad
B.
Reduced Dicer expression in the cord blood of infants admitted with severe respiratory syncytial virus disease
BMC Infect. Dis.
2011
, vol. 
11
 pg. 
59
 
[PubMed]
57
Gale
M.
Jr
Katze
M. G.
Molecular mechanisms of interferon resistance mediated by viral-directed inhibition of PKR, the interferon-induced protein kinase
Pharmacol. Ther.
1998
, vol. 
78
 (pg. 
29
-
46
)
[PubMed]
58
Chendrimada
T. P.
Gregory
R. I.
Kumaraswamy
E.
Norman
J.
Cooch
N.
Nishikura
K.
Shiekhattar
R.
TRBP recruits the Dicer complex to Ago2 for microRNA processing and gene silencing
Nature
2005
, vol. 
436
 (pg. 
740
-
744
)
[PubMed]
59
Wu
Q.
Wang
X.
Ding
S.-W.
Viral suppressors of RNA-based viral immunity: host targets
Cell. Host Microb.
2010
, vol. 
8
 (pg. 
12
-
15
)
60
Rui
E.
de Moura
P. R.
Kobarg
J.
Expression of deletion mutants of the hepatitis B virus protein HBx in E. coli and characterization of their RNA binding activities
Virus Res.
2001
, vol. 
74
 (pg. 
59
-
73
)
[PubMed]

Author notes

1

These authors contributed equally to this work.