Glycogen functions as a carbohydrate reserve in a variety of organisms and its metabolism is highly regulated. The activities of glycogen synthase and glycogen phosphorylase, the rate-limiting enzymes of the synthesis and degradation processes, respectively, are regulated by allosteric modulation and reversible phosphorylation. To identify the protein kinases affecting glycogen metabolism in Neurospora crassa, we performed a screen of 84 serine/threonine kinase knockout strains. We identified multiple kinases that have already been described as controlling glycogen metabolism in different organisms, such as NcSNF1, NcPHO85, NcGSK3, NcPKA, PSK2 homologue and NcATG1. In addition, many hypothetical kinases have been implicated in the control of glycogen metabolism. Two kinases, NcIME-2 and NcNIMA, already functionally characterized but with no functions related to glycogen metabolism regulation, were also identified. Among the kinases identified, it is important to mention the role of NcSNF1. We showed in the present study that this kinase was implicated in glycogen synthase phosphorylation, as demonstrated by the higher levels of glycogen accumulated during growth, along with a higher glycogen synthase (GSN) ±glucose 6-phosphate activity ratio and a lesser set of phosphorylated GSN isoforms in strain Ncsnf1KO, when compared with the wild-type strain. The results led us to conclude that, in N. crassa, this kinase promotes phosphorylation of glycogen synthase either directly or indirectly, which is the opposite of what is described for Saccharomyces cerevisiae. The kinases also play a role in gene expression regulation, in that gdn, the gene encoding the debranching enzyme, was down-regulated by the proteins identified in the screen. Some kinases affected growth and development, suggesting a connection linking glycogen metabolism with cell growth and development.

INTRODUCTION

Glycogen is a polysaccharide widely distributed in micro-organisms and animal cells, and its main role is that of a carbohydrate reserve. Its metabolism is under an intricate regulation that senses nutrient availability and other environmental conditions. The mechanisms of glycogen synthesis and degradation have been well characterized in many organisms, including bacteria, yeast and mammals, and both processes are carried out by the concerted action of a set of enzymes, the main control being the activities of glycogen synthase (EC 2.4.1.11) and glycogen phosphorylase (EC 2.4.1.1), respectively [13]. Both enzymes are regulated by allosteric modulation and reversible phosphorylation, existing as dephosphorylated forms, in which the synthase enzyme is active, and phosphorylated forms, with an active phosphorylase enzyme [4,5]. Multiple phosphorylation sites were identified in different glycogen synthases, phosphorylated by different protein kinases, depending on the organism, whereas glycogen phosphorylase is phosphorylated in a single residue, Ser14, which is modified by the phosphorylase kinase protein [1]. Rabbit muscle glycogen synthase, the best characterized enzyme so far, has at least nine phosphorylation sites, located at both the N- and C-termini of the polypeptide chain, and different protein kinases were linked to the in vitro phosphorylation of this enzyme [6]. Studies with this enzyme led to the concept of hierarchal phosphorylation, in which the phosphorylation in one site is necessary for a subsequent site [7]. Glycogen synthases of micro-organisms lack the N-terminal phosphorylation sites and only the protein kinases that phosphorylate the Saccharomyces cerevisiae Gsy2p glycogen synthase have been identified so far. The Psk2p and cyclin-dependent Pho85p protein kinases phosphorylate in vitro two of the three phosphorylation sites in the yeast enzyme [8,9].

The fungus Neurospora crassa has been widely used as a model organism for fundamental aspects of eukaryotic biology. Knowledge of its genome sequence [10] and the construction of a set of deletion strains, each carrying a deletion in a specific ORF, have allowed screening for proteins linked to a particular phenotype. We have previously used a collection of knockout strains in genes encoding transcription factors to identify regulatory proteins that either directly or indirectly regulate glycogen metabolism in N. crassa [11]. In the present study we used a set of mutant strains in protein kinases in an attempt to identify kinases affecting glycogen accumulation. Protein phosphorylation is considered a key event in many signal transduction pathways of biological systems [12,13]. In N. crassa, the number of genes encoding serine/threonine kinases is estimated to be 107 [14], according to the most recent annotation, and many remain uncharacterized with respect to their biological function. Among the N. crassa protein kinases functionally characterized, it is important to mention the NDR kinase DBF-2, demonstrated as being involved in cell cycle regulation, conidiation and acting as a negative regulator of glycogen metabolism in N. crassa [15]. DBF-2 NDR protein kinase is an orthologue of human LATS1 kinase, implicated in cell proliferation and/or tumour progression and a component of the Hippo signalling transduction pathway [16]. More recently, the whole set of the N. crassa serine/threonine kinase mutant strains was analysed for their morphology, growth phenotypes and chemical sensitivity, showing that a large number of kinases is either essential or necessary for normal growth [14]. The importance of mitogen-activated protein kinases (MAPKs) in the N. crassa protoperithecial development was demonstrated in nine MAPK mutant strains belonging to three cascades; all mutant strains were defective in sexual development [17].

This work focuses on the identification of which N. crassa protein kinases affect glycogen accumulation by using the knockout strain collection. Our results demonstrated that protein kinases already identified in glycogen metabolism regulation were identified in this work and revealed that additional proteins could be implicated in this process. In addition, the protein kinases probably influencing glycogen synthase phosphorylation status were investigated using biochemical approaches.

EXPERIMENTAL

N. crassa strains and growth conditions

The N. crassa strain FGSC 9718 (mus-51::bar mat a), used in this work as the wild-type reference, and a set of 147 mutant strains (including mating types A and a) individually knocked out in genes encoding protein kinases were purchased from the Fungal Genetics Stock Center [18]. The deletion strains comprise a set of mutants in which each ORF had been disrupted from start to stop codon by the insertion of the hph gene (hygromycin B phosphotransferase) as a marker [19]. The strains were cultivated in Vogel's minimal (VM) medium [20] supplemented with 2% sucrose. Hygromycin B (200 μg/ml final concentration) was added to the medium when using the heterokaryotic mutant strains. After 10 days of culture, conidia were suspended in sterile water and counted. For vegetative growth, conidia (107/ml) were inoculated into 250 ml of VM medium and cultured at 30°C and 250 rev./min. Mycelia samples were harvested at specific times of growth, filtered, frozen in liquid nitrogen and stored at −80°C. Samples were used for glycogen quantification, gene expression assays and glycogen synthase activity. For cell growth quantification, conidia (107/ml) were inoculated into 50 ml of VM medium and cultured at 30°C at 250 rev./min, and samples were harvested after 24 h. Growth was quantified by weighing the biomass after drying at 98°C for 16 h. For the heat-shock experiments, conidia (107/ml) were first germinated in 100 ml of VM medium containing 2% sucrose, at 30°C and 250 rev./min for 24 h. After this time, an aliquot was removed, filtered, frozen in liquid nitrogen and stored at −80°C until use (before heat shock). The remaining cultures were filtered and transferred into fresh VM pre-heated at 45°C. After 30 min, the mycelia were harvested by filtration, frozen in liquid nitrogen and stored at −80°C (after heat shock). The frozen mycelial pads were further used to prepare crude cellular extracts for different analyses.

GSN phosphorylation analysis

Glycogen synthase phosphorylation was analysed by two-dimensional electrophoresis. For this analysis, 24-h mycelial pads from the wild-type and mutant strains were ground to a fine powder in liquid nitrogen and extracted in lysis buffer (50 mM HEPES, pH 7.4, 137 mM NaCl, 10% glycerol, 25 mM NaF, 1 mM EDTA and 10 mM Na4P2O7). Total protein was precipitated using the 2D Clean-Up kit (GE Healthcare), suspended in sample buffer (30 mM Tris/HCl, pH 8.0, 7 M urea, 2 M thiourea, 4% CHAPS and 20 mM DTT), and quantified using the 2D-Quant kit (GE HealthCare). Approximately 250 μg of total protein was fractionated by isoelectric focusing (IEF), using the pH 3–10 gradient Immobiline™ DryStrip (13-cm, linear, GE Healthcare) in an Ettan IPGphor 3 system (GE Healthcare), according to the manufacturer's instructions. After rehydration, IEF was carried out at 50 μA per strip at 20°C, using the following steps: 100 V (10 h), 500 V (500 V·h), 1000 V (750 V·h), 8000 V (11325 V·h), and 8000 V (5067 V·h). After electrofocusing, the strips were twice equilibrated in 3 ml of equilibration buffer [50 mM Tris/HCl, pH 8.8, 6 M urea, 30% (v/v) glycerol, 2% (w/v) SDS and 0.005% Bromophenol Blue, adding 10 mg/ml DTT for the first time and 25 mg/ml iodoacetamide the second time]. Equilibrated strips were subjected to SDS/PAGE (9.0% gel), using a Hoefer™ SE600 system (GE Healthcare) and the proteins were developed with Coomassie B Brilliant Blue R-250. To analyse the GSN phosphorylation status in the mutant strains, proteins were transferred to a nitrocellulose membrane after 2D electrophoresis and blotted with anti-GSN raised in rabbits. Blots were subsequently probed with horseradish peroxidase (HRP)-conjugated secondary antibodies (Sigma) and developed with a luminol reagent. As a control of phosphorylation, total protein from the wild-type strain was treated with lambda phosphatase (NEB).

Glycogen and trehalose quantification

Mycelial pad samples submitted and not submitted to heat shock were used. The mycelia were ground to a fine powder in a pre-chilled mortar in liquid nitrogen and extracted into a lysis buffer [50 mM Tris/HCl, pH 7.6, 100 mM NaF, 1 mM EDTA, 1 mM PMSF, 0.1 mM tosyl-L-lysine chloromethyl ketone (TLCK), 1 mM benzamidine and 1 μg/ml each of pepstatin and aprotinin]. Cell extracts were clarified by centrifuging at 3000 g for 10 min at 4°C, and the supernatants were used for glycogen and protein quantifications. Glycogen content was measured following the protocol described by Hardy and Roach [21] with slight modifications. Briefly, 100 μl of the crude extract was precipitated with 20% trichloroacetic acid (TCA) (final concentration). The supernatant was separated after centrifuging (5000 g for 10 min at 4°C); the glycogen was precipitated with 500 μl of 95% cold ethanol and collected by centrifugation. After that, it was washed twice with 66% ethanol, dried and digested with α-amylase (10 mg/ml) and amyloglucosidase (30 mg/ml). Free glucose was measured with a glucose oxidase kit, and the glycogen content was normalized to the total protein concentration. Total protein was quantified according to the method of Hartree [22] using BSA as a standard.

For quantification of trehalose, mycelial pads were ground to a fine powder in a pre-chilled mortar in liquid nitrogen, and extracted into a lysis buffer (50 mM Tris/HCl, pH 7.6, 100 mM NaF, 1 mM EDTA, 1 mM PMSF, 0.1 mM TLCK, 1 mM benzamidine and 1 μg/ml each of pepstatin and aprotinin). Cellular extracts were clarified by centrifuging at 5000 g for 10 min at 4°C, and the supernatants were used for trehalose and protein quantifications. Trehalose content was determined according to [23] with slight modifications. Briefly, the assays were carried out in a total volume of 0.4 ml in 300 mM sodium acetate buffer, pH 5.5, containing 30 mM CaCl2. Partially purified trehalase (2.3 units) from Humicola grisea [24] was added and the samples were incubated at 50°C overnight. The reaction was stopped by incubating the samples at 100°C for 10 min. The glucose released was quantified with a glucose oxidase kit, and the trehalose content was normalized to the total protein concentration. Total protein was quantified according to the method of Hartree [22] using BSA as a standard.

Glycogen synthase activity quantification

The activity of the glycogen synthase was determined by [14C]glucose incorporation as described by Thomas et al. [25]. Briefly, mycelia pads were ground to a fine powder in liquid nitrogen in a pre-chilled mortar and 200 mg of each sample was extracted in 1 ml of lysis buffer (50 mM Tris/HCl, pH 7.5, 100 mM NaF, 1 mM EDTA, 1 mM PMSF, 1 mM benzamidine, 1 mM 2-mercaptoethanol, and 1 μg/ml each of aprotinin, pepstatin and TLCK). Cellular extracts were clarified (1000 g for 20 min at 4°C) and total proteins were quantified [22] using BSA as a standard. To assay glycogen synthase activity, 15–30 μl of the supernatant was added to 60 μl of the reaction buffer [50 mM Tris/HCl, pH 7.8, 20 mM EDTA, 25 mM NaF, 0.67% glycogen, 3 mM UDP-[14C]glucose (1.8 mCi/mmol), with or without 7.2 mM glucose 6-phosphate] and incubated at 30°C for 15 min. After incubation, 75 μl were withdrawn, placed on Whatmann 3MM paper and washed with cold ethanol (70%) under agitation for 15 min. An additional two washes in ethanol (70%) were done, the first for 60 min and the second for 15 min. After the washes, papers containing the reactions were dried and quantified in an LS 6500 Scintillation Counter (Beckman Coulter™). One unit of glycogen synthase activity is defined as the amount of enzyme that transfers 1 μmol of glucose to the glycogen per minute.

RNA isolation and gene expression analysis

Total RNA was prepared from mycelial samples not submitted to heat shock as described in [26]. Briefly, 36-h mycelial pads were disrupted by grinding in a mortar with liquid nitrogen and extracted with 750 μl of NTES buffer (0.6 M NaCl, 100 mM Tris/HCl, pH 8.0, 10 mM EDTA and 4% SDS) and 750 μl of phenol (saturated with 0.1 M Tris/HCl, pH 8.0). The aqueous phase was re-extracted twice with phenol and the RNA precipitated with 0.75 vol. of 8 M LiCl for 2 h at 4°C. Nucleic acids were collected by centrifuging (9300 g for 10 min at 4°C), suspended in 0.3 ml of double-distilled water and subjected to another round of precipitation with 30 μl of 3 M sodium acetate (pH 5.2) and 0.75 ml of 95% ethanol. After this, total RNAs were collected by centrifuging and washed twice with 70% ethanol; the pellets were suspended in RNase-free water and stored at −80°C. RNA (10 μg) from each sample was fractionated on a 2.2 M formaldehyde 1.2% (w/v) agarose gel, stained with ethidium bromide, and visualized under UV light to assess the 25S and 18S rRNA integrity.

Gene expression analysis was performed by quantitative real-time PCR (qRT-PCR). DNase treatment and cDNA synthesis were performed according to the manufacturer's instructions. RNA samples (20 μg) were treated with RQ1 RNase-free DNase (Promega) and subjected to cDNA synthesis using a SuperScript III First Strand Synthesis kit (Invitrogen) and an oligo(dT) primer. Reactions were performed on a StepOnePlus™ Real-Time PCR System (Applied Biosystems) using the Power SYBR Green PCR Master Mix (Applied Biosystems), and specific primers for glycogen synthase (gsn), glycogen phosphorylase (gpn) and tubulin (tub-2) mRNA amplicons. The sequences are shown in Table 1. Five replicates were performed per experiment and the data were analysed using StepOne™ Software version 2.1 (Applied Biosystems) in the standard comparative curve method. The fluorescent dye ROX™ was used as the passive reference to normalize the SYBR green reporter dye fluorescent signal. All PCR products exhibited melting curves indicating the presence of a single amplicon. Expression of the tubulin β chain (tub-2 gene, NCU04054) was used as the endogenous control for all experiments.

Table 1
Oligonucleotides used for qPCR

Primers are positioned according to the ATG start codon.

PrimerSequence (5′→3′)ORFGenePosition
qGSN-F TACCAAGCATCACCACCAACCTCT NCU06687 gsn +1541 to +1564 
qGSN-R TGTCTGCGGCTCTTCTGGGTAAAT NCU06687 gsn +1689 to +1712 
qGPN-F TGCCAATATCGAAATCACCCGCGA NCU07027 gpn +2247 to +2061 
qGPN-R TCTCGATGGCCTCAAACACCTTGA NCU07027 gpn +2375 to +2398 
qRAMIF-F TCTGCGATGCCGAGTTGT NCU05429 gbn +1487 to +1504 
qRAMIF-R ACTCGTTGCCCTCGAAGT NCU05429 gbn +1616 to +1633 
qDESRAM-F TCGGCGGTAATCAAGCCA NCU00743 gdn +3779 to +3796 
qDESRAM-R TGAATTTGCCGGCTTCGT NCU00743 gdn +3935 to +3952 
4054Tub-F CCTCCACCTTCGTCGGTAACTCC NCU04054 tub +1091 to +1113 
4054Tub-R GGTACTGCTGGTACTCGGAGACG NCU04054 tub +1254 to +1276 
PrimerSequence (5′→3′)ORFGenePosition
qGSN-F TACCAAGCATCACCACCAACCTCT NCU06687 gsn +1541 to +1564 
qGSN-R TGTCTGCGGCTCTTCTGGGTAAAT NCU06687 gsn +1689 to +1712 
qGPN-F TGCCAATATCGAAATCACCCGCGA NCU07027 gpn +2247 to +2061 
qGPN-R TCTCGATGGCCTCAAACACCTTGA NCU07027 gpn +2375 to +2398 
qRAMIF-F TCTGCGATGCCGAGTTGT NCU05429 gbn +1487 to +1504 
qRAMIF-R ACTCGTTGCCCTCGAAGT NCU05429 gbn +1616 to +1633 
qDESRAM-F TCGGCGGTAATCAAGCCA NCU00743 gdn +3779 to +3796 
qDESRAM-R TGAATTTGCCGGCTTCGT NCU00743 gdn +3935 to +3952 
4054Tub-F CCTCCACCTTCGTCGGTAACTCC NCU04054 tub +1091 to +1113 
4054Tub-R GGTACTGCTGGTACTCGGAGACG NCU04054 tub +1254 to +1276 

Microscopic analysis

To determine conidial germination, conidia (107/ml) were inoculated into 50 ml of VM medium containing 2% sucrose, at 30°C and 250 rev./min; samples were harvested every 2 h and examined by light microscopy. Conidia were also inoculated on to a coverslip and incubated in VM medium plus 2% sucrose at 30°C for different times. For analysis of the nuclei, mycelia were fixed (3.7% formaldehyde, 50 mM NaH2PO4, pH 7.0, and 0.2% Tween 80), washed twice with PBS and stained with 100 μl of DAPI (0.5 mg/ml) for 5 min. The mycelia were washed again in PBS and examined in an Axio Imager.A2 microscope (Zeiss). Images were captured with an AxioCam MRm camera and processed using the AxioVision software, version 4.8.2. Further processing was performed using Adobe Photoshop 7.0.

RESULTS

Serine/threonine protein kinase mutant strains

We screened a collection of 84 N. crassa mutant strains, corresponding to a single mating type (A or a), each carrying a deletion in a single gene encoding a serine/threonine protein kinase. The protein kinases were classified into the following groups: AGC [PKA (protein kinase A), PKG (protein kinase G) and PKC (protein kinase C)], CaMK (Ca2+/calmodulin-dependent protein kinase), CK1 (casein kinase 1), CMGC [CDK (cyclin-dependent kinase), MAPK, GSK3 (glycogen synthase kinase 3) and CLK (CDC2-like kinase)], STE (homologue of yeast sterile proteins), and ‘other group’, which does not include the histidine kinases [14]. The additional 18 mutant strains, more recently available (‘atypical’ group) [14], were not analysed in the present study and 19 strains were heterokaryotic mutant strains, according to the fungus genome database (http://www.broad.mit.edu/annotation/genome/neurospora/Home.html). When working on such strains, Hygromycin B was added to the medium to enrich knockout conidia. All strains and the gene product names missing in each strain, together with the kinase families, are listed in Supplementary Table S1. All selected mutant strains had their gene knockout confirmed by PCR using the oligonucleotides described in Supplementary Table S2.

Protein kinases affecting glycogen and trehalose storage and glycogen synthase activity

To search for protein kinases regulating glycogen metabolism in N. crassa, the mutant strain set was analysed to search for strains presenting glycogen accumulation profiles different from those found in the wild-type strain. The mutant strains were analysed under normal growth temperature (30°C) and heat-shock stress (45°C) and the amount of glycogen accumulated under both conditions for all strains is shown in Supplementary Table S3. For comparison, we decided to quantify trehalose, another storage carbohydrate, accumulated by the selected mutant strains. It is known, from previous work, that N. crassa decreases glycogen and increases trehalose when the mycelium is exposed to heat shock (45°C) [27,28]. Of the 84 mutant strains analysed, 15 showed patterns of glycogen accumulation different from those observed in the wild-type strain (Figure 1A). The strains were selected because they showed either higher or lower glycogen levels than the wild-type strain at the two temperatures analysed. For comparison, the selected strains had their trehalose content quantified. Some mutant strains were of particular interest, because they exhibited remarkable differences when compared with the wild-type strain. Although the mutant strains NCU05638KO, NCU05658KO, NCU06626KO, NCU07880KO and NCU08177KO accumulated very low levels of glycogen, the amount of glycogen accumulated by the strains NCU09212KO, NCU06249KO, NCU03187KO, NCU04566KO and NCU06240KO was highly increased at both temperatures. Finally, we noted the high glycogen levels observed in the strains NCU09212KO and NCU04566KO after heat shock. As the selected strains showed impaired control of glycogen accumulation, compared with the wild-type strain, we concluded that the protein kinases missing in the mutant strains might be involved in the regulation of glycogen accumulation. Most of the selected mutant strains also presented impaired trehalose accumulation either before or after heat shock (Figure 1B), showing that the protein kinases identified as regulators of glycogen metabolism may regulate carbohydrate metabolism in general.

Glycogen and trehalose accumulation before and after heat shock in the selected mutant strains

Figure 1
Glycogen and trehalose accumulation before and after heat shock in the selected mutant strains

Conidia (107/ml) were first germinated in 100 ml of VM medium containing 2% sucrose, at 30°C and 250 rev./min over 24 h. After this time, an aliquot was removed, filtered, frozen in liquid nitrogen and stored at −80°C until use (before heat shock, HS). The remaining cultures were filtered and transferred into fresh VM pre-heated to 45°C. After 30 min, the mycelia were harvested by filtration, frozen in liquid nitrogen and stored at −80°C (after HS). (A) Glycogen was extracted from mycelia, both submitted and not submitted to HS, digested with α-amylase and amyloglucosidase, and the free glucose was enzymatically determined with a glucose oxidase kit. (B) Trehalose in mycelia, both submitted and not submitted to heat shock, were digested with a partially purified trehalase and the free glucose was enzymatically determined with a glucose oxidase kit. Results represent the average of at least three independent experiments. The asterisk shows the heterokaryotic strains. WT, wild-type.

Figure 1
Glycogen and trehalose accumulation before and after heat shock in the selected mutant strains

Conidia (107/ml) were first germinated in 100 ml of VM medium containing 2% sucrose, at 30°C and 250 rev./min over 24 h. After this time, an aliquot was removed, filtered, frozen in liquid nitrogen and stored at −80°C until use (before heat shock, HS). The remaining cultures were filtered and transferred into fresh VM pre-heated to 45°C. After 30 min, the mycelia were harvested by filtration, frozen in liquid nitrogen and stored at −80°C (after HS). (A) Glycogen was extracted from mycelia, both submitted and not submitted to HS, digested with α-amylase and amyloglucosidase, and the free glucose was enzymatically determined with a glucose oxidase kit. (B) Trehalose in mycelia, both submitted and not submitted to heat shock, were digested with a partially purified trehalase and the free glucose was enzymatically determined with a glucose oxidase kit. Results represent the average of at least three independent experiments. The asterisk shows the heterokaryotic strains. WT, wild-type.

Many selected proteins are kinases already functionally characterized in other organisms, although some of them have not yet been characterized at the protein level, and are annotated either as conserved hypothetical proteins or only as protein kinase due to the presence of a kinase domain (Table 2). Most of the selected protein kinases were described as being involved with growth and development in the fungus [14] and many proteins were previously implicated as involved in the control of glycogen metabolism. Three strains are heterokaryotic, which means that they carry a nucleus with a non-functional allele (by gene knockout) and one with the wild-type gene. They were included in our results because they are mutant in protein kinases previously described as proteins regulating glycogen metabolism in different organisms. One is the NcPHO85 cyclin-dependent protein kinase encoded by the ORF NCU07580. In S. cerevisiae, this kinase, together with the cyclin Pcl10p (Pcl10p–Pho85p complex), phosphorylates the glycogen synthase Gsy2p and inhibits glycogen biosynthesis [29]. The ORF NCU04185 product is the glycogen synthase kinase 3 (NcGSK3) orthologous protein, one of the most important kinases that regulates mammalian glycogen metabolism by phosphorylating glycogen synthase [30]. The ORF NCU06240 product is the catalytic subunit of cAMP-dependent protein kinase and was described as regulating glycogen metabolism in N. crassa by influencing the GSN phosphorylation [31]. Additional protein kinases previously described as regulators of glycogen metabolism were also identified. The NCU04566KO strain, which showed high glycogen levels at both temperatures, is a mutant lacking the S. cerevisiae Snf1p protein kinase orthologue, a homologue of the mammalian AMP-activated protein kinase. In yeast, this kinase regulates glycogen metabolism by controlling the phosphorylation of glycogen synthase [32] and autophagy, a process that preserves glycogen stores [33]. The NCU00188 gene product is the S. cerevisiae Atg1p serine/threonine protein kinase orthologous protein, first identified as required for the autophagic process [34]. Atg1p was further demonstrated to be required for the maintenance of cell viability under conditions of starvation and to maintain glycogen storage during the stationary phase [33]. The S. cerevisiae atg1 mutant cells were able to synthesize glycogen, but were unable to maintain the glycogen stores during the stationary phase. Surprisingly, the N. crassa NCU00188KO strain accumulated low levels of glycogen at the exponential phase.

Table 2
Glycogen synthase (GSN) activity in the selected mutant strains
GSN activity (nmol/min per mg of protein)
Total±G6P
Fungal Genetics Stock CenterNCU #Gene product names30°C45°C30°C45°C
9718  Wild-type 1.35±0.81 1.58±0.49 0.25±0.01 0.69±0.01 
11313 04096 Serine/threonine protein kinase 3 1.92±0.08 0.86±0.03 0.80±0.06 0.61±0.03 
11500 04185* Protein kinase GSK3 0.46±0.01 0.41±0.05 0.44±0.02 0.47±0.00 
11513 06240* PKA catalytic subunit-1 0.41±0.18 0.2±0.17 0.31±0.00 0.58±0.00 
11545 09212 Serine/threonine protein kinase 1.12±0.10 0.69±0.10 0.40±0.05 0.47±0.01 
12420 04566 Protein kinase SNF1 2.15±0.15 1.15±0.12 0.91±0.08 0,94±0.04 
14539 07580* Cyclin-dependent protein kinase 0.63±0.28 0.29±0.03 0.52±0.04 0.40±0.07 
16738 06249 Serine/threonine protein kinase 0.35±0.02 0.45±0.20 0.35±0.06 0.86±0.06 
17400 00188 ATG1 protein 0.72±0.25 0.56±1.26 0.46±0.04 0.68±0.04 
17937 01498 Serine/threonine protein kinase MAK 0.91±0.00 0.42±0.07 0.57±0.05 0.61±0.03 
17948 05638 Serine/threonine protein kinase 34 1.37±0.21 1.00±1.03 0.33±0.02 0.62±0.05 
17951 05658 Serine/threonine protein kinase 36 0.90±0.35 0.51±0.02 0.44±0.05 0.60±0.06 
17959 06626 Phosphoinositide 3-kinase subunit 4 0.98±0.02 1.70±0.51 0.39±0.02 0.60±0.01 
17965 07880 Protein kinase 3.88±1.07 2.14±1.23 0.36±0.02 0.74±0.06 
17966 08177 Protein kinase 1.44±0.28 2.12±0.48 0.22±0.05 0.91±0.02 
21730 03187 G2-specific protein kinase nimA 1.00±0.12 0.41±0.08 0.35±0.50 0.70±0.02 
GSN activity (nmol/min per mg of protein)
Total±G6P
Fungal Genetics Stock CenterNCU #Gene product names30°C45°C30°C45°C
9718  Wild-type 1.35±0.81 1.58±0.49 0.25±0.01 0.69±0.01 
11313 04096 Serine/threonine protein kinase 3 1.92±0.08 0.86±0.03 0.80±0.06 0.61±0.03 
11500 04185* Protein kinase GSK3 0.46±0.01 0.41±0.05 0.44±0.02 0.47±0.00 
11513 06240* PKA catalytic subunit-1 0.41±0.18 0.2±0.17 0.31±0.00 0.58±0.00 
11545 09212 Serine/threonine protein kinase 1.12±0.10 0.69±0.10 0.40±0.05 0.47±0.01 
12420 04566 Protein kinase SNF1 2.15±0.15 1.15±0.12 0.91±0.08 0,94±0.04 
14539 07580* Cyclin-dependent protein kinase 0.63±0.28 0.29±0.03 0.52±0.04 0.40±0.07 
16738 06249 Serine/threonine protein kinase 0.35±0.02 0.45±0.20 0.35±0.06 0.86±0.06 
17400 00188 ATG1 protein 0.72±0.25 0.56±1.26 0.46±0.04 0.68±0.04 
17937 01498 Serine/threonine protein kinase MAK 0.91±0.00 0.42±0.07 0.57±0.05 0.61±0.03 
17948 05638 Serine/threonine protein kinase 34 1.37±0.21 1.00±1.03 0.33±0.02 0.62±0.05 
17951 05658 Serine/threonine protein kinase 36 0.90±0.35 0.51±0.02 0.44±0.05 0.60±0.06 
17959 06626 Phosphoinositide 3-kinase subunit 4 0.98±0.02 1.70±0.51 0.39±0.02 0.60±0.01 
17965 07880 Protein kinase 3.88±1.07 2.14±1.23 0.36±0.02 0.74±0.06 
17966 08177 Protein kinase 1.44±0.28 2.12±0.48 0.22±0.05 0.91±0.02 
21730 03187 G2-specific protein kinase nimA 1.00±0.12 0.41±0.08 0.35±0.50 0.70±0.02 

We have not identified the NDR kinase DBF-2 encoded by the ORF NCU09071 in our screen. This protein kinase was functionally characterized in N. crassa as involved in three fundamental processes: cell cycle regulation, conidiation and glycogen biosynthesis [15]. Mutant cells lacking this protein kinase accumulated glycogen in cytoplasmic leakage droplets at the end of growing hypha tips, as identified by NMR. Among the hypothetical proteins, we should mention the ORF NCU06249 product, annotated as a hypothetical protein, and homologue to the S. cerevisiae PAS kinase Psk2p described as a kinase that phosphorylates Gsy2p [8].

We further quantified glycogen synthase (GSN) phosphorylation status, the enzyme that catalyses the regulatory step in glycogen synthesis, in an attempt to correlate enzyme phosphorylation with the glycogen stored by the mutant strains. Enzymatic activity was quantified in the presence and absence of glucose 6-phosphate (G6P), the GSN allosteric modulator. The±G6P activity ratio is considered as an index of phosphorylation, higher levels correlating with lower phosphorylation and therefore higher activity. The activity was quantified in all selected mutant strains (see Table 2). The protein kinases missing in the mutant strains, which presented a high activity ratio at 30°C, could be directly implicated in GSN phosphorylation. Among the mutant strains analysed, we observed the high±G6P ratio (and thus lower GSN phosphorylation) at 30°C in the strains NCU04185KO (NcGSK3), NCU04566KO (NcSNF1) and NCU07580KO (NcPHO85), which are mutants of protein kinases described as regulating GSN phosphorylation, as previously mentioned. These results indicate that these proteins are probably also implicated in N. crassa GSN phosphorylation. The mutant strain NCU00188KO (NcATG1) also showed a high±G6P ratio indicating that this protein may be implicated in N. crassa GSN phosphorylation. In addition, and most importantly, this analysis revealed new protein kinases that may regulate glycogen storage through GSN phosphorylation. Among them, are the NCU04096, NCU09212, NCU01498, and NCU05658 gene products, most of which are annotated as hypothetical protein kinases. The only functionally characterized kinase is the NCU01498 gene product, the S. cerevisiae Ime2 homologue, involved in the induction of meiosis and sporulation in yeast [35], and in non-self recognition and programmed cell death in N. crassa [36]. From these results, we therefore conclude that protein kinases not yet described could be directly implicated in N. crassa GSN phosphorylation. Finally, the high±G6P ratio observed for some mutant strains (NCU04096KO and NCU01498KO) did not correlate with the high levels of glycogen accumulated, as would be expected for a kinase phosphorylating the enzyme GSN.

Mutant strains with impaired glycogen levels during growth

To know whether the glycogen accumulated by the selected mutant strains correlated with either higher synthesis or degradation of glycogen, we quantified the glycogen accumulated in mycelia harvested at different growth times. We selected strains presenting (see Figure 1) lower and higher glycogen storage than the wild-type at 24 h. We have previously demonstrated that, in the N. crassa wild-type strain, glycogen peaks at 24–36 h of the vegetative growth [27]. Some mutant strains presenting lower glycogen storage at 24 h showed a delay in the peak of glycogen accumulated during growth, compared with the wild-type strain (Figure 2A, strains NCU07880KO, NCU05638KO and NCU06626KO), accumulating higher levels at 48 h of growth. However, one strain (NCU08177KO) was unable to accumulate glycogen even though the total GSN activity at 30°C was similar to that in the wild-type strain (see Table 2). All proteins are annotated as hypothetical protein kinases in the fungus database.

Analysis of glycogen content along the vegetative growth in some selected mutant strains

Figure 2
Analysis of glycogen content along the vegetative growth in some selected mutant strains

Conidia (107/ml) were grown in liquid VM medium plus 2% sucrose, and mycelia were harvested at the indicated times of growth up to 72 h. The glycogen was extracted and digested with α-amylase and amyloglucosidase enzymes. The free glucose was enzymatically determined with a glucose oxidase kit. Results are the average of three independent experiments. The square symbol represents the glycogen accumulated by the wild-type strain during vegetative growth.

Figure 2
Analysis of glycogen content along the vegetative growth in some selected mutant strains

Conidia (107/ml) were grown in liquid VM medium plus 2% sucrose, and mycelia were harvested at the indicated times of growth up to 72 h. The glycogen was extracted and digested with α-amylase and amyloglucosidase enzymes. The free glucose was enzymatically determined with a glucose oxidase kit. Results are the average of three independent experiments. The square symbol represents the glycogen accumulated by the wild-type strain during vegetative growth.

The strains presenting higher levels of glycogen at 24 h also showed higher levels during growth with the exception of the strain NCU03187KO (Figure 2B). This strain lacks NcNIMA, a cell cycle-regulated protein kinase functionally characterized in N. crassa by Pu et al. [37]. This strain presented the highest levels of glycogen at the start of growth (12 h) but was unable to retain the glycogen accumulated. Among the strains showing higher levels during growth, it is important to emphasize the mutant strain in the NcSNF1 protein (NCU04566KO), which seems to play an opposite role to that described in S. cerevisiae with regard to GSN phosphorylation. The snf1 yeast strain is unable to accumulate glycogen, most probably by retaining the hyperphosphorylated state of Gsy2 [32]. The N. crassa Ncsnf1KO strain accumulated more glycogen than the wild-type strain and this result could be explained by the higher±G6P activity ratio (see Table 2), which means less phosphorylated isoforms of GSN.

As the levels of glycogen accumulated also correlate with physiological conditions, which result from transcriptional regulation of the genes encoding regulatory enzymes, we decided to verify whether the lack of protein kinases could affect the expression of genes encoding glycogenic enzymes. We analysed the expression of the gsn and gbn genes (which encode GSN and the debranching enzyme, respectively, both involved in glycogen synthesis) and gpn and gdn genes (which encode glycogen phosphorylase and debranching enzyme, respectively, involved in glycogen degradation) in the selected mutant strains. Gene expression was analysed by qPCR in the same samples previously selected, and the results are shown in Figure 3. Only the gdn gene appeared to be regulated by the protein kinases, being overexpressed in all mutant strains, which indicates gpn down-regulation by the protein kinases. The gene expression regulation could contribute to the lower levels of glycogen accumulated by some mutant strains.

Quantitative PCR analysis of gsn, gpn, gbn and gdn genes in some selected mutant strains

Figure 3
Quantitative PCR analysis of gsn, gpn, gbn and gdn genes in some selected mutant strains

Conidia (107/ml) were inoculated into liquid VM medium plus 2% sucrose, and grown over 36 h. After this, mycelia were collected by filtration, the total RNA was extracted and reverse-transcribed, and gene expression analysed. The tub-2 gene (NCU04054) was used as the endogenous control for all experiments. The results are the average of three independent experiments. WT, wild-type.

Figure 3
Quantitative PCR analysis of gsn, gpn, gbn and gdn genes in some selected mutant strains

Conidia (107/ml) were inoculated into liquid VM medium plus 2% sucrose, and grown over 36 h. After this, mycelia were collected by filtration, the total RNA was extracted and reverse-transcribed, and gene expression analysed. The tub-2 gene (NCU04054) was used as the endogenous control for all experiments. The results are the average of three independent experiments. WT, wild-type.

Different phosphorylated isoforms of GSN were identified in some selected mutant strains

As previously mentioned, the±G6P activity ratio is considered as an index of GSN phosphorylation. To analyse whether the higher activity ratio could be correlated with different isoforms of phosphorylated GSN, we performed 2D gels followed by Western blot using anti-GSN antibody. Total protein was extracted from mycelia harvested at 24 h of growth of mutant strains, exhibiting at 30°C±G6P an activity ratio higher than that of the wild-type strain. Only one strain (NCU08177KO) had the same ratio as the wild-type strain. The results are shown in Figure 4. Five isoforms of GSN differently phosphorylated were observed in the wild-type strain, which were reduced to two isoforms after treating with protein phosphatase. Most of the mutant strains exhibited the same pattern of phosphorylation, i.e. five isoforms of GSN, some of them being more intense than others. Although the phosphorylation sites of GSN have not been mapped to date, this result suggests that, under the growth conditions analysed in the present study, some phosphorylated isoforms may predominate. Two mutant strains exhibited an altered phosphorylation pattern for GSN: one is the NCU07880KO mutant strain (lacking a hypothetical serine/threonine protein kinase), which showed an additional phosphorylated isoform and apparently similar intensities of all isoforms. The other is the NcSNF1 mutant strain (NCU04566KO), which showed three predominant isoforms, indicating that GSN is less phosphorylated in this mutant strain. This result reinforces the results previously presented, which suggested that the NcSNF1 may be implicated in GSN phosphorylation. The higher±G6P activity ratio in this mutant strain, presented in Table 2, could be explained by less phosphorylated, and therefore more active, enzyme, resulting in hyperaccumulation of glycogen, the opposite to what is described for S. cerevisiae.

A zoom-in view of GSN in the 2D gel images

Figure 4
A zoom-in view of GSN in the 2D gel images

The mutant strains were grown for 24 h in liquid VM medium plus 2% sucrose, and mycelia were harvested by filtration. Total protein was extracted and 250 μg of total protein was fractionated by IEF followed by SDS/PAGE (2D-PAGE). After this, the proteins were transferred to a nitrocellulose membrane and analysed by Western blot using a polyclonal anti-GSN antibody raised in rabbits.

Figure 4
A zoom-in view of GSN in the 2D gel images

The mutant strains were grown for 24 h in liquid VM medium plus 2% sucrose, and mycelia were harvested by filtration. Total protein was extracted and 250 μg of total protein was fractionated by IEF followed by SDS/PAGE (2D-PAGE). After this, the proteins were transferred to a nitrocellulose membrane and analysed by Western blot using a polyclonal anti-GSN antibody raised in rabbits.

NcSNF1 may be implicated in GSN phosphorylation

For better analysis of GSN phosphorylation by the NcSNF1 protein kinase, GSN activity was quantified in the presence and absence of G6P in mycelial samples from wild-type and Ncsnf1KO mutant strains, harvested at different times of growth. The results showed that GSN was less phosphorylated in the mutant strain samples from 24 h to 60 h of growth compared with the wild-type strain, indicating that NcSNF1 positively affects GSN phosphorylation (Figure 5A).

GSN activity and glycogen accumulation during growth

Figure 5
GSN activity and glycogen accumulation during growth

(A) GSN activity (±G6P ratio) during vegetative growth. The Ncsnf1KO, NCU03523KO and wild-type strains (WT) were grown in liquid VM medium plus 2% sucrose up to 72 h. Mycelia from both strains were harvested at the indicated times and the crude cellular extracts were used to quantify the GSN activity in the presence and absence of G6P. Results are the average of three independent experiments. (B) Glycogen accumulation in the Ncsnf1KO, NCU06177KO, NCU03523KO and wild-type strains over 72 h of growth. Mycelia were harvested at different times during growth and glycogen was extracted and digested with α-amylase and amyloglucosidase enzymes. The free glucose was enzymatically determined with a glucose oxidase kit. Results are the average of three independent experiments.

Figure 5
GSN activity and glycogen accumulation during growth

(A) GSN activity (±G6P ratio) during vegetative growth. The Ncsnf1KO, NCU03523KO and wild-type strains (WT) were grown in liquid VM medium plus 2% sucrose up to 72 h. Mycelia from both strains were harvested at the indicated times and the crude cellular extracts were used to quantify the GSN activity in the presence and absence of G6P. Results are the average of three independent experiments. (B) Glycogen accumulation in the Ncsnf1KO, NCU06177KO, NCU03523KO and wild-type strains over 72 h of growth. Mycelia were harvested at different times during growth and glycogen was extracted and digested with α-amylase and amyloglucosidase enzymes. The free glucose was enzymatically determined with a glucose oxidase kit. Results are the average of three independent experiments.

The SNF1/AMPK (AMP-activated protein kinase) proteins are activated by phosphorylation by upstream kinases (Sak1, Elm1 and Tos3 in yeast) and dephosphorylated by protein phosphatases [38]. We decided to investigate the activation of NcSNF1 by kinases in N. crassa. A blast search using the yeast protein kinases homologues as a query in the N. crassa genome database retrieved the ORF products NCU06177 and NCU03523 (varying from 30% to 42% identity), which are annotated as a CaMK and a hypothetical protein, respectively. It is important to mention that in Park et al. [14] the NCU03523 product is described as the Yos3/Sak1 homologue. The glycogen accumulated during growth was quantified in both knockout strains and compared with those accumulated by the wild-type and Ncsnf1KO strains. The levels of glycogen accumulated by the NCU06177KO strain during growth were slightly decreased when compared with those in the wild-type strain (Figure 5B), suggesting that in N. crassa this protein kinase may not be implicated in NcSNF1 activation. However, the glycogen levels in the NCU03523KO strain were very close to those in the Ncsnf1KO strain, suggesting that this kinase might be implicated in the regulation of NcSNF1 by phosphorylation. The Ncsnf1KO strain again showed the highest levels of glycogen. We decided to analyse the GSN±G6P activity ratio in the NCU03523KO strain and, although their glycogen levels were closer to those in the Ncsnf1KO, the GSN activity was comparable with that in the wild-type strain. We suggest that the activation of glycogen metabolism in the NCU03523KO strain is not mediated via GSN activation by dephosphorylation.

Some protein kinases affected growth and development

To verify whether the protein kinases also influenced growth and development, the growth of the mutant strains was quantified by dry weight and the development analysed in samples collected at early times of growth in liquid cultures. Growth results are shown in Supplementary Figure S1 and the results showed that some mutants had a reduced ability to grow, such as the strains Ncsnf1KO and NcnimAKO, and only NCU08177KO showed a delay in conidia germination at early times (Figure 6A). However, conidia of this strain showed complete germination at 8 h, indicating that the low germination in the early stages of growth was not due to impaired conidial viability. Nuclei from this strain were analysed during conidia germination and the results showed changes in nuclear morphology and the dynamics of nuclear divisions (Figure 6B), suggesting that this kinase influences the cell cycle regulation.

Conidia germination in the mutant strain NCU08177KO

Figure 6
Conidia germination in the mutant strain NCU08177KO

(A) Conidia (107/ml) from wild-type and mutant strains were inoculated into liquid VM medium plus 2% sucrose and aliquots were collected at the indicated times. Images were obtained using the microscope Axio Imager.A2 (Zeiss) with ×40 magnification. (B) Conidia were inoculated on to a coverslip, grown in liquid VM medium plus 2% sucrose for different times, and stained with DAPI. Images were obtained using the microscope Axio Imager.A2 with ×100 magnification.

Figure 6
Conidia germination in the mutant strain NCU08177KO

(A) Conidia (107/ml) from wild-type and mutant strains were inoculated into liquid VM medium plus 2% sucrose and aliquots were collected at the indicated times. Images were obtained using the microscope Axio Imager.A2 (Zeiss) with ×40 magnification. (B) Conidia were inoculated on to a coverslip, grown in liquid VM medium plus 2% sucrose for different times, and stained with DAPI. Images were obtained using the microscope Axio Imager.A2 with ×100 magnification.

DISCUSSION

The sequencing of the N. crassa genome allowed the construction of a collection of mutant strains, with each strain deleted in a gene encoding a protein kinase. In the present study, this collection was used to perform an investigation aimed at identifying the protein kinases that regulate glycogen metabolism. To pursue this goal, we quantified the carbohydrate levels during vegetative growth and also under a stress condition such as heat shock. The amount of glycogen found in a particular situation results from a balance between the activities of GSN and those of glycogen phosphorylase. These enzymes regulate glycogen synthesis and degradation, respectively, and they are both regulated by phosphorylation and allosterism, in which phosphorylation activates glycogen phosphorylase and inhibits GSN [4]. There are multiple phosphorylation sites in GSN, which is supposed to be the main control point, whereas glycogen phosphorylase is phosphorylated in a single residue. A number of protein kinases were identified in the present study as regulators of glycogen metabolism, which also control trehalose accumulation, another reserve carbohydrate. Some mutant strains accumulated low levels of glycogen, and one mutant strain (NCU08177KO) was unable to accumulate glycogen during growth. This strain also showed impaired cell cycle regulation, suggesting that glycogen levels might be connected to cell cycle progression. We identified protein kinases that may regulate glycogen metabolism either through gdn gene expression or by GSN post-translational modification via phosphorylation. However, additional regulatory pathways may be linked to glycogen metabolism regulation.

A number of proteins identified in our screen were previously described in the control of glycogen accumulation in different organisms, which validated our screen. These include NcSNF1, NcPHO85, NcGSK3, NcPKA, the PSK2 homologue and NcATG1 proteins. However, we did not identify some other protein kinases already described as regulators of glycogen metabolism, such as the NDR kinase DBF-2 in N. crassa [15] and S. cerevisiae [39]. Another protein not identified in our screen is Rim15p, a kinase that acts downstream of PKA, the yeast mutant of which exhibits defects in glycogen and trehalose accumulation [40]. A series of protein kinases identified by Wilson et al. [39], in a screening of a strain deletion set implicated in glycogen metabolism regulation in yeast, was not identified either. We may speculate that the strategy used in this work, quantification of glycogen accumulated at a specific time (24 h of growth), impaired the identification of such kinases in our screen. On the other hand, we identified two protein kinases functionally characterized but with no known functions related to glycogen metabolism regulation. One is the protein NcIME-2, the knockout strain of which showed lower glycogen levels and higher glycogen synthase±G6P activity ratio than the wild-type strain. This protein kinase was first identified in S. cerevisiae as required in the meiotic cell cycle, but more recent studies revealed that this kinase displays multiple cellular functions beyond meiosis [41]. In N. crassa, NcIME-2 was demonstrated to be involved in the inhibition of protoperithecia formation under low availability of nitrogen. Microarray analysis revealed that this kinase regulates, under nitrogen starvation conditions, genes involved in a variety of cellular functions, including metabolism [36]. In present study, we demonstrated that the ime-2KO strain exhibited a GSN±G6P activity ratio higher than that of the wild-type strain, although this enzyme was not predicted to be an NcIME-2 phosphorylation target, as described by Hutchison et al. [36]. The other one is the NcNIMA (never-in-mitosis A) protein kinase, first identified in Aspergillus nidulans as required for the mitotic entry causing G2 arrest [42]. More recently, this kinase was demonstrated to regulate interphase microtubules, indicating that it could integrate cell growth and development with mitotic regulation in A. nidulans [43]. In N. crassa, NIMA was demonstrated in the present study to regulate glycogen metabolism; the nimAKO strain accumulated higher levels of glycogen at the early phase of vegetative growth when the cells are actively engaged in mitotic division and degrade glycogen at later times of growth. Together with NcPHO85, a kinase involved in cell cycle progression, the identification of NcNIMA led us to speculate that the energy provided by glycogen metabolism could be connected to cell growth and development in N. crassa.

NcSNF1 as a kinase that promotes GSN phosphorylation

We demonstrated in the present study that the Ncsnf1KO strain accumulated higher levels of glycogen compared with the wild-type strain. The result was corroborated by a combination of assays including the higher GSN±G6P activity ratio, which means less phosphorylated GSN and therefore more active enzyme, and less phosphorylated GSN isoforms. Altogether, this led us to conclude that, in the wild-type strain, the NcSNF1 kinase promotes phosphorylation of glycogen synthase either directly or indirectly by inactivating a phosphatase or activating another kinase, or both. This protein kinase was identified in S. cerevisiae as a protein required for growth on a less preferred carbon source, such as sucrose [44]. Together with AMPK, the mammalian homologue, this kinase has been extensively characterized in different organisms and, besides its role in carbon repression, it is described as regulating the expression of a large set of genes by phosphorylation of either transcription factors or metabolic enzymes, or regulation of transcription by a chromatin-based mechanism [45,46]. The role of the S. cerevisiae Snf1p in the regulation of glycogen metabolism was reported for the first time by Hardy et al. [32]. Yeast snf1 mutants are not able to accumulate glycogen, which correlated with hyperphosphorylation of Gsy2p, as shown by the low±G6P activity ratio. Snf1 is also required to maintain glycogen stores [33]. What could explain the opposite results between yeast and N. crassa with regard to glycogen metabolism regulation by NcSNF1? Members of the SNF1/AMPK family are heterotrimers composed of a catalytic α (Snf1 in yeast), and regulatory β (Gal83, Sip1 or Sip2 in yeast) and γ (Snf4 in yeast) subunits [38]. In N. crassa, the products of the ORFs NCU03837, annotated as the Snf1 kinase complex β-subunit Gal83, and NCU01471, annotated as nuclear protein SNF4, are the β- and γ-subunit orthologous proteins, respectively. The β subunits control the subcellular localization of Snf1 [47] and probably control access of the kinase to different substrates. Gal83 and Sip2 contain a conserved glycogen-binding domain (GBD) and bind glycogen in vivo [48]. The ORF NCU03837 product is a protein with a GBD [48]. Although its ability to bind glycogen has not been demonstrated yet, the domain has several conserved amino acid residues at key positions, which led us to suppose that the protein is able to bind glycogen. The SNF1/AMPK proteins are described as being activated via phosphorylation by upstream kinases and dephosphorylated by protein phosphatases [38]. A blast search using the yeast protein kinases homologues as a query in the N. crassa genome database retrieved the ORF NCU06177 and NCU03523 products. The glycogen accumulated by the NCU06177KO strain during growth was similar to the wild-type strain whereas the levels in the NCU03523KO strain were closer to those in the Ncsnf1KO strain. These results led us to conclude that NcSNF1 may be phosphorylated by the NCU03523 product. We therefore identified a putative kinase that activates NcSNF1 by phosphorylation; however, the NcSNF1 activation may not correlate with GSN phosphorylation.

In addition to phosphorylation control on Gsy2p, the S. cerevisiae Snf1 also controls glycogen accumulation by regulating the expression of the GSN gene (GSY2); gene expression in a snf1 strain was approximately 50% of the wild-type level [32]. In N. crassa, we demonstrated in the present study that GSN expression was not regulated by NcSNF1, although it did regulate the gene encoding the debranching enzyme (gdn). The findings described in the present study support a role for NcSNF1 in regulating glycogen accumulation in N. crassa through GSN phosphorylation, but the molecular mechanisms are unexpectedly different from those described in yeast. More work will be necessary to elucidate how the regulatory pathway involving NcSNF1 functions in the regulation of glycogen metabolism in N. crassa.

We thank Dr Peter J. Roach, Indiana University School of Medicine, Indianapolis, IN, U.S.A. for reviewing the manuscript and Dr Rubens Monti, Faculdade de Ciências Farmacêuticas, UNESP, Araraquara for help in trehalose quantification.

Abbreviations

     
  • AMPK

    AMP-activated protein kinase

  •  
  • CaMK

    Ca2+/calmodulin-dependent protein kinase

  •  
  • G6P

    glucose 6-phosphate

  •  
  • GBD

    glycogen-binding domain

  •  
  • GSN

    glycogen synthase

  •  
  • IEF

    isoelectric focusing

  •  
  • MAPK

    mitogen-activated protein kinase

  •  
  • PKA

    protein kinase A

  •  
  • TLCK

    tosyl-L-lysine chloromethyl ketone

  •  
  • VM

    Vogel’s minimal

AUTHOR CONTRIBUTION

Thiago de Souza Candido and Ana Paula Felício performed the screening of the mutant strains. Thiago de Souza Candido quantified the glycogen synthase activity under the supervision of Fernanda Zanolli Freitas and performed the 2D-PAGE experiments together with Ana Paula Felício. Rodrigo Duarte Gonçalves performed the experiments for trehalose and glycogen accumulation during growth and Fernanda Barbosa Cupertino carried out the gene expression analysis. Thiago de Souza Candido and Ana Carolina Gomes Vieira de Carvalho carried out the microscopic experiments. Maria Célia Bertolini co-ordinated the study and wrote the paper.

FUNDING

This work was supported by Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP) and Conselho Nacional de Desenvolvimento Científico e Tecnológico (CNPq) by grants to M.C.B. T.S.C. is a graduate fellow from FAPESP, F.B.C. and F.Z.F. are postdoctoral fellows from FAPESP, R.D.G. is a postdoctoral fellow from CNPq, A.P.F. was a postdoctoral fellow from CNPq, A.C.G.V.C. was an undergraduate fellow from FAPESP and M.C.B. is a CNPq fellow.

References

References
1
Roach
 
P. J.
Depaoli-Roach
 
A. A.
Hurley
 
T. D.
Tagliabracci
 
V. S.
 
Glycogen and its metabolism: some new developments and old themes
Biochem. J.
2012
, vol. 
441
 (pg. 
763
-
787
)
[PubMed]
2
Bertolini
 
M. C.
Freitas
 
F. Z.
de Paula
 
R. M.
Cupertino
 
F. B.
Gonçalves
 
R. D.
 
Witzany
 
G.
 
Glycogen metabolism regulation in Neurospora crassa
Biocommunication of Fungi
2012
Berlin
Springer
(pg. 
39
-
55
)
3
Wilson
 
W. A.
Roach
 
P. J.
Montero
 
M.
Baroja-Fernández
 
E.
Muñoz
 
F. J.
Eydallin
 
G.
Viale
 
A. M.
Pozueta-Romero
 
J.
 
Regulation of glycogen metabolism in yeast and bacteria
FEMS Microbiol. Rev.
2010
, vol. 
34
 (pg. 
952
-
985
)
[PubMed]
4
Téllez-Iñón
 
M. T.
Terenzi
 
H.
Torres
 
H. N.
 
Interconvertible forms of glycogen synthetase in Neurospora crassa
Biochim. Biophys. Acta
1969
, vol. 
191
 (pg. 
765
-
768
)
[PubMed]
5
Rothman-Denes
 
L. B.
Cabib
 
E.
 
Glucose-6-phosphate dependent and independent forms of yeast glycogen synthetase: their properties and interconversions
Biochemistry
1971
, vol. 
10
 (pg. 
1236
-
1242
)
[PubMed]
6
Roach
 
P. J.
Skurat
 
A. V.
Harris
 
R. A.
 
Jefferson
 
L. S.
Cherrington
 
A. D.
 
Regulation of glycogen metabolism
Handbook of Physiology: the Endocrine Pancreas and Regulation of Metabolism, vol. II
2001
Oxford
Oxford University Press
(pg. 
609
-
647
)
7
Roach
 
P. J.
 
Control of glycogen synthase by hierarchal protein phosphorylation
FASEB J.
1990
, vol. 
4
 (pg. 
2961
-
2968
)
[PubMed]
8
Rutter
 
J.
Probst
 
B. L.
McKnight
 
S. L.
 
Coordinate regulation of sugar flux and translation by PAS kinase
Cell
2002
, vol. 
111
 (pg. 
17
-
28
)
[PubMed]
9
Huang
 
D.
Moffat
 
J.
Wilson
 
W. A.
Moore
 
L.
Cheng
 
C.
Roach
 
P. J.
Andrews
 
B.
 
Cyclin partners determine Pho85 protein kinase substrate specificity in vitro and in vivo: control of glycogen biosynthesis by Pcl8 and Pcl10
Mol. Cell. Biol.
1998
, vol. 
18
 (pg. 
3289
-
3299
)
[PubMed]
10
Galagan
 
J. E.
Calvo
 
S. E.
Borkovich
 
K. A.
Selker
 
E. U.
Read
 
N. D.
Jaffe
 
D.
FitzHugh
 
W.
Ma
 
L. J.
Smirnov
 
S.
Purcell
 
S.
, et al 
The genome sequence of the filamentous fungus Neurospora crassa
Nature
2003
, vol. 
422
 (pg. 
859
-
868
)
[PubMed]
11
Gonçalves
 
R. D.
Cupertino
 
F. B.
Freitas
 
F. Z.
Luchessi
 
A. D.
Bertolini
 
M. C.
 
A genome-wide screen for Neurospora crassa transcription factors regulating glycogen metabolism
Mol. Cell. Proteomics
2011
, vol. 
10
 pg. 
M111.007963
 
[PubMed]
12
Blom
 
N.
Sicheritz-Pontén
 
T.
Gupta
 
R.
Gammeltoft
 
S.
Brunak
 
S.
 
Prediction of post-translational glycosylation and phosphorylation of proteins from the amino acid sequence
Proteomics
2004
, vol. 
4
 (pg. 
1633
-
1649
)
[PubMed]
13
Dickman
 
M. B.
Yarden
 
O.
 
Serine/threonine protein kinases and phosphatases in filamentous fungi
Fungal Genet. Biol.
1999
, vol. 
26
 (pg. 
99
-
117
)
[PubMed]
14
Park
 
G.
Servin
 
J. A.
Turner
 
G. E.
Altamirano
 
L.
Colot
 
H. V.
Collopy
 
P.
Litvinkova
 
L.
Li
 
L.
Jones
 
C. A.
Diala
 
F. G.
, et al 
Global analysis of serine-threonine protein kinase genes in Neurospora crassa
Eukaryot. Cell
2011
, vol. 
10
 (pg. 
1553
-
1564
)
[PubMed]
15
Dvash
 
E.
Kra-Oz
 
G.
Ziv
 
C.
Carmeli
 
S.
Yarden
 
O.
 
The NDR kinase DBF-2 is involved in regulation of mitosis, conidial development, and glycogen metabolism in Neurospora crassa
Eukaryot. Cell
2010
, vol. 
9
 (pg. 
502
-
513
)
[PubMed]
16
Harvey
 
K.
Tapon
 
N.
 
The Salvador–Warts–Hippo pathway: an emerging tumour-suppressor network
Nat. Rev. Cancer
2007
, vol. 
7
 (pg. 
182
-
191
)
[PubMed]
17
Lichius
 
A.
Lord
 
K. M.
Jeffree
 
C. E.
Oborny
 
R.
Boonyarungsrit
 
P.
Read
 
N. D.
 
Importance of MAP kinases during protoperithecial morphogenesis in Neurospora crassa
PLoS ONE
2012
, vol. 
7
 pg. 
e42565
 
[PubMed]
18
McCluskey
 
K.
 
The Fungal Genetics Stock Center: from molds to molecules
Adv. Appl. Microbiol.
2003
, vol. 
52
 (pg. 
245
-
262
)
[PubMed]
19
Colot
 
H. V.
Park
 
G.
Turner
 
G. E.
Ringelberg
 
C.
Crew
 
C. M.
Litvinkova
 
L.
Weiss
 
R. L.
Borkovich
 
K. A.
Dunlap
 
J. C.
 
A high-throughput gene knockout procedure for Neurospora reveals functions for multiple transcription factors
Proc. Natl. Acad. Sci. U.S.A.
2006
, vol. 
103
 (pg. 
10352
-
10357
)
[PubMed]
20
Vogel
 
H. J.
 
A convenient growth medium for Neurospora crassa (medium N)
Microbiol. Genet. Bull.
1956
, vol. 
13
 (pg. 
42
-
43
)
21
Hardy
 
T. A.
Roach
 
P. J.
 
Control of yeast glycogen synthase-2 by COOH-terminal phosphorylation
J. Biol. Chem.
1993
, vol. 
268
 (pg. 
23799
-
23805
)
[PubMed]
22
Hartree
 
E. F.
 
Determination of protein: a modification of the Lowry method that gives a linear photometric response
Anal. Biochem.
1972
, vol. 
48
 (pg. 
422
-
427
)
[PubMed]
23
Neves
 
M. J.
Jorge
 
J. A.
François
 
J. M.
Terenzi
 
H. F.
 
Effects of heat shock on the level of trehalose and glycogen, and on the induction of thermotolerance in Neurospora crassa
FEBS Lett.
1991
, vol. 
183
 (pg. 
19
-
22
)
24
Zimmermann
 
N. A.
Terenzi
 
H. F.
Jorge
 
J. A.
 
Purification and properties of an extracellular conidial trehalase from Humicola grisea var. thermoidea
Biochim. Biophys. Acta
1990
, vol. 
1036
 (pg. 
41
-
46
)
[PubMed]
25
Thomas
 
J. A.
Schlender
 
K. K.
Larner
 
J.
 
A rapid filter paper assay for UDPglucose-glycogen glucosyltransferase, including as improved biosynthesis of UDP-14C-glucose
Anal. Biochem.
1968
, vol. 
25
 (pg. 
486
-
499
)
[PubMed]
26
Sokolovsky
 
V.
Kaldenhoff
 
R.
Ricci
 
M.
Russo
 
V. E. A.
 
Fast and reliable mini-prep RNA extraction from Neurospora crassa
Fungal Genet. Newslett.
1990
, vol. 
37
 (pg. 
41
-
43
)
27
de Paula
 
R.
de Pinho
 
C. A.
Terenzi
 
H. F.
Bertolini
 
M. C.
 
Cloning and molecular characterization of the gsn cDNA encoding glycogen synthase in Neurospora crassa
Mol. Genet. Genomics
2002
, vol. 
267
 (pg. 
241
-
253
)
[PubMed]
28
Noventa-Jordão
 
M. A.
Polizeli
 
M. L. T. M.
Bonini
 
B. M.
Jorge
 
J. A.
Terenzi
 
H. F.
 
Effects of temperature shifts on the activities of Neurospora crassa glycogen synthase, glycogen phosphorylase and trehalose-6-phosphate synthase
FEBS Lett.
1996
, vol. 
378
 (pg. 
32
-
36
)
[PubMed]
29
Wilson
 
W. A.
Mahrenholz
 
A. M.
Roach
 
P. J.
 
Substrate targeting of the yeast cyclin-dependent kinase Pho85p by the cyclin Pcl10p
Mol. Cell. Biol.
1999
, vol. 
19
 (pg. 
7020
-
7030
)
[PubMed]
30
Zhang
 
W.
DePaoli-Roach
 
A. A.
Roach
 
P. J.
 
Mechanisms of multisite phosphorylation and inactivation of rabbit muscle glycogen synthase
Arch. Biochem. Biophys.
1993
, vol. 
304
 (pg. 
219
-
225
)
[PubMed]
31
Freitas
 
F. Z.
de Paula
 
R. M.
Barbosa
 
L. C.
Terenzi
 
H. F.
Bertolini
 
M. C.
 
cAMP signaling pathway controls glycogen metabolism in Neurospora crassa by regulating the glycogen synthase gene expression and phosphorylation
Fungal Genet. Biol.
2010
, vol. 
47
 (pg. 
43
-
52
)
[PubMed]
32
Hardy
 
T. A.
Huang
 
D.
Roach
 
P. J.
 
Interactions between cAMP-dependent and SNF1 protein kinases in the control of glycogen accumulation in Saccharomyces cerevisiae
J. Biol. Chem.
1994
, vol. 
269
 (pg. 
27907
-
27913
)
[PubMed]
33
Wang
 
Z.
Wilson
 
W. A.
Fujino
 
M. A.
Roach
 
P. J.
 
Antagonistic controls of autophagy and glycogen accumulation by Snf1p, the yeast homolog of AMP-activated protein kinase, and the cyclin-dependent kinase Pho85p
Mol. Cell. Biol.
2001
, vol. 
21
 (pg. 
5742
-
5752
)
[PubMed]
34
Matsuura
 
A.
Tsukada
 
M.
Wada
 
Y.
Ohsumi
 
Y.
 
Apg1p, a novel protein kinase required for the autophagic process in Saccharomyces cerevisiae
Gene
1997
, vol. 
192
 (pg. 
245
-
250
)
[PubMed]
35
Smith
 
H. E.
Mitchell
 
A. P.
 
A transcriptional cascade governs entry into meiosis in Saccharomyces cerevisiae
Mol. Cell. Biol.
1989
, vol. 
9
 (pg. 
2142
-
2152
)
[PubMed]
36
Hutchison
 
E. A.
Bueche
 
J. A.
Glass
 
N. L.
 
Diversification of a protein kinase cascade: IME-2 is involved in nonself recognition and programmed cell death in Neurospora crassa
Genetics
2012
, vol. 
192
 (pg. 
467
-
482
)
[PubMed]
37
Pu
 
R. T.
Xu
 
G.
Wu
 
L.
Vierula
 
J.
O’Donnell
 
K.
Ye
 
X. S.
Osmani
 
S. A.
 
Isolation of a functional homolog of the cell cycle-specific NIMA protein kinase of Aspergillus nidulans and functional analysis of conserved residues
J. Biol. Chem.
1995
, vol. 
270
 (pg. 
18110
-
18116
)
[PubMed]
38
Ghillebert
 
R.
Swinnen
 
E.
Wen
 
J.
Vandesteene
 
L.
Ramon
 
M.
Norga
 
K.
Rolland
 
F.
Winderickx
 
J.
 
The AMPK/SNF1/SnRK1 fuel gauge and energy regulator: structure, function and regulation
FEBS J.
2011
, vol. 
278
 (pg. 
3978
-
3990
)
[PubMed]
39
Wilson
 
W. A.
Wang
 
Z.
Roach
 
P. J.
 
Systematic identification of the genes affecting glycogen storage in the yeast Saccharomyces cerevisiae: implication of the vacuole as a determinant of glycogen level
Mol. Cell. Proteomics
2002
, vol. 
1
 (pg. 
232
-
242
)
[PubMed]
40
Reinders
 
A.
Bürckert
 
N.
Boller
 
T.
Wiemken
 
A.
De Virgilio
 
C.
 
Saccharomyces cerevisiae cAMP-dependent protein kinase controls entry into stationary phase through the Rim15p protein kinase
Genes Dev.
1998
, vol. 
12
 (pg. 
2943
-
2955
)
[PubMed]
41
Irniger
 
S.
 
The Ime2 protein kinase family in fungi: more duties than just meiosis
Mol. Microbiol.
2011
, vol. 
80
 (pg. 
1
-
13
)
[PubMed]
42
Oakley
 
B. R.
Morris
 
N. R.
 
A mutation in Aspergillus nidulans that blocks the transition from interphase to prophase
J. Cell Biol.
1983
, vol. 
96
 (pg. 
1155
-
1158
)
[PubMed]
43
Govindaraghavan
 
M.
McGuire Anglin
 
S. L.
Shen
 
K. F.
Shukla
 
N.
De Souza
 
C. P.
Osmani
 
S. A.
 
Identification of interphase functions for the NIMA kinase involving microtubules and the ESCRT pathway
PLoS Genet.
2014
, vol. 
10
 pg. 
e1004248
 
[PubMed]
44
Carlson
 
M.
Osmond
 
B. C.
Botstein
 
D.
 
Mutants of yeast defective in sucrose utilization
Genetics
1981
, vol. 
98
 (pg. 
25
-
40
)
[PubMed]
45
Hedbacker
 
K.
Carlson
 
M.
 
SNF1/AMPK pathways in yeast
Front. Biosci.
2008
, vol. 
13
 (pg. 
2408
-
2420
)
[PubMed]
46
Zhang
 
M.
Galdieri
 
L.
Vancura
 
A.
 
The Yeast AMPK homolog SNF1 regulates acetyl coenzyme A homeostasis and histone acetylation
Mol. Cell. Biol.
2013
, vol. 
33
 (pg. 
4701
-
4717
)
[PubMed]
47
Vincent
 
O.
Townley
 
R.
Kuchin
 
S.
Carlson
 
M.
 
Subcellular localization of the Snf1 kinase is regulated by specific beta subunits and a novel glucose signaling mechanism
Genes Dev.
2001
, vol. 
15
 (pg. 
1104
-
1114
)
[PubMed]
48
Wiatrowski
 
H. A.
Van Denderen
 
B. J.
Berkey
 
C. D.
Kemp
 
B. E.
Stapleton
 
D.
Carlson
 
M.
 
Mutations in the gal83 glycogen-binding domain activate the snf1/gal83 kinase pathway by a glycogen-independent mechanism
Mol. Cell. Biol.
2004
, vol. 
24
 (pg. 
352
-
361
)
[PubMed]

Supplementary data