POLH (DNA polymerase η), a target of p53 tumour suppressor, plays a key role in TLS (translesion DNA synthesis). Loss of POLH is responsible for the human cancer-prone syndrome XPV (xeroderma pigmentosum variant). Owing to its critical role in DNA repair and genome stability, POLH expression and activity are regulated by multiple pathways. In the present study, we found that the levels of both POLH transcript and protein were decreased upon knockdown of the transcript encoding PCBP1 [poly(rC)-binding protein 1]. We also found that the half-life of POLH mRNA was markedly decreased upon knockdown of PCBP1. Moreover, we found that PCBP1 directly bound to the POLH 3′-UTR and the PCBP1-binding site in POLH mRNA is an atypical AU-rich element. Finally, we showed that the AU-rich element in POLH 3′-UTR was responsive to PCBP1 and sufficient for PCBP1 to regulate POLH expression. Taken together, we uncovered a novel mechanism by which POLH expression is controlled by PCBP1 via mRNA stability.

INTRODUCTION

POLH (DNA polymerase η), a member of the Y-family DNA polymerases, is necessary for repair of DNA lesions induced by UV irradiation and carcinogens via TLS (translesion DNA synthesis) [16]. POLH can accurately repair CPDs (cyclobutane pyrimidine dimers), pyrimidine (6-4) pyrimidone photoadducts, cPus (8,5′-cyclopurine-2′-deoxynucleosides) and 8-oxoG (7,8-dihydro-8-oxoguanine) caused by UV irradiation or oxidative stress [711]. Upon DNA damage, POLH can be recruited to the sites of replication fork stalling by interacting with FANCD2 and PCNA [1214]. Mutation of the POLH gene is associated with the human syndrome XPV (xeroderma pigmentosum variant) [1517]. XPV patients are prone to skin cancer [1820]. Consistently, repression of POLH expression is observed in various types of skin cancer [18]. In addition to its role in TLS, POLH is necessary for hypermutation of immunoglobulin genes [21,22] and for maintenance of genome stability [2326].

POLH expression is found to be regulated by multiple mechanisms, including transcriptional regulation by DNA damage in a p53-dependent manner [25], and protein stability by Pirh2 and Mdm2 E3 ligases [27,28]. Caenorhabditis elegans POLH is targeted for proteasomal degradation upon SUMOylation by the Cul4/Ddb1/Cdt2 pathway [29]. Additionally, the enzymatic activity of POLH is regulated by post-translational modifications, such as SUMOylation and monoubiquitination [30,31]. In the present study, we found that POLH expression is regulated by PCBP1 [poly(rC)-binding protein 1; also called hnRNP E1 (heterogeneous nuclear ribonucleoprotein E1) or α-CP1] via mRNA stability. We also found that PCBP1 directly binds to POLH 3′-UTR. Interestingly, we found that an ARE (AU-rich element) in POLH mRNA is recognized by and responsive to PCBP1, although several PCBP1-binding sites are CU-rich elements or oligo(rC) elements [3235]. Taken together, we uncovered a novel mechanism by which POLH expression is regulated by PCBP1 via mRNA stability.

EXPERIMENTAL

Cell culture

Human pancreatic cancer cell line MIA-PaCa2, human colon cancer cell line p53−/− HCT116, human cervical carcinoma cell line ME180 and human breast cancer cell line MCF7 were cultured in Dulbecco's modified Eagle's medium (Invitrogen) with 10% FBS (Hyclone) and maintained at 37°C in a 5% CO2 incubator.

Plasmids

Lentiviral vectors (pLKO.1-puro) expressing shRNA targeting luciferase and PCBP1 were purchased from Sigma. The targeting sequences are 5′-CGCTGAGTACTTCGAAATGTC-3′ for control luciferase shRNA and 5′-CCCATGATCCAACTGTGTAAT-3′ (shPCBP1) or 5′-GCTCCTCTGGTAGGCAGGTTACT-3′ (shPCBP1*) for PCBP1 shRNA. pGEX-4T-3 plasmid was used to express GST and GST-fused PCBP1 proteins as described previously [36]. To generate the mutant p53(R175H) reporter vector, the DNA fragments amplified from POLH 3′-UTR were digested with XhoI and NheI and then ligated into pcDNA3-p53(R175H) vector [25] cut by XhoI and XbaI. The primers used for amplification of POLH 3′-UTR are listed in Table 1. Plasmid RP11-22I24 (BACPAC Resources, Children's Hospital and Research Center at Oakland, CA, U.S.A.), which carries the POLH locus, was used as a template to amplify POLH 3′-UTR.

Table 1
Primers used in the present study

F, forward; R, reverse.

(a) Primers for reverse transcription–PCR 
Primer name Sequence (5′→3′) 
POLH-exo4-F TCGAGCCATTGAAATAAGCC 
POLH-exo5-R ACAAGGTCAGCCTATCTCGG 
Actin-exo3-F CTGAAGTACCCCATCGAGCACGGCA 
Actin-exo4-R GGATAGCACAGCCTGGATAGCAACG 
PCBP1-F GGCGGGTGTAAGATCAAAGA 
PCBP1-R GAGCGGAGAAATGGTGTGTT 
p63-1751-F GAGGTTGGGCTGTTCATCAT 
p63-2023-R GTGAATCGCACAGCATCAAT 
ΔNp63-153-F GGAAAACAATGCCCAGACTC 
ΔNp63-513-R TGGGGTCATCACCTTGATCT 
(b) Primers for generation of reporter vectors 
Primer name Sequence (5′→3′) 
POLH-XhoI-2447-F ATCGCTCGAGTGCTGCCCTCAGGCTTGCCTGTAGGATTTA 
POLH-NheI-8412-R ATCGGCTAGCTATTGTACAGAATAAAAATGTTTTATTGAATAC 
POLH-NheI-3607-R ATCGGCTAGCCCTGACGACAGAGGGAGA 
POLH-XhoI-3515-F ATGCCTCGAGAATGTAATGAGACTTGCATAGTT 
POLH-NheI-4619-R ATCGGCTAGCTGCCCTAGTTACCATATCACTT 
POLH-XhoI-4580-F ATCGCTCGAGGAAGCCTTGAAACCCTAAA 
POLH-NheI-5879-R ATCGGCTAGCCACCTGGTCATTAGTATCTTTTAG 
POLH-XhoI-5843-F ATCGCTCGAGGAGAAATGCTGATCTAAAAGA 
POLH-NheI-7177-R ATCGGCTAGCGATTCAGGTGATCCTCCC 
POLH-XhoI-7032-F ATGCCTCGAGGAGGTGGGTGGACTACTGGA 
POLH-NheI-2723-R ATCGGCTAGCCAAGGCCCACACACTTTTTA 
POLH-XhoI2447-2471-F ATCGCTCGAGTGCTGCCCTCAGGCTTGCCTGTAGG 
(c) Primers for generation of REMSA RNA probes 
Primer name Sequence (5′→3′) 
POLH-2447-T7-F GGATCCTAATACGACTCACTATAGGGAGTGCTGCCCTCAGGCTTGCCTG 
POLH-3607-R CCTGACGACAGAGGGAGA 
POLH-3515-T7-F GGATCCTAATACGACTCACTATAGGGAGAATGTAATGAGACTTGCATAGTT 
POLH-4619-R TGCCCTAGTTACCATATCACTT 
POLH-4580-T7-F GGATCCTAATACGACTCACTATAGGGAGGAAGCCTTGAAACCCTAAA 
POLH-5879-R CACCTGGTCATTAGTATCTTTTAG 
POLH-5843-T7-F GGATCCTAATACGACTCACTATAGGGAGGAGAAATGCTGATCTAAAAGA 
POLH-7177-R GATTCAGGTGATCCTCCC 
POLH-7032-T7-F GGATCCTAATACGACTCACTATAGGGAGGAGGTGGGTGGACTACTGGA 
POLH-8412-R TATTGTACAGAATAAAAATGTT 
POLH-2964-R GGCTGGTCTCAAACTCCTGA 
POLH-2945-T7-F GGATCCTAATACGACTCACTATAGGGAGTCAGGAGTTTGAGACCAGCC 
POLH-2723-R CAAGGCCCACACACTTTTTA 
POLH-2704-T7-F GGATCCTAATACGACTCACTATAGGGAGTAAAAAGTGTGTGGGCCTTG 
POLH-2587-R TCAGCACCTAAATGGATTATTTTT 
POLH-2564-T7-F GGATCCTAATACGACTCACTATAGGGAGAAAAATAATCCATTTAGGTGCTGA 
T7-deltaARE-A-F GGATCCTAATACGACTCACTATAGGGAGTGCTGCCCTCAGGCTTGCCTGTAGGCAGATCTTTATCTTTAATAT 
T7-deltaARE-B-F GGATCCTAATACGACTCACTATAGGGAGTGCTGCCCTCAGGCTTGCCTGTAGGATTTAATATTTTTTATCTTTACAGATCTCAGATTTCCCTGAGAAAG 
T7-deltaARE-AB-F GGATCCTAATACGACTCACTATAGGGAGTGCTGCCCTCAGGCTTGCCTGTAGGCAGATCTCAGATTTCCCTGAGAAAGGGAAT 
POLH-ARE-A-t2a-F TGCTGCCCTCAGGCTTGCCTGTAGGAAAAAAAAAAAAAAAACAAAACAGATCTTTATCTTTAATATTTTATCTTTACAGATTTCCCTGAGAAAG 
POLH-ARE-B-t2a-F TGCTGCCCTCAGGCTTGCCTGTAGGATTTAATATTTTTTATCTTTACAGATCTAAAACAAAAAAAAAAAAACAAAACAGATTTCCCTGAGAAAG 
T7-POLH-2447-2467-F GGATCCTAATACGACTCACTATAGGGAGTGCTGCCCTCAGGCTTGCCTG 
(a) Primers for reverse transcription–PCR 
Primer name Sequence (5′→3′) 
POLH-exo4-F TCGAGCCATTGAAATAAGCC 
POLH-exo5-R ACAAGGTCAGCCTATCTCGG 
Actin-exo3-F CTGAAGTACCCCATCGAGCACGGCA 
Actin-exo4-R GGATAGCACAGCCTGGATAGCAACG 
PCBP1-F GGCGGGTGTAAGATCAAAGA 
PCBP1-R GAGCGGAGAAATGGTGTGTT 
p63-1751-F GAGGTTGGGCTGTTCATCAT 
p63-2023-R GTGAATCGCACAGCATCAAT 
ΔNp63-153-F GGAAAACAATGCCCAGACTC 
ΔNp63-513-R TGGGGTCATCACCTTGATCT 
(b) Primers for generation of reporter vectors 
Primer name Sequence (5′→3′) 
POLH-XhoI-2447-F ATCGCTCGAGTGCTGCCCTCAGGCTTGCCTGTAGGATTTA 
POLH-NheI-8412-R ATCGGCTAGCTATTGTACAGAATAAAAATGTTTTATTGAATAC 
POLH-NheI-3607-R ATCGGCTAGCCCTGACGACAGAGGGAGA 
POLH-XhoI-3515-F ATGCCTCGAGAATGTAATGAGACTTGCATAGTT 
POLH-NheI-4619-R ATCGGCTAGCTGCCCTAGTTACCATATCACTT 
POLH-XhoI-4580-F ATCGCTCGAGGAAGCCTTGAAACCCTAAA 
POLH-NheI-5879-R ATCGGCTAGCCACCTGGTCATTAGTATCTTTTAG 
POLH-XhoI-5843-F ATCGCTCGAGGAGAAATGCTGATCTAAAAGA 
POLH-NheI-7177-R ATCGGCTAGCGATTCAGGTGATCCTCCC 
POLH-XhoI-7032-F ATGCCTCGAGGAGGTGGGTGGACTACTGGA 
POLH-NheI-2723-R ATCGGCTAGCCAAGGCCCACACACTTTTTA 
POLH-XhoI2447-2471-F ATCGCTCGAGTGCTGCCCTCAGGCTTGCCTGTAGG 
(c) Primers for generation of REMSA RNA probes 
Primer name Sequence (5′→3′) 
POLH-2447-T7-F GGATCCTAATACGACTCACTATAGGGAGTGCTGCCCTCAGGCTTGCCTG 
POLH-3607-R CCTGACGACAGAGGGAGA 
POLH-3515-T7-F GGATCCTAATACGACTCACTATAGGGAGAATGTAATGAGACTTGCATAGTT 
POLH-4619-R TGCCCTAGTTACCATATCACTT 
POLH-4580-T7-F GGATCCTAATACGACTCACTATAGGGAGGAAGCCTTGAAACCCTAAA 
POLH-5879-R CACCTGGTCATTAGTATCTTTTAG 
POLH-5843-T7-F GGATCCTAATACGACTCACTATAGGGAGGAGAAATGCTGATCTAAAAGA 
POLH-7177-R GATTCAGGTGATCCTCCC 
POLH-7032-T7-F GGATCCTAATACGACTCACTATAGGGAGGAGGTGGGTGGACTACTGGA 
POLH-8412-R TATTGTACAGAATAAAAATGTT 
POLH-2964-R GGCTGGTCTCAAACTCCTGA 
POLH-2945-T7-F GGATCCTAATACGACTCACTATAGGGAGTCAGGAGTTTGAGACCAGCC 
POLH-2723-R CAAGGCCCACACACTTTTTA 
POLH-2704-T7-F GGATCCTAATACGACTCACTATAGGGAGTAAAAAGTGTGTGGGCCTTG 
POLH-2587-R TCAGCACCTAAATGGATTATTTTT 
POLH-2564-T7-F GGATCCTAATACGACTCACTATAGGGAGAAAAATAATCCATTTAGGTGCTGA 
T7-deltaARE-A-F GGATCCTAATACGACTCACTATAGGGAGTGCTGCCCTCAGGCTTGCCTGTAGGCAGATCTTTATCTTTAATAT 
T7-deltaARE-B-F GGATCCTAATACGACTCACTATAGGGAGTGCTGCCCTCAGGCTTGCCTGTAGGATTTAATATTTTTTATCTTTACAGATCTCAGATTTCCCTGAGAAAG 
T7-deltaARE-AB-F GGATCCTAATACGACTCACTATAGGGAGTGCTGCCCTCAGGCTTGCCTGTAGGCAGATCTCAGATTTCCCTGAGAAAGGGAAT 
POLH-ARE-A-t2a-F TGCTGCCCTCAGGCTTGCCTGTAGGAAAAAAAAAAAAAAAACAAAACAGATCTTTATCTTTAATATTTTATCTTTACAGATTTCCCTGAGAAAG 
POLH-ARE-B-t2a-F TGCTGCCCTCAGGCTTGCCTGTAGGATTTAATATTTTTTATCTTTACAGATCTAAAACAAAAAAAAAAAAACAAAACAGATTTCCCTGAGAAAG 
T7-POLH-2447-2467-F GGATCCTAATACGACTCACTATAGGGAGTGCTGCCCTCAGGCTTGCCTG 

RNAi

For lentivirus preparation, shRNA-expressing vector (10 μg) and packaging plasmids [pMDL g/p RRE (5 μg), pCMV-VSVG (5 μg) and pRSV-REV (5 μg)] were co-transfected into HEK (human embryonic kidney)-293T cells (6×106) using Expressfect™ transfection reagent (Denville Scientific). Lentiviral particles were collected from the medium every 24 h for 2 days and then filtered and concentrated by ultracentrifugation at 107000 g in a Beckman SW41TI rotor for 2 h at 4°C. Cells were transduced with concentrated lentiviral particles and then treated with puromycin for 3 days to eliminate untransduced cells. For MCF7 and p53−/− HCT116 cells, 1 μg/ml of puromycin was used, whereas 0.5 μg/ml of puromycin was used for MIA-PaCa2 and ME180 cells.

Antibodies and Western blot analysis

Mouse anti-PCBP1 (E-2), mouse anti-p63 (4A4) and rabbit anti-POLH (H-300) antobodies purchased from Santa Cruz Biotechnology were used for Western blots. Rabbit anti-PCBP1 (8534) antibody from Cell Signaling Technology was used for immunoprecipitation. Mouse anti-HA (haemagglutinin) antibody was purchased from Covance. Rabbit anti-actin antibody was purchased from Sigma.

Whole-cell lysates were prepared with 2× SDS sample buffer and separated using SDS-PAGE (8–10% gels), transferred on to nitrocellulose membrane and then probed with primary and secondary antibodies, followed by chemiluminescent detection.

RNA isolation and reverse transcription–PCR

Total RNAs were extracted from cells using TRIzol® reagent (Invitrogen) according to the manufacturer's protocol. cDNA was synthesized using MMLV (Moloney murine leukaemia virus) reverse transcriptase (Promega) according to the manufacturer's manual. Semi-quantitative PCR was performed with GoTaq DNA polymerase (Promega). Quantitative reverse transcription–PCR (qRT-PCR) was performed with Maxima SYBR Green qPCR Master Mix (Thermo) and the relative expression level was calculated upon normalization to the level of actin transcript. The sequences of primers used for PCR are listed in Table 1.

RNA immunoprecipitation assay

RNA immunoprecipitation was carried out as described previously [37]. Briefly, ~3×106 cells were lysed with 1 ml of lysis buffer (10 mM Hepes, pH 7.0, 100 mM KCl, 100 mM NaCl, 10 mM MgCl2, 0.5% Nonidet P40 and 1 mM DTT) supplemented with RiboLock™ ribonuclease inhibitor (Thermo Scientific) and protease inhibitor cocktails (Sigma). The cell lysates were centrifuged for 10 min at 15700 g at 4°C, followed by imunoprecipitation with 2 μg of rabbit anti-PCBP1 antibody or isotype control IgG at 4°C for 6 h. The RNA–protein immunocomplexes were immunoprecipitated by Protein A–agarose beads (Sigma), followed by semi-quantitative reverse transcription–PCR analysis.

REMSA (RNA electrophoretic mobility-shift assay)

The probes used for REMSA were labelled during in vitro transcription of a DNA fragment containing the T7 promoter and a part or all of POLH 3′UTR. Briefly, 250 ng of purified DNA fragments was incubated with 20 μCi of [α-32P]UTP (800 Ci/ml, PerkinElmer), 0.5 mM each of rNTP (A, G and C), 10 units of T7 RNA polymerase (Ambion) and 20 units of RNase inhibitor (Thermo) in 10 μl of reaction mixture at 37°C for 1 h. DNase I (1 unit; Promega) was added to the reaction mixture to remove the DNA template. The labelled RNA probes were purified by Sephadex G-50 column to remove unlabelled free nucleotides. The radioactivity of probes was measured by a liquid scintillation counter. REMSA was performed as described previously [36]. Briefly, 50000 c.p.m. of α-32P-labelled RNA probe, 250 nM GST or GST–PCBP1 and 100 ng/μl of yeast tRNA were mixed in 20 μl of binding buffer (10 mM Tris/HCl, pH 8.0, 25 mM KCl, 10 mM MgCl2 and 1 mM DTT) at room temperature for 20 min, followed by treatment with 100 units of RNase T1 (Ambion) for 15 min at 37°C to digest unprotected RNA fragments. The RNA–protein complexes were then separated in 7% native polyacrylamide gel and visualized by autoradiography.

RESULTS

POLH expression is decreased by knockdown of PCBP1

A transcript with a long 3′-UTR is often subject to post-transcriptional regulation, including mRNA stability. Since POLH has a long 3′-UTR (~6000 nt) along with several CU- and AREs, we examined whether PCBP1, a poly(rC)-binding protein, regulates POLH expression. To test this, PCBP1 was knocked down in MCF7 cells transduced with lentivirus expressing PCBP1 shRNAs for 3 days. A lentivirus expressing shRNA targeting luciferase mRNA was used as a negative control. We found that the level of POLH protein in MCF7 cells, which carries wild-type p53, was decreased by knockdown of PCBP1, but not control shRNA (Figure 1A). To rule out potential effects of wild-type p53 on expression of POLH, a target of p53 [25], PCBP1 was knocked down in p53−/− HCT116 cells, MIA-PaCa2 cells which carry a mutant p53 [38] and ME180 cells which have undetectable wild-type p53 [39]. We showed that knockdown of PCBP1 led to decreased expression of POLH regardless of the status of the p53 gene (Figures 1B–1D). As a control, ΔNp63 in ME180 cells and TAp63 in MIA-PaCa2 cells were decreased by knockdown of PCBP1, consistent with a previous report [36]. Next, we examined whether the decreased levels of POLH protein are due to decreased levels of POLH transcript. Indeed, we found that the levels of POLH transcript were decreased in cells by knockdown of PCBP1 regardless of the status of the p53 gene (Figure 2). Together, these results suggest that PCBP1 is necessary for appropriate expression of POLH.

POLH expression is decreased upon knockdown of PCBP1

Figure 1
POLH expression is decreased upon knockdown of PCBP1

MCF7 (A), ME180 (B), MIA-PaCa2 (C) and p53−/− HCT116 (D) cells were transduced with a lentivirus expressing luciferase shRNA (shLuc) or one of the two PCBP1 shRNAs (shPCBP1 or shPCBP1*), followed by puromycin selection for 3 days. Whole-cell lysates were collected and used for Western blotting to measure the levels of PCBP1, POLH, actin, ΔNp63α and TAp63α. The level of actin protein was used as a loading control. Western blots shown in the Figure are representative of three independent experiments. The values below the strips are the relative intensities normalized to actin.

Figure 1
POLH expression is decreased upon knockdown of PCBP1

MCF7 (A), ME180 (B), MIA-PaCa2 (C) and p53−/− HCT116 (D) cells were transduced with a lentivirus expressing luciferase shRNA (shLuc) or one of the two PCBP1 shRNAs (shPCBP1 or shPCBP1*), followed by puromycin selection for 3 days. Whole-cell lysates were collected and used for Western blotting to measure the levels of PCBP1, POLH, actin, ΔNp63α and TAp63α. The level of actin protein was used as a loading control. Western blots shown in the Figure are representative of three independent experiments. The values below the strips are the relative intensities normalized to actin.

POLH mRNA is decreased upon knockdown of PCBP1

Figure 2
POLH mRNA is decreased upon knockdown of PCBP1

MCF7 (A), ME180 (B), MIA-PaCa2 (C) and p53−/− HCT116 (D) cells were transduced with a lentivirus expressing a control luciferase shRNA (shLuc) or one of the two PCBP1 shRNAs (shPCBP1 or shPCBP1*), followed by puromycin selection for 3 days. Total RNA was purified and quantitative reverse transcription–PCR (qRT-PCR) was performed to determine the levels of POLH, PCBP1 and actin transcripts. Results are means±S.D. and significance was calculated using the Student's t test (**P<0.01, *P<0.05).

Figure 2
POLH mRNA is decreased upon knockdown of PCBP1

MCF7 (A), ME180 (B), MIA-PaCa2 (C) and p53−/− HCT116 (D) cells were transduced with a lentivirus expressing a control luciferase shRNA (shLuc) or one of the two PCBP1 shRNAs (shPCBP1 or shPCBP1*), followed by puromycin selection for 3 days. Total RNA was purified and quantitative reverse transcription–PCR (qRT-PCR) was performed to determine the levels of POLH, PCBP1 and actin transcripts. Results are means±S.D. and significance was calculated using the Student's t test (**P<0.01, *P<0.05).

POLH mRNA stability is regulated by PCBP1

As an RNA-binding protein, PCBP1 may bind to its target and then regulate the target's mRNA stability. To test this, the half-life of POLH mRNA was measured in p53−/− HCT116 cells transduced with a lentivirus expressing luciferase shRNA or PCBP1 shRNA (shPCBP1) for 3 days. The cells were then treated with 100 μM DRB (5,6-dichloro-1-β-D-ribofuranosylbenzimidazole), a transcription inhibitor, to block de novo RNA synthesis. We found that the half-life of POLH mRNA was decreased from ~2.57 h in control cells to ~1.44 h in PCBP1-knockdown cells (Figure 3).

POLH mRNA stability is regulated by PCBP1

Figure 3
POLH mRNA stability is regulated by PCBP1

p53−/− HCT116 cells were transduced with a lentivirus expressing shLuc or shPCBP1 and selected with puromycin for 3 days, followed by treatment with DRB for the indicated times. The levels of POLH and actin transcripts were determined by quantitative reverse transcription–PCR (qRT-PCR). The relative levels of POLH transcript were normalized with the levels of actin, which were then plotted along with the times following DRB treatment to determine the relative half-life of POLH mRNA. Results are means±S.D. and representative of three independent experiments.

Figure 3
POLH mRNA stability is regulated by PCBP1

p53−/− HCT116 cells were transduced with a lentivirus expressing shLuc or shPCBP1 and selected with puromycin for 3 days, followed by treatment with DRB for the indicated times. The levels of POLH and actin transcripts were determined by quantitative reverse transcription–PCR (qRT-PCR). The relative levels of POLH transcript were normalized with the levels of actin, which were then plotted along with the times following DRB treatment to determine the relative half-life of POLH mRNA. Results are means±S.D. and representative of three independent experiments.

To examine whether PCBP1 physically associates with POLH mRNA in vivo, an RNA immunoprecipitation assay followed by semi-quantitative reverse transcription–PCR was performed with MIA-PaCa2, p53−/− HCT116 and ME180 cells. We found that the level of POLH mRNA was highly enriched in anti-PCBP1 immunocomplexes (Figure 4). The levels of TAp63α and ∆Np63α transcripts were also examined as positive controls and found to be enriched in anti-PCBP1 immunocomplexes (Figure 4), consistent with a previous report [36]. In contrast, no interaction was found between actin transcript and PCBP1 (Figure 4).

PCBP1 physically interacts with POLH transcript in vivo

Figure 4
PCBP1 physically interacts with POLH transcript in vivo

MIA-PaCa2 (A), p53−/− HCT116 (B) and ME180 (C) cells were lysed using immunoprecipitation buffer and incubated with rabbit anti-PCBP1 antibody or control IgG, followed by washing and RNA extraction. Semi-quantitative reverse transcription–PCR was performed to examine the level of POLH in the control IgG and anti-PCBP1 immunocomplexes. The levels of ΔNp63 transcript in ME180 cells, and TAp63 transcript in MIA-PaCa2 cells, were measured as a positive control. The levels of actin transcript were used as a negative control. The semi-quantitative reverse transcription–PCR result is representative of at least three independent experiments. IP, immunoprecipitation.

Figure 4
PCBP1 physically interacts with POLH transcript in vivo

MIA-PaCa2 (A), p53−/− HCT116 (B) and ME180 (C) cells were lysed using immunoprecipitation buffer and incubated with rabbit anti-PCBP1 antibody or control IgG, followed by washing and RNA extraction. Semi-quantitative reverse transcription–PCR was performed to examine the level of POLH in the control IgG and anti-PCBP1 immunocomplexes. The levels of ΔNp63 transcript in ME180 cells, and TAp63 transcript in MIA-PaCa2 cells, were measured as a positive control. The levels of actin transcript were used as a negative control. The semi-quantitative reverse transcription–PCR result is representative of at least three independent experiments. IP, immunoprecipitation.

POLH 3′-UTR is recognized by and responsive to PCBP1

To identify a region in the POLH 3′-UTR that is responsive to PCBP1, we generated seven reporter (mutant p53 R175H) plasmids which carry nothing or a segment from POLH 3′UTR (Figure 5A). Mutant p53 R175H was chosen as a reporter since mutant p53 is highly stable and can be easily detected. These reporters were expressed in MIA-PaCa2 cells transduced with a lentivirus expressing shRNA against luciferase or PCBP1. As expected, knockdown of PCBP1 led to decreased expression of endogenous POLH (Figure 5B). We also found that knockdown of PCBP1 was capable of decreasing the level of mutant p53 protein from a reporter vector that contains the full-length or fragment A of POLH 3′-UTR (Figure 5B, 3′-UTR and A panels). In contrast, knockdown of PCBP1 had no obvious effect on the expression of mutant p53 from the control vector that does not carry POLH 3′-UTR and vectors that contain fragments B–E of POLH 3′-UTR (Figure 5B, Ctrl and B–E panels). Thus, fragment A (nt 2447–3607) of POLH 3′-UTR carries a PCBP1-responsive element.

POLH 3′-UTR is responsive to PCBP1

Figure 5
POLH 3′-UTR is responsive to PCBP1

(A) Schematic presentation of mutant p53 (R175H) reporter vectors that carry none, the full-length or a part of POLH 3′-UTR. Ctrl, no POLH 3′-UTR; 3′-UTR, full-length POLH 3′-UTR (nt 2447–8412); A, nt 2447–3607 from POLH mRNA; B, nt 3515–4619 from POLH mRNA; C, nt 4580–5879 from POLH mRNA; D, nt 5843–7177 from POLH mRNA; E, 7032–8412 from POLH mRNA. (B) The reporter vectors were transfected into MIA-PaCa2 cells transduced with a lentivirus-expressing luciferase shRNA or PCBP1 shRNA (shPCBP1) for 3 days. Western blots were performed to determine the levels of the reporter (HA-tagged mutant p53 R175H), endogenous POLH, PCBP1 and actin. Western blots shown in the Figure are representative of three independent experiments. The values below the strips are the relative intensities normalized to actin. Ctrl, control.

Figure 5
POLH 3′-UTR is responsive to PCBP1

(A) Schematic presentation of mutant p53 (R175H) reporter vectors that carry none, the full-length or a part of POLH 3′-UTR. Ctrl, no POLH 3′-UTR; 3′-UTR, full-length POLH 3′-UTR (nt 2447–8412); A, nt 2447–3607 from POLH mRNA; B, nt 3515–4619 from POLH mRNA; C, nt 4580–5879 from POLH mRNA; D, nt 5843–7177 from POLH mRNA; E, 7032–8412 from POLH mRNA. (B) The reporter vectors were transfected into MIA-PaCa2 cells transduced with a lentivirus-expressing luciferase shRNA or PCBP1 shRNA (shPCBP1) for 3 days. Western blots were performed to determine the levels of the reporter (HA-tagged mutant p53 R175H), endogenous POLH, PCBP1 and actin. Western blots shown in the Figure are representative of three independent experiments. The values below the strips are the relative intensities normalized to actin. Ctrl, control.

To define the PCBP1-responsive element in POLH 3′-UTR, REMSA was performed with five RNA probes (A–E), which span the entire POLH 3′-UTR, to map the binding site of PCBP1 in POLH transcript (Figure 6A). p63 3′-UTR was used as a positive control [36]. We showed that GST-fused PCBP1 bound strongly to fragment A and p63 probe, weakly to fragment C, but little if at all to fragments B, D and E (Figure 6B). As expected, GST alone didn't bind to these probes (Figure 6B). The specificity was confirmed by competition assay. As indicated in Figure 6(C), the binding of PCBP1 to fragment A was inhibited by addition of an excess amount of unlabelled fragment A or p63 RNA probe. Next, we prepared six subfragments from fragment A: A1 (nt 2447–2964); A2 (nt 2945–3607); A11 (nt 2447–2723); A12 (nt 2704–2964); A111 (nt 2447–2587); and A112 (nt 2564–2723) (Figure 6A). We showed that GST-fused PCBP1 bound to A1, A11 and A111, but not to A2, A12 or A112 (Figures 6D–6F). These results suggest that sub-fragment A111 (nt 2447–2587) contains the PCBP1-binding site.

PCBP1 directly binds to POLH 3′-UTR

Figure 6
PCBP1 directly binds to POLH 3′-UTR

(A) Schematic presentation of the transcript of POLH and the locations of the probes used for REMSA. (B) PCBP1 binds to fragment A of POLH 3′-UTR (nt 2447–3607). REMSA was performed with GST or GST-fused PCBP1 along with 32P-labelled RNA probes (A, B, C, D, E and p63). p63 probe was used as positive control. RPC, RNA–protein complex. (C) Competition assay was performed by mixing 32P-labelled RNA probe A along with or without 50-fold of unlabelled p63 probe or probe A. (D) REMSA was performed by mixing 32P-labelled RNA probes (A, A1 and A2) with GST or GST–PCBP1. (E) REMSA was performed by mixing 32P-labelled RNA probes (A1, A11 and A12) with GST or GST–PCBP1. (F) REMSA was performed by mixing 32P-labelled RNA probes (A11, A111 and A112) with GST or GST–PCBP1. The Figures are representative of two independent experiments.

Figure 6
PCBP1 directly binds to POLH 3′-UTR

(A) Schematic presentation of the transcript of POLH and the locations of the probes used for REMSA. (B) PCBP1 binds to fragment A of POLH 3′-UTR (nt 2447–3607). REMSA was performed with GST or GST-fused PCBP1 along with 32P-labelled RNA probes (A, B, C, D, E and p63). p63 probe was used as positive control. RPC, RNA–protein complex. (C) Competition assay was performed by mixing 32P-labelled RNA probe A along with or without 50-fold of unlabelled p63 probe or probe A. (D) REMSA was performed by mixing 32P-labelled RNA probes (A, A1 and A2) with GST or GST–PCBP1. (E) REMSA was performed by mixing 32P-labelled RNA probes (A1, A11 and A12) with GST or GST–PCBP1. (F) REMSA was performed by mixing 32P-labelled RNA probes (A11, A111 and A112) with GST or GST–PCBP1. The Figures are representative of two independent experiments.

PCBP1 directly binds to an ARE in POLH 3′-UTR

PCBP proteins are shown to preferentially recognize CU/C-rich elements [33]. Thus we searched for such elements in the A11 region (nt 2447–2723) of POLH 3′-UTR. We found two well-conserved AREs, ARE-A (nt 2472–2492) and ARE-B (nt 2500–2522), but no CU/C-rich elements (Figure 7A). Since PCBP1 is also found to recognize a poly(rU) element [40], we examined whether one or both AREs are recognized by PCBP1. To test this, we generated three RNA probes in which one or both AREs were deleted: ΔARE-A, ΔARE-B and ΔARE-AB (Figure 7A). We found that ΔARE-A was still recognized by PCBP1, whereas the binding of PCBP1 to ΔARE-B and ΔARE-AB was markedly deceased (Figure 7B), suggesting that ARE-B is the primary PCBP1-binding site. To define further the PCBP1-responsive element in POLH mRNA, we tested whether the poly(rU) sequence in ARE-B is required for PCBP1 binding. To address this, two RNA probes were generated: ARE-A-U2A and ARE-B-U2A in which U to A substitutions were made (Figure 7C). REMSA was performed and showed that the binding of PCBP1 to probe ARE-B-U2A was nearly abolished (Figure 7D). In contrast, the binding of PCBP1 to probe ARE-A-U2A was not decreased, but instead increased (Figure 7D). These results suggest that the poly(rU) sequence in ARE-B is essential for PCBP1 binding.

An ARE in POLH 3′-UTR is recognized by and responsive to PCBP1

Figure 7
An ARE in POLH 3′-UTR is recognized by and responsive to PCBP1

(A) Schematic presentation of the wild-type and deletion mutant probes used for REMSA. (B) REMSA was performed by mixing 32P-labelled probes (A11, ΔARE-A, ΔARE-B and ΔARE-AB) with GST or GST–PCBP1 to identify the PCBP1-binding site in POLH 3′-UTR. RPC, RNA–protein complex. (C) Schematic presentation of wild-type and mutant probes used for REMSA. (D) Poly(rU) nucleotides in ARE-B of POLH 3′-UTR are crucial for PCBP1 binding. REMSA was performed by mixing 32P-labelled RNA probes (A111, ARE-A-U2A and ARE-B-U2A) with GST and GST–PCBP1. The image is representative of two independent experiments. (E) Schematic presentation of the reporter vectors for identification of the PCBP1-binding site in POLH 3′-UTR. (F) ARE-B in POLH 3′-UTR is responsive to PCBP1. The reporter vectors were transfected into MIA-PaCa2 cells transduced with a lentivirus expressing luciferase shRNA or PCBP1 shRNA (shPCBP1) for 3 days. The levels of the reporter (HA-tagged mutant p53 R175H), endogenous POLH, PCBP1 and actin were determined by Western blotting. Western blots shown here are representative of three independent experiments. The values below the strips are the relative intensities normalized to actin. Ctrl, control.

Figure 7
An ARE in POLH 3′-UTR is recognized by and responsive to PCBP1

(A) Schematic presentation of the wild-type and deletion mutant probes used for REMSA. (B) REMSA was performed by mixing 32P-labelled probes (A11, ΔARE-A, ΔARE-B and ΔARE-AB) with GST or GST–PCBP1 to identify the PCBP1-binding site in POLH 3′-UTR. RPC, RNA–protein complex. (C) Schematic presentation of wild-type and mutant probes used for REMSA. (D) Poly(rU) nucleotides in ARE-B of POLH 3′-UTR are crucial for PCBP1 binding. REMSA was performed by mixing 32P-labelled RNA probes (A111, ARE-A-U2A and ARE-B-U2A) with GST and GST–PCBP1. The image is representative of two independent experiments. (E) Schematic presentation of the reporter vectors for identification of the PCBP1-binding site in POLH 3′-UTR. (F) ARE-B in POLH 3′-UTR is responsive to PCBP1. The reporter vectors were transfected into MIA-PaCa2 cells transduced with a lentivirus expressing luciferase shRNA or PCBP1 shRNA (shPCBP1) for 3 days. The levels of the reporter (HA-tagged mutant p53 R175H), endogenous POLH, PCBP1 and actin were determined by Western blotting. Western blots shown here are representative of three independent experiments. The values below the strips are the relative intensities normalized to actin. Ctrl, control.

To determine whether ARE-B is responsive to PCBP1 in vivo, we generated four additional reporter plasmids carrying mutant p53 R175H and a portion of POLH 3′-UTR (nt 2447–2723) with or without ARE-A, ARE-B or both (Figure 7E). These reporter plasmids were expressed in MIA-PaCa2 cells transduced with a lentivirus expressing shRNA against luciferase or PCBP1. As a positive control, the level of endogenous POLH was measured and found to be decreased upon knockdown of PCBP1 (Figure 7F). As a negative control, we found that knockdown of PCBP1 had no obvious effect on the expression of mutant p53 (R175H) from a reporter vector that carries no sequence from POLH 3′-UTR (Figure 7F, Ctrl panel). Interestingly, we found that the level of mutant p53 was decreased by knockdown of PCBP1 for the reporter vectors that carry an intact ARE-B (A11 and ΔARE-A) (Figure 7F, A11 and ΔARE-A panels). In contrast, knockdown of PCBP1 had no effect on mutant p53 expression for reporter vectors that carry ΔARE-B and ΔARE-AB region respectively (Figure 7F, ΔARE-B and ΔARE-AB panels). These data suggest that PCBP1 binds to ARE-B and the poly(rU) nucleotides in ARE-B are crucial for the binding of PCBP1 to POLH mRNA.

DISCUSSION

Previous studies have shown that POLH expression can be regulated at the transcriptional level by p53 and at post-translational levels by Pirh2 and MDM2 (murine double minute 2) [25,27,28]. It is not clear, however, whether POLH expression is regulated by other mechanisms. In the present study, we found that PCBP1 regulates POLH expression via mRNA stability. Thus an obvious question would be: is there a functional connection between PCBP1 and POLH? Indeed, PCBP1 is known to inhibit tumour invasiveness and metastasis by repressing PRL3 [41] and CD44 [42]. Additionally, dephosphorylated PCBP1 is capable of repressing EMT (epithelial–mesenchymal transition) via decreased translation of Dab2 (disabled-2) and ILEI (interleukin-like EMT inducer) [43]. Consistently, PCBP1 is found to be down-regulated in cervical tumour tissues [44], in breast cancer cell lines [45] and during malignant transformation of hydatidiform moles [46]. Since POLH is necessary for the maintenance of genome stability [23,24], down-regulation of PCBP1 in cancer cells would reduce POLH mRNA stability, leading to genome instability. Additionally, since POLH plays a role in p53 activation upon DNA damage [25], down-regulation of PCBP1 in cancer cells would reduce the level of POLH, thus weakening p53 activation. Thus further studies are warranted to address the relationship between PCBP1 and POLH in normal and cancer cells, which may provide an insight into the possibility that PCBP1 might be explored as a marker or target for anticancer therapeutic strategies.

PCBP1 is known to recognize poly(rC)- or CU-rich elements in its targets, including tyrosine hydroxylase [47], β-globin [48], androgen receptor [49], collagens [50], erythropoietin [47] and 15-lipoxygenase [51]. PCBP1 also recognizes non-poly(rC) elements in other targets, including human papilloma virus L2 transcript [52] and Dab2 and ILEI transcripts [43]. However, the PCBP1 consensus element has not been defined in these transcripts. In the present study, we found that PCBP1 regulates POLH expression via binding to an ARE located in the proximal POLH 3′-UTR. Although POLH mRNA harbours at least two AREs, our data suggest that only one ARE is recognized by and responsive to PCBP1. Thus future studies are needed to define how POLH mRNA stability is regulated by PCBP1 and other RNA-binding proteins via the ARE.

Abbreviations

     
  • ARE

    AU-rich element

  •  
  • Dab2

    disabled-2

  •  
  • DRB

    5,6-dichloro-1-β-D-ribofuranosylbenzimidazole

  •  
  • EMT

    epithelial–mesenchymal transition

  •  
  • HA

    haemagglutinin

  •  
  • ILEI

    interleukin-like EMT inducer

  •  
  • PCBP1

    poly(rC)-binding protein 1

  •  
  • POLH

    DNA polymerase η

  •  
  • REMSA

    RNA electrophoretic mobility-shift assay

  •  
  • TLS

    translesion DNA synthesis

  •  
  • XPV

    xeroderma pigmentosum variant

AUTHOR CONTRIBUTION

Cong Ren and Xinbin Chen designed the research, analysed the data and wrote the paper. Cong Ren performed experiments. Seong-Jun Cho and Yong-Sam Jung contributed reagents and analysed the data.

FUNDING

This work was supported in part by the National Institutes of Health [grant numbers CA123227, CA076069 and CA081237].

References

References
1
Cleaver
J. E.
Lam
E. T.
Revet
I.
Disorders of nucleotide excision repair: the genetic and molecular basis of heterogeneity
Nat. Rev. Genet.
2009
, vol. 
10
 (pg. 
756
-
768
)
[PubMed]
2
Friedberg
E. C.
Wagner
R.
Radman
M.
Specialized DNA polymerases, cellular survival, and the genesis of mutations
Science
2002
, vol. 
296
 (pg. 
1627
-
1630
)
[PubMed]
3
McCulloch
S. D.
Kunkel
T. A.
The fidelity of DNA synthesis by eukaryotic replicative and translesion synthesis polymerases
Cell Res.
2008
, vol. 
18
 (pg. 
148
-
161
)
[PubMed]
4
Prakash
S.
Johnson
R. E.
Prakash
L.
Eukaryotic translesion synthesis DNA polymerases: specificity of structure and function
Annu. Rev. Biochem.
2005
, vol. 
74
 (pg. 
317
-
353
)
[PubMed]
5
Fischhaber
P. L.
Friedberg
E. C.
How are specialized (low-fidelity) eukaryotic polymerases selected and switched with high-fidelity polymerases during translesion DNA synthesis?
DNA Repair (Amst)
2005
, vol. 
4
 (pg. 
279
-
283
)
[PubMed]
6
Lange
S. S.
Takata
K.
Wood
R. D.
DNA polymerases and cancer
Nat. Rev. Cancer.
2011
, vol. 
11
 (pg. 
96
-
110
)
[PubMed]
7
Maga
G.
Villani
G.
Crespan
E.
Wimmer
U.
Ferrari
E.
Bertocci
B.
Hubscher
U.
8-oxo-guanine bypass by human DNA polymerases in the presence of auxiliary proteins
Nature
2007
, vol. 
447
 (pg. 
606
-
608
)
[PubMed]
8
Haracska
L.
Yu
S. L.
Johnson
R. E.
Prakash
L.
Prakash
S.
Efficient and accurate replication in the presence of 7,8-dihydro-8-oxoguanine by DNA polymerase η
Nat. Genet.
2000
, vol. 
25
 (pg. 
458
-
461
)
[PubMed]
9
You
C.
Swanson
A. L.
Dai
X.
Yuan
B.
Wang
J.
Wang
Y.
Translesion synthesis of 8,5′-cyclopurine-2′-deoxynucleosides by DNA polymerases η, ι, and ζ
J. Biol. Chem.
2013
, vol. 
288
 (pg. 
28548
-
28556
)
[PubMed]
10
Albertella
M. R.
Green
C. M.
Lehmann
A. R.
O’Connor
M. J.
A role for polymerase η in the cellular tolerance to cisplatin-induced damage
Cancer Res.
2005
, vol. 
65
 (pg. 
9799
-
9806
)
[PubMed]
11
Cruet-Hennequart
S.
Gallagher
K.
Sokol
A. M.
Villalan
S.
Prendergast
A. M.
Carty
M. P.
DNA polymerase η, a key protein in translesion synthesis in human cells
Subcell. Biochem.
2010
, vol. 
50
 (pg. 
189
-
209
)
[PubMed]
12
Fu
D.
Dudimah
F. D.
Zhang
J.
Pickering
A.
Paneerselvam
J.
Palrasu
M.
Wang
H.
Fei
P.
Recruitment of DNA polymerase η by FANCD2 in the early response to DNA damage
Cell Cycle
2013
, vol. 
12
 (pg. 
803
-
809
)
[PubMed]
13
Kannouche
P. L.
Wing
J.
Lehmann
A. R.
Interaction of human DNA polymerase η with monoubiquitinated PCNA: a possible mechanism for the polymerase switch in response to DNA damage
Mol. Cell
2004
, vol. 
14
 (pg. 
491
-
500
)
[PubMed]
14
Acharya
N.
Yoon
J. H.
Gali
H.
Unk
I.
Haracska
L.
Johnson
R. E.
Hurwitz
J.
Prakash
L.
Prakash
S.
Roles of PCNA-binding and ubiquitin-binding domains in human DNA polymerase η in translesion DNA synthesis
Proc. Natl. Acad. Sci. U.S.A.
2008
, vol. 
105
 (pg. 
17724
-
17729
)
[PubMed]
15
Di Lucca
J.
Guedj
M.
Lacapere
J. J.
Fargnoli
M. C.
Bourillon
A.
Dieude
P.
Dupin
N.
Wolkenstein
P.
Aegerter
P.
Saiag
P.
, et al. 
Variants of the xeroderma pigmentosum variant gene (POLH) are associated with melanoma risk
Eur. J. Cancer
2009
, vol. 
45
 (pg. 
3228
-
3236
)
[PubMed]
16
Guo
J.
Zhou
G.
Zhang
W.
Song
Y.
Bian
Z.
A novel mutation causes XP-V disease and XP-V tumor proneness may involve imbalance of numerous DNA polymerases
Oncol. Lett.
2013
, vol. 
6
 (pg. 
1583
-
1590
)
[PubMed]
17
Liu
X.
Zhang
X.
Qiao
J.
Fang
H.
Identification of a novel nonsense mutation in POLH in a Chinese pedigree with xeroderma pigmentosum, variant type
Int. J. Med. Sci.
2013
, vol. 
10
 (pg. 
766
-
770
)
[PubMed]
18
Flanagan
A. M.
Rafferty
G.
O’Neill
A.
Rynne
L.
Kelly
J.
McCann
J.
Carty
M. P.
The human POLH gene is not mutated, and is expressed in a cohort of patients with basal or squamous cell carcinoma of the skin
Int. J. Mol. Med.
2007
, vol. 
19
 (pg. 
589
-
596
)
[PubMed]
19
Glick
E.
White
L. M.
Elliott
N. A.
Berg
D.
Kiviat
N. B.
Loeb
L. A.
Mutations in DNA polymerase η are not detected in squamous cell carcinoma of the skin
Int. J. Cancer
2006
, vol. 
119
 (pg. 
2225
-
2227
)
[PubMed]
20
Broughton
B. C.
Cordonnier
A.
Kleijer
W. J.
Jaspers
N. G.
Fawcett
H.
Raams
A.
Garritsen
V. H.
Stary
A.
Avril
M. F.
Boudsocq
F.
, et al. 
Molecular analysis of mutations in DNA polymerase η in xeroderma pigmentosum-variant patients
Proc. Natl. Acad. Sci. U.S.A.
2002
, vol. 
99
 (pg. 
815
-
820
)
[PubMed]
21
Delbos
F.
Aoufouchi
S.
Faili
A.
Weill
J. C.
Reynaud
C. A.
DNA polymerase η is the sole contributor of A/T modifications during immunoglobulin gene hypermutation in the mouse
J. Exp. Med.
2007
, vol. 
204
 (pg. 
17
-
23
)
[PubMed]
22
Zeng
X.
Winter
D. B.
Kasmer
C.
Kraemer
K. H.
Lehmann
A. R.
Gearhart
P. J.
DNA polymerase η is an A-T mutator in somatic hypermutation of immunoglobulin variable genes
Nat. Immunol.
2001
, vol. 
2
 (pg. 
537
-
541
)
[PubMed]
23
Rey
L.
Sidorova
J. M.
Puget
N.
Boudsocq
F.
Biard
D. S.
Monnat
R. J.
Jr
Cazaux
C.
Hoffmann
J. S.
Human DNA polymerase η is required for common fragile site stability during unperturbed DNA replication
Mol. Cell. Biol.
2009
, vol. 
29
 (pg. 
3344
-
3354
)
[PubMed]
24
Bergoglio
V.
Boyer
A. S.
Walsh
E.
Naim
V.
Legube
G.
Lee
M. Y.
Rey
L.
Rosselli
F.
Cazaux
C.
Eckert
K. A.
Hoffmann
J. S.
DNA synthesis by Pol η promotes fragile site stability by preventing under-replicated DNA in mitosis
J. Cell Biol.
2013
, vol. 
201
 (pg. 
395
-
408
)
[PubMed]
25
Liu
G.
Chen
X.
DNA polymerase η, the product of the xeroderma pigmentosum variant gene and a target of p53, modulates the DNA damage checkpoint and p53 activation
Mol. Cell. Biol.
2006
, vol. 
26
 (pg. 
1398
-
1413
)
[PubMed]
26
Durando
M.
Tateishi
S.
Vaziri
C.
A non-catalytic role of DNA polymerase η in recruiting Rad18 and promoting PCNA monoubiquitination at stalled replication forks
Nucleic Acids Res.
2013
, vol. 
41
 (pg. 
3079
-
3093
)
[PubMed]
27
Jung
Y. S.
Liu
G.
Chen
X.
Pirh2 E3 ubiquitin ligase targets DNA polymerase η for 20S proteasomal degradation
Mol. Cell. Biol.
2010
, vol. 
30
 (pg. 
1041
-
1048
)
[PubMed]
28
Jung
Y. S.
Qian
Y.
Chen
X.
DNA polymerase η is targeted by Mdm2 for polyubiquitination and proteasomal degradation in response to ultraviolet irradiation
DNA Repair (Amst).
2012
, vol. 
11
 (pg. 
177
-
184
)
[PubMed]
29
Kim
S. H.
Michael
W. M.
Regulated proteolysis of DNA polymerase η during the DNA-damage response in C. elegans
Mol. Cell
2008
, vol. 
32
 (pg. 
757
-
766
)
[PubMed]
30
Bienko
M.
Green
C. M.
Sabbioneda
S.
Crosetto
N.
Matic
I.
Hibbert
R. G.
Begovic
T.
Niimi
A.
Mann
M.
Lehmann
A. R.
Dikic
I.
Regulation of translesion synthesis DNA polymerase η by monoubiquitination
Mol. Cell
2010
, vol. 
37
 (pg. 
396
-
407
)
[PubMed]
31
Jung
Y. S.
Hakem
A.
Hakem
R.
Chen
X.
Pirh2 E3 ubiquitin ligase monoubiquitinates DNA polymerase η to suppress translesion DNA synthesis
Mol. Cell. Biol.
2011
, vol. 
31
 (pg. 
3997
-
4006
)
[PubMed]
32
Chaudhury
A.
Chander
P.
Howe
P. H.
Heterogeneous nuclear ribonucleoproteins (hnRNPs) in cellular processes: focus on hnRNP E1′s multifunctional regulatory roles
RNA
2010
, vol. 
16
 (pg. 
1449
-
1462
)
[PubMed]
33
Ostareck-Lederer
A.
Ostareck
D. H.
Hentze
M. W.
Cytoplasmic regulatory functions of the KH-domain proteins hnRNPs K and E1/E2
Trends Biochem. Sci.
1998
, vol. 
23
 (pg. 
409
-
411
)
[PubMed]
34
Waggoner
S. A.
Johannes
G. J.
Liebhaber
S. A.
Depletion of the poly(C)-binding proteins alphaCP1 and alphaCP2 from K562 cells leads to p53-independent induction of cyclin-dependent kinase inhibitor (CDKN1A) and G1 arrest
J. Biol. Chem.
2009
, vol. 
284
 (pg. 
9039
-
9049
)
[PubMed]
35
Ostareck-Lederer
A.
Ostareck
D. H.
Control of mRNA translation and stability in haematopoietic cells: the function of hnRNPs K and E1/E2
Biol. Cell
2004
, vol. 
96
 (pg. 
407
-
411
)
[PubMed]
36
Cho
S. J.
Jung
Y. S.
Chen
X.
Poly (C)-binding protein 1 regulates p63 expression through mRNA stability
PLoS ONE
2013
, vol. 
8
 pg. 
e71724
 
[PubMed]
37
Peritz
T.
Zeng
F.
Kannanayakal
T. J.
Kilk
K.
Eiriksdottir
E.
Langel
U.
Eberwine
J.
Immunoprecipitation of mRNA–protein complexes
Nat. Protoc.
2006
, vol. 
1
 (pg. 
577
-
580
)
[PubMed]
38
Srivastava
S.
Tong
Y. A.
Devadas
K.
Zou
Z. Q.
Chen
Y.
Pirollo
K. F.
Chang
E. H.
The status of the p53 gene in human papilloma virus positive or negative cervical carcinoma cell lines
Carcinogenesis
1992
, vol. 
13
 (pg. 
1273
-
1275
)
[PubMed]
39
Thomas
M.
Pim
D.
Banks
L.
The role of the E6-p53 interaction in the molecular pathogenesis of HPV
Oncogene
1999
, vol. 
18
 (pg. 
7690
-
7700
)
[PubMed]
40
Leffers
H.
Dejgaard
K.
Celis
J. E.
Characterisation of two major cellular poly(rC)-binding human proteins, each containing three K-homologous (KH) domains
Eur. J. Biochem.
1995
, vol. 
230
 (pg. 
447
-
453
)
[PubMed]
41
Wang
H.
Vardy
L. A.
Tan
C. P.
Loo
J. M.
Guo
K.
Li
J.
Lim
S. G.
Zhou
J.
Chng
W. J.
Ng
S. B.
Li
H. X.
Zeng
Q.
PCBP1 suppresses the translation of metastasis-associated PRL-3 phosphatase
Cancer Cell
2010
, vol. 
18
 (pg. 
52
-
62
)
[PubMed]
42
Lian
W. X.
Yin
R. H.
Kong
X. Z.
Zhang
T.
Huang
X. H.
Zheng
W. W.
Yang
Y.
Zhan
Y. Q.
Xu
W. X.
Yu
M.
, et al. 
THAP11, a novel binding protein of PCBP1, negatively regulates CD44 alternative splicing and cell invasion in a human hepatoma cell line
FEBS Lett.
2012
, vol. 
586
 (pg. 
1431
-
1438
)
[PubMed]
43
Chaudhury
A.
Hussey
G. S.
Ray
P. S.
Jin
G.
Fox
P. L.
Howe
P. H.
TGF-β-mediated phosphorylation of hnRNP E1 induces EMT via transcript-selective translational induction of Dab2 and ILEI
Nat. Cell Biol.
2010
, vol. 
12
 (pg. 
286
-
293
)
[PubMed]
44
Pillai
M. R.
Chacko
P.
Kesari
L. A.
Jayaprakash
P. G.
Jayaram
H. N.
Antony
A. C.
Expression of folate receptors and heterogeneous nuclear ribonucleoprotein E1 in women with human papillomavirus mediated transformation of cervical tissue to cancer
J. Clin. Pathol.
2003
, vol. 
56
 (pg. 
569
-
574
)
[PubMed]
45
Thakur
S.
Nakamura
T.
Calin
G.
Russo
A.
Tamburrino
J. F.
Shimizu
M.
Baldassarre
G.
Battista
S.
Fusco
A.
Wassell
R. P.
, et al. 
Regulation of BRCA1 transcription by specific single-stranded DNA binding factors
Mol. Cell. Biol.
2003
, vol. 
23
 (pg. 
3774
-
3787
)
[PubMed]
46
Shi
Z.
Zhang
T.
Long
W.
Wang
X.
Zhang
X.
Ling
X.
Ding
H.
Down-regulation of poly(rC)-binding protein 1 correlates with the malignant transformation of hydatidiform moles
Int. J. Gynecol. Cancer
2012
, vol. 
22
 (pg. 
1125
-
1129
)
[PubMed]
47
Czyzyk-Krzeska
M. F.
Beresh
J. E.
Characterization of the hypoxia-inducible protein binding site within the pyrimidine-rich tract in the 3′-untranslated region of the tyrosine hydroxylase mRNA
J. Biol. Chem.
1996
, vol. 
271
 (pg. 
3293
-
3299
)
[PubMed]
48
Yu
J.
Russell
J. E.
Structural and functional analysis of an mRNP complex that mediates the high stability of human β-globin mRNA
Mol. Cell. Biol.
2001
, vol. 
21
 (pg. 
5879
-
5888
)
[PubMed]
49
Yeap
B. B.
Voon
D. C.
Vivian
J. P.
McCulloch
R. K.
Thomson
A. M.
Giles
K. M.
Czyzyk-Krzeska
M. F.
Furneaux
H.
Wilce
M. C.
Wilce
J. A.
Leedman
P. J.
Novel binding of HuR and poly(C)-binding protein to a conserved UC-rich motif within the 3′-untranslated region of the androgen receptor messenger RNA
J. Biol. Chem.
2002
, vol. 
277
 (pg. 
27183
-
27192
)
[PubMed]
50
Thiele
B. J.
Doller
A.
Kahne
T.
Pregla
R.
Hetzer
R.
Regitz-Zagrosek
V.
RNA-binding proteins heterogeneous nuclear ribonucleoprotein A1, E1, and K are involved in post-transcriptional control of collagen I and III synthesis
Circ. Res.
2004
, vol. 
95
 (pg. 
1058
-
1066
)
[PubMed]
51
Reimann
I.
Huth
A.
Thiele
H.
Thiele
B. J.
Suppression of 15-lipoxygenase synthesis by hnRNP E1 is dependent on repetitive nature of LOX mRNA 3′-UTR control element DICE
J. Mol. Biol.
2002
, vol. 
315
 (pg. 
965
-
974
)
[PubMed]
52
Collier
B.
Goobar-Larsson
L.
Sokolowski
M.
Schwartz
S.
Translational inhibition in vitro of human papillomavirus type 16 L2 mRNA mediated through interaction with heterogenous ribonucleoprotein K and poly(rC)-binding proteins 1 and 2
J. Biol. Chem.
1998
, vol. 
273
 (pg. 
22648
-
22656
)
[PubMed]