Sigma-1 receptor (Sig-1R) is an intracellular chaperone protein with many ligands, located at the endoplasmic reticulum (ER). Binding of cocaine to Sig-1R has previously been found to modulate endothelial functions. In the present study, we show that cocaine dramatically inhibits store-operated Ca2+ entry (SOCE), a Ca2+ influx mechanism promoted by depletion of intracellular Ca2+ stores, in rat brain microvascular endothelial cells (RBMVEC). Using either Sig-1R shRNA or pharmacological inhibition with the unrelated Sig-1R antagonists BD-1063 and NE-100, we show that cocaine-induced SOCE inhibition is dependent on Sig-1R. In addition to revealing new insight into fundamental mechanisms of cocaine-induced changes in endothelial function, these studies indicate an unprecedented role for Sig-1R as a SOCE inhibitor.

INTRODUCTION

Sigma-1 receptors (Sig-1Rs) are chaperone proteins residing at the interface between endoplasmic reticulum (ER) and mitochondria [1,2]; upon stimulation, they translocate to other cell regions [3,4]. Sig-1Rs interact with various targets, including ion channels, G protein-coupled receptors, tyrosine kinase receptors and kinases, to regulate cellular functions [3,5]. Stimulating factors include Sig-1R agonists and ER stress [2]. Moreover, activated Sig-1Rs typically associate with inositol 1,4,5-trisphosphate receptor type 3, favouring an increase in cytosolic Ca2+ concentration [2,6].

Store-operated Ca2+ entry (SOCE) [7,8] is an important mechanism for Ca2+ influx, described in a variety of cells, including the endothelium [8,9]. Physiologically, SOCE is activated by depletion of intracellular Ca2+ pools following stimulation of plasma membrane receptors that couple to phosphoinositide hydrolysis and inositol 1,4,5-trisphosphate generation. These decreases in ER Ca2+ content are sensed by the ER Ca2+ sensor, stromal interaction molecule 1 (STIM1) [8,10], resulting in activation of Ca2+ channels in the plasma membrane termed Orai1, also known as Ca2+ release-activated Ca2+ channels [8,11].

Since cocaine is a Sig-1R agonist [12] and cocaine-induced activation of Sig-1Rs was reported to modulate the function of brain microvascular endothelium [13,14], we examined the Sig-1R-mediated effect of cocaine on SOCE in rat brain microvascular endothelial cells (RBMVEC).

EXPERIMENTAL PROCEDURES

Chemicals

All chemicals were from Sigma–Aldrich, unless otherwise mentioned. Cocaine hydrochloride was generously supplied by NIDA; NE-100 hydrochloride was from Santa Cruz Biotechnology.

Cell culture

RBMVEC from Cell Applications, Inc. were cultured in rat brain endothelial basal medium and rat brain endothelial growth supplement, according to the manufacturer's instructions (Cell Applications, Inc.). Cells were grown in T75 flasks coated with attachment factor (Cell Applications, Inc.) until 80% confluent. Cells were plated on round coverslips of 25 mm diameter coated with human fibronectin (Discovery Labware) for measurements of cytosolic Ca2+ and membrane potential and on six-well plates for Western blot analysis.

Cell transfections

RBMVEC were transfected 24 h after plating with four unique 29mer shRNA constructs Oprs1 (Sig-1R) rat, with the following sequences: TF711128A (GCCATTCGGGACGATACTGGGCTGAGATT), TF711128B (ATCATCTCTGGCACTTTCCACCAGTGGAG), TF711128C (CCTGTTTCTGACTATTGTGGCGGTGCTGA), TF711128D (TTGCACGCCTCGCTGTCTGAGTACGTGCT), in pRFP-C-RS vector or scrambled negative control non-effective shRNA in pRFP-C-RS (OriGene Technologies), using Cytofect endothelial cell transfection kit (Cell Applications, Inc.). Throughout the manuscript, the Sig-1R shRNA constructs are abbreviated Sig-1R shRNA (A), Sig-1R shRNA (B), Sig-1R shRNA (C) and Sig-1R shRNA (D).

Western blot analysis

Whole-cell lysates were separated on Mini-PROTEAN TGX 4–20% gels (Bio-Rad) by SDS/PAGE followed by immunoblotting. Proteins were transferred to an Odyssey nitrocellulose membrane (Li-Cor Biosciences). After blocking with Odyssey blocking buffer, the membranes were incubated overnight with primary antibody against Sig-1R (OPRS1, rabbit polyclonal, 1:1000, OriGene Technologies). An antibody against β-actin (mouse monoclonal, 1: 10,000; Sigma–Aldrich) was used to confirm equal protein loading. Membranes were washed with TBS-Tween 20 (TBST) and incubated with the secondary antibodies: IRDye 800CW conjugated goat anti-rabbit IgG and IRDye 680 conjugated goat anti-mouse IgG (1 : 10000, 1 h at 21°C). Membranes were then washed in TBST and scanned using an Li-Cor Odyssey Infrared Imager and analysed using Odyssey software.

Cytosolic Ca2+ measurement

Intracellular Ca2+ levels were evaluated as previously described [15,16]. Briefly, cells were incubated with 5 μM Fura-2 AM (Molecular Probes) in Hanks’ balanced salt solution at 21°C for 1 h and washed with dye-free Hanks’ balanced salt solution. Coverslips were mounted in an open bath chamber (QR-40LP; Warner Instruments) on the stage of an inverted microscope Nikon Eclipse TiE (Nikon Inc.), equipped with a Perfect Focus System and a Photometrics CoolSnap HQ2 charge-coupled device camera (Photometrics). Ca2+ levels were determined ratiometrically using Fura-2 AM fluorescence (emission 510 nm), following alternate excitation at 340 and 380 nm. This was acquired at a frequency of 0.25 Hz, and the relative 340 nm/380 nm fluorescence ratio was further plotted as a function of time. Images were acquired/analysed using NIS-Elements AR software (Nikon, Inc.).

Measurement of membrane potential

The relative changes in membrane potential of single neurons were evaluated using bis-(1,3-dibutylbarbituric acid) trimethine oxonol, DiBAC4(3) (Invitrogen), a slow response voltage-sensitive dye, as previously described [15,16]. Upon membrane hyperpolarization, the dye concentrates in the cell membrane, leading to a decrease in fluorescence intensity, whereas depolarization induces the sequestration of the dye into the cytosol, resulting in an increase in the fluorescence intensity. RBMVEC were incubated for 30 min in HBSS containing 0.5 mM DiBAC4(3) and the fluorescence monitored at 0.17 Hz, excitation/emission: 480 nm/540 nm. Calibration of DiBAC4(3) fluorescence following background subtraction was performed using the Na+–K+ ionophore gramicidin in Na+-free physiological solution and various concentrations of K+ (to alter membrane potential) and N-methylglucamine (to maintain osmolarity). Under these conditions, the membrane potential was approximately equal to the K+ equilibrium potential determined by the Nernst equation. The intracellular K+ and Na+ concentration were assumed to be 130 and 10 mM, respectively.

Statistical analysis

Data are expressed as mean ± S.E.M. One-way ANOVA followed by post hoc analysis using Bonferroni and Tukey tests were used to evaluate significant differences between groups; P<0.05 was considered statistically significant.

RESULTS AND DISCUSSION

To determine the effect of cocaine on stored-operated Ca2+ entry, we used a classical protocol to induce SOCE. Briefly, ER Ca2+ stores were depleted in Fura-2-loaded cells using the sarcoplasmic/ER Ca2+ ATPase inhibitor thapsigargin (1 μM) in the absence of extracellular Ca2+ (Figure 1A). No differences in the resultant rise in cytosolic Ca2+ were observed in the presence or absence of cocaine (3 μM, 15 min) indicating no effect of cocaine on ER Ca2+ content. SOCE was then stimulated by the addition of Ca2+ (1 mM). Surprisingly, a  ∼50% decrease in SOCE was observed in cocaine-pretreated cells (Figures 1A and 1B).

Cocaine inhibits SOCE in brain microvascular endothelial cells: pharmacological evidence of Sig-1R involvement

Figure 1
Cocaine inhibits SOCE in brain microvascular endothelial cells: pharmacological evidence of Sig-1R involvement

(A) Averaged traces of Fura-2 fluorescence ratio (F340/F380) indicating the modulation of store-operated Ca2+ entry by pretreatment with cocaine (Coc, 3 μM, 15 min, n=64 cells) alone, cocaine in the presence of Sig-R antagonists BD-1063 (BD, 10 μM, 20 min, n=68 cells) or NE-100 (NE, 3 μM, 20 min, n=57 cells) in RBMVEC cells. Cocaine reduced the SOCE amplitude as compared with control RBMVEC (n=61 cells); the reduction was prevented by treatment with Sig-1R antagonists. (B) Comparison of the amplitudes and areas under curve of SOCE elicited by cocaine in each of the conditions mentioned before. *P<0.05 as compared with control. (C) Cocaine does not change the resting membrane potential (RMP) of RBMVEC: averaged traces and comparison of medium RMP of cocaine-treated (n=63 cells) and control, untreated cells (n=47 cells); the arrow indicates the moment of cocaine application.

Figure 1
Cocaine inhibits SOCE in brain microvascular endothelial cells: pharmacological evidence of Sig-1R involvement

(A) Averaged traces of Fura-2 fluorescence ratio (F340/F380) indicating the modulation of store-operated Ca2+ entry by pretreatment with cocaine (Coc, 3 μM, 15 min, n=64 cells) alone, cocaine in the presence of Sig-R antagonists BD-1063 (BD, 10 μM, 20 min, n=68 cells) or NE-100 (NE, 3 μM, 20 min, n=57 cells) in RBMVEC cells. Cocaine reduced the SOCE amplitude as compared with control RBMVEC (n=61 cells); the reduction was prevented by treatment with Sig-1R antagonists. (B) Comparison of the amplitudes and areas under curve of SOCE elicited by cocaine in each of the conditions mentioned before. *P<0.05 as compared with control. (C) Cocaine does not change the resting membrane potential (RMP) of RBMVEC: averaged traces and comparison of medium RMP of cocaine-treated (n=63 cells) and control, untreated cells (n=47 cells); the arrow indicates the moment of cocaine application.

Since cocaine is a Sig-1R agonist [12], we assessed the possibility that Sig-1R mediates cocaine-induced SOCE inhibition. Pretreatment with the selective Sig-1R antagonists BD-1063 (10 μM, 20 min) [17] or NE-100 (3 μM, 20 min) [18,19], completely eliminated cocaine-induced SOCE inhibition (Figures 1A and 1B).

To exclude any bias due to potential effects of cocaine on membrane potential, we examined the effect of cocaine on membrane potential in RBMVEC loaded with a voltage-sensitive dye, DiBAC4(3) [15]. We observed no changes in membrane potential in response to cocaine application (Figure 1C).

Finally, RBMVECs were transfected with four different Sig-1R shRNA constructs. Western analysis revealed that Sig-1R expression was decreased by 22.5±2.5% (n=3 independent experiments) after transfection with Sig-1R shRNA (B) (ATCATCTCTGGCACTT TCCACCAGTGGAG) and 28±4.3% (n=3) after transfection with Sig-1R shRNA (D) (TTGCACGCCTCGCTGTCTGAGTACGTGCT). Sig-1R shRNA (C) was less efficacious in knocking down Sig-1R, and (A) was ineffective; these constructs were not used in the subsequent functional studies. Fluorescence microscopic analysis of red fluorescent protein (RFP) expression revealed ∼60% transfection efficiency. Since the 22.5±2.5% and 28±4.3% knockdowns observed by Western analysis were based on whole populations, the actual knockdowns in transfected cells (selectively measured in SOCE assay) were 45.6% for Sig-1R shRNA (B) and 56.8% for Sig-1R shRNA (D). As depicted in Figures 2B and 2C, under these conditions, cocaine again failed to inhibit SOCE. Considered collectively, these findings reveal that cocaine inhibits SOCE in cerebral microvascular endothelial cells via Sig-1R activation.

Knockdown of Sig-1Rs prevents cocaine-induced SOCE inhibition

Figure 2
Knockdown of Sig-1Rs prevents cocaine-induced SOCE inhibition

(A) RBMVEC express Sig-1R protein; Sig-1R protein expression is significantly reduced by transfection with Sig-1R shRNA constructs B and D, but not altered by transfection with scrambled negative control non-effective shRNA–RFP (*P<0.05 as compared with control untransfected and with scrambled shRNA transfected conditions). Immunoblot on the left is representative of three independent experiments; quantifications are indicated on the right. (B) Averaged traces of Fura-2 fluorescence ratio (F340/F380) revealing that SOCE inhibition by cocaine is reversed by Sig-1R knockdown using shRNA constructs B and D, but not by scrambled shRNA. (C) Comparison of the amplitudes and areas under curve of SOCE elicited by cocaine in naive RBMVEC (n=64 cells) or RBMVEC transfected with scrambled shRNA (n=54 cells), Sig-1R shRNA (B) (n=59 cells) or Sig-1R shRNA (D) (n=62 cells); *P< 0.05 as compared with cocaine.

Figure 2
Knockdown of Sig-1Rs prevents cocaine-induced SOCE inhibition

(A) RBMVEC express Sig-1R protein; Sig-1R protein expression is significantly reduced by transfection with Sig-1R shRNA constructs B and D, but not altered by transfection with scrambled negative control non-effective shRNA–RFP (*P<0.05 as compared with control untransfected and with scrambled shRNA transfected conditions). Immunoblot on the left is representative of three independent experiments; quantifications are indicated on the right. (B) Averaged traces of Fura-2 fluorescence ratio (F340/F380) revealing that SOCE inhibition by cocaine is reversed by Sig-1R knockdown using shRNA constructs B and D, but not by scrambled shRNA. (C) Comparison of the amplitudes and areas under curve of SOCE elicited by cocaine in naive RBMVEC (n=64 cells) or RBMVEC transfected with scrambled shRNA (n=54 cells), Sig-1R shRNA (B) (n=59 cells) or Sig-1R shRNA (D) (n=62 cells); *P< 0.05 as compared with cocaine.

Cocaine is well defined as a modulator of endothelial function and has been shown to increase blood–brain barrier permeability [13,20] and facilitate transmigration of inflammatory leucocytes into the brain [2123]. Involvement of Sig-1R in this effect has also been established [13,14]. What was not previously recognized, however, is the possibility that these effects of cocaine and Sig-1R on endothelial permeability and activation could be Ca2+-dependent. However, changes in Ca2+ concentration are well known to modulate a wide variety of endothelial functions [24] including barrier permeability [25], endothelial proliferation [9,26] and expression of adhesion molecules responsible for inflammatory cell recruitment [27]. Hence, the current investigation provides a new role for SOCE modulation in cocaine- and Sig-1R-induced changes in endothelial function.

Based on the present findings, Sig-1Rs can be added to the growing list of endogenous molecules with the capacity to modulate SOCE [28]. Importantly, Sig-1Rs appear to mediate SOCE termination, the mechanisms of which have remained elusive.

Although we have not defined this mechanism in the current study, there are several possibilities ranging from interfering with STIM–Orai interaction to kinase modulation. Indeed, Sig-1R has been shown to modulate the functions of p38 mitogen-activated protein kinase (MAPK) [29], extracellular-signal-regulated kinases (ERK)1/2 [30] and calcineurin [31], all of which regulate STIM1 phosphorylation [3234]. Moreover, both STIM1 [33,35] and Orai1 [36,37] are known to be negatively regulated by phosphorylation. Future investigations may provide further insight into the novel biochemical mechanism.

AUTHOR CONTRIBUTION

Cristina Brailoiu, Elena Deliu, Linda Console-Bram, Jonathan Soboloff and Eugen Brailoiu performed experiments and analysed data. Cristina Brailoiu and Elena Deliu drafted the manuscript. Mary Abood, Ellen Unterwald and Jonathan Soboloff analysed data and revised the manuscript critically for important intellectual content. Eugen Brailoiu designed the study. All authors reviewed the results, read and approved the final version of the manuscript.

FUNDING

This work was supported by the NIH [grant numbers DA035926 (to M.E.A.) and P30DA013429 (to E.M.U.)].

Abbreviations

     
  • ER

    endoplasmic reticulum

  •  
  • RBMVEC

    rat brain microvascular endothelial cells

  •  
  • RFP

    red fluorescent protein

  •  
  • Sig-1R

    sigma-1 receptor

  •  
  • SOCE

    store-operated calcium entry

  •  
  • STIM1

    stromal interaction molecule 1

References

References
1
Hayashi
T.
Rizzuto
R.
Hajnoczky
G.
Su
T.P.
MAM: more than just a housekeeper
Trends Cell Biol.
2009
, vol. 
19
 (pg. 
81
-
88
)
[PubMed]
2
Hayashi
T.
Su
T.P.
Sigma-1 receptor chaperones at the ER-mitochondrion interface regulate Ca(2+) signaling and cell survival
Cell
2007
, vol. 
131
 (pg. 
596
-
610
)
[PubMed]
3
Su
T.P.
Hayashi
T.
Maurice
T.
Buch
S.
Ruoho
A.E.
The sigma-1 receptor chaperone as an inter-organelle signaling modulator
Trends Pharmacol. Sci.
2010
, vol. 
31
 (pg. 
557
-
566
)
[PubMed]
4
Hayashi
T.
Su
T.P.
Intracellular dynamics of sigma-1 receptors (sigma(1) binding sites) in NG108-15 cells
J. Pharmacol. Exp. Ther.
2003
, vol. 
306
 (pg. 
726
-
733
)
[PubMed]
5
Kourrich
S.
Su
T.P.
Fujimoto
M.
Bonci
A.
The sigma-1 receptor: roles in neuronal plasticity and disease
Trends Neurosci.
2012
, vol. 
35
 (pg. 
762
-
771
)
[PubMed]
6
Tsai
S.Y.
Hayashi
T.
Mori
T.
Su
T.P.
Sigma-1 receptor chaperones and diseases
Cent. Nerv. Syst. Agents Med. Chem.
2009
, vol. 
9
 (pg. 
184
-
189
)
[PubMed]
7
Hogan
P.G.
Rao
A.
Store-operated calcium entry: mechanisms and modulation
Biochem. Biophys. Res. Commun.
2015
, vol. 
460
 (pg. 
40
-
49
)
[PubMed]
8
Redondo
P.C.
Rosado
J.A.
Store-operated calcium entry: unveiling the calcium handling signalplex
Int. Rev. Cell Mol. Biol.
2015
, vol. 
316
 (pg. 
183
-
226
)
[PubMed]
9
Abdullaev
I.F.
Bisaillon
J.M.
Potier
M.
Gonzalez
J.C.
Motiani
R.K.
Trebak
M.
Stim1 and Orai1 mediate CRAC currents and store-operated calcium entry important for endothelial cell proliferation
Circ. Res.
2008
, vol. 
103
 (pg. 
1289
-
1299
)
[PubMed]
10
Smyth
J.T.
Beg
A.M.
Wu
S.
Putney
J.W.
Jr.
Rusan
N.M.
Phosphoregulation of STIM1 leads to exclusion of the endoplasmic reticulum from the mitotic spindle
Curr. Biol.
2012
, vol. 
22
 (pg. 
1487
-
1493
)
[PubMed]
11
Luik
R.M.
Wu
M.M.
Buchanan
J.
Lewis
R.S.
The elementary unit of store-operated Ca2+ entry: local activation of CRAC channels by STIM1 at ER-plasma membrane junctions
J. Cell. Biol.
2006
, vol. 
174
 (pg. 
815
-
825
)
[PubMed]
12
Sharkey
J.
Glen
K.A.
Wolfe
S.
Kuhar
M.J.
Cocaine binding at sigma receptors
Eur. J. Pharmacol.
1988
, vol. 
149
 (pg. 
171
-
174
)
[PubMed]
13
Yao
H.
Duan
M.
Buch
S.
Cocaine-mediated induction of platelet-derived growth factor: implication for increased vascular permeability
Blood
2011
, vol. 
117
 (pg. 
2538
-
2547
)
[PubMed]
14
Yao
H.
Kim
K.
Duan
M.
Hayashi
T.
Guo
M.
Morgello
S.
Prat
A.
Wang
J.
Su
T.P.
Buch
S.
Cocaine hijacks sigma1 receptor to initiate induction of activated leukocyte cell adhesion molecule: implication for increased monocyte adhesion and migration in the CNS
J. Neurosci.
2011
, vol. 
31
 (pg. 
5942
-
5955
)
[PubMed]
15
Altmann
J.B.
Yan
G.
Meeks
J.F.
Abood
M.E.
Brailoiu
E.
Brailoiu
G.C.
G protein-coupled estrogen receptor-mediated effects on cytosolic calcium and nanomechanics in brain microvascular endothelial cells
J. Neurochem.
2015
, vol. 
133
 (pg. 
629
-
639
)
[PubMed]
16
Barr
J.L.
Deliu
E.
Brailoiu
G.C.
Zhao
P.
Yan
G.
Abood
M.E.
Unterwald
E.M.
Brailoiu
E.
Mechanisms of activation of nucleus accumbens neurons by cocaine via sigma-1 receptor-inositol 1,4,5-trisphosphate-transient receptor potential canonical channel pathways
Cell Calcium
2015
, vol. 
58
 (pg. 
196
-
207
)
[PubMed]
17
Matsumoto
R.R.
Bowen
W.D.
Tom
M.A.
Vo
V.N.
Truong
D.D.
De Costa
B.R.
Characterization of two novel sigma receptor ligands: antidystonic effects in rats suggest sigma receptor antagonism
Eur. J. Pharmacol.
1995
, vol. 
280
 (pg. 
301
-
310
)
[PubMed]
18
Berardi
F.
Ferorelli
S.
Colabufo
N.A.
Leopoldo
M.
Perrone
R.
Tortorella
V.
A multireceptorial binding reinvestigation on an extended class of sigma ligands: N-[omega-(indan-1-yl and tetralin-1-yl)alkyl] derivatives of 3,3-dimethylpiperidine reveal high affinities towards sigma1 and EBP sites
Bioorg. Med. Chem.
2001
, vol. 
9
 (pg. 
1325
-
1335
)
[PubMed]
19
Chaki
S.
Okuyama
S.
Ogawa
S.
Tanaka
M.
Muramatsu
M.
Nakazato
A.
Tomisawa
K.
Solubilization and characterization of binding sites for [3H]NE-100, a novel and potent sigma 1 ligand, from guinea pig brain
Life Sci.
1996
, vol. 
59
 (pg. 
1331
-
1340
)
[PubMed]
20
Dhillon
N.K.
Peng
F.
Bokhari
S.
Callen
S.
Shin
S.H.
Zhu
X.
Kim
K.J.
Buch
S.J.
Cocaine-mediated alteration in tight junction protein expression and modulation of CCL2/CCR2 axis across the blood–brain barrier: implications for HIV-dementia
J. Neuroimmune Pharmacol.
2008
, vol. 
3
 (pg. 
52
-
56
)
[PubMed]
21
Fiala
M.
Eshleman
A.J.
Cashman
J.
Lin
J.
Lossinsky
A.S.
Suarez
V.
Yang
W.
Zhang
J.
Popik
W.
Singer
E.
, et al. 
Cocaine increases human immunodeficiency virus type 1 neuroinvasion through remodeling brain microvascular endothelial cells
J. Neurovirol.
2005
, vol. 
11
 (pg. 
281
-
291
)
[PubMed]
22
Fiala
M.
Gan
X.H.
Zhang
L.
House
S.D.
Newton
T.
Graves
M.C.
Shapshak
P.
Stins
M.
Kim
K.S.
Witte
M.
Chang
S.L.
Cocaine enhances monocyte migration across the blood–brain barrier. Cocaine's connection to AIDS dementia and vasculitis?
Adv. Exp. Med. Biol.
1998
, vol. 
437
 (pg. 
199
-
205
)
[PubMed]
23
Gan
X.
Zhang
L.
Berger
O.
Stins
M.F.
Way
D.
Taub
D.D.
Chang
S.L.
Kim
K.S.
House
S.D.
Weinand
M.
, et al. 
Cocaine enhances brain endothelial adhesion molecules and leukocyte migration
Clin. Immunol.
1999
, vol. 
91
 (pg. 
68
-
76
)
[PubMed]
24
Tran
Q.K.
Watanabe
H.
Calcium signalling in the endothelium
Handb. Exp. Pharmacol.
2006
(pg. 
145
-
187
)
25
Wu
S.
Cioffi
E.A.
Alvarez
D.
Sayner
S.L.
Chen
H.
Cioffi
D.L.
King
J.
Creighton
J.R.
Townsley
M.
Goodman
S.R.
Stevens
T.
Essential role of a Ca2+-selective, store-operated current (ISOC) in endothelial cell permeability: determinants of the vascular leak site
Circ. Res.
2005
, vol. 
96
 (pg. 
856
-
863
)
[PubMed]
26
Li
J.
Cubbon
R.M.
Wilson
L.A.
Amer
M.S.
McKeown
L.
Hou
B.
Majeed
Y.
Tumova
S.
Seymour
V.A.
Taylor
H.
, et al. 
Orai1 and CRAC channel dependence of VEGF-activated Ca2+ entry and endothelial tube formation
Circ. Res.
2011
, vol. 
108
 (pg. 
1190
-
1198
)
[PubMed]
27
Gandhirajan
R.K.
Meng
S.
Chandramoorthy
H.C.
Mallilankaraman
K.
Mancarella
S.
Gao
H.
Razmpour
R.
Yang
X.F.
Houser
S.R.
Chen
J.
, et al. 
Blockade of NOX2 and STIM1 signaling limits lipopolysaccharide-induced vascular inflammation
J. Clin. Invest.
2013
, vol. 
123
 (pg. 
887
-
902
)
[PubMed]
28
Soboloff
J.
Rothberg
B.S.
Madesh
M.
Gill
D.L.
STIM proteins: dynamic calcium signal transducers
Nat. Rev. Mol. Cell Biol.
2012
, vol. 
13
 (pg. 
549
-
565
)
[PubMed]
29
Moon
J.Y.
Roh
D.H.
Yoon
S.Y.
Kang
S.Y.
Choi
S.R.
Kwon
S.G.
Choi
H.S.
Han
H.J.
Beitz
A.J.
Lee
J.H.
Sigma-1 receptor-mediated increase in spinal p38 MAPK phosphorylation leads to the induction of mechanical allodynia in mice and neuropathic rats
Exp. Neurol.
2013
, vol. 
247
 (pg. 
383
-
391
)
[PubMed]
30
Mueller
B.H.
2nd
Park
Y.
Ma
H.Y.
Dibas
A.
Ellis
D.Z.
Clark
A.F.
Yorio
T.
Sigma-1 receptor stimulation protects retinal ganglion cells from ischemia-like insult through the activation of extracellular-signal-regulated kinases 1/2
Exp. Eye Res.
2014
, vol. 
128
 (pg. 
156
-
169
)
[PubMed]
31
Mari
Y.
Katnik
C.
Cuevas
J.
Sigma-1 receptor inhibition of ASIC1a channels is dependent on a pertussis toxin-sensitive G-protein and an AKAP150/calcineurin complex
Neurochem. Res.
2014
, vol. 
40
 (pg. 
2055
-
2067
)
32
Pozo-Guisado
E.
Casas-Rua
V.
Tomas-Martin
P.
Lopez-Guerrero
A.M.
Alvarez-Barrientos
A.
Martin-Romero
F.J.
Phosphorylation of STIM1 at ERK1/2 target sites regulates interaction with the microtubule plus-end binding protein EB1
J. Cell Sci.
2013
, vol. 
126
 (pg. 
3170
-
3180
)
[PubMed]
33
Sundivakkam
P.C.
Natarajan
V.
Malik
A.B.
Tiruppathi
C.
Store-operated Ca2+ entry (SOCE) induced by protease-activated receptor-1 mediates STIM1 protein phosphorylation to inhibit SOCE in endothelial cells through AMP-activated protein kinase and p38beta mitogen-activated protein kinase
J. Biol. Chem.
2013
, vol. 
288
 (pg. 
17030
-
17041
)
[PubMed]
34
Vasauskas
A.A.
Chen
H.
Wu
S.
Cioffi
D.L.
The serine-threonine phosphatase calcineurin is a regulator of endothelial store-operated calcium entry
Pulm. Circ.
2014
, vol. 
4
 (pg. 
116
-
127
)
[PubMed]
35
Smyth
J.T.
Petranka
J.G.
Boyles
R.R.
DeHaven
W.I.
Fukushima
M.
Johnson
K.L.
Williams
J.G.
Putney
J.W.
Jr.
Phosphorylation of STIM1 underlies suppression of store-operated calcium entry during mitosis
Nat. Cell Biol.
2009
, vol. 
11
 (pg. 
1465
-
1472
)
[PubMed]
36
Kawasaki
T.
Ueyama
T.
Lange
I.
Feske
S.
Saito
N.
Protein kinase C-induced phosphorylation of Orai1 regulates the intracellular Ca2+ level via the store-operated Ca2+ channel
J. Biol. Chem.
2010
, vol. 
285
 (pg. 
25720
-
25730
)
[PubMed]
37
Hooper
R.
Zhang
X.
Webster
M.
Go
C.
Kedra
J.
Marchbank
K.
Gill
D.L.
Weeraratna
A.T.
Trebak
M.
Soboloff
J.
Novel PKC-mediated control of Orai1 function in invasive melanoma
Mol. Cell Biol.
2015
, vol. 
35
 (pg. 
2790
-
2798
)
[PubMed]