The yeast protein methyltransferase Hmt1 can methylate histone H3 arginine 2. The intermolecular trans interaction of Hmt1 is essential for its activity. Our data suggest an intermolecular trans-complementary model for protein arginine methyltransferases.

INTRODUCTION

It is increasingly evident that post-translational modification (PTM) of a protein extends the range of its functions. PTMs can be either small chemical groups (e.g. phosphate, methyl and acetyl) or large peptides [e.g., ubiquitin and small ubiquitin-like modifier (SUMO)]. PTMs on histones have drawn much attention, because they regulates many of the fundamental biological processes including chromatin structure maintenance, gene transcription, DNA replication and DNA damage repair [1,2].

Arginine methylation is frequently found on proteins and catalysed by protein arginine methyltransferases (PRMTs), which transfer the methyl groups from S-adenosyl methionine (SAM) to the nitrogen atom(s) of the arginine side chain. There are three types of methylation on an arginine residue: ω-NG-monomethylarginine (Rme1), ω-NG,NG-dimethylarginine (asymmetric dimethylarginine, Rme2a) and ω-NG,N′G-dimethylarginine (symmetric dimethylarginine, Rme2s; Figure 1A). PRMTs are classified as type I, II and III enzymes. All PRMTs can catalyse the formation of Rme1, whereas type I and type II PRMTs further carry out the formation of Rme2a and Rme2s respectively (Figure 1A) [3]. Up till now, 10 PRMTs have been identified in human cells (namely PRMT1–9 and FBXO11) [3], whereas three are reported in budding yeast Saccharomyces cerevisiae (Hmt1, Hsl7 and Rmt2) [46]. Previously, yeast Yor021C was shown to be a PRMT, but it belongs to the SPOUT family [7]. PRMTs have been shown to play important roles in many cellular processes, such as mRNA export, ribosome biogenesis and DNA metabolism pathways [1,8]. Recently, the dysregulation of PRMTs expression has been found in a variety of human diseases [9,10]. Interestingly, one PRMT can have multiple targets [9]. For example, PRMT6 methylates histone H3R2, H4 and H2A [1113], as well as some non-histone proteins, such as high mobility group protein (HMGA)1a/b [14], HIV TAT protein [15] and DNA polymerase β [16]. Additionally, different PRMTs can modify a same target site. For example, both PRMT7 and PRMT5 have the activity of catalysing H3R2me2s [17,18]. The complexity between arginine methyltransferases and their substrates leads to difficulties in dissecting the functions of both a methyltansferase and a methylation site. All of these enzymes contain four conserved SAM-binding/catalytic motifs, namely I, post I, II and III, a β-barrel substrates-binding domain and a dimerization domain [19]. Several lines of evidences indicate that PRMTs favour a dimeric conformation [1825], suggesting the importance of dimerization for their activities. However, how dimerization regulates PRMTs’ activities remains unclear.

Identification of the anti-H3R2me2a antibody

Figure 1
Identification of the anti-H3R2me2a antibody

(A) Arginine methylation is catalysed by PRMTs. The type I, II and III PRMTs all catalyse the formation of NG-monomethylarginine. The type I and II further carry out asymmetric- and symmetric-dimethylation on arginine respectively. (B) The specificity of the anti-H3R2me2a antibody was determined by dot blotting analysis. The peptides of the first 20 amino acids of histone H3 or H4, with or without modifications (labelled on the top of the panel) were spotted on nitrocellulose membranes at the indicated concentrations (indicated on the left) and detected by the antibody against H3R2me2a. (C) Chromatin associated H3R2me2a detected by anti-H3R2me2a antibody. Histones were extracted from WT and H3R2A mutant yeast cells and detected with anti-H3R2me2a antibody. Histone H4 was used as loading control.

Figure 1
Identification of the anti-H3R2me2a antibody

(A) Arginine methylation is catalysed by PRMTs. The type I, II and III PRMTs all catalyse the formation of NG-monomethylarginine. The type I and II further carry out asymmetric- and symmetric-dimethylation on arginine respectively. (B) The specificity of the anti-H3R2me2a antibody was determined by dot blotting analysis. The peptides of the first 20 amino acids of histone H3 or H4, with or without modifications (labelled on the top of the panel) were spotted on nitrocellulose membranes at the indicated concentrations (indicated on the left) and detected by the antibody against H3R2me2a. (C) Chromatin associated H3R2me2a detected by anti-H3R2me2a antibody. Histones were extracted from WT and H3R2A mutant yeast cells and detected with anti-H3R2me2a antibody. Histone H4 was used as loading control.

The 39.8-kDa Hmt1 protein in S. cerevisiae takes the name of heterogeneous nuclear ribonucleoprotein methyltransferase. Previous studies showed that Hmt1 methylates several mRNA-binding proteins, including Npl3, Hrp1, Snp1 and Rps2 and functions in mRNA maturation and export [4,19,2628]. Additionally, Hmt1 possesses methyltransferase activity to the R3 of free histone H4 in vitro [29]. Moreover, deletion of HMT1 results in a decrease in histone H4R3 methylation, a modest decrease in telomere silencing and enhancement of rDNA recombination in vivo [30]. Structural studies by Weiss et al. [19] revealed that Hmt1 monomer contains an N-terminal SAM-binding/catalytic domain and a C-terminal substrate-binding domain. Hmt1 monomers form homodimers and three dimers form a hexamer. Substitution of the ‘antenna’ region (residues 175–204) of Hmt1 with eight alanine residues abolishes its dimerization and methyltransferase activity toward Npl3 in vitro. Consistently, the non-phosphorylatable Hmt1 mutant (Hmt1-S9A) cannot form an oligomer and exhibits no activity in vivo [31]. These results further suggest that the dimerization/oligomerization is important for Hmt1 activity.

In the present work, we purified recombinant Hmt1 and found that Hmt1 has histone H3R2me1 and H3R2me2a methylation activities in vitro. Dimerization, but not hexamerization is essential for Hmt1 activity. The methylation on histone H3R2 by Hmt1 requires discrete domains from two Hmt1 molecules that contribute to SAM-binding and substrate-binding respectively.

EXPERIMENTAL

Plasmids and strains

Yeast strains used in this work were derivatives of YPH499 as listed in Table 1. Yeast strains were constructed by transformation with a lithium acetate procedure. Primers used in the present study are listed in Table 2.

Table 1
S. cerevisiae strains used in the present study
Strain Relevant genotype Source 
YPH499 MATa ura3-52 lys2-801_amber ade2-101_ochre trp1-Δ63 his3-Δ200 leu2-Δ1 [36
HTY01 YPH499 pCM252 [CEN TRP1] Present work 
HTY02 YPH499 pCM252 [CEN TRP1 HMT1] Present work 
HTY03 YPH499 pCM252 [CEN TRP1 HMT1] adh4::URA3-TEL-VIIL Present work 
HTY04 YPH499 pCM252 [CEN TRP1 hmt1-Dm] Present work 
HTY05 YPH499 pCM252 [CEN TRP1 hmt1-Dm], adh4::URA3-TEL-VIIL Present work 
HTY06 YPH499 pCM252 [CEN TRP1 hmt1-Hm] Present work 
HTY07 YPH499 pCM252 [CEN TRP1 hmt1-Hm], adh4::URA3-TEL-VIIL Present work 
HTY08 YPH499 pCM252 [CEN TRP1], sir2Δ::HIS3,adh4::URA3-TEL-VIIL Present work 
HTY09 YPH499 hmt1Δ::HIS3 Present work 
Strain Relevant genotype Source 
YPH499 MATa ura3-52 lys2-801_amber ade2-101_ochre trp1-Δ63 his3-Δ200 leu2-Δ1 [36
HTY01 YPH499 pCM252 [CEN TRP1] Present work 
HTY02 YPH499 pCM252 [CEN TRP1 HMT1] Present work 
HTY03 YPH499 pCM252 [CEN TRP1 HMT1] adh4::URA3-TEL-VIIL Present work 
HTY04 YPH499 pCM252 [CEN TRP1 hmt1-Dm] Present work 
HTY05 YPH499 pCM252 [CEN TRP1 hmt1-Dm], adh4::URA3-TEL-VIIL Present work 
HTY06 YPH499 pCM252 [CEN TRP1 hmt1-Hm] Present work 
HTY07 YPH499 pCM252 [CEN TRP1 hmt1-Hm], adh4::URA3-TEL-VIIL Present work 
HTY08 YPH499 pCM252 [CEN TRP1], sir2Δ::HIS3,adh4::URA3-TEL-VIIL Present work 
HTY09 YPH499 hmt1Δ::HIS3 Present work 
Table 2
Primers used in the present study
Primer name Sequence (5‘-3‘) 
P1 TCGGATCCAGCAAGACAGCCGTGAAAGATTC 
P2 GTACTCGAGTTAATGCATTAAATAAGAACCTTC 
P3 GTACTCGAGTTACTTATCGAACTTGTAAGAAATTTTGATATTTAG 
P4 ACTGAATTCACCGCCACCATGCATTAAATAAGAACCTTC 
P5 ACTGAATTCACCGCCACCCTTATCGAACTTGTAAGAAATTTTGATATTTAG 
P6 ACTGAATTCGGTGGCAGCAAGACAGCCGTGAAAGATTC 
P7 ACTGGATCCATGAGCAAGACAGCCGTGAAAG 
P8 CAGATCGATTTAATGCATTAAATAAGAACCTTC 
P9 CTGGGATCCAGAGAAGAACTAGACGAGTTG 
P10 GTCGACTTTTCTTTGGATGAATTTGTCGG 
P11 CTGACTAGTGACTTTTGTTTGCTGGAGAAAG 
P12 CTGGGATCCATGACCGTGCTAAGCGTTAC 
HMT1-G68R-f GTTGCCGTACCGGTATTTTATC 
HMT1-G68R-r ACCGGTACGGCAACCGACGTC 
HMT1-G86R-f GTTATCCGTGTTGATATGTC 
HMT1-G86R-r ATCAACACGGATAACATGCTTC 
HMT1-K125R-f CCTAGAGTTGACATCATAATTTC 
HMT1-K125R-r CAACTCTAGGAAAGGGTAAATG 
HMT1-G159R-f AAGGCCGTCTGATCTTTCCC 
HMT1-G159R-r AGATCAGACGGCCTTCTACC 
HMT1-Dm-f CAAGCCGCTGCCGCGGCTGCTGCTTCGCCATTTGTTCCGTTG 
HMT1-Dm-r CGAAGCAGCAGCCGCGGCAGCGGCTTGCCAGTAGTTCAACTTC 
HMT1-Hm-r TCTAGCTGCTGCAACTGGTGACACC 
HMT1-Hm-r CAGTTGCAGCAGCTAGATCATCAGG 
Primer name Sequence (5‘-3‘) 
P1 TCGGATCCAGCAAGACAGCCGTGAAAGATTC 
P2 GTACTCGAGTTAATGCATTAAATAAGAACCTTC 
P3 GTACTCGAGTTACTTATCGAACTTGTAAGAAATTTTGATATTTAG 
P4 ACTGAATTCACCGCCACCATGCATTAAATAAGAACCTTC 
P5 ACTGAATTCACCGCCACCCTTATCGAACTTGTAAGAAATTTTGATATTTAG 
P6 ACTGAATTCGGTGGCAGCAAGACAGCCGTGAAAGATTC 
P7 ACTGGATCCATGAGCAAGACAGCCGTGAAAG 
P8 CAGATCGATTTAATGCATTAAATAAGAACCTTC 
P9 CTGGGATCCAGAGAAGAACTAGACGAGTTG 
P10 GTCGACTTTTCTTTGGATGAATTTGTCGG 
P11 CTGACTAGTGACTTTTGTTTGCTGGAGAAAG 
P12 CTGGGATCCATGACCGTGCTAAGCGTTAC 
HMT1-G68R-f GTTGCCGTACCGGTATTTTATC 
HMT1-G68R-r ACCGGTACGGCAACCGACGTC 
HMT1-G86R-f GTTATCCGTGTTGATATGTC 
HMT1-G86R-r ATCAACACGGATAACATGCTTC 
HMT1-K125R-f CCTAGAGTTGACATCATAATTTC 
HMT1-K125R-r CAACTCTAGGAAAGGGTAAATG 
HMT1-G159R-f AAGGCCGTCTGATCTTTCCC 
HMT1-G159R-r AGATCAGACGGCCTTCTACC 
HMT1-Dm-f CAAGCCGCTGCCGCGGCTGCTGCTTCGCCATTTGTTCCGTTG 
HMT1-Dm-r CGAAGCAGCAGCCGCGGCAGCGGCTTGCCAGTAGTTCAACTTC 
HMT1-Hm-r TCTAGCTGCTGCAACTGGTGACACC 
HMT1-Hm-r CAGTTGCAGCAGCTAGATCATCAGG 

To construct Hmt1 mutants, HMT1 open reading frame (ORF) was amplified with primers P1/P2 and cloned into the BamHI and XhoI sites of pGEX-6p-1 plasmid (GE Healthcare). Plasmids bearing HMT1 mutations were generated by site-directed mutagenesis using PCR with the indicated primers and plasmid pGEX-6p-1-HMT1 as template. HMT1-ΔC was amplified with primers P1/P3.

For Hmt12 fusion gene, the first copy of HMT1 or HMT1-Nm was amplified with primers P1/P4 and pGEX-6p-1-HMT1 or pGEX-6p-1-HMT1-Nm as template and HMT1-ΔC was amplified with primers P1/P5 and pGEX-6p-1-HMT1 as template, then the PCR fragments were digested with BamHI/EcoRI. The second copy of HMT1 or HMT1-Nm was amplified with primers P6/P2 and HMT1-ΔC was amplified with primers P6/P3 and the PCR fragments were digested with EcoRI/XhoI. The two fragments were cloned into BamHI and XhoI sites of pGEX-6p-1.

HMT1 was deleted using a pRS303 plasmid which contained about 500 bp homologous sequences (amplified using primers P9/P10 and P11/P12) flanking the HMT1 ORF.

For HMT1 overexpression plasmids, the ORFs of HMT1, HMT1-Dm and HMT1-Hm were amplified with primers P7/P8 using pGEX-6p-1-HMT1, HMT1-Dm and HMT1-Hm as template respectively. The PCR fragments were cloned into the BamHI and ClaI sites of pCM252 [32].

Antibodies

The anti-H3R2me2a monoclonal antibody is prepared in our laboratory. Briefly, the antigen, H3 peptide A-Rme2a-T-K-Q-T-A-R with an additional cysteine at the C-terminal, was conjugated to maleimide activated BSA (BSA, KLH Conjugation Kit, Sigma–Aldrich, MBK1) through the disulfide bond between the thiol-groups of cysteines and then used to immunize mice. Hybridoma cells were formed by fusing myeloma cells with the spleen cells from the immunized mice. The antibodies secreted by the different hybridoma cell lines were then identified for their affinity and specificity to the antigen by ELISA assay and dot blot. The anti-H3R2me1 monoclonal antibody, anti-H4R3me2s polyclonal antibodies and anti-histone H4 polyclonal antibodies were from Abcam. The anti-H4R3me2a polyclonal antibodies were from Active Motif. The anti-His polyclonal antibodies were from CWBIO.

Dot blot

The unmodified or modified peptides of histone H3 (1-ARTKQTARKSTGGKAPRKQL-20) and H4 (1-SGRGKGG-KGLGKGGAKRHRK-20) were dotted on nitrocellulose membrane (Whatman Protran BA79) at the indicated concentrations. The membrane was blocked for 1 h in TBST buffer (10 mM Tris/HCl, pH 7.5, 150 mM NaCl and 0.01% Tween 20) containing 5% (w/v) non-fat milk powder, followed by an overnight incubation with the anti-H3R2me2a monoclonal antibody. The membrane was washed three times for 10 min with TBST at room temperature and then incubated with peroxidase-conjugated secondary antibody for 1 h at room temperature. The signal was detected by ECL reagent (Thermo) and imaged using X-ray film (Kodak).

Western blotting

Western blotting was performed with standard procedures. Briefly, proteins were separated by SDS/PAGE (15% gel) and transferred to Hybond ECL membrane (GE Healthcare) and probed with appropriate antibodies using the method shown in the Dot blot section. For the in vivo histone analysis, chromatin was normalized to histone H4 using anti-H4 antibody. The amount of substrate and enzyme used in the in vitro methylation assay was monitored by anti-histidine antibody or Coomassie-stained SDS/PAGE gels.

Recombinant Hmt1 purification

The wild-type (WT) and mutant HMT1 was cloned in pGEX-6p-1 plasmid and the GST-fused recombinant Hmt1 proteins were overexpressed in Escherichia coli BL21(DE3). Typically 1 litre of E. coli was cultured in 2× YT medium with 0.1 mM IPTG for induction at 16°C overnight. Cells were lysed in PBS buffer (150 mM NaCl, 2.7 mM KCl, 2 mM KH2PHO4, 10 mM Na2HPHO4, pH 7.4) supplemented with protease inhibitors, 5% glycerol and 1 mM 2-mercaptoethanol and centrifuged at 40000 g for 60 min at 4°C. The supernatants were collected and Hmt1 proteins were purified with Glutathione Sepharose 4 fast flow according to the manufacturer's instructions (GE Healthcare). The Sepharose was washed with PBS buffer containing 500 mM NaCl and 5% glycerol for three times at 4°C. Then the PreScission protease was employed to cleave the GST-tag in cleavage buffer (PBS with 2 mM MgCl2 and 5% glycerol) for 12 h at 4°C.

Gel filtration chromatography

About 1 mg (at 2 mg/ml) of the recombinant Hmt1 protein was loaded on to a Superdex 200, 10/300 GL column (GE Healthcare) and eluted with PBS buffer with 5% glycerol at a flow rate of 1 ml/min. The fractions were collected every 0.5 ml.

In vitro methylation assay

Methylation assays were performed in 12 μl of the PBS reaction system. The purified Hmt1 proteins (as indicated in Figures) were incubated with 50 ng of the recombinant histidine-tagged H3 and 30 μM SAM (NEB, B9003S) at 30°C for 3 h or for the indicated time in the time course experiments. Then the products were detected by Western blotting using antibodies against methylated H3R2.

Telomere silencing

URA3 gene was integrated at the left end of chromosome VII of each strain. Yeast cells were cultured in YC (yeast complete medium)–Trp medium containing 2 μg/ml doxycycline (Sigma D1822) at 30°C overnight and suspended in sterile water at D600 ∼ 0.3. Three microlitres of 5-fold serial dilutions were plated on YC–Trp medium containing 2 μg/ml doxycycline, with or without 0.15% 5-FOA (5-fluoroorotic acid). Plates were incubated at 30°C for 2 days and photographed.

Telomere Southern blotting

The yeast genomic DNA was digested with XhoI, separated by 0.8% agarose gel, transferred to Hybond-N+ membrane (GE Healthcare), cross-linked by UV and then probed by the [32P]-labelled TG1–3 probe as described previously [33].

Hmt1 overexpression in vivo

YPH499 cells carrying the WT or mutant HMT1 on the pCM252 plasmid [32] were cultured in YC–Trp liquid medium at 30°C overnight. The fresh cultures were transferred in to inducible YC–Trp liquid medium with 2 μg/ml doxycycline for about 24 h. Fifty millilitres of cells grown to D600 ∼ 0.8 were harvested for chromatin preparation as described previously [34]. Western blot was then performed to detect histone H3R2 methylation.

Quantitative RT-PCR

The relative expression of HMT1 was quantified as described previously [34]. Briefly, total RNA was isolated from yeast cells using an RNeasy mini kit (Qiagen). The genomic DNA was removed by the RQ1 DNase digestion (Promega). cDNA was synthesized using a MLV reverse transcriptase and oligo(dT) (Promega) using 1 μg of RNA as template in 20 μl of PCR volume. An appropriate amount of cDNA was used in the subsequent real-time (RT) fluorescent quantitative PCR (ABI).

RESULTS

Preparation and characterization of the antibody against the methylated histone H3R2

Previous studies suggest that histone H3R2me2a is a heterochromatin mark [11,12]. The work in our group has mainly been focusing on yeast telomere heterochromatin. Thus, we wanted to investigate the function of histone H3R2me2a in telomere heterochromatin maintenance. For this purpose, we developed a monoclonal antibody towards H3R2me2a (See ‘Experimental’). The specificity of the antibody was examined by dot-blotting. The anti-H3R2me2a antibody recognized the H3 peptides with R2me2a modification regardless of the methylation status of H3K4 and did not cross-react with H3R2, H3R2me1, H3R2me2s and other tested peptides (Figure 1B). Additionally, the anti-H3R2me2a antibody recognized histones from WT yeast cells, but not those from H3R2A mutant cells (Figure 1C), confirming the specificity of the anti-H3R2me2a monoclonal antibody we have prepared.

Hmt1 methylates histone H3R2 in vitro

We searched yeast homologue(s) of human PRMTs by sequence alignment and found that Hmt1 shares significant identity with PRMT1 (51%), PRMT8 (50%), PRMT3 (48%) and PRMT6 (31%) (Figure 2A). Considering that deletion of HMT1 results in a modest decrease in telomere silencing in yeast [30] and PRMT6 is responsible for H3R2 methylation in mammals [11,12], we decided to study the activity of Hmt1 towards histone H3R2.

In vitro methylation of histone H3R2 by the recombinant Hmt1

Figure 2
In vitro methylation of histone H3R2 by the recombinant Hmt1

(A) Sequence alignment of yeast Hmt1 (YBR034C) and human PRMT6 (AAH73866). The conserved methyltransferase motifs I, II, post I and III and the ‘antenna’ motif are labelled. The mutations used in this study are indicated. Nm (substitution of Gly68 with arginine) and ΔC (C-terminal 21 amino acids truncation and addition of D-K) mutations are labelled with a circle and diamond respectively. (B) Gel filtration analysis [Superdex 200 (10/300) column] of the recombinant Hmt1. The molecular mass of protein standards are indicated on the top. The elution profile is shown in the top panel. The recombinant Hmt1 detected by Coomassie Blue-stained SDS/PAGE is shown in the middle panel (BC represents protein before column). The methyltransferase activity of eluted Hmt1 is shown at the bottom panel. Two microlitres of each fraction was used for both the in vitro assays. The anti-H3R2me2a antibody was used in the Western analysis to examine the methyltransferase activity of Hmt1. Histidine-tagged yeast full-length H3, purified from E. coli, was used as substrate. SAM was used as methyl group donor. (C) Time course experiment examining Hmt1 activity. The methyltransferase activity assays of Hmt1 were performed using recombinant histidine-tagged histone H3 as substrate. Hmt1 (0.5 μg) was used in every reaction. Hmt1 activity was detected by Western blot using antibodies against histone H3R2me1 and H3R2me2a (indicated on left). The reaction time in minutes is labelled on top. Histone H3 loading is visualized by anti-histidine antibody. (D) Methylation assay of H3 using [methyl–3H]–SAM. Purified recombinant H3R2A or H3 was incubated with 2 μg of Hmt1 and 3 μCi of [methyl–3H]–SAM (Perkin–Elmer, NET155001MC) at 30°C for 3 h. Products were subjected to SDS/PAGE. The gel was dried and exposed for 2 days at −80°C. The amounts of recombinant H3R2A or H3 used in the assay are indicated on top.

Figure 2
In vitro methylation of histone H3R2 by the recombinant Hmt1

(A) Sequence alignment of yeast Hmt1 (YBR034C) and human PRMT6 (AAH73866). The conserved methyltransferase motifs I, II, post I and III and the ‘antenna’ motif are labelled. The mutations used in this study are indicated. Nm (substitution of Gly68 with arginine) and ΔC (C-terminal 21 amino acids truncation and addition of D-K) mutations are labelled with a circle and diamond respectively. (B) Gel filtration analysis [Superdex 200 (10/300) column] of the recombinant Hmt1. The molecular mass of protein standards are indicated on the top. The elution profile is shown in the top panel. The recombinant Hmt1 detected by Coomassie Blue-stained SDS/PAGE is shown in the middle panel (BC represents protein before column). The methyltransferase activity of eluted Hmt1 is shown at the bottom panel. Two microlitres of each fraction was used for both the in vitro assays. The anti-H3R2me2a antibody was used in the Western analysis to examine the methyltransferase activity of Hmt1. Histidine-tagged yeast full-length H3, purified from E. coli, was used as substrate. SAM was used as methyl group donor. (C) Time course experiment examining Hmt1 activity. The methyltransferase activity assays of Hmt1 were performed using recombinant histidine-tagged histone H3 as substrate. Hmt1 (0.5 μg) was used in every reaction. Hmt1 activity was detected by Western blot using antibodies against histone H3R2me1 and H3R2me2a (indicated on left). The reaction time in minutes is labelled on top. Histone H3 loading is visualized by anti-histidine antibody. (D) Methylation assay of H3 using [methyl–3H]–SAM. Purified recombinant H3R2A or H3 was incubated with 2 μg of Hmt1 and 3 μCi of [methyl–3H]–SAM (Perkin–Elmer, NET155001MC) at 30°C for 3 h. Products were subjected to SDS/PAGE. The gel was dried and exposed for 2 days at −80°C. The amounts of recombinant H3R2A or H3 used in the assay are indicated on top.

We overexpressed and purified recombinant Hmt1 in E. coli. A gel filtration analysis using a Superdex 200 (10/300) column revealed that the recombinant Hmt1 peaked at fraction number 24, corresponding to a molecular mass of about 200 kDa (Figure 2B, upper panel) and fraction number 30 with a molecular mass of about 40 kDa, suggesting that Hmt1 exists as oligomers (e.g., hexamers), dimers and monomers in solution. This result is consistent with a previous structural study [19]. We then performed an in vitro methylation assay to examine the methyltransferase activity of the eluted Hmt1 fractions. The result showed that the fractions containing recombinant Hmt1 have H3R2me2a methylation activity (Figure 2B, lower panel), which is in proportion to the protein quantity (Figure 2B, middle panel).

In order to validate that Hmt1 is a type I PRMT, which catalyses the formation of both Rme1 and Rme2a, we carried out a time course experiment examining the in vitro methylation products (Figure 2C). The H3R2me2a and H3R2me1 signals emerged within 5 min and culminated at 1 h. Then the H3R2me2a signal remained stable, whereas the H3R2me1 signal faded gradually with the extension of reaction time, indicating that H3R2me1 was further transformed to H3R2me2a. These results reveal that Hmt1 catalyses both H3R2me1 and H3R2me2a formation in vitro. We also performed an in vitro methylation assay using [methyl–3H]–SAM as methyl group donor (Figure 2D). More radioactive methyl groups of SAM were transferred to the recombinant WT histone H3 than to the mutant histone H3R2A. These data support the conclusion that Hmt1 methylates not only R2, but also other arginines in histone H3 in vitro.

The N-terminal domain of Hmt1 consists of four well-conserved methyltransferase motifs, I, post I, II and III, which are responsible for SAM-binding and catalytic activity and the C-terminal domain forms an elongated nine-stranded β-barrel for substrate binding (Figures 2A and 3A) [19]. To elucidate the molecular mechanism by which Hmt1 accomplishes its methyltransferase activity, we constructed several Hmt1 mutants. These recombinant mutant Hmt1 proteins were purified to near homogeneity and subjected to in vitro methylation assays. The results showed that single substitution of Gly68, Gly86 or Gly159 to arginine and ΔC mutation (truncation of the C-terminal 21 amino acids following the addition of D-K; reported in [19]) abolished Hmt1 activity (Figures 3B and 3C), indicating that these residues are essential for Hmt1 activity.

Hmt1 mutations affecting its activity

Figure 3
Hmt1 mutations affecting its activity

(A) Ribbon diagram of Hmt1 monomer structure drawn according to PDB database. The N-terminal domain and C-terminal domain are shown in yellow and blue respectively and the ‘antenna’ motif is shown in green. The Nm mutation is shown in red and the ΔC is shown in flesh. The sketch map indicates the mutation sites of Nm and ΔC. The smaller and bigger ovals symbolize the N-terminal domain and the C-terminal domain. The mutations are shown by red symbols as described in Figure 1(B). (B and C) Methyltransferase activity assay of recombinant Hmt1 mutants. The recombinant Hmt1 mutant proteins, including G68R, G86R, K125R, G159R (B) and Hmt1-ΔC (C) were purified and their methyltransferase activities were examined by Western blot using antibodies against histone H3R2me1 and H3R2me2a. 0.5 μg of each protein was used in the activity assay (Coomassie).

Figure 3
Hmt1 mutations affecting its activity

(A) Ribbon diagram of Hmt1 monomer structure drawn according to PDB database. The N-terminal domain and C-terminal domain are shown in yellow and blue respectively and the ‘antenna’ motif is shown in green. The Nm mutation is shown in red and the ΔC is shown in flesh. The sketch map indicates the mutation sites of Nm and ΔC. The smaller and bigger ovals symbolize the N-terminal domain and the C-terminal domain. The mutations are shown by red symbols as described in Figure 1(B). (B and C) Methyltransferase activity assay of recombinant Hmt1 mutants. The recombinant Hmt1 mutant proteins, including G68R, G86R, K125R, G159R (B) and Hmt1-ΔC (C) were purified and their methyltransferase activities were examined by Western blot using antibodies against histone H3R2me1 and H3R2me2a. 0.5 μg of each protein was used in the activity assay (Coomassie).

Dimerization but not hexamerization is essential for Hmt1 activity in vitro

It has been reported that two Hmt1 monomers form a dimer through the connection between the ‘antenna’ motif of one molecule and the N-terminal domain of the other and three Hmt1 homodimers can further form a hexamer [19]. The Hmt1 mutants that cannot form the dimer are inactive. To address whether dimerization or hexamerization is required for Hmt1 activity to histone H3R2, we constructed two Hmt1 mutants (Figure 2A, named Hmt1-Dm and Hmt1-Hm). In the Hmt1-Dm mutant, residues 188–194 at the ‘antenna’ motif, which is responsible for Hmt1 dimerization [19], were replaced with seven alanines. In the Hmt1-Hm mutant, residues 296–298, presumably mediating the hexamerization [19], were replaced with three alanines. These two mutant proteins were purified from E. coli and fractionated through Superdex 200 (10/300) columns. The Hmt1-Dm was eluted at a molecular mass less than 45 kDa (Figure 4A), indicating that it is in a monomer conformation. The Hmt1-Hm was mainly eluted at a molecular mass close to 66 kDa (Figure 4B), suggesting that Hmt1-Hm forms dimers, but not hexamers. The subsequent in vitro methylation assay revealed that the Hmt1-Dm mutant had no histone H3R2 methyltransferase activity (Figure 4C). In contrast, the Hmt1-Hm mutant showed an activity comparable to that of WT Hmt1 (Figure 4C). A time course experiment further confirmed that Hmt1-Hm produced H3R2me1 and H3R2me2a (Figure 4D). These results indicate that the dimerization, but not hexamerization, is essential for Hmt1 methyltransferase activity.

Dimerization of Hmt1 is essential for its activity

Figure 4
Dimerization of Hmt1 is essential for its activity

(A and B) Gel-filtration [Superdex 200, (10/300) column] analysis of recombinant Hmt1-Dm (A) and Hmt1-Hm (B) mutant proteins. Upper panels: elution profile; lower panels: 2 μl of each fraction was subjected to SDS/PAGE followed by Coomassie Blue staining. (C) In vitro methylation assay of mutated proteins Hmt1-Dm (fractions 26 and 29) and Hmt1-Hm (fraction 26). 0.5 μg of each protein was used in the assay. WT Hmt1 is a positive control. (D) Time course experiment examining the methylation activity of the mutant Hmt1-Hm protein (0.5 μg in each reaction). The methyltransferase activity of Hmt1-Hm was detected by Western blot using antibodies against histone H3R2me1 and H3R2me2a. The reaction time in minutes is given on top.

Figure 4
Dimerization of Hmt1 is essential for its activity

(A and B) Gel-filtration [Superdex 200, (10/300) column] analysis of recombinant Hmt1-Dm (A) and Hmt1-Hm (B) mutant proteins. Upper panels: elution profile; lower panels: 2 μl of each fraction was subjected to SDS/PAGE followed by Coomassie Blue staining. (C) In vitro methylation assay of mutated proteins Hmt1-Dm (fractions 26 and 29) and Hmt1-Hm (fraction 26). 0.5 μg of each protein was used in the assay. WT Hmt1 is a positive control. (D) Time course experiment examining the methylation activity of the mutant Hmt1-Hm protein (0.5 μg in each reaction). The methyltransferase activity of Hmt1-Hm was detected by Western blot using antibodies against histone H3R2me1 and H3R2me2a. The reaction time in minutes is given on top.

The histone H3R2 methylation activity of Hmt1 is achieved through trans-interaction of two molecules of Hmt1

Since Hmt1 forms dimers to execute methylation activity, we wondered how dimerization affects its activity. Firstly, we constructed a fusion gene in which two copies of HMT1 gene were tandem ligated with a linker oligo of 5′-GGT GGC GGT GAA TTC GGT GGC-3′ sequence, encoding an Hmt1-G-G-G-E-F-G-G-Hmt1 fusion protein, named Hmt12 (Figure 5A). The recombinant Hmt12 was overexpressed in E. coli and purified to near homogeneity. The methyltransferase activity of Hmt12 was examined. The result showed that the recombinant Hmt12 had the histone H3R2 methylation activity (Figure 5F).

Hmt1 dimer methylates H3R2 in trans

Figure 5
Hmt1 dimer methylates H3R2 in trans

(AE) Schematic representations of the fusion proteins Hmt12 (A), Hmt12-Nm1/2 (B), Hmt12-ΔC1/2 (C), Hmt12-Nm1ΔC2 (D) and Hmt12-ΔC1Nm2 (E). The Nm and ΔC mutations are labelled as in Figure 3(A). The dimeric-interactions between two molecules are indicated by double lines. The linker-peptide is shown by a single line. The trans-active catalytic unit, which consists of an N-terminal SAM-binding/catalytic domain from one monomer and a C-terminal substrate-binding domain from its dimer partner, is marked using shadow in (D) and (E). (F and G) Methyltransferase activities of the WT (F) and mutant fusion proteins (G) were detected by Western blot using antibodies against H3R2me1 or H3R2me2a. The purified recombinant proteins were shown by Coomassie Blue-stained gels in top panels. Contl represents the no-enzyme control. Enzymes used were: 0.5 μg (F) or 1 μg (G). (H) Proposed model of how Hmt1 dimer catalyses H3R2 methylation in trans. The N-tail of histone H3 is indicated by broken line and the H3R2 is marked.

Figure 5
Hmt1 dimer methylates H3R2 in trans

(AE) Schematic representations of the fusion proteins Hmt12 (A), Hmt12-Nm1/2 (B), Hmt12-ΔC1/2 (C), Hmt12-Nm1ΔC2 (D) and Hmt12-ΔC1Nm2 (E). The Nm and ΔC mutations are labelled as in Figure 3(A). The dimeric-interactions between two molecules are indicated by double lines. The linker-peptide is shown by a single line. The trans-active catalytic unit, which consists of an N-terminal SAM-binding/catalytic domain from one monomer and a C-terminal substrate-binding domain from its dimer partner, is marked using shadow in (D) and (E). (F and G) Methyltransferase activities of the WT (F) and mutant fusion proteins (G) were detected by Western blot using antibodies against H3R2me1 or H3R2me2a. The purified recombinant proteins were shown by Coomassie Blue-stained gels in top panels. Contl represents the no-enzyme control. Enzymes used were: 0.5 μg (F) or 1 μg (G). (H) Proposed model of how Hmt1 dimer catalyses H3R2 methylation in trans. The N-tail of histone H3 is indicated by broken line and the H3R2 is marked.

Based on the Hmt12 fusion protein, we made several mutants. The Hmt12-Nm1/2 protein contains two G68R mutations in each N-terminal domain (Figure 5B). The Hmt12-ΔC1/2 contains two ΔC21+2 mutations in each C-terminal domain (Figure 5C). The Hmt12-Nm1ΔC2 contains one G68R mutation in the N-terminal domain of the first Hmt1 molecule and one ΔC21+2 mutation in the C-terminal domain of the second Hmt1 molecule (Figure 5D). These mutant fusion proteins were overexpressed and purified. Methyltransferase activity assays showed that the recombinant Hmt12-Nm1/2 and Hmt12-ΔC1/2 proteins could not methylate H3R2 (Figure 5G, lanes 1 and 2). These results were as expected because these mutant proteins have defects in either SAM binding or substrate binding (Figures 5F and 5G). In the Hmt12-Nm1ΔC2 mutant (Figure 5D), the first molecule has a defect in SAM binding and the second molecule has a defect in substrate binding. Presumably neither mutated molecule in this fusion protein was able to accomplish the methylation reaction on its own. Surprisingly, the recombinant Hmt12-Nm1ΔC2 exhibited H3R2 methylation activity (Figure 5G, lane 3), which was probably contributed by both the C-terminal domain of the first molecule and the N-terminal domain of the second one (Figure 5D). This result led us to propose a model that two opposing domains from two Hmt1 molecules constitute a catalytically active unit to catalyse H3R2 methylation: an N-terminal domain of one molecule binds SAM and a C-terminal domain of the other binds the substrate, and the interaction of two Hmt1 molecules contributes to methyltransferase activity in trans (Figure 5H). To test this model further, we made an Hmt12-ΔC1Nm2 mutant, which contains ΔC21+2 mutation in the first molecule and G68R mutation in the second one (Figure 5E). The recombinant Hmt12-ΔC1Nm2 protein was capable of methylating H3R2 (Figure 5G, lane 4), supporting the model of intermolecular trans-complementation to methyltransferase activity (Figure 5H).

Deletion of HMT1 does not affect global H3R2me2a level in yeast chromatin

Since Hmt1 methylates H3R2 in vitro, we therefore wanted to know whether Hmt1 methylates H3R2 in vivo. We examined H3R2 methylation level in hmt1Δ cells and found that the chromatin-associated H3R2me2a is not affected by HMT1 deletion (Figure 6A). Then we overexpressed Hmt1, Hmt1-Dm, Hmt1-Hm or Hmt1-Hm-Nm in yeast cells through a doxycycline-inducible system. The quantitative-PCR results showed that the mRNA of the WT and the mutated HMT1 was expressed at a comparable level upon induction (Figure 6B). We then examined H3R2 methylation level in these yeast strains and found that overexpressing Hmt1-Hm modestly increased H3R2me1 and significantly increased H3R2me2a (Figure 6C). These results suggest that the dimeric form of Hmt1 is active in vivo. Since H3R2me2a has been shown to be enriched at heterochromatin [11,35], we examined telomere silencing and telomere length in the cells overexpressing WT or mutant Hmt1. The results showed that neither telomere length nor silencing was affected (Figures 6D and 6E).

Overexpressing Hmt1-Hm increased H3R2me2a in vivo

Figure 6
Overexpressing Hmt1-Hm increased H3R2me2a in vivo

(A) Deletion of HMT1 causes little change of H3R2 methylation in vivo. The chromatin from WT or hmt1Δ yeast cells (two independent clones) was subjected to Western blot to detect the H3R2 methylation level. The antibodies used are indicated on the left. Histone H4 was used as internal control. (B) Relative expression of HMT1 (or hmt1 mutant) mRNA in strains containing pCM252, pCM252-HMT1, pCM252-hmt1-Dm and pCM252-hmt1-Hm after doxycycline induction. (C) Detection of the histone H3R2 methylation level in Hmt1-Hm-Nm, Hmt1, Hmt1-Dm and Hmt1-Hm after doxycycline induction. Histones were extracted from the indicated strains and histone H3R2 methylation was examined by Western blot. The antibodies used are shown on the left. (D) Telomere silencing assay. Upper schematic diagram shows that the URA3 reporter gene is inserted adjacent to the left telomere of chromosome VII. Yeast cells were cultured with doxycycline for 24 h. Serially diluted cells were spotted on doxycycline-containing (+Dox) YC–Trp medium with or without 5-FOA and then cultured at 30oC for 2 days before photographing sir2Δ cells were used as the positive control. (E) Telomere Southern blot analysis of the yeast strains overexpressing HMT1 (or hmt1 mutant). Genomic DNA was extracted from the indicated yeast cells after doxycycline induction for 24 h and subjected to telomere Southern blot analysis. Three independent clones for each strain were examined. The size markers are indicated on the left.

Figure 6
Overexpressing Hmt1-Hm increased H3R2me2a in vivo

(A) Deletion of HMT1 causes little change of H3R2 methylation in vivo. The chromatin from WT or hmt1Δ yeast cells (two independent clones) was subjected to Western blot to detect the H3R2 methylation level. The antibodies used are indicated on the left. Histone H4 was used as internal control. (B) Relative expression of HMT1 (or hmt1 mutant) mRNA in strains containing pCM252, pCM252-HMT1, pCM252-hmt1-Dm and pCM252-hmt1-Hm after doxycycline induction. (C) Detection of the histone H3R2 methylation level in Hmt1-Hm-Nm, Hmt1, Hmt1-Dm and Hmt1-Hm after doxycycline induction. Histones were extracted from the indicated strains and histone H3R2 methylation was examined by Western blot. The antibodies used are shown on the left. (D) Telomere silencing assay. Upper schematic diagram shows that the URA3 reporter gene is inserted adjacent to the left telomere of chromosome VII. Yeast cells were cultured with doxycycline for 24 h. Serially diluted cells were spotted on doxycycline-containing (+Dox) YC–Trp medium with or without 5-FOA and then cultured at 30oC for 2 days before photographing sir2Δ cells were used as the positive control. (E) Telomere Southern blot analysis of the yeast strains overexpressing HMT1 (or hmt1 mutant). Genomic DNA was extracted from the indicated yeast cells after doxycycline induction for 24 h and subjected to telomere Southern blot analysis. Three independent clones for each strain were examined. The size markers are indicated on the left.

DISCUSSION

Arginine methylation is a common PTM for proteins. The examination and identification of arginine methylation largely rely on both accurate proteomic analysis and highly specific antibody. Luckily, we have obtained a monoclonal antibody that specifically recognizes asymmetric dimethylation of histone H3R2 (Figure 2), allowing us to investigate the activity of yeast PRMT Hmt1 on histone H3R2.

Hmt1 methylates histone H3R2 in vitro (Figure 2). When overexpressed, Hmt1 appears to be capable of methylating H3R2 in vivo (Figure 6). To our knowledge, Hmt1 is the first methyltransferase for histone H3R2 identified in S. cerevisiae. Previously, Hmt1 has been reported to be responsible for methylation of histone H4R3 [29,30] and several mRNA-binding proteins [4,19,2628]. In addition to R2, other arginines in histone H3 could also be methylated by Hmt1 in vitro (Figure 2D), supporting the notion that Hmt1 has a wide spectrum of substrates. It won't be surprising if more proteins are found to be the substrates of Hmt1.

Hmt1 forms homodimers as well as hexamers in vitro (Figure 2C) [19]. Disruption of hexamerization in Hmt1-Hm mutant does not affect its methyltransferase activity in vitro (Figures 4B and 4C), but enhances its methyltransferase activity on histone H3R2 in vivo (Figure 6C), suggesting that oligomerization might play a regulatory role in Hmt1 activity. Dimerization of Hmt1 appears to be essential for its enzymatic activity, because the Hmt1-Dm mutant loses the ability of dimerization and exhibits no methyltransferase activity (Figures 4A and 4C). The activation of Hmt1 through dimerization seems not to be the result of an allosteric effect. In the fusion mutant Hmt12-Nm1ΔC2, two mutated Hmt1 molecules are fused together, with the N-terminal-mutated molecule defective in SAM binding and the C-terminal-truncated one defective in substrate binding (Figure 5D). Neither molecule in the fusion protein is active alone (Figures 3B and 3C). The methylation activity of Hmt12-Nm1ΔC2 towards histone H3R2 must be attributed to the intact domains of two Hmt1 molecules. In other words, the SAM binding and substrate binding occur in separate molecules of an Hmt1 dimer. Therefore, Hmt1 represents the first example of arginine methyltransferases that executes its activity through an intermolecular mechanism: the N-terminal Rossmann-fold domain of one molecule in an Hmt1 homodimer is responsible for SAM binding and the C-terminal domain of the other molecule is responsible for substrate binding, and the methylation of histone H3R2 requires discrete but different contributions from two Hmt1 molecules (Figure 5H). It will be of considerable interest to investigate whether this trans-mechanism of protein methylation is universal to other PRMTs that form the ‘head to tail’ dimer configuration [1825].

A previous study by Yu et al. [30] showed that deletion of HMT1 resulted in a decrease in histone H4R3 methylation and a modest defect in telomere silencing. These observations support the idea that histone H3R2 and/or H4R3 methylation play a role in maintaining heterochromatin structure and function. However, in our study deletion of HMT1 did not affect telomere silencing (result not shown). The methylation level of histone H3R2 is not affected by HMT1 deletion (Figure 6A), indicating a redundancy of more than one methyltransferase toward H3R2. Besides, the increase in histone H3R2me2a by overexpression of Hmt1-Hm does not affect telomere length or silencing (Figures 6D and 6E). Therefore, it remains elusive whether histone H3R2me2a is a bona fide telomeric heterochromatin mark. Further studies are needed to decipher the functions and mechanisms of Hmt1 and H3R2me2a in chromatin structure and function.

Abbreviations

     
  • 5-FOA

    5-fluoroorotic acid

  •  
  • ORF

    open reading frame

  •  
  • PRMT

    protein arginine methyltransferase

  •  
  • PTM

    post-translational modification

  •  
  • Rme1

    ω-NG-monomethylarginine

  •  
  • Rme2a

    ω-NG,NG-dimethylarginine (asymmetric dimethylarginine)

  •  
  • Rme2s

    ω-NG,N′G-dimethylarginine (symmetric dimethylarginine)

  •  
  • SAM

    S-adenosyl methionine

  •  
  • WT

    wild-type

  •  
  • YC

    yeast complete medium

AUTHOR CONTRIBUTION

Hong-Tao Li and Jin-Qiu Zhou proposed the subject, designed the experiments, interpreted the data and wrote the manuscript. Hong-Tao Li performed most of the experiments. Ting Gong performed the experiments of HMT1 overexpression and wrote the manuscript. Zhen Zhou and Yu-Ting Liu performed some experiments. Xiongwen Cao and Charlie Chen provided antibody against mono-methylated H3R2 for project initiation. Yongning He helped in Hmt1 structure analysis.

FUNDING

This work is supported by the Natural Science Foundation of China [grant number 31230040/31221001]; the Ministry of Science and Technology [grant number 2013CB910403/2011CB966301 (to J.-Q.Z.)]; and the Postdoctoral Fellowship Program of Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences [grant number 2011KIP503 (to H.-T.L)].

References

References
1
Kouzarides
T.
Chromatin modifications and their function
Cell
2007
, vol. 
128
 (pg. 
693
-
705
)
[PubMed]
2
Auclair
Y.
Richard
S.
The role of arginine methylation in the DNA damage response
DNA Repair
2013
, vol. 
12
 (pg. 
459
-
465
)
[PubMed]
3
Bedford
M.T.
Clarke
S.G.
Protein arginine methylation in mammals: who, what, and why
Mol. Cell
2009
, vol. 
33
 (pg. 
1
-
13
)
[PubMed]
4
Henry
M.F.
Silver
P.A.
A novel methyltransferase (Hmt1p) modifies poly(A)+-RNA-binding proteins
Mol. Cell. Biol.
1996
, vol. 
16
 (pg. 
3668
-
3678
)
[PubMed]
5
Lee
J.-H.
Cook
J.R.
Pollack
B.P.
Kinzy
T.G.
Norris
D.
Pestka
S.
Hsl7p, the yeast homologue of human JBP1, is a protein methyltransferase
Biochem. Biophys. Res. Commun.
2000
, vol. 
274
 (pg. 
105
-
111
)
[PubMed]
6
Niewmierzycka
A.
Clarke
S.
S-adenosylmethionine-dependent methylation in Saccharomyces cerevisiae: identification of a novel protein arginine methyltransferase
J. Biol. Chem.
1999
, vol. 
274
 (pg. 
814
-
824
)
[PubMed]
7
Young
B.D.
Weiss
D.I.
Zurita-Lopez
C.I.
Webb
K.J.
Clarke
S.G.
McBride
A.E.
Identification of methylated proteins in the yeast small ribosomal subunit: a role for SPOUT methyltransferases in protein arginine methylation
Biochemistry
2012
, vol. 
51
 (pg. 
5091
-
5104
)
[PubMed]
8
Bedford
M.T.
Richard
S.
Arginine methylation: an emerging regulatorof protein function
Mol. Cell
2005
, vol. 
18
 (pg. 
263
-
272
)
[PubMed]
9
Wei
H.
Mundade
R.
Lange
K.
Lu
T.
Protein arginine methylation of non-histone proteins and its role in diseases
Cell Cycle
2013
, vol. 
13
 (pg. 
32
-
41
)
[PubMed]
10
Yang
Y.
Bedford
M.T.
Protein arginine methyltransferases and cancer
Nat. Rev. Cancer
2013
, vol. 
13
 (pg. 
37
-
50
)
[PubMed]
11
Guccione
E.
Bassi
C.
Casadio
F.
Martinato
F.
Cesaroni
M.
Schuchlautz
H.
Luscher
B.
Amati
B.
Methylation of histone H3R2 by PRMT6 and H3K4 by an MLL complex are mutually exclusive
Nature
2007
, vol. 
449
 (pg. 
933
-
937
)
[PubMed]
12
Hyllus
D.
Stein
C.
Schnabel
K.
Schiltz
E.
Imhof
A.
Dou
Y.
Hsieh
J.
Bauer
U.M.
PRMT6-mediated methylation of R2 in histone H3 antagonizes H3 K4 trimethylation
Genes Dev.
2007
, vol. 
21
 (pg. 
3369
-
3380
)
[PubMed]
13
Harrison
M.J.
Tang
Y.H.
Dowhan
D.H.
Protein arginine methyltransferase 6 regulates multiple aspects of gene expression
Nucleic Acids Res.
2010
, vol. 
38
 (pg. 
2201
-
2216
)
[PubMed]
14
Sgarra
R.
Lee
J.
Tessari
M.A.
Altamura
S.
Spolaore
B.
Giancotti
V.
Bedford
M.T.
Manfioletti
G.
The AT-hook of the chromatin architectural transcription factor high mobility group A1a is arginine-methylated by protein arginine methyltransferase 6
J. Biol. Chem.
2006
, vol. 
281
 (pg. 
3764
-
3772
)
[PubMed]
15
Boulanger
M.-C.
Liang
C.
Russell
R.S.
Lin
R.
Bedford
M.T.
Wainberg
M.A.
Richard
S.
Methylation of Tat by PRMT6 regulates human immunodeficiency virus type 1 gene expression
J. Virol.
2005
, vol. 
79
 (pg. 
124
-
131
)
[PubMed]
16
El-Andaloussi
N.
Valovka
T.
Toueille
M.
Steinacher
R.
Focke
F.
Gehrig
P.
Covic
M.
Hassa
P.O.
Schär
P.
Hübscher
U.
Hottiger
M.O.
Arginine methylation regulates DNA polymerase β
Mol. Cell
2006
, vol. 
22
 (pg. 
51
-
62
)
[PubMed]
17
Migliori
V.
Muller
J.
Phalke
S.
Low
D.
Bezzi
M.
Mok
W.C.
Sahu
S.K.
Gunaratne
J.
Capasso
P.
Bassi
C.
, et al. 
Symmetric dimethylation of H3R2 is a newly identified histone mark that supports euchromatin maintenance
Nat. Struct. Mol. Biol.
2009
, vol. 
19
 (pg. 
136
-
144
)
18
Sun
L.
Wang
M.
Lv
Z.
Yang
N.
Liu
Y.
Bao
S.
Gong
W.
Xu
R.M.
Structural insights into protein arginine symmetric dimethylation by PRMT5
Proc. Natl. Acad. Sci. U.S.A.
2011
, vol. 
108
 (pg. 
20538
-
20543
)
[PubMed]
19
Weiss
V.H.
McBride
A.E.
Soriano
M.A.
Filman
D.J.
Silver
P.A.
Hogle
J.M.
The structure and oligomerization of the yeast arginine methyltransferase, Hmt1
Nat. Struct. Biol.
2000
, vol. 
7
 (pg. 
1165
-
1171
)
[PubMed]
20
Cheng
Y.
Frazier
M.
Lu
F.
Cao
X.
Redinbo
M.R.
Crystal structure of the plant epigenetic protein arginine methyltransferase 10
J. Mol. Biol.
2011
, vol. 
414
 (pg. 
106
-
122
)
[PubMed]
21
Zhang
X.
Zhou
L.
Cheng
X.
Crystal structure of the conserved core of protein arginine methyltransferase PRMT3
EMBO J.
2000
, vol. 
19
 (pg. 
3509
-
3519
)
[PubMed]
22
Zhang
X.
Cheng
X.
Structure of the predominant protein arginine methyltransferase PRMT1 and analysis of its binding to substrate peptides
Structure
2003
, vol. 
11
 (pg. 
509
-
520
)
[PubMed]
23
Troffer-Charlier
N.
Cura
V.
Hassenboehler
P.
Moras
D.
Cavarelli
J.
Functional insights from structures of coactivator-associated arginine methyltransferase 1 domains
EMBO J.
2007
, vol. 
26
 (pg. 
4391
-
4401
)
[PubMed]
24
Yue
W.W.
Hassler
M.
Roe
S.M.
Thompson-Vale
V.
Pearl
L.H.
Insights into histone code syntax from structural and biochemical studies of CARM1 methyltransferase
EMBO J.
2007
, vol. 
26
 (pg. 
4402
-
4412
)
[PubMed]
25
Cura
V.
Troffer-Charlier
N.
Lambert
M.A.
Bonnefond
L.
Cavarelli
J.
Cloning, expression, purification and preliminary X-ray crystallographic analysis of mouse protein arginine methyltransferase 7
Acta Crystallogr. F Struct. Biol. Commun.
2014
, vol. 
70
 (pg. 
80
-
86
)
[PubMed]
26
Shen
E.C.
Henry
M.F.
Weiss
V.H.
Valentini
S.R.
Silver
P.A.
Lee
M.S.
Arginine methylation facilitates the nuclear export of hnRNP proteins
Genes Dev.
1998
, vol. 
12
 (pg. 
679
-
691
)
[PubMed]
27
Lipson
R.S.
Webb
K.J.
Clarke
S.G.
Rmt1 catalyzes zinc-finger independent arginine methylation of ribosomal protein Rps2 in Saccharomyces cerevisiae
Biochem. Biophys. Res. Commun.
2010
, vol. 
391
 (pg. 
1658
-
1662
)
[PubMed]
28
Chen
Y.C.
Milliman
E.J.
Goulet
I.
Cote
J.
Jackson
C.A.
Vollbracht
J.A.
Yu
M.C.
Protein arginine methylation facilitates cotranscriptional recruitment of pre-mRNA splicing factors
Mol. Cell. Biol.
2010
, vol. 
30
 (pg. 
5245
-
5256
)
[PubMed]
29
Lacoste
N.
Utley
R.T.
Hunter
J.M.
Poirier
G.G.
Cote
J.
Disruptor of telomeric silencing-1 is a chromatin-specific histone H3 methyltransferase
J. Biol. Chem.
2002
, vol. 
277
 (pg. 
30421
-
30424
)
[PubMed]
30
Yu
M.C.
Lamming
D.W.
Eskin
J.A.
Sinclair
D.A.
Silver
P.A.
The role of protein arginine methylation in the formation of silent chromatin
Genes Dev.
2006
, vol. 
20
 (pg. 
3249
-
3254
)
[PubMed]
31
Messier
V.
Zenklusen
D.
Michnick
S.W.
A nutrient-responsive pathway that determines M phase timing through control of B-cyclin mRNA stability
Cell
2013
, vol. 
153
 (pg. 
1080
-
1093
)
[PubMed]
32
Belli
G.
Gari
E.
Piedrafita
L.
Aldea
M.
Herrero
E.
An activator/repressor dual system allows tight tetracycline-regulated gene expression in budding yeast
Nucleic Acids Res.
1998
, vol. 
26
 (pg. 
942
-
947
)
[PubMed]
33
Teng
S.-C.
Zakian
V.A.
Telomere-telomere recombination is an efficient bypass pathway for telomere maintenance in Saccharomyces cerevisiae
Mol. Cell. Biol.
1999
, vol. 
19
 (pg. 
8083
-
8093
)
[PubMed]
34
Peng
J.
Zhou
J.Q.
The tail-module of yeast mediator complex is required for telomere heterochromatin maintenance
Nucleic Acids Res.
2012
, vol. 
40
 (pg. 
581
-
593
)
[PubMed]
35
Kirmizis
A.
Santos-Rosa
H.
Penkett
C.J.
Singer
M.A.
Vermeulen
M.
Mann
M.
Bahler
J.
Green
R.D.
Kouzarides
T.
Arginine methylation at histone H3R2 controls deposition of H3K4 trimethylation
Nature
2007
, vol. 
449
 (pg. 
928
-
932
)
[PubMed]
36
Sikorski
R.S.
Hieter
P.
A system of shuttle vectors and yeast host strains designed for efficient manipulation of DNA in Saccharomyces cerevisiae
Genetics
1989
, vol. 
122
 (pg. 
19
-
27
)
[PubMed]

Author notes

The crystal structure of yeast arginine methyltransferase Hmt1 will appear in the PDB under accession code 1G6Q.