Multidrug resistance 1 (MDR1) is a member of the major facilitator superfamily that contributes to MDR of Candida albicans. This antiporter belongs to the drug/H+ antiporter 1 family, pairing the downhill gradient of protons to drug extrusion. Hence, drug efflux from cytosol to extracellular space and the parallel import of H+ towards cytosol are inextricably linked processes. For monitoring the drug/H+ antiporter activity of Mdr1p, we developed a new system, exploiting a GFP variant pHluorin, which changes its fluorescence properties with pH. This enabled us to measure the cytosolic pH correlated to drug efflux. Since protonation of charged residues is a key step in proton movement, we explored the role of all charged residues of the 12 transmembrane segments (TMSs) of Mdr1p in drug/H+ transport by mutational analysis. This revealed that the conserved residue R215, positioned close to the C-terminal end of TMS-4, is critical for drug/H+ antiport, allowing protonation over a range of pH, in contrast with its H215 or K215 variants that failed to transport drugs at basic pH. Mutation of other residues of TMS-4 highlights the role of this TMS in drug transport, as confirmed by in silico modelling of Mdr1p and docking of drugs. The model points to the importance of R215 in proton transport, suggesting that it may adopt two main conformations, one oriented towards the extracellular face and the other towards the centre of Mdr1p. Together, our results not only establish a new system for monitoring drug/H+ transport, but also unveil a positively charged residue critical to Mdr1p function.

Introduction

Prolonged exposure to antifungals invariably results in the development of multidrug resistance in fungal pathogens [1]. The opportunistic fungal pathogen Candida albicans too has learnt to circumvent the toxic effects of xenobiotics. Among several strategies employed to combat the onslaught of antifungals, efflux of drugs from the cytosol represents one of the major mechanisms adopted by the microorganism [2,3]. There are two main classes of efflux pump proteins responsible for the development of antifungal resistance, involving different mechanistic strategies to power efflux of drugs. For example, while the superfamily of ATP-binding cassette (ABC) proteins, which are primary active transporters, utilizes energy derived directly from ATP hydrolysis to efflux drugs, the major facilitator superfamily (MFS) proteins are secondary active transporters that utilize energy derived from the proton motive force to efflux different substrates [4,5]. Both classes of transporters are integral membrane proteins with distinctive functional domains. ABC transporters contain transmembrane domains (TMDs) as well as nucleotide-binding domains, while MFS transporters only possess TMDs [5].

Among several ABC transporters that exist in the genome of C. albicans, Candida Drug Resistance protein (Cdr1p), a multidrug transporter, plays a major role in antifungal resistance [6]. An overexpression of CDR1 gene encoding Cdr1p is associated with an increased efflux of the incoming drug in azole-resistant clinical isolates recovered from patients receiving long-term antifungal therapy [7,8]. Considering that Cdr1p is a major transporter involved in multidrug resistance (MDR), its structure and function have been investigated in detail. In most structural- and functional-related studies, Cdr1p was overexpressed in Saccharomyces cerevisiae (AD1-8u strain) wherein its expression was driven by the ScPDR5 promoter [3]. A recent systematic study probed the nature of the drug-binding pocket of Cdr1p and identified several critical residues to demonstrate that Cdr1p harbours multiple binding sites specific to a drug or to a group of drugs [9].

A large number of MFS proteins exist in the Candida genome, but only Mdr1p overexpression is linked to a clinical drug resistance [4,10]. Mdr1p belongs to the drug/H+ antiporter 1 (DHA1) family of antiporters, which cause an efflux of drugs in an exchange with H+. The MFS transporter Mdr1p is a 564 amino acid long integral plasma membrane (PM) protein that shares the structural features of the MFS transporters belonging to the DHA1 family [1113]. Mdr1p has two TMDs, made of six transmembrane segments (TMSs) that together combine to form the substrate-binding pocket for their transport. Although Mdr1p has a definite role in clinical drug resistance, it did not attract sufficient interest pertaining to the molecular details of drug transport. There have been limited studies, however, which confirmed the relevance of conserved critical antiporter C motif [11]. A more recent rational approach of mutagenesis, which employed a membrane environment-based computational approach to predict the functionality of critical residues, identified several residues distributed on different TMSs to be critical to drug transport [14]. Nevertheless, a complete mechanistic picture pertaining to Mdr1p is still lacking. For instance, the demonstration of DHA activity and involvement of critical residues therein is not well understood.

As Mdr1p is a DHA, it cause efflux of the drug in exchange for proton import [15]. Both substrate and proton movement are inextricably linked and it is difficult to selectively demonstrate their transport. The measurement of H+ transport coupled with drug transport has not been successfully achieved, for instance, in yeast cells, due to their small size, well-established microelectrodes could not be conveniently used for proton measurements [16]. To circumvent this limitation, in the present study we exploited a pH-sensitive fluorescent pHluorin, which has a ratiometric property that overcomes the difficulties that are usually encountered with other fluorescent probes [16]. We developed a system where pHluorin is co-expressed with Mdr1p, which, by measuring the pH-dependent change in fluorescence, allows the monitoring of the proton import coupled with drug efflux. With the use of this ratiometric pHluorin, we not only could show drug/H+ coupled transport, but also could monitor the corresponding change in the cytosolic pH due to the import of H+. The measurements of pHluorin fluorescence of Mdr1p mutant variants generated by site-directed mutagenesis also led to identifying critical arginine (R215), which among charged amino acids is essential for H+ co-transport.

Materials and methods

Materials

Drug and chemicals including CHX (cycloheximide), Aniso (anisomycin), NR (Nile red), 4-NQO (4-nitroquinoline), SDS, NaN3 (sodium azide), ammonium acetate, PEG (polyethylene glycol), LiAc (lithium acetate), dATP, dTTP, dGTP and dCTP were obtained from Sigma-Aldrich, India. FLC (fluconazole) was obtained as a kind gift from Ranbaxy Laboratories, India. 2-DOG (2-deoxyglucose) and all medium components were obtained from Hi-Media, India. MES (2-(N-morpholino) ethane sulfonic acid) and HEPES (4-(2-hydroxyethyl)-1piperazineethanesulfonic acid) were purchased from Amresco, Inc., USA. The oligonucleotides used in the study, as listed in Table 1, were procured from Sigma Genosys, India. Anti-GFP and Anti-HIS monoclonal antibodies were purchased from Santa Cruz Biotechnology, Inc. (Texas, USA).

Table 1
List of primers used in the study
Primer namePrimer sequence
Leu 2 Del FP TTTACATTTCAGCAATATATATATATATATTTCAAGGATATACCATTCTACGGATCCCCGGGTTAATTAA 
Leu 2 Del RP TATCATAAAAAAAGAGAATCTTTTTAAGCAAGGATTTTCTTAACTTCTTCGAATTCGAGCTCGTTTTCGA 
Mdr1 Pac1 FP 5′-CGCGATTAATTAAATGCATTACAGATTTTTGAGAGATAG-3′ 
Mdr1 Not1 RP 5′-CGCGAGCGGCCGCAATTAGCATACTTAGATCTTGCTCTC-3′ 
Mdr1 K116A FP 5′-GCCAACTTTACAAGCAGCATTTTTCATTTTC-3′ 
Mdr1 K116 RP 5′-GAAAATGAAAAATGCTGCTTGTAAAGTTGGC-3′ 
Mdr1 R215A FP 5′-GTTTATGTATATTGGCATTCTTGGGTGGATTC-3′ 
Mdr1 R215A RP 5′-GAATCCACCCAAGAATGCCAATATACATAAAC-3′ 
Mdr1 R215E FP 5′-GGTTTATGTATATTGGAATTCTTGGGTGGATTC-3′ 
Mdr1 R215E RP 5′-GAATCCACCCAAGAATTCCAATATACATAAACC-3′ 
Mdr1 R215K FP 5′-GGTTTATGTATATTGAAATTCTTGGGTGGATTC-3′ 
Mdr1 R215K RP 5′-GAATCCACCCAAGAATTTCAATATACATAAACC-3′ 
Mdr1 R215Q FP 5′-GGTTTATGTATATTGCAATTCTTGGGTGGATTC-3′ 
Mdr1 R215Q RP 5′-GAATCCACCCAAGAATTGCAATATACATAAACC-3′ 
Mdr1 R215H FP 5′-GGTTTATGTATATTGCATTTCTTGGGTGGATTC-3′ 
Mdr1 R215H RP 5′-GAATCCACCCAAGAAATGCAATATACATAAACC-3′ 
Mdr1 E373A FP 5′-CTTTACTTGTTTTTCGCAGTTTTCCAATTTAT-3′ 
Mdr1 E373A RP 5′-ATAAATTGGAAAACTGCGAAAAACAAGTAAAG-3′ 
Mdr1 D501A FP 5′-GTTTTTGCATCAAATAAATTGTTCAGATCAGTC-3′ 
Mdr1 D501A RP 5′-GACTGATCTGAACAATTTATTTGATGCAAAAAC-3′ 
Mdr1 R504A FP 5′-CAAATGATTTGTTCGCATCAGTCATTGCATCAG-3′ 
Mdr1 R504A RP 5′-CTGATGCAATGACTGATGCGAACAAATCATTTG-3′ 
Mdr1 R504E FP 5′-CAAATGATTTGTTCGAATCAGTCATTGCATCAG-3′ 
Mdr1 R504E RP 5′-CTGATGCAATGACTGATTCGAACAAATCATTTG-3′ 
Mdr1 R504Q FP 5′-CAAATGATTTGTTCCAATCAGTCATTGCATC-3′ 
Mdr1 R504Q RP 5′-GATGCAATGACTGATTGGAACAAATCATTTG-3′ 
Mdr1 R504H FP 5′-CAAATGATTTGTTCCACTCAGTCATTGCATC-3′ 
Mdr1 R504H RP 5′-GATGCAATGACTGAGTGGAACAAATCATTTG-3′ 
Mdr1 R504K FP 5′-CAAATGATTTGTTCAAATCAGTCATTGCATCAG-3′ 
Mdr1 R504K RP 5′-CTGATGCAATGACTGATTTGAACAAATCATTTG-3′ 
Mdr1 L214A FP 5′-GTTTATGTATAGCGAGATTCTTGG-3′ 
Mdr1 L214A RP 5′-CCAAGAATCTCGCTATACATAAAC-3′ 
Mdr1 F216A FP 5′-GTATATTGAGAGCCTTGGGTGGATTC-3′ 
Mdr1 F216A RP 5′-GAATCCACCCAAGGCTCTCAATATAC-3′ 
Mdr1 L217A FP 5′-GTATATTGAGATTCGCGGGTGGATTCTTC-3′ 
Mdr1 L217A RP 5′-GAAGAATCCACCCGCGAATCTCAATATAC-3′ 
Mdr1 G219A FP 5′-GAGATTCTTGGGTGCATTCTTCGCCAGTC-3′ 
Mdr1 G219A RP 5′-GACTGGCGAAGAATGCACCCAAGAATCTC-3′ 
Mdr1 F220A FP 5′-GATTCTTGGGTGGAGCCTTCGCCAGTCCTG-3′ 
Mdr1 F220A RP 5′-CAGGACTGGCGAAGGCTCCACCCAAGAATC-3′ 
Mdr1 F221A FP 5′-CTTGGGTGGATTCGCCGCCAGTCCTTG-3′ 
Mdr1 F221A RP 5′-CAAGGACTGGCGGCGAATCCACCCAAG-3′ 
Mdr1 S223A FP 5′-GGATTCTTCGCCGCTCCTTGTTTGG-3′ 
Mdr1 S223A RP 5′-CCAAACAAGGAGCGGCGAAGAATCC-3′ 
Mdr1 P224A FP 5′-CTTCGCCAGTGCTTGTTTGGCCACTG-3′ 
Mdr1 P224A RP 5′-CAGTGGCCAAACAAGCACTGGCGAAG-3′ 
Mdr1 C225A FP 5′-CTTCGCCAGTCCT GCTTTGGCCACTGGTG-3′ 
Mdr1 C225A RP 5′-CACCAGTGGCCAAAGCAGGACTGGCGAAG-3′ 
Mdr1 A227G FP 5′-GTCCTTGTTTGGGCACTGGTGGCGC-3′ 
Mdr1 A227G RP 5′-GCGCCACCAGTGCCCAAACAAGGAC-3′ 
Mdr1 T228A FP 5′-CTTGTTTGGCCGCTGGTGGCGCAAG-3′ 
Mdr1 T228A RP 5′-CTTGCGCCACCAGCGGCCAAACAAG-3′ 
Mdr1 A231G FP 5′-GCCACTGGTGGCGGAAGTGTTGCTG-3′ 
Mdr1 A231G RP 5′-CAGCAACACTTCCGCCACCAGTGGC-3′ 
Mdr1 D235A FP 5′-GTGCAAGTGTTGCTGCTGTGGTTAAATTTTGG-3′ 
Mdr1 D235A RP 5′-CCAAAATTTAACCACAGCAGCAACACTTGCAC-3′ 
Primer namePrimer sequence
Leu 2 Del FP TTTACATTTCAGCAATATATATATATATATTTCAAGGATATACCATTCTACGGATCCCCGGGTTAATTAA 
Leu 2 Del RP TATCATAAAAAAAGAGAATCTTTTTAAGCAAGGATTTTCTTAACTTCTTCGAATTCGAGCTCGTTTTCGA 
Mdr1 Pac1 FP 5′-CGCGATTAATTAAATGCATTACAGATTTTTGAGAGATAG-3′ 
Mdr1 Not1 RP 5′-CGCGAGCGGCCGCAATTAGCATACTTAGATCTTGCTCTC-3′ 
Mdr1 K116A FP 5′-GCCAACTTTACAAGCAGCATTTTTCATTTTC-3′ 
Mdr1 K116 RP 5′-GAAAATGAAAAATGCTGCTTGTAAAGTTGGC-3′ 
Mdr1 R215A FP 5′-GTTTATGTATATTGGCATTCTTGGGTGGATTC-3′ 
Mdr1 R215A RP 5′-GAATCCACCCAAGAATGCCAATATACATAAAC-3′ 
Mdr1 R215E FP 5′-GGTTTATGTATATTGGAATTCTTGGGTGGATTC-3′ 
Mdr1 R215E RP 5′-GAATCCACCCAAGAATTCCAATATACATAAACC-3′ 
Mdr1 R215K FP 5′-GGTTTATGTATATTGAAATTCTTGGGTGGATTC-3′ 
Mdr1 R215K RP 5′-GAATCCACCCAAGAATTTCAATATACATAAACC-3′ 
Mdr1 R215Q FP 5′-GGTTTATGTATATTGCAATTCTTGGGTGGATTC-3′ 
Mdr1 R215Q RP 5′-GAATCCACCCAAGAATTGCAATATACATAAACC-3′ 
Mdr1 R215H FP 5′-GGTTTATGTATATTGCATTTCTTGGGTGGATTC-3′ 
Mdr1 R215H RP 5′-GAATCCACCCAAGAAATGCAATATACATAAACC-3′ 
Mdr1 E373A FP 5′-CTTTACTTGTTTTTCGCAGTTTTCCAATTTAT-3′ 
Mdr1 E373A RP 5′-ATAAATTGGAAAACTGCGAAAAACAAGTAAAG-3′ 
Mdr1 D501A FP 5′-GTTTTTGCATCAAATAAATTGTTCAGATCAGTC-3′ 
Mdr1 D501A RP 5′-GACTGATCTGAACAATTTATTTGATGCAAAAAC-3′ 
Mdr1 R504A FP 5′-CAAATGATTTGTTCGCATCAGTCATTGCATCAG-3′ 
Mdr1 R504A RP 5′-CTGATGCAATGACTGATGCGAACAAATCATTTG-3′ 
Mdr1 R504E FP 5′-CAAATGATTTGTTCGAATCAGTCATTGCATCAG-3′ 
Mdr1 R504E RP 5′-CTGATGCAATGACTGATTCGAACAAATCATTTG-3′ 
Mdr1 R504Q FP 5′-CAAATGATTTGTTCCAATCAGTCATTGCATC-3′ 
Mdr1 R504Q RP 5′-GATGCAATGACTGATTGGAACAAATCATTTG-3′ 
Mdr1 R504H FP 5′-CAAATGATTTGTTCCACTCAGTCATTGCATC-3′ 
Mdr1 R504H RP 5′-GATGCAATGACTGAGTGGAACAAATCATTTG-3′ 
Mdr1 R504K FP 5′-CAAATGATTTGTTCAAATCAGTCATTGCATCAG-3′ 
Mdr1 R504K RP 5′-CTGATGCAATGACTGATTTGAACAAATCATTTG-3′ 
Mdr1 L214A FP 5′-GTTTATGTATAGCGAGATTCTTGG-3′ 
Mdr1 L214A RP 5′-CCAAGAATCTCGCTATACATAAAC-3′ 
Mdr1 F216A FP 5′-GTATATTGAGAGCCTTGGGTGGATTC-3′ 
Mdr1 F216A RP 5′-GAATCCACCCAAGGCTCTCAATATAC-3′ 
Mdr1 L217A FP 5′-GTATATTGAGATTCGCGGGTGGATTCTTC-3′ 
Mdr1 L217A RP 5′-GAAGAATCCACCCGCGAATCTCAATATAC-3′ 
Mdr1 G219A FP 5′-GAGATTCTTGGGTGCATTCTTCGCCAGTC-3′ 
Mdr1 G219A RP 5′-GACTGGCGAAGAATGCACCCAAGAATCTC-3′ 
Mdr1 F220A FP 5′-GATTCTTGGGTGGAGCCTTCGCCAGTCCTG-3′ 
Mdr1 F220A RP 5′-CAGGACTGGCGAAGGCTCCACCCAAGAATC-3′ 
Mdr1 F221A FP 5′-CTTGGGTGGATTCGCCGCCAGTCCTTG-3′ 
Mdr1 F221A RP 5′-CAAGGACTGGCGGCGAATCCACCCAAG-3′ 
Mdr1 S223A FP 5′-GGATTCTTCGCCGCTCCTTGTTTGG-3′ 
Mdr1 S223A RP 5′-CCAAACAAGGAGCGGCGAAGAATCC-3′ 
Mdr1 P224A FP 5′-CTTCGCCAGTGCTTGTTTGGCCACTG-3′ 
Mdr1 P224A RP 5′-CAGTGGCCAAACAAGCACTGGCGAAG-3′ 
Mdr1 C225A FP 5′-CTTCGCCAGTCCT GCTTTGGCCACTGGTG-3′ 
Mdr1 C225A RP 5′-CACCAGTGGCCAAAGCAGGACTGGCGAAG-3′ 
Mdr1 A227G FP 5′-GTCCTTGTTTGGGCACTGGTGGCGC-3′ 
Mdr1 A227G RP 5′-GCGCCACCAGTGCCCAAACAAGGAC-3′ 
Mdr1 T228A FP 5′-CTTGTTTGGCCGCTGGTGGCGCAAG-3′ 
Mdr1 T228A RP 5′-CTTGCGCCACCAGCGGCCAAACAAG-3′ 
Mdr1 A231G FP 5′-GCCACTGGTGGCGGAAGTGTTGCTG-3′ 
Mdr1 A231G RP 5′-CAGCAACACTTCCGCCACCAGTGGC-3′ 
Mdr1 D235A FP 5′-GTGCAAGTGTTGCTGCTGTGGTTAAATTTTGG-3′ 
Mdr1 D235A RP 5′-CCAAAATTTAACCACAGCAGCAACACTTGCAC-3′ 

Growth media and strains used

Plasmid pZR4.1 having pHluorin gene used in the present study was a gift from Dr Rajini Rao (John Hopkins School of Medicine, USA). Other plasmids including pZR4.1 were maintained in Escherichia coli DH5α cells. The E. coli was cultured in Luria-Bertani medium from Difco, BD Biosciences (NJ, USA), to which ampicillin (100 μg/ml) was added. Yeast strains were either cultured in YEPD broth (Hi-Media, Mumbai, India) or grown on solid YEPD containing 2% agar in plates.

Molecular cloning

The MDR1 gene was amplified from genomic DNA of the SC5314 strain of C. albicans using MDR1HisF and MDR1HisR primers (Table 1). PCR product was digested using PacI and NotI and cloned into PacI–NotI-digested pABC3His vectors [17]. Positive clones were confirmed by restriction digestion and DNA sequencing. Saccharomyces cerevisiae AD1-8u strain was used as a heterologous expression system to overexpress the His-tagged version of MDR1 transporter. The hypersusceptible AD1-8u strain is deleted in seven ABC transporters (ScYor1p, ScSnq2p, ScPdr5p, ScPdr10p, ScPdr11p, ScYcf1p and ScPdr15p,) and also harbours gain-of-function (GOF) mutation in the transcription factor Pdr1p, resulting in constitutive hyperinduction of the PDR5 promoter. For co-expression of pHluorin and MDR1-His proteins, AD1-8u was further derivatized by the deletion of the LEU2 gene and the resulting strain was designated as AD1-8uleu (Table 2). To construct the AD-Mdr1-pH strain, an MDR1-His overexpression cassette together with episomal plasmid pZR4.1 was used to co-transform the AD1-8uleu strain by the LiAc transformation method. Positive colonies were confirmed by the expression of pHluorin with confocal microscopy and by functional MDR1-His expression with western blot test and the drug susceptibility assay.

Table 2
List of strains used in the study
StrainGenotype/descriptionSource/reference
AD1-8U MATa pdr1-3 hisG ura3, Δyor1::hisG, Δsnq2::hisG, Δpdr10::hisG, Δpdr11::hisG, Δycf1::hisG, Δpdr15::hisG [17
AD1-8ULeu MATa pdr1-3 hisG, ura3 Δyor1::hisG, Δsnq2::hisG, Δpdr10::hisG, Δpdr11::hisG, Δycf1::hisG, Δpdr15::hisG, ΔLeu2::kanMX The present study 
AD-Mdr1-His MATa pdr1-3 hisG, ura3 Δyor1::hisG, Δsnq2::hisG, Δpdr10::PDR5PROM -Mdr1-His-STOP, Δpdr11::hisG, Δycf1::hisG, Δpdr15::hisG, ΔLeu2::kanMX The present study 
RPMdr1-GFP MATa pdr1-3 hisG ura3 Δyor1::hisG, Δsnq2::hisG, Δpdr10:: PDR5PROM-Mdr1-GFP- STOP, Δpdr11::hisG, Δycf1::hisG, Δpdr15::hisG [11
AD-pH MATa pdr1-3 hisG, ura3 Δyor1::hisG, Δsnq2::hisG, Δpdr10::hisG, Δpdr11::hisG, Δycf1::hisG, Δpdr15::hisG, ΔLeu2::kanMX,pHluorin  
AD-Mdr1-pH MATa pdr1-3 hisG, ura3 Δyor1::hisG, Δsnq2::hisG, Δpdr10::PDR5PROM Mdr1-His-STOP, Δpdr11::hisG, Δycf1::hisG, Δpdr15::hisG, ΔLeu2::kanMX,pHluorin The present study 
K116A Mdr1 cells carrying K116A mutation in MDR1 ORF and integrated at the PDR5 locus The present study 
R215A Mdr1 cells carrying R215A mutation in MDR1 ORF and integrated at PDR5 locus The present study 
R215E Mdr1 cells carrying R215E mutation in MDR1 ORF and integrated at the PDR5 locus The present study 
R215Q Mdr1 cells carrying R215Q mutation in MDR1 ORF and integrated at the PDR5 locus The present study 
R215H Mdr1 cells carrying R215H mutation in MDR1 ORF and integrated at the PDR5 locus The present study 
R215K Mdr1 cells carrying R215K mutation in MDR1 ORF and integrated at the PDR5 locus The present study 
E373A Mdr1 cells carrying E373A mutation in MDR1 ORF and integrated at the PDR5 locus The present study 
D501A Mdr1 cells carrying D501A mutation in MDR1 ORF and integrated at the PDR5 locus The present study 
R504A Mdr1 cells carrying R504A mutation in MDR1 ORF and integrated at the PDR5 locus The present study 
R504E Mdr1 cells carrying R504E mutation in MDR1 ORF and integrated at the PDR5 locus The present study 
R504Q Mdr1 cells carrying R504Q mutation in MDR1 ORF and integrated at the PDR5 locus The present study 
R504H Mdr1 cells carrying R504H mutation in MDR1 ORF and integrated at the PDR5 locus The present study 
R504K Mdr1 cells carrying R504K mutation in MDR1 ORF and integrated at the PDR5 locus The present study 
StrainGenotype/descriptionSource/reference
AD1-8U MATa pdr1-3 hisG ura3, Δyor1::hisG, Δsnq2::hisG, Δpdr10::hisG, Δpdr11::hisG, Δycf1::hisG, Δpdr15::hisG [17
AD1-8ULeu MATa pdr1-3 hisG, ura3 Δyor1::hisG, Δsnq2::hisG, Δpdr10::hisG, Δpdr11::hisG, Δycf1::hisG, Δpdr15::hisG, ΔLeu2::kanMX The present study 
AD-Mdr1-His MATa pdr1-3 hisG, ura3 Δyor1::hisG, Δsnq2::hisG, Δpdr10::PDR5PROM -Mdr1-His-STOP, Δpdr11::hisG, Δycf1::hisG, Δpdr15::hisG, ΔLeu2::kanMX The present study 
RPMdr1-GFP MATa pdr1-3 hisG ura3 Δyor1::hisG, Δsnq2::hisG, Δpdr10:: PDR5PROM-Mdr1-GFP- STOP, Δpdr11::hisG, Δycf1::hisG, Δpdr15::hisG [11
AD-pH MATa pdr1-3 hisG, ura3 Δyor1::hisG, Δsnq2::hisG, Δpdr10::hisG, Δpdr11::hisG, Δycf1::hisG, Δpdr15::hisG, ΔLeu2::kanMX,pHluorin  
AD-Mdr1-pH MATa pdr1-3 hisG, ura3 Δyor1::hisG, Δsnq2::hisG, Δpdr10::PDR5PROM Mdr1-His-STOP, Δpdr11::hisG, Δycf1::hisG, Δpdr15::hisG, ΔLeu2::kanMX,pHluorin The present study 
K116A Mdr1 cells carrying K116A mutation in MDR1 ORF and integrated at the PDR5 locus The present study 
R215A Mdr1 cells carrying R215A mutation in MDR1 ORF and integrated at PDR5 locus The present study 
R215E Mdr1 cells carrying R215E mutation in MDR1 ORF and integrated at the PDR5 locus The present study 
R215Q Mdr1 cells carrying R215Q mutation in MDR1 ORF and integrated at the PDR5 locus The present study 
R215H Mdr1 cells carrying R215H mutation in MDR1 ORF and integrated at the PDR5 locus The present study 
R215K Mdr1 cells carrying R215K mutation in MDR1 ORF and integrated at the PDR5 locus The present study 
E373A Mdr1 cells carrying E373A mutation in MDR1 ORF and integrated at the PDR5 locus The present study 
D501A Mdr1 cells carrying D501A mutation in MDR1 ORF and integrated at the PDR5 locus The present study 
R504A Mdr1 cells carrying R504A mutation in MDR1 ORF and integrated at the PDR5 locus The present study 
R504E Mdr1 cells carrying R504E mutation in MDR1 ORF and integrated at the PDR5 locus The present study 
R504Q Mdr1 cells carrying R504Q mutation in MDR1 ORF and integrated at the PDR5 locus The present study 
R504H Mdr1 cells carrying R504H mutation in MDR1 ORF and integrated at the PDR5 locus The present study 
R504K Mdr1 cells carrying R504K mutation in MDR1 ORF and integrated at the PDR5 locus The present study 

Immunodetection of His-tagged protein

PM fractions used for immunodetection of His-tagged protein were prepared as described previously with minor modifications [11]. Forty micrograms of total PM proteins were used for immunodetection with HRP-labelled anti-His monoclonal antibody at a 1:5000 dilution. For immunodetection of Pma1 protein, the same membrane was first stripped and then re-probed PM fractions were probed with an anti-Pma1 polyclonal primary antibody and HRP-labelled anti-rabbit secondary antibody. Protein bands were detected by the BIO-RAD Chemidoc XRS+ system following reaction with the Clarity Western ECL blotting substrate (Bio-Rad).

Measurements of intracellular pH

pHluorin has bimodal excitation at 405 and 485 nm with an emission at 516 nm. Change in cytosolic pH leads to change in fluorescence intensity, reading at 405 nm (I405) and 485 nm (I485) excitation wavelengths. This property of pHluorin was exploited for the measurement of pH change by the method described by Brett et al. [18] with slight modifications. Briefly, buffers with pH in the range of 5.5–8.5 were used for calibration. Calibration buffers containing 50 mM MES, 50 mM HEPES, 50 mM KCl, 50 mM NaCl, 200 mM ammonium acetate, 10 mM NaN3 and 10 mM 2-DOG were titrated to seven different pH values within 5.5–8.5 with NaOH or HCl [18]. We also included cell-permeant ammonium acetate capable of collapsing pH gradients across multiple membranes, sodium azide and 2-DOG to halt ATP production and inhibit the H+-pumps of the cell. For fluorescence measurement, freshly growing transformants expressing pHluorin were used. An equal number of cells were suspended and mixed well in each tube containing each calibration buffer. The Cary Eclipse Spectrofluorimeter for excitation at wavelengths 405 and 485 nm and an emission wavelength of 508 nm was set up. Fluorescence intensity and absorbance values were acquired using a quartz cuvette. Emission fluorescence intensity readings at 405 nm (I405) and 485 nm (I485) excitation wavelengths were acquired and background fluorescence was measured using pHluorin free yeast. The average of three readings was used for each experimental value at a given pH. At the end, experimental (I405/I485) values were background-subtracted and a calibration curve of the ratio of fluorescence intensity values versus pH was plotted. As a routine, for estimating cytoplasmic pH, background-subtracted experimental I405/I485 values from the used strain were compared with a standard calibration curve. All experiments were performed at 30°C.

For cytosolic pH measurements, AD-Mdr1-pH strains containing cytosolic pHluorin were grown in YNB medium for 18 h (mid-log phase) at 30°C. Exponentially growing cells were harvested and the final OD600 of 0.5–0.7 was used for our study. For measurement of cytosolic pH, freshly growing transformants were suspended in each tube carrying calibration buffers ranging from pH 5.5 to 8.5 as discussed above. For measurements of cytosolic pH and drug accumulation simultaneously, 25 μM of [3H] MTX (specific activity, 8.60 Ci/mmol) was used according to an earlier described protocol [11]. Briefly, for the efflux measurements, 5% yeast suspension was incubated with [3H]-MTX for 30 min. The cells were pelleted and resuspended in MES buffer of pH lower than 6.5 to initiate the efflux. An aliquot of 100 µl was taken at regular intervals and filtered on a 0.45 µm filter disc (Millipore, India). The cells were washed twice with PBS and the concentration of the radiolabelled drug trapped within the cells was measured by dipping the filter discs in a liquid scintillation cocktail and measuring with a scintillation counter (Packard Bioscience). Intracellular accumulation of [3H]-MTX and change in pHluorin fluorescence relative to a change in pH were measured simultaneously.

For the measurement of cytosolic pH in mutant variants in relation to the drug efflux, all variants were constructed in an AD-Mdr1-pH background. First, 5% cell suspension of exponentially grown cells [wild-type (WT) and mutant variants] was incubated with different concentrations of drug (4-NQO) in the range of 0–150 μm for 30 min. Cells were pelleted and the efflux was initiated by resuspending the drug-preloaded cells in MES buffer (pH 6.5). Changes in pHluorin fluorescence in response to the drug efflux were measured with a spectrofluorimeter.

Measurement of buffering capacity of cytosol

The buffering capacity of the cytosol was measured by using a weak base (NH4Cl) and by essentially following the method described by Maresova et al. [19]. To calculate the buffering capacity of yeast cells, initially, the fluorescence ratio (R405/485 nm) of exponentially growing yeast cells in citrate phosphate buffer was calculated followed by the addition of ammonium chloride (up to 10 mM). The resulting increase in the fluorescence ratio upon the addition of NH4Cl was converted to pH by the calibration curve, and the cytosolic concentration of ammonium ions [BH+] was calculated from the equation:

 
formula
(1)

where Ka is the dissociation constant of NH3, [B] total is the total ammonium chloride concentration, [H+]ext is the proton concentration in the buffer and [H+]int is the new intracellular proton concentration (after the increase). The buffering capacity (β) is calculated as follows:

 
formula

Transport of NR

Transport of NR in cells expressing WT or a mutant variant of Mdr1-His was measured by flow cytometry with a FACSort flow cytometer (Becton Dickinson Immunocytometry Systems, San Jose, CA). Exponentially grown cells with OD600 of 0.25 were taken and harvested to make 5% cell suspension in dilution medium (containing one-third of YEPD and two-third of water). For the measurements, NR was added to a final concentration of 7 μM as described previously [20]. Cells were incubated in a shaking water bath at 150 rpm at 30°C for 30 min. The cells were then harvested, and 10 000 cells were analyzed by flow cytometry and data were treated with the Cell Quest software.

Fluorescence and confocal microscopy

For fluorescence microscopy, the cells expressing GFP-tagged membrane proteins and cytosolic pHluorin were grown to their exponential phase, washed with PBS and viewed under a Nickon Ti90 fluorescence microscope. For confocal microscopy, cells were then directly viewed with a ×100 oil immersion objective on an Olympus FluoView™ FV 1000 laser confocal microscope (PA, USA).

Site-directed mutagenesis and development of transformants

Site-directed mutagenesis was performed by using the Quick-Change mutagenesis kit from Stratagene (La Jolla, CA, USA). The mutations were introduced into the plasmid pABC3-Mdr1-His/pSKPPUS-CaMdr1-GFP using primers as listed in Table 1 according to the manufacturer's instructions. The desired alterations in the nucleotide sequences were confirmed by sequencing of the entire ORF. From the mutated plasmids, the pABC3-Mdr1His cassette was removed by Asc1 digestion and the gel-purified transformation cassette was used to transform AD1-8uleu cells by the LiAc transformation protocol as described previously [21]; for pSKPPUS-CaMdr1-GFP, XbaI-mediated linearized plasmid was directly used for transformation.

Drug susceptibility assays

The yeast cells were grown overnight on YEPD plates and then suspended in 0.9% NaCl to an OD600 of 0.1. A volume of 4 µl of fivefold serial dilutions of each strain was spotted onto YEPD plates in the absence (control) and the presence of the following drugs: 0.6 µg/ml FLC, 0.2 µg/ml CHX and 0.2 µg/ml 4-NQO. Growth differences were recorded following incubation of the plates for 48 h at 30°C. Growth was not affected by the presence of the solvents used for the drugs (data not shown) [22].

3D modelling and molecular docking

The Mdr1p 3D model included residues 103–564 forming the membrane region. It was based on the 3D model of MDR1–6 (Expasy #Q9URI1), 99.5% identical over the entire sequence. The Q9URI1 model was generated by the Protein Model Portal [23], based on the 3D structure of the glycerol-3-phosphate transporter from E. coli GlpT, with PDB code 1PW4 [24]. As the sequence identity and strong similarity between Q9URI1 and GlpT was 14 and 22%, respectively, we carefully checked the model by comparing it with the 3D structures of EmrD (15% identity + 24% strong similarity, with PDB code 2GFP [25]) and MdfA [14% identity + 23% strong similarity, PDB codes 4ZOW, 4ZP2 or 4ZP0 when co-crystallized with chloramphenicol, N,N-dimethyldodecylamine N-oxide (LDAO) or deoxycholate (DOC), respectively [26]].

Docking simulations were carried out with autodock Vina 1.1.2 [27] and a parallelized version, Vina LC 1.1.2 [28] using a 64 CPU system. Protein and ligands were prepared with autodock tools 4 [29]. The docking box was designed to cover the whole of the membrane region and using the following parameters: points in x-, y- and z-dimension 30, 28, 34, spacing of 1 Å and a centre grid box x, y and z of 32, 20, −29. Exhaustiveness was set up to 32. Docking of FLC, CHX and NR was done by allowing the side chain of the 31 following residues to move in the drug-binding region: TMS1: T128; Y131; M132; S134; V136; T138; TMS2: L161; F162; V163; Y166; TMS3: Y188; T191; F195; TMS4: R215; S223; C225; L226; T228; TMS5: W249; TMS7: Y365; L368; Y369; F372; E373; TMS8: Y394; TMS10: F474; Q478; TMS11: D501; L502; R504 ; S505; S509. Notably, most of these residues when replaced individually with alanine were found to be functionally critical, yielding drug susceptible variants (Redhu, A.K. et al., unpublished results). Some of these mutants have been discussed in the Results section. Docking parameters were first tested by docking on the apo form of MdfA, the three ligands co-crystallized with DOC, LDAO and chloramphenicol.

Statistical analysis

Data are represented as mean ± standard deviation (SD). The statistical analyses were performed using Student's t-test (http://www.studentsttest.com/). Differences were considered statistically significant when P < 0.005 (* signifies P < 0.05, **signifies P ≤ 0.01 and *** signifies P ≤ 0.001).

Results

Expression of pHluorin in an Mdr1p overexpressing S. cerevisiae system

Saccharomyces cerevisiae strain AD1-8u has routinely been used as a host strain for overexpressing ABC and MDR transporters of Candida spp. by us and several other groups [11]. AD1-8u is a derivative of a strain containing the pdr1-3 gene with a GOF mutation in the transcription factor Pdr1p, resulting in constitutive hyperinduction of the PDR5 promoter [17]. It is deleted in seven genes encoding ABC transporters and is hypersusceptible to many drugs. We have successfully used this system for an overexpression and functional characterization of a GFP-tagged Mdr1p version [11]. For H+ transport measurements, we used a well-known pH-sensitive GFP variant protein, pHluorin. Since the excitation and emission range of GFP and pHluorin overlaps, we constructed a C-terminal His-tagged version of Mdr1p in the pABC3-His vector as described in Experimental Procedures. Since the plasmid pZR4.1 containing the pHluorin gene harbours a leu auxotrophic marker, the heterologous expression system AD1-8u was further derivatized with the introduction of leu auxotrophy, resulting in the formation of an AD1-8uleu strain. The AD1-8uleu was then transformed with plasmid pZR 4.1 to obtain an AD-Mdr1-pH strain that co-expresses Mdr1p-His and pHluorin.

The western blot analysis of the PM fraction of AD-Mdr1-pH cells showed that the Mdr1p-His protein was transcribed, expressed and properly targeted to the PM. This was further confirmed by using a well-known PM marker protein Pma1 as a control (Figure 1A). The functionality of Mdr1p-His was confirmed by spot dilution assays on 4-NQO and CHX (Figure 1B). As shown, the AD-Mdr1-pH strain was able to offer resistance to 4-NQO and CHX in contrast with the untagged-Mdr1p strain. Finally, the expression of pHluorin was checked by confocal microscopy (Figure 1C). Together, these results show that we developed a functional system co-expressing both Mdr1p and pHluorin.

Schematic representation of the strategy employed to study proton transport by Mdr1p.

Figure 1.
Schematic representation of the strategy employed to study proton transport by Mdr1p.

(A) Immunoblot analysis of the PM fractions (40 μg total protein) with HRP-conjugated anti-His monoclonal antibody. PM protein Pma1p probed with anti-Pma1 antibody was taken as a control for loading and PM fractions. (B) Serial dilution assay of drugs 4-NQO and CHX was used to confirm functional integration of the MDR1 gene into the AD1-8Uleu strain. (C) Episomal transformation of pHluorin into the Mdr1-His integrated host strain showing cytosolic expression of fluorescent pHluorin as confirmed by confocal microscopy.

Figure 1.
Schematic representation of the strategy employed to study proton transport by Mdr1p.

(A) Immunoblot analysis of the PM fractions (40 μg total protein) with HRP-conjugated anti-His monoclonal antibody. PM protein Pma1p probed with anti-Pma1 antibody was taken as a control for loading and PM fractions. (B) Serial dilution assay of drugs 4-NQO and CHX was used to confirm functional integration of the MDR1 gene into the AD1-8Uleu strain. (C) Episomal transformation of pHluorin into the Mdr1-His integrated host strain showing cytosolic expression of fluorescent pHluorin as confirmed by confocal microscopy.

pHluorin modulates its fluorescence properties in response to changes in intracellular pH

We exploited the ratiometric fluorescence property of pHluorin to measure changes in intracellular pH in response to the efflux of drugs by Mdr1p [19]. The excitation spectrum of pHluorin is bimodal with a major peak at 405 nm and a minor peak at 485 nm with an emission maximum at 516 nm. Dual excitation at 405 and 485 nm yields a fluorescence ratio of 405/485 nm that changes in response to a change in intracellular pH. Upon acidification, excitation at 405 nm decreases with a corresponding increase in excitation at 485 nm, resulting in changes in the ratio of 405/485 nm [19].

For calibration, the change in pHluorin fluorescence in response to pH was monitored in exponentially grown cells. These cells were harvested and suspended in calibration buffers with pH ranging between 5.5 and 8.5 as described in Experimental Procedures. To collapse the pH gradient across the multiple membranes, the calibration mixture included cell-permeant weak base ammonium acetate, while the addition of sodium azide and deoxyglucose was included to halt the production of ATP and to inhibit the membrane H+-pump activity. This was done to ensure that the differences observed in pHluorin fluorescence were exclusively due to the import of protons. Although cells do have some intrinsic auto-fluorescence, we have directly compared pH measurements with and without background corrections on the calibration and experimental samples and have seen no difference in the final values. The pH-dependent change in fluorescence intensity was analyzed by dual excitation at 405 and 485 nm with an emission filter of 516 nm and the ratio of fluorescence I405/I485 nm versus pH was generated (Figure 2A). The pH-dependent change in pHluorin fluorescence could also be observed in confocal images of the AD-Mdr1-pH strain when exposed to different pH solutions ranging from 5.5 to 8.5 (Figure 2B). It is evident from the calibration curve that the ratiometric response of pHluorin is linear over a wide range of pH. The data are represented as mean ± SD of three independent experiments (Figure 2C). This calibration curve was used as a reference for all future experiments. The increase in pH from 5.5 to 8.5 shifts the excitation wavelength of pHluorin, resulting in an increase in fluorescence at 405 and a simultaneous decrease at 485 nm. This leads to a constant increase in the ratio of 405/485 nm, with an increase in pH from low to high. Thus, a standard linear trend line is obtained (Figure 2C). The relative fluorescence was calculated after the subtraction of background fluorescence. The standard calibration curve was used to deduce the pH at a particular drug concentration in our experiments. These preliminary measurements amply demonstrated the suitability of the co-expression system, which can be exploited to measure changes in cytosolic pH associated with drug efflux.

Measurement of change in pHluorin fluorescence across different pH ranges.

Figure 2.
Measurement of change in pHluorin fluorescence across different pH ranges.

(A) Cytoplasmic pHluorin expressed in Mdr1-His cells suspended in buffers of different ranges of pH from 5.5 to 8.5. The change in fluorescence was analyzed with the fluorescence spectrophotometer by dual excitation at 405 nm (red bars) and 485 nm (orange bars) with an emission filter of 516 nm. The ratio of 405/485 nm (green bars) is shown on the right Y-axis. (B) Confocal microscopic images showing the change in fluorescence of cytosolic pH indicator pHluorin along with change in pH. All images are shown at equal magnification. (C) A calibration curve showing the measured ratio of fluorescence intensity at 405 nm (I405) to the intensity at 485 nm (I485) versus pH. Results are represented as mean ± SD of three independent experiments.

Figure 2.
Measurement of change in pHluorin fluorescence across different pH ranges.

(A) Cytoplasmic pHluorin expressed in Mdr1-His cells suspended in buffers of different ranges of pH from 5.5 to 8.5. The change in fluorescence was analyzed with the fluorescence spectrophotometer by dual excitation at 405 nm (red bars) and 485 nm (orange bars) with an emission filter of 516 nm. The ratio of 405/485 nm (green bars) is shown on the right Y-axis. (B) Confocal microscopic images showing the change in fluorescence of cytosolic pH indicator pHluorin along with change in pH. All images are shown at equal magnification. (C) A calibration curve showing the measured ratio of fluorescence intensity at 405 nm (I405) to the intensity at 485 nm (I485) versus pH. Results are represented as mean ± SD of three independent experiments.

Measurement of DHA activity of Mdr1p

The efflux of drug from the cytosol to the extracellular space leads to the movement of protons towards the cytosol, which results in a decrease in the pH (Figure 3A). This was first confirmed in our system by using one of the well-known Mdr1p substrates, methotrexate [11]. To study both drug accumulation and pH change simultaneously, we used radiolabelled methotrexate ([3H]-MTX). Changes in cytosolic pH were measured in terms of changes in the fluorescence of pHluorin (relative fluorescence unit, RFU) after resuspension of drug-preloaded cells in MES buffer (pH 6.5). It was observed that when drug efflux was initiated with cells that were preincubated with 25 μM of methotrexate ([3H]-MTX), there was a gradual increase in cytosolic H+ concentration, implying a decrease in the cytosolic pH over a range of time (Figure 3B). To maintain a reasonable proton gradient across the membrane, the experiment was performed at extracellular buffer of pH 6.5. Prior to these analyses, a time kill assay with the particular drug concentration was also performed to rule out any death of cells at this concentration during the course of the experiment (data not shown).

Drug induced cellular acidification of cells expressing pHluorin in the extracellular buffer at pH 6.5.

Figure 3.
Drug induced cellular acidification of cells expressing pHluorin in the extracellular buffer at pH 6.5.

(A) Change in cytosolic pH in response to efflux of the drug by Mdr1p. (B) Time kinetics of change in cytosolic proton concentration (H+) in response to 3[H]-MTX accumulation (counts per minute). The cytosolic proton concentrations were derived from the change in pH values calculated from a standard calibration plot of the RFU ratio at 405/485 nm. (C) Time kinetics of change in cytosolic proton concentration (H+) in response to NR efflux. (D) Buffering capacity of AD-Mdr1-pH and AD-pH cells calculated according to eqn (1). Results are represented as mean ± SD of three independent experiments.

Figure 3.
Drug induced cellular acidification of cells expressing pHluorin in the extracellular buffer at pH 6.5.

(A) Change in cytosolic pH in response to efflux of the drug by Mdr1p. (B) Time kinetics of change in cytosolic proton concentration (H+) in response to 3[H]-MTX accumulation (counts per minute). The cytosolic proton concentrations were derived from the change in pH values calculated from a standard calibration plot of the RFU ratio at 405/485 nm. (C) Time kinetics of change in cytosolic proton concentration (H+) in response to NR efflux. (D) Buffering capacity of AD-Mdr1-pH and AD-pH cells calculated according to eqn (1). Results are represented as mean ± SD of three independent experiments.

We observed that there is a time-dependent decrease in pH linked to substrate efflux. Starting with an initial pH of 6.5, the pH lowered to 5.7 after 27 min in response to substrate transport/efflux. To monitor both substrate efflux and proton transport in real time, we also simultaneously monitored NR efflux and change in cytosolic pH as a function of time. NR (7 μM) was used to measure both drug efflux and proton import simultaneously. It is worth mentioning that many studies from our laboratory and other groups have well illustrated the suitability of NR as a common dye to monitor drug efflux [20,21,30,31].

The results showed a direct correlation between the rates of efflux versus the decrease in pH (Figure 3C). Control experiments with drug substrates excluded the possibility of any interference in pHluorin fluorescence measurements. Notably, the buffering capacity of AD-Mdr1-pH and AD-pH cells was found to be in the similar range, which corresponded to 57 ± 10 mM/pH (Figure 3D).

Conserved R215 and R504 are critical for DHA

In contrast with some of the well-characterized bacterial MFS transporters, the criticality of residues in proton recognition and its coupling with the substrate transport of Mdr1p are poorly understood. To get an insight into the functional relevance of residues involved in drug/H+ exchanges, we performed a systematic alanine replacement analysis of all charged residues that fall within 12 putative TMSs of Mdr1p. A total of five such residues K116 (TMS-1), R215 (TMS-4), E373 (TMS-7), D501 (TMS-11) and R504 (TMS-11) are putatively embedded within the indicated TMSs (Figure 4A). Notably, some charged residues such as those which were present at the junction of TMSs or within loops were not included in our analysis. After replacement with alanine, cell surface expression and membrane localization of WT and mutants were confirmed with confocal microscopy and western blot analysis with PM fractions (Figure 4B). The mutant variants of two negatively charged residues E373A and D501A expressing cells behaved similarly to cells expressing the native protein, as was evident from their drug susceptibility and NR accumulation assays that did not change (Figure 4C,D). Therefore, their role in drug/H+ transport was ruled out. The mutational analysis of positively charged residues, however, provided interesting insights into drug/H+ transport. The analysis of the three positively charged residues K116, R215 and R504 revealed that while the K116A variant behaved similarly to native protein, variants R215A and R504A showed a marked sensitivity to all the tested drugs (Figure 4C). The increased drug susceptibility of the R215A and R504A variants was well supported by a parallel decrease in NR transport. The flow cytometry data revealed a fivefold increase in intracellular NR accumulation (poor efflux when compared with the WT; Figure 4D).

Cell surface localization and phenotyping of the alanine variants of the selected charge residue mutant variants of Mdr1p.

Figure 4.
Cell surface localization and phenotyping of the alanine variants of the selected charge residue mutant variants of Mdr1p.

(A) Topological diagram of Mdr1p highlighting the charged residues within the 12 transmembrane helices. (B) Membrane localization of WT and other mutant variants of the charged residues as observed by confocal microscopy and western blot analyses with the anti-GFP monoclonal antibody. (C) Four microliters of fivefold serial dilutions of each strain was spotted onto YEPD plates in the absence or presence of different concentrations of the following drugs: 0.6 μg/ml FLC, 0.2 μg/ml CHX and 0.2 μg/ml 4-NQO. (D) Intracellular accumulation assay of the fluorescent substrate NR in the different alanine mutant variants. The intensity scale for fluorescence measurements is in arbitrary units (a.u.). The values are mean ± SD of three independent experiments. Student's t-test was performed to evaluate the statistical significance of the difference between Mdr1 and its mutant variants. P ≤ 0.001 represented as ***.

Figure 4.
Cell surface localization and phenotyping of the alanine variants of the selected charge residue mutant variants of Mdr1p.

(A) Topological diagram of Mdr1p highlighting the charged residues within the 12 transmembrane helices. (B) Membrane localization of WT and other mutant variants of the charged residues as observed by confocal microscopy and western blot analyses with the anti-GFP monoclonal antibody. (C) Four microliters of fivefold serial dilutions of each strain was spotted onto YEPD plates in the absence or presence of different concentrations of the following drugs: 0.6 μg/ml FLC, 0.2 μg/ml CHX and 0.2 μg/ml 4-NQO. (D) Intracellular accumulation assay of the fluorescent substrate NR in the different alanine mutant variants. The intensity scale for fluorescence measurements is in arbitrary units (a.u.). The values are mean ± SD of three independent experiments. Student's t-test was performed to evaluate the statistical significance of the difference between Mdr1 and its mutant variants. P ≤ 0.001 represented as ***.

Positive charge of residue R215 and steric hindrance of residue R504 are critical for transport

To evaluate the significance of the position and charge of R215 and R504, we constructed glutamate (opposite charge but equivalent side chain length), lysine (similar charge), histidine (similar charge but structurally distinct side chain) and glutamine (neutral residue with equivalent side chain length) variants for both R215 and R504, respectively. The functionality of resulting mutant variants of Mdr1p R215E, R215Q, R215K, R215H, R504E, R504Q, R504K and R504H was evaluated for their functionality. Our rationale was since glutamate is a negatively charged amino acid with a side chain of almost equivalent length, and lysine is positively charged with a relatively shorter side chain, these substitutions could provide useful information regarding the importance of charge and size of R215 and R504.

Notably, the introduction of opposite charge at the two positions (R504E, R215E) yielded opposite results. While R504E replacement did not affect drug resistance, the R215E variant became hypersusceptible to all the tested drugs. Restoration of normal growth in R504E when compared with R504A suggested that, at this particular position, the charge is not critical. However, for R215 charge appears to be a key feature. This became more apparent when R215 and R504 were individually substituted with lysine (R215K and R504K variants). Expectedly, R215K variant was fully functional, as it conferred resistance to all the tested drugs and also remained transport competent, contrasting the phenotype of the R504K variant that was susceptible to all drugs and also showed a defect in substrate transport (Figure 5). Subsequently, both R215 and R504 were substituted with glutamine and histidine. The substitution with glutamine at R215Q and R504Q led to contrasted phenotypes. While R504Q demonstrated WT phenotype, R215Q could not, again emphasizing the importance of the positive charge of R215. The retention of WT phenotype in (R215H) further reinforced the importance of the positive charge of R215 (Figure 5). Taken together, the drug susceptibility and substrate transport strongly pointed out that R215 in TMS-4 is critical to drug/H+ co-transport.

Cell surface expression and membrane localization of mutant variants of WT, R215 and R504, their drug resistance profile and substrate accumulation assay.

Figure 5.
Cell surface expression and membrane localization of mutant variants of WT, R215 and R504, their drug resistance profile and substrate accumulation assay.

(A) Membrane localization of WT and mutant variants of R215 and R504 was observed by confocal microscopy and western blot analysis. (B) Growth differences were recorded following incubation of the plates for 48 h at 30°C. Growth was not affected by the presence of the solvents used for the drugs (data not shown). (C and D) The intracellular accumulation assay of the fluorescent substrate (NR) in the different mutant variants of arginine 215 and 504. The intensity scale measurement is given in a.u. Results are the mean ± SD of at least three independent experiments. Student's t-test was performed to evaluate the statistical significance of the difference between Mdr1 and its mutant variants. P < 0.05 represented as *, P ≤ 0.01 represented as ** and P ≤ 0.001 represented as ***.

Figure 5.
Cell surface expression and membrane localization of mutant variants of WT, R215 and R504, their drug resistance profile and substrate accumulation assay.

(A) Membrane localization of WT and mutant variants of R215 and R504 was observed by confocal microscopy and western blot analysis. (B) Growth differences were recorded following incubation of the plates for 48 h at 30°C. Growth was not affected by the presence of the solvents used for the drugs (data not shown). (C and D) The intracellular accumulation assay of the fluorescent substrate (NR) in the different mutant variants of arginine 215 and 504. The intensity scale measurement is given in a.u. Results are the mean ± SD of at least three independent experiments. Student's t-test was performed to evaluate the statistical significance of the difference between Mdr1 and its mutant variants. P < 0.05 represented as *, P ≤ 0.01 represented as ** and P ≤ 0.001 represented as ***.

Protonation of R215 is critical for drug expulsion

The observation that the R215K and R215H variants retain the functionality of Mdr1 transporter, provided an opportunity to further examine the importance of the positive charge at the R215 position. We evaluated the in vivo pH effect on protonation of lysine and histidine residues in the R215K and R215H mutants, by changing the external pH. For this, cells were grown on solid agar media of different pH (Figure 6). All the variants along with the WT Mdr1 cells, in the absence of drug 4-NQO, grew well between the pH of 5.5 and 8. Notably, while the presence of the drug did not show any impact of pH on growth of WT cells, mutant variants R215A, R215E and R215Q were unable to grow under the indicated pH conditions (Figure 6A). However, R215K and R215H variants grew well at pH ranging from 5.5 to 6.5, but became more susceptible to 4-NQO at pH 7.0 and fully sensitive at higher pH. The impact of pH on R215K and R215H was further strengthened by NR accumulation assays. As depicted in Figure 6B, the NR accumulation was very low (normal efflux) between pH 5.5 and 6.5, which progressively increased corresponding to poor efflux at higher pH, i.e. 7.5–8.0. These experiments show that position 215 is critical for the proton transfer mechanism, which is preserved when a basic residue is present. Subsequent experiments with pHluroin fluorescence measurements corroborated our findings for these two residues. For instance, R215K and R215H could maintain the proton movement similar to WT as was evident from the measurement of decrease in cytosolic pH, but R215A, R215E and R215Q failed to do so (Figure 6C). Expectedly, mutant variants of R504 (R504A, R504E, R504Q, R504K and R504H) did not show any impact on pH and resistance profile towards 4-NQO and NR efflux, which remained unaltered across the pH ranges used as depicted in Figure 7A,B. On the other hand, R504K and R504H also did not lead to any change in pH, whereas the similar length amino acid substitutions R504E, R504Q could retain the native protein function (Figure 7C).

Drug resistance assay in R215 mutant variants under different pH conditions and measurement of proton import in relation to drug efflux.

Figure 6.
Drug resistance assay in R215 mutant variants under different pH conditions and measurement of proton import in relation to drug efflux.

(A) Cells were diluted and spotted on YEPD agar plates having a pH range from 5.5 to 8.0. YEPD plates without and with 4-NQO (0.2 μg/ml) at different pH ranges, plates were visualized after incubation for 48 h at 30°C. (B) Intracellular accumulation assay of the fluorescent substrate NR in the different mutant variants of arginine 215 as a function of pH. The intensity scale for fluorescence measurements is in a.u. (C) 4-NQO (0–150 μm) induced cellular acidification of WT and R215 mutant variants expressing pHluorin in an extracellular buffer of pH 6.5. The observed decrease in pH was observed in R215K and R215H mutants similar to WT. Results are the mean ± SD of at least three independent experiments. Student's t-test was performed to evaluate statistical significance of the difference between Mdr1 and its mutant variants. P < 0.05 represented as *, P ≤ 0.01 represented as ** and P ≤ 0.001 represented as ***.

Figure 6.
Drug resistance assay in R215 mutant variants under different pH conditions and measurement of proton import in relation to drug efflux.

(A) Cells were diluted and spotted on YEPD agar plates having a pH range from 5.5 to 8.0. YEPD plates without and with 4-NQO (0.2 μg/ml) at different pH ranges, plates were visualized after incubation for 48 h at 30°C. (B) Intracellular accumulation assay of the fluorescent substrate NR in the different mutant variants of arginine 215 as a function of pH. The intensity scale for fluorescence measurements is in a.u. (C) 4-NQO (0–150 μm) induced cellular acidification of WT and R215 mutant variants expressing pHluorin in an extracellular buffer of pH 6.5. The observed decrease in pH was observed in R215K and R215H mutants similar to WT. Results are the mean ± SD of at least three independent experiments. Student's t-test was performed to evaluate statistical significance of the difference between Mdr1 and its mutant variants. P < 0.05 represented as *, P ≤ 0.01 represented as ** and P ≤ 0.001 represented as ***.

Drug resistance assay in R504 mutant variants under different pH conditions and measurement of proton import in relation to drug efflux.

Figure 7.
Drug resistance assay in R504 mutant variants under different pH conditions and measurement of proton import in relation to drug efflux.

(A) Cells were diluted and spotted on YEPD agar plates having a pH range from 5.5 to 8.0. Showing YEPD plates without and with 4-NQO (0.2 μg/ml) at different pH ranges, plates were visualized after incubation for 48 h at 30°C. (B) Intracellular accumulation assay of the fluorescent substrate (NR) in the different mutant variants of R504 as a function of pH. The intensity scale for fluorescence measurements is in a.u. (C). 4-NQO (0–150 μm) induced cellular acidification of WT and R504 mutant variants expressing pHluorin in an extracellular buffer of pH 6.5. The observed decrease in pH was observed in R504Q and R504E mutant variants. Results are the mean ± SD of at least three independent experiments. Student's t-test was performed to evaluate statistical significance of the difference between Mdr1 and its mutant variants. P < 0.05 represented as *, P ≤ 0.01 represented as ** and P ≤ 0.001 represented as ***.

Figure 7.
Drug resistance assay in R504 mutant variants under different pH conditions and measurement of proton import in relation to drug efflux.

(A) Cells were diluted and spotted on YEPD agar plates having a pH range from 5.5 to 8.0. Showing YEPD plates without and with 4-NQO (0.2 μg/ml) at different pH ranges, plates were visualized after incubation for 48 h at 30°C. (B) Intracellular accumulation assay of the fluorescent substrate (NR) in the different mutant variants of R504 as a function of pH. The intensity scale for fluorescence measurements is in a.u. (C). 4-NQO (0–150 μm) induced cellular acidification of WT and R504 mutant variants expressing pHluorin in an extracellular buffer of pH 6.5. The observed decrease in pH was observed in R504Q and R504E mutant variants. Results are the mean ± SD of at least three independent experiments. Student's t-test was performed to evaluate statistical significance of the difference between Mdr1 and its mutant variants. P < 0.05 represented as *, P ≤ 0.01 represented as ** and P ≤ 0.001 represented as ***.

Of note, for the measurements of cytosolic pH in R215 and R504 mutant variants in relation to drug efflux, all mutant variants were constructed in an AD-Mdr1-pH background. First, 5% cell suspension of exponentially grown cells (WT and mutant variants) was incubated with different concentrations of drug (4-NQO) in the range of 0–150 μm for 30 min. Efflux was initiated after resuspension of drug-preloaded cells with MES (pH 6.5). The decrease in the cytosolic pH in response to drug efflux was measured in terms of change in pHluorin fluorescence. Expectedly, mutant variants of R504 (R504A, R504E, R504Q, R504K and R504H) did not show any impact of pH and the resistance profile towards 4-NQO and NR efflux remained unaltered across the pH ranges used as depicted in Figure 7A,B. On the other hand, R504K and R504H could not maintain such proton movement as measured by change in pHluorin fluorescence of R504 mutants, whereas the similar length amino acid substitutions R504E and R504Q did it (Figure 7C).

Discussion

The ability of Mdr1p to confer drug resistance towards many antifungals marks it as an important transporter relevant to clinical drug resistance in C. albicans. It belongs to the category of secondary active transporters, which uses the downhill gradient of the proton for its obligatory exchange with the drug to function as an antiporter. Since drug and proton exchange are reciprocally linked, a true measure of functionality of the protein should include the measurement of proton import linked to drug extrusion. The present study has primarily focused on the largely unexplored drug/H+ exchange linked with the functionality of Mdr1p. For this, we have successfully developed a system to monitor the import of protons linked to drug expulsion by monitoring changes in cytosolic pH. This is achieved by employing a pH-sensitive GFP fluorophore (pHluorin) to monitor cytosolic acidification in response to drug expulsion by Mdr1p overexpressing S. cerevisiae strain. Our experiments demonstrate that the efflux of the common drug substrates by Mdr1p indeed leads to the import of protons, resulting in cytosolic pH decrease as monitored by the reporter's fluorescence. Additionally, dose-dependent and time-course studies also enabled us to examine the change in cytosolic pH brought about by extrusion of different substrates in real time. Together, we established the utility of the system in carrying out functional studies pertaining to H+/drug transport by Mdr1p. The presence of positively and negatively charged residues is a common structural feature of a protonation and deprotonation site in secondary active transporters [32]. Accordingly, our efforts to unravel the role of charge residues of Mdr1p provide key insights. Our systematic alanine scanning of all charged residues reveals that while negatively charged residues do not apparently play a direct role in H+/drug transport, R215 of TMS-4 among positively charged residues is critical for protonation of the Mdr1 protein. That the replacement of R215 with Ala, Glu and Gln results in the loss of function of protein, but its replacement with Lys or His maintains that the drug transporter function reinforces the importance of TMS-4 arginine. Notwithstanding the fact that the presence of charged residues inside the membrane is energetically not favourable, an occurrence of membrane-embedded positively charged residues in Mdr1p points towards their crucial role in coupling of translocation of the proton with drug extrusion.

To assess the positional and functional significance of R215, molecular modelling of Mdr1p was done (Figure 8). Analysis of the 3D model suggests an overall crucial role of TMS-4, which houses the critical R215 residue, in the structural and functional aspects of Mdr1p. TMS-4 displays a dual positioning, mainly exposing its outer leaflet side, L211-F221, to the lipid interface, whereas the inner leaflet side, A222-V233, has no contact with lipids, being fully embedded inside the protein between TMS1–3 (Figure 8A,B). Three phenylalanine residues in the outer leaflet side, F216, F220 and F221 (Figure 8B,C), are facing the lipid interface, suggesting a precise role of these residues, either tightly anchoring this moiety of TMS-4 in the lipid outer layer and/or allowing a lateral sliding upon drug transport. Notably, these phenylalanine residues are well conserved in other antiporters such as the glycerol-3-phosphate transporter from E. coli, GlpT (F128, W132 and F133) [24] or the E. coli MDR transporter MdfA (F113, I117) [26]. The mutation of these residues in alanine should hamper folding/addressing of the protein, or if still folded/addressed, should hamper a good connection between the H+ pathway and drug translocation. Our mutation analysis reinforced this hypothesis. The single replacement by alanine of each phenylalanine yielded non-functional proteins (Figure 9B). Such interactions probably tether the helix and, to an extent, the protein within the membrane. Since proper orientation of the proton or drug-interacting residues is necessary for the conformational motions responsible for the passage of proton or the drug, this helix holds significance in the drug/H+ antiport. Interestingly, positioning of TMS-4 towards the centre of the protein in a typical MFS fold also points to its importance in the function of the antiporter, as alanine replacement of most of the residues constituting this TMS leads to drug-sensitive yeast [33] (Figure 9B). However, some residues of TMS-4 like L214A L217A, C225A and A227G when changed to alanine did not affect the drug susceptibility of cells expressing these mutant variants in the presence of tested drugs (Figure 9B).

Molecular model of Mdr1p depicting mutated residues with the participation of R215 in H+ binding and R504 and D501 in drug binding.

Figure 8.
Molecular model of Mdr1p depicting mutated residues with the participation of R215 in H+ binding and R504 and D501 in drug binding.

(A) The Mdr1p 3D model was generated as described in Experimental Procedures. The model is displayed in a cartoon, rainbow-coloured from residue 103 (blue) to residue 564 (red). TMSs are numbered at their N-terminus with the same colour scheme. TMS-7 and -11, which are in the front view, have been coloured with transparency. Residues mutated in the present study are displayed in the stick and labelled. (B) Model details displaying TMS-4 from the extracellular face surrounded by TMS1–3. Residues R215 and F216,220-221 are shown in the stick. (C) Superposition of Mdr1-R215 and of MdfA-R112 to the drug-binding region. Part of the 3D model of Mdr1p focused on the putative drug-binding region is displayed. Segments V154 to L171 of TMS2 and S495 to L518 of TMS11 were truncated for showing the drug-binding region. Drugs docked close to R215 are displayed according to results displayed in Figure 9, NR in orange and yellow, FLC in blue and CHX in green. The region surrounding R212 of the X-ray structure of MdfA superposed to the 3D model of Mdr1 is displayed in light green with the three drugs co-crystallized, chloramphenicol in magenta, LDAO in pink and DOC in violet [26]. The figure shows the dual position of Mdr1-R215 and MdfA-R112 either oriented towards the extracellular space for the former or pointing towards its drug-binding site for the later. Figures were generated with Pymol 1.7.

Figure 8.
Molecular model of Mdr1p depicting mutated residues with the participation of R215 in H+ binding and R504 and D501 in drug binding.

(A) The Mdr1p 3D model was generated as described in Experimental Procedures. The model is displayed in a cartoon, rainbow-coloured from residue 103 (blue) to residue 564 (red). TMSs are numbered at their N-terminus with the same colour scheme. TMS-7 and -11, which are in the front view, have been coloured with transparency. Residues mutated in the present study are displayed in the stick and labelled. (B) Model details displaying TMS-4 from the extracellular face surrounded by TMS1–3. Residues R215 and F216,220-221 are shown in the stick. (C) Superposition of Mdr1-R215 and of MdfA-R112 to the drug-binding region. Part of the 3D model of Mdr1p focused on the putative drug-binding region is displayed. Segments V154 to L171 of TMS2 and S495 to L518 of TMS11 were truncated for showing the drug-binding region. Drugs docked close to R215 are displayed according to results displayed in Figure 9, NR in orange and yellow, FLC in blue and CHX in green. The region surrounding R212 of the X-ray structure of MdfA superposed to the 3D model of Mdr1 is displayed in light green with the three drugs co-crystallized, chloramphenicol in magenta, LDAO in pink and DOC in violet [26]. The figure shows the dual position of Mdr1-R215 and MdfA-R112 either oriented towards the extracellular space for the former or pointing towards its drug-binding site for the later. Figures were generated with Pymol 1.7.

Helical wheel projection of TMS-4 and drug susceptibility of selected mutants and docking of NR, FLC and cycloheximide on Mdr1p 3D model.

Figure 9.
Helical wheel projection of TMS-4 and drug susceptibility of selected mutants and docking of NR, FLC and cycloheximide on Mdr1p 3D model.

(A) Helical wheel projection of protein sequence was constructed by the EMBOSS PEPWHEEL program. This displays the sequence in a helical representation as if looking down the axis of the helix. The hydrophilic residues are depicted as circles and hydrophobic residues as diamonds. Hydrophobicity is colour-coded as well: the most hydrophobic residue is green and residue with zero hydrophobicity is coded as yellow. Hydrophilic residues are coded red, the amount of red decreasing proportionally to hydrophilicity. The critical mutations that affected drug resistance are marked in the box. (B) Drug susceptibility of selected TMS-4 mutant variants as determined by spot assay with different drugs (CHX 0.2 μg/ml, FLC 0.6 μg/ml and NQO 0.2 μg/ml). Growth differences were recorded following incubation of the plates for 48 h at 30°C. The spot assays were repeated thrice, but only one representative image is shown. (C) Docking scores and poses obtained for NR, FCL and CHX. The eight best poses are displayed for each ligand, located in three different sites, named 1, 2 and 3. Each best location is indicated by a star and displayed in the corresponding models below. Sites 1–3 are close to the binding region of DOC, LDAO and chloramphenicol in MdfA [26].

Figure 9.
Helical wheel projection of TMS-4 and drug susceptibility of selected mutants and docking of NR, FLC and cycloheximide on Mdr1p 3D model.

(A) Helical wheel projection of protein sequence was constructed by the EMBOSS PEPWHEEL program. This displays the sequence in a helical representation as if looking down the axis of the helix. The hydrophilic residues are depicted as circles and hydrophobic residues as diamonds. Hydrophobicity is colour-coded as well: the most hydrophobic residue is green and residue with zero hydrophobicity is coded as yellow. Hydrophilic residues are coded red, the amount of red decreasing proportionally to hydrophilicity. The critical mutations that affected drug resistance are marked in the box. (B) Drug susceptibility of selected TMS-4 mutant variants as determined by spot assay with different drugs (CHX 0.2 μg/ml, FLC 0.6 μg/ml and NQO 0.2 μg/ml). Growth differences were recorded following incubation of the plates for 48 h at 30°C. The spot assays were repeated thrice, but only one representative image is shown. (C) Docking scores and poses obtained for NR, FCL and CHX. The eight best poses are displayed for each ligand, located in three different sites, named 1, 2 and 3. Each best location is indicated by a star and displayed in the corresponding models below. Sites 1–3 are close to the binding region of DOC, LDAO and chloramphenicol in MdfA [26].

3D modelling analysis of Mdr1p reveals that R215 is ideally located to play a role in the proton pathway, positioned in the outer leaflet and oriented towards the middle of the protein, pointing towards the extracellular face of Mdr1p. Multiple alignment of Mdr1p with known structures of MFS transporters show that R215 in Mdr1p is equivalent to R112 in the E. coli multidrug transporter MdfA that is equally oriented inside the TMS [34] but pointing towards the drug-binding site (Figure 8C). We observed the same conformational change capacity when docking drugs to the Mdr1p model (not shown), suggesting a possible mechanism of proton transfer. Similarly, mutational analysis of R112 of MdfA supports our data that, at this particular position, positive charge is important for the functional activity of protein as R112K and R112H are functional in comparison with R112A, R112E and R112Q, similar to R215 mutational analysis in Mdr1p. Since the location of R215 is pointing towards the extracellular face and hence, protonation (and thus the charge) of lysine and histidine can be affected by external pH, drug resistance of R215K and R215H was analyzed under different pH conditions. These mutants function efficiently at acidic or neutral pH, but not at basic pH, conditions. This strongly supports that acidic pH helps in better protonation of positive charge at position R215 in Mdr1p, which leads to better drug efflux at acidic pH in comparison with basic. Because of the above-discussed results and high conservation of this residue in the drug proton antiporter family, it is likely that R215 participates in the mechanism of proton recognition in DHA activity of Mdr1p.

Abbreviations

2-DOG, 2-deoxyglucose; 4-NQO, 4-nitroquinoline; ABC, ATP-binding cassette; Cdr1p, Candida Drug Resistance protein; CHX, cycloheximide; DHA1, drug/H+ antiporter 1; DOC, deoxycholate; FLC, fluconazole; GOF, gain of function; HEPES, 4-(2-hydroxyethyl)-1piperazineethanesulfonic acid; LDAO, N,N-dimethyldodecylamine N-oxide; LiAc, lithium acetate; MDR1, multidrug resistance 1; MES, 2-(N-morpholino) ethane sulfonic acid; MFS, major facilitator superfamily; MTX, methotrexate; NaN3, sodium azide; NR, Nile red; PEG, polyethylene glycol; PM, plasma membrane; TMDs, transmembrane domains; TMS, transmembrane segments.

Author Contribution

A.K.R., N.K.K., A.B. and R.P. designed the experiments; A.K.R., N.K.K. and A.B. performed the experiments. A.M. and P.F. contributed towards 3D modelling and analysis of the model. A.K.R., N.K.K., A.B., P.F. and R.P. wrote the paper. All authors read and approved the final manuscript.

Funding

The work has been supported in part by grants to R.P. from the Department of Biotechnology: DBT [No. BT/01/CEIB/10/III/02], DBT [No. BT/PR7392/MED/29/652/2012] and DBT [No. BT/PR14879/BRB10/885/2010]. P.F. was supported by Centre National de la Recherche Scientifique (CNRS) and Université Claude Bernard Lyon 1 (UCBL1) through recurrent funding and French National Research Agency [ANR-CLAMP-13-BSV5-0001-01] and [ANR-NMX-14-CE09-0024-03].

Acknowledgments

A.K.R., A.B. and N.K.K. acknowledge Senior Research Fellowship award from the Department of Biotechnology-Govt. of India (DBT-GOI), Council of Scientific and Industrial Research (CSIR) and University Grants Commission (UGC), respectively. We thank Dr Rajini Rao for the kind gift of pHluorin plasmid pZR4.1. The authors also thank Dr Abdul Haseeb Shah and Dr Manpreet Kaur Rawal for their help in preliminary work.

Competing Interests

The Authors declare that there are no competing interests associated with the manuscript.

References

References
1
Richardson
,
D.M.
(
2005
)
Changing patterns and trends in systemic fungal infections
.
J. Antimicrob. Chemother.
56
,
5
i11
doi:
2
Albertson
,
G.D.
,
Niimi
,
M.
,
Cannon
,
R.D.
and
Jenkinson
,
H.F.
(
1996
)
Multiple efflux mechanisms are involved in Candida albicans fluconazole resistance
.
Antimicrob. Agents Chemother.
40
,
2835
2841
PMID:
[PubMed]
3
Nakamura
,
K.
,
Niimi
,
M.
,
Niimi
,
K.
,
Holmes
,
A.R.
,
Yates
,
J.E.
,
Decottignies
,
A.
et al
(
2001
)
Functional expression of Candida albicans drug efflux pump Cdr1p in a Saccharomyces cerevisiae strain deficient in membrane transporters
.
Antimicrob. Agents Chemother.
45
,
3366
3374
doi:
4
Pao
,
S.S.
,
Paulsen
,
I.T.
and
Saier
, Jr,
M.H.
(
1998
)
Major facilitator superfamily
.
Microbiol. Mol. Biol. Rev.
62
,
1
34
PMID:
[PubMed]
5
Prasad
,
R.
and
Rawal
,
M.K.
(
2014
)
Efflux pump proteins in antifungal resistance
.
Front. Pharmacol.
5
,
202
doi:
6
Prasad
,
R.
and
Goffeau
,
A.
(
2012
)
Yeast ATP-binding cassette transporters conferring multidrug resistance
.
Annu. Rev. Microbiol.
66
,
39
63
doi:
7
Sanglard
,
D.
,
Kuchler
,
K.
,
Ischer
,
F.
,
Pagani
,
J.L.
,
Monod
,
M.
and
Bille
,
J.
(
1995
)
Mechanisms of resistance to azole antifungal agents in Candida albicans isolates from AIDS patients involve specific multidrug transporters
.
Antimicrob. Agents Chemother.
39
,
2378
2386
doi:
8
Sanglard
,
D.
,
Ischer
,
F.
,
Monod
,
M.
and
Bille
,
J.
(
1996
)
Susceptibilities of Candida albicans multidrug transporter mutants to various antifungal agents and other metabolic inhibitors
.
Antimicrob. Agents Chemother.
40
,
2300
2305
PMID:
[PubMed]
9
Rawal
,
M.K.
,
Khan
,
M.F.
,
Kapoor
,
K.
,
Goyal
,
N.
,
Sen
,
S.
,
Saxena
,
A.K.
et al
(
2013
)
Insight into pleiotropic drug resistance ATP-binding cassette pump drug transport through mutagenesis of Cdr1p transmembrane domains
.
J. Biol. Chem.
288
,
24480
24493
doi:
10
Sun
,
N.
,
Li
,
D.
,
Fonzi
,
W.
,
Li
,
X.
,
Zhang
,
L.
and
Calderone
,
R.
(
2013
)
Multidrug-resistant transporter Mdr1p-mediated uptake of a novel antifungal compound
.
Antimicrob. Agents Chemother.
57
,
5931
5939
doi:
11
Pasrija
,
R.
,
Banerjee
,
D.
and
Prasad
,
R.
(
2007
)
Structure and function analysis of CaMdr1p, a major facilitator superfamily antifungal efflux transporter protein of Candida albicans: identification of amino acid residues critical for drug/H+ transport
.
Eukaryot. Cell
6
,
443
453
doi:
12
Ben-Yaacov
,
R.
,
Knoller
,
S.
,
Caldwell
,
G.A.
,
Becker
,
J.M.
and
Koltin
,
Y.
(
1994
)
Candida albicans gene encoding resistance to benomyl and methotrexate is a multidrug resistance gene
.
Antimicrob. Agents Chemother.
38
,
648
652
doi:
13
Fling
,
M.E.
,
Kopf
,
J.
,
Tamarkin
,
A.
,
Gorman
,
J.A.
,
Smith
,
H.A.
and
Koltin
,
Y.
(
1991
)
Analysis of a Candida albicans gene that encodes a novel mechanism for resistance to benomyl and methotrexate
.
Mol. Gen. Genet.
227
,
318
329
doi:
14
Kapoor
,
K.
,
Rehan
,
M.
,
Kaushiki
,
A.
,
Pasrija
,
R.
,
Lynn
,
A.M.
and
Prasad
,
R.
(
2009
)
Rational mutational analysis of a multidrug MFS transporter CaMdr1p of Candida albicans by employing a membrane environment based computational approach
.
PloS Comput. Biol.
5
,
e1000624
doi:
15
Paulsen
,
I.T.
and
Skurray
,
R.A.
(
1993
)
Topology, structure and evolution of two families of proteins involved in antibiotic and antiseptic resistance in eukaryotes and prokaryotes — an analysis
.
Gene
124
,
1
11
doi:
16
Rottenberg
,
H.
(
1979
)
The measurement of membrane potential and ΔpH in cells, organelles, and vesicles
.
Methods Enzymol.
55
,
547
569
doi:
17
Lamping
,
E.
,
Monk
,
B.C.
,
Niimi
,
K.
,
Holmes
,
A.R.
,
Tsao
,
S.
,
Tanabe
,
K.
et al
(
2007
)
Characterization of three classes of membrane proteins involved in fungal azole resistance by functional hyperexpression in Saccharomyces cerevisiae.
Eukaryot. Cell
6
,
1150
1165
doi:
18
Brett
,
C.L.
,
Tukaye
,
D.N.
,
Mukherjee
,
S.
and
Rao
,
R.
(
2005
)
The yeast endosomal Na+(K+)/H+ exchanger Nhx1 regulates cellular pH to control vesicle trafficking
.
Mol. Biol. Cell.
16
,
1396
1405
doi:
19
Maresova
,
L.
,
Hoskova
,
B.
,
Urbankova
,
E.
,
Chaloupka
,
R.
and
Sychrova
,
H.
(
2010
)
New applications of pHluorin-measuring intracellular pH of prototrophic yeasts and determining changes in the buffering capacity of strains with affected potassium homeostasis
.
Yeast
27
,
317
325
. PMID:
[PubMed]
20
Ivnitski-Steele
,
I.
,
Holmes
,
A.R.
,
Lamping
,
E.
,
Monk
,
B.C.
,
Cannon
,
R.D.
and
Sklar
,
L.A.
(
2009
)
Identification of Nile Red as a fluorescent substrate of the Candida albicans ATP-binding cassette transporters Cdr1p and Cdr2p and the major facilitator superfamily transporter Mdr1p
.
Anal. Biochem.
394
,
87
91
doi:
21
Kapoor
,
K.
,
Rehan
,
M.
,
Lynn
,
A.M.
and
Prasad
,
M.
(
2010
)
Employing information theoretic measures and mutagenesis to identify residues critical for drug-Proton antiport function in Mdr1p of Candida albicans
.
PLoS ONE
5
,
e11041
doi:
22
Mukhopadhyay
,
K.
,
Kohli
,
A.
and
Prasad
,
R.
(
2002
)
Drug susceptibilities of yeast cells are affected by membrane lipid composition
.
Antimicrob. Agents Chemother.
46
,
3695
3705
doi:
23
Haas
,
J.
,
Roth
,
S.
,
Arnold
,
K.
,
Kiefer
,
F.
,
Schmidt
,
T.
,
Bordoli
,
L.
et al
(
2013
)
The protein model portal-—a comprehensive resource for protein structure and model information
.
Database (Oxford)
2013
,
bat031
doi:
24
Huang
,
Y.
,
Lemieux
,
M.J.
,
Song
,
J.
,
Auer
,
M.
and
Wang
,
D.N.
(
2003
)
Structure and mechanism of the glycerol-3-phosphate transporter from Escherichia coli
.
Science
301
,
616
620
doi:
25
Yin
,
Y.
,
He
,
X.
,
Szewczyk
,
P.
,
Nguyen
,
T.
and
Chang
,
G.
(
2006
)
Structure of the multidrug transporter EmrD from Escherichia coli
.
Science
312
,
741
744
doi:
26
Heng
,
J.
,
Zhao
,
Y.
,
Liu
,
M.
,
Liu
,
Y.
,
Fan
,
J.
,
Wang
,
X.
et al
(
2015
)
Substrate-bound structure of the E. coli multidrug resistance transporter MdfA
.
Cell Res.
25
,
1060
1073
doi:
27
Trott
,
O.
and
Olson
,
A.J.
(
2010
)
Autodock Vina: improving the speed and accuracy of docking with a new scoring function, efficient optimization, and multithreading
.
J. Comput. Chem.
31
,
455
461
doi:
28
Zhang
,
X.
,
Wong
,
S.E.
and
Lightstone
,
F.C.
(
2013
)
Message passing interface and multithreading hybrid for parallel molecular docking of large databases on petascale high performance computing machines
.
J. Comput. Chem.
34
,
915
927
doi:
29
Morris
,
G.M.
,
Huey
,
R.
,
Lindstrom
,
W.
,
Sanner
,
M.F.
,
Belew
,
R.K.
,
Goodsell
,
D.S.
et al
(
2009
)
AutoDock4 and AutodockTools4: automated docking with selective receptor flexiblity
.
J. Comput. Chem.
30
,
2785
2791
doi:
30
Keniya
,
M.V.
,
Fleischer
,
E.
,
Klinger
,
A.
,
Cannon
,
R.D.
and
Monk
,
B.C.
(
2015
)
Inhibitors of the Candida albicans major facilitator superfamily transporter Mdr1p responsible for fluconazole resistance
.
PLoS ONE
10
,
e0126350
doi:
31
Mandal
,
A.
,
Kumar
,
A.
,
Singh
,
A.
,
Lynn
,
A.M.
,
Kapoor
,
K.
and
Prasad
,
R.
(
2012
)
A key structural domain of the Candida albicans Mdr1 protein
.
Biochem. J.
445
,
313
322
doi:
32
Shi
,
Y.
(
2013
)
Common folds and transport mechanisms of secondary active transporters
.
Annu. Rev. Biophys.
42
,
51
72
doi:
33
Yan
,
N.
(
2015
)
Structural biology of the major facilitator superfamily transporters
.
Annu. Rev. Biophys.
44
,
257
283
doi:
34
Sigal
,
N.
,
Vardy
,
E.
,
Molshanski-Mor
,
S.
,
Eitan
,
A.
,
Pilpel
,
Y.
,
Schuldiner
,
S.
et al
(
2005
)
3D model of the Escherichia coli multidrug transporter MdfA reveals an essential membrane-Embedded positive charge
.
Biochemistry
44
,
14870
14880
doi: