The ISWI class of proteins consists of a family of chromatin remodeling ATPases that is ubiquitous in eukaryotes and predominantly functions to slide nucleosomes laterally. The yeast Saccharomyces cerevisiae Isw1 partners with several non-essential alternative subunits — Ioc2, Ioc3, or Ioc4 — to form two distinct complexes Isw1a and Isw1b. Besides its ATPase domain, Isw1 presents a C-terminal region formed by HAND, SANT, and SLIDE domains responsible for interaction with the Ioc proteins and optimal association of Isw1 to chromatin. Despite diverse studies on the functions of the Isw1-containing complexes, molecular evidence for a regulation of this chromatin remodeling ATPase is still elusive. Results presented here indicate that Isw1 is not only ubiquitylated but also strongly SUMOylated on multiple lysine residues by the redundant Siz1/Siz2 SUMO E3 ligases. However, Isw1 is a poor substrate of the Ulp1 and Ulp2 SUMO proteases, thus resulting in a high level of modification. Extensive site-directed mutagenesis allowed us to identify the major SUMOylation sites and develop a SUMO-defective mutant of Isw1. Using this molecular tool, we show that SUMOylation of Isw1 specifically facilitates and/or stabilizes its interaction with its cofactor Ioc3 and consequently the efficient recruitment of the Isw1–Ioc3 complex onto chromatin. Together these data reveal a new regulatory mechanism for this fascinating remodeling factor.

Introduction

Chromatin remodelers have the faculty to slide, eject, or reposition nucleosomes, thereby providing the transcription and replication machineries with dynamic access to the genome. To exert these functions, they take advantage of the energy released by ATP hydrolysis catalyzed by their ATPase domain. They are classified based on the sequence homology of their conserved ATPase subunit into four distinct families: ISWI, INO80/SWR1, CHD, and SWI/SNF (including RSC) [14]. The ISWI family composed of ISW1 and ISW2 complexes in Saccharomyces cerevisiae, as well as the unique representative of the CHD family in yeast, Chd1, represent the major actors of nucleosome spacing in vivo [5,6].

The Isw1 ATPase forms two distinct complexes, Isw1a and b with its specific cofactors, Ioc3 and Ioc2/Ioc4, respectively [1,7]. Genome-wide, Isw1 was shown to spread across all genic nucleosome positions, whereas Ioc3 is enriched at nucleosome +1 and Ioc4 at nucleosomes +2, +3, and +4, suggesting that the Ioc subunits may confer distinct genome-wide positional specificities on Isw1 [8]. However, deletion of ISW1 does not significantly affect transcription [7,9] and ISW1 rather participates in the maintenance of chromatin integrity during RNA polymerase II-mediated transcription elongation. It indeed prevents cryptic transcription over coding regions through its ability to antagonize trans-histone exchange [5,8,1012]. Recently, we could demonstrate an unexpected function of Isw1 as a quality control factor that surveys nuclear mRNP biogenesis [13].

In addition to its ATPase domain, Isw1 contains closely spaced HAND, SANT, and SLIDE motifs in the C-terminal region that provide the ability of Isw1 to interact with nucleosomes [1416]. The recruitment of the ISW1 complex onto active genes requires both Set1-mediated tri-methylation of histone H3 at lysine 4 and Set2-mediated H3K36 methylation, shown to recruit the Ioc4 subunit of the complex via an interaction with its PWWP domain [11,17]. Whether the recruitment of ISW1 onto chromatin could be regulated by other mechanisms, such as post-translational modifications, has not yet been investigated. In this respect, SUMOylation of transcription regulators has been recently reported to modulate their clearance from the promoter [18] or to favor gene silencing by controlling protein–protein interactions as well as multi-subunit complexes assembly (reviewed in [19,20]).

Here, we show that Isw1 is not only ubiquitylated but also strongly SUMOylated by Siz1/Siz2 SUMO E3 ligases. Isw1 is SUMO-modified on multiple sites, which we could determine by poly-SUMOylation. Our results support that SUMOylation of Isw1 favors its interaction with its cofactor Ioc3 and its efficient association with chromatin.

Materials and methods

Yeast strains and plasmids, and culture

The S. cerevisiae strains and plasmids used in the present study are listed in Tables 1 and 2, respectively. Yeast cells were grown overnight at 30°C either in yeast extract, peptone, and dextrose (YPD) medium or in synthetic medium (SD) with the appropriate supplements. Strains containing the ulp1-ts allele were grown at permissive temperature (25°C) and subsequently shifted to 37°C for 3 h before harvesting for biochemical analysis. For cell growth assay, five-fold serial dilutions of the different strains were spotted on YPD or SD with the appropriate supplement plates. For drug sensitivity analysis, cells were incubated for 90 min at 30°C in the presence of MMS (0.02%) or HU (100 mM).

Table 1
Strains used in the present study
Name Genotype Reference or origin 
WT (W303) Mat a, ade2-, leu2-, his-, trp-, ura3- Laboratory collection 
rad5 G535R Mat a, ade2-, leu2-, his-, trp-, ura3-, rad5 G535R Laboratory collection 
ISW1-3HA Mat a, ade2-, leu2-, his-, trp-, ura3-, ISW1-3HA::KANMX The present study 
ISW1-3HA siz1Δ Mat a, ade2-, leu2-, his-, trp-, ura3-, ISW1-3HA::KANMX, siz1::NAT The present study 
ISW1-3HA siz2Δ Mat a, ade2-, leu2-, his-, trp-, ura3-, ISW1-3HA::KANMX, siz2::Hph The present study 
ISW1-3HA siz1Δ siz2Δ Mat a, ade2-, leu2-, his-, trp-, ura3-, ISW1-3HA::KANMX, siz1::NAT, siz2::Hph The present study 
ISW1-3HA IOC3-13MYC siz1Δ siz2Δ Mat a, ade2-, leu2-, his-, trp-, ura3-, ISW1-3HA::KANMX, IOC3-13MYC::HIS siz1::NAT, siz2::Hph The present study 
ISW1-3HA IOC3-13MYC Mat a, ade2-, leu2-, his-, trp-, ura3-, ISW1-3HA::KANMX, IOC3-13MYC::HIS The present study 
ISW1-GFP Mat a, ade2-, leu2-, his-, trp-, ura3-, ISW1-GFP::HIS The present study 
ISW1-KR-GFP Mat a, ade2-, leu2-, his-, trp-, ura3-, ISW1-K(1102, 1103, 1105)R-GFP::HIS The present study 
isw1Δ Mat a, ade2-, leu2-, his-, trp-, ura3-, isw1::KANMX Laboratory collection 
WT (S288C) Mat α, ura3-52, leu2-1 A. Corbett 
ISW1-13MYC Mat α, ura3-52, leu2-1, ISW1-13MYC::KANMX The present study 
ISW1-13MYC ulp2Δ Mat α, ura3-52, leu2-1, ISW1-13MYC::KANMX, ulp2Δ::Hph The present study 
ulp1ts Mat a, ULP1::KANMX, YCplac111-ulp1-333 [47
ulp1ts ISW1-3HA Mat a, ULP1::KANMX, YCplac111-ulp1-333, ISW1-3HA:: HIS The present study 
SUMO-KRall Mat a, smt3::HIS3MX6 Ylplac211-smt3-KRall::URA3 [33
SUMO-KRall ISW1-3HA Mat a, smt3::HIS3MX6 Ylplac211-smt3-KRall::URA3, Isw1-3HA::KANMX The present study 
WT (BY4742) Mat a, his3-, leu2-, lys2-, ura3- EUROSCARF 
IOC2-13Myc isw1Δ Mat a, his3-, leu2-, lys2-, ura3-, IOC2-3Myc::KANMX, isw1::HIS3 The present study 
IOC3-13Myc isw1Δ Mat a, his3-, leu2-, lys2-, ura3-, IOC3-3Myc::KANMX, isw1::HIS3 The present study 
IOC4-13Myc isw1Δ Mat a, ade2-, leu2-, his-, trp-, ura3-, IOC4-3Myc::KANMX, isw1::HIS3 The present study 
Name Genotype Reference or origin 
WT (W303) Mat a, ade2-, leu2-, his-, trp-, ura3- Laboratory collection 
rad5 G535R Mat a, ade2-, leu2-, his-, trp-, ura3-, rad5 G535R Laboratory collection 
ISW1-3HA Mat a, ade2-, leu2-, his-, trp-, ura3-, ISW1-3HA::KANMX The present study 
ISW1-3HA siz1Δ Mat a, ade2-, leu2-, his-, trp-, ura3-, ISW1-3HA::KANMX, siz1::NAT The present study 
ISW1-3HA siz2Δ Mat a, ade2-, leu2-, his-, trp-, ura3-, ISW1-3HA::KANMX, siz2::Hph The present study 
ISW1-3HA siz1Δ siz2Δ Mat a, ade2-, leu2-, his-, trp-, ura3-, ISW1-3HA::KANMX, siz1::NAT, siz2::Hph The present study 
ISW1-3HA IOC3-13MYC siz1Δ siz2Δ Mat a, ade2-, leu2-, his-, trp-, ura3-, ISW1-3HA::KANMX, IOC3-13MYC::HIS siz1::NAT, siz2::Hph The present study 
ISW1-3HA IOC3-13MYC Mat a, ade2-, leu2-, his-, trp-, ura3-, ISW1-3HA::KANMX, IOC3-13MYC::HIS The present study 
ISW1-GFP Mat a, ade2-, leu2-, his-, trp-, ura3-, ISW1-GFP::HIS The present study 
ISW1-KR-GFP Mat a, ade2-, leu2-, his-, trp-, ura3-, ISW1-K(1102, 1103, 1105)R-GFP::HIS The present study 
isw1Δ Mat a, ade2-, leu2-, his-, trp-, ura3-, isw1::KANMX Laboratory collection 
WT (S288C) Mat α, ura3-52, leu2-1 A. Corbett 
ISW1-13MYC Mat α, ura3-52, leu2-1, ISW1-13MYC::KANMX The present study 
ISW1-13MYC ulp2Δ Mat α, ura3-52, leu2-1, ISW1-13MYC::KANMX, ulp2Δ::Hph The present study 
ulp1ts Mat a, ULP1::KANMX, YCplac111-ulp1-333 [47
ulp1ts ISW1-3HA Mat a, ULP1::KANMX, YCplac111-ulp1-333, ISW1-3HA:: HIS The present study 
SUMO-KRall Mat a, smt3::HIS3MX6 Ylplac211-smt3-KRall::URA3 [33
SUMO-KRall ISW1-3HA Mat a, smt3::HIS3MX6 Ylplac211-smt3-KRall::URA3, Isw1-3HA::KANMX The present study 
WT (BY4742) Mat a, his3-, leu2-, lys2-, ura3- EUROSCARF 
IOC2-13Myc isw1Δ Mat a, his3-, leu2-, lys2-, ura3-, IOC2-3Myc::KANMX, isw1::HIS3 The present study 
IOC3-13Myc isw1Δ Mat a, his3-, leu2-, lys2-, ura3-, IOC3-3Myc::KANMX, isw1::HIS3 The present study 
IOC4-13Myc isw1Δ Mat a, ade2-, leu2-, his-, trp-, ura3-, IOC4-3Myc::KANMX, isw1::HIS3 The present study 

The derivative strains (chromosomally tagging and mutant) were constructed using a PCR-based homologous recombination [21]. Plasmids encoding different Isw1-KR-FLAG point mutants were constructed from pRS416-Isw1-WT-2Flag indicated in Table 2 using the site-directed mutagenesis kit (QuikChange; Agilent Technologies).

Table 2
Plasmids used in the present study
Plasmid name Description Reference or origin 
YEp352-6His-Ub 2μ/URA3/CUPpromoter/6-His-Ub [48
YEp352-6His-SUMO 2μ/URA3/CUPpromoter/6-His-SUMO [24
pRS416–ISW1-2FL CEN/URA3/ISW1-2Flag T. Tsukiyama 
pRS416–K751/2/3R-2FL CEN/URA3/K751/2/3R-2Flag (Lys 751, 752 and 753 to Arg) The present study 
pRS416–K928R-2FL CEN/URA3/K928R-2Flag (Lys928 to Arg) The present study 
pRS416–K1102/3/5R-2FL CEN/URA3/K1102/3/5R-2Flag (Lys1102, 1103 and 1105 to Arg) The present study 
pRS416–2KR1-2FL CEN/URA3/2KR1-2Flag (Lys 751, 752, 753 and Lys 1102, 1103, 1105 to Arg) The present study 
pRS416–2KR2-2FL CEN/URA3/2KR2-2Flag (Lys 928 and Lys 1102, 1103, 1105 to Arg) The present study 
pRS416–3KR-2FL CEN/URA3/3KR-2Flag (Lys 751, 752, 753, Lys 928 and Lys 1102, 1103, 1105 to Arg) The present study 
P415-ISW1 CEN/LEU2/ISW1 The present study 
Plasmid name Description Reference or origin 
YEp352-6His-Ub 2μ/URA3/CUPpromoter/6-His-Ub [48
YEp352-6His-SUMO 2μ/URA3/CUPpromoter/6-His-SUMO [24
pRS416–ISW1-2FL CEN/URA3/ISW1-2Flag T. Tsukiyama 
pRS416–K751/2/3R-2FL CEN/URA3/K751/2/3R-2Flag (Lys 751, 752 and 753 to Arg) The present study 
pRS416–K928R-2FL CEN/URA3/K928R-2Flag (Lys928 to Arg) The present study 
pRS416–K1102/3/5R-2FL CEN/URA3/K1102/3/5R-2Flag (Lys1102, 1103 and 1105 to Arg) The present study 
pRS416–2KR1-2FL CEN/URA3/2KR1-2Flag (Lys 751, 752, 753 and Lys 1102, 1103, 1105 to Arg) The present study 
pRS416–2KR2-2FL CEN/URA3/2KR2-2Flag (Lys 928 and Lys 1102, 1103, 1105 to Arg) The present study 
pRS416–3KR-2FL CEN/URA3/3KR-2Flag (Lys 751, 752, 753, Lys 928 and Lys 1102, 1103, 1105 to Arg) The present study 
P415-ISW1 CEN/LEU2/ISW1 The present study 

To genomically integrate the Isw1 KR-GFP mutation, a PCR fragment was generated containing ISW1-K1102/1103/1105R followed by full length of GFP, the ADH1 terminator, the HIS3MX6 cassette, and 50 nt complementary to the ISW1 locus just downstream of the stop codon. The PCR fragment was obtained using the primer pairs ISW1-K1102/3/5R-Int-F TGATGGAGTAGAGAGCAGAAGAGCGAGGATTGAGGATACGTCGAATGTTGGAACTGAACAGTTGGTAGCAGAGAAAATTCCGGAAAACGAAACCACTCATCGGATCCCCGGGTTAATTAA, and ISW1-K1102/3/5R-Int-R AGCATGGTGTAGGATATATTAAAAAAAATCGAAATATAAAAAAAGAAGGTGAATTCGAGCTCGTTTAAAC, with a plasmid pFA6a-GFP-HIS3MX6 as the template. Yeast cells were transformed and selected on restrictive medium plates (DO-HIS). Finally, the clones were verified by DNA sequencing.

Purification of ubiquitylated and SUMOylated proteins

Cells transformed with a plasmid encoding 6His-Ubiquitin or 6His-SUMO under the CUP1 promoter were grown on a selective medium and stimulated overnight with 0.1 mM CuSO4. A total of 100 OD600 of cells were lysed with glass beads in a 20% TCA solution, and the final TCA concentration in the cell lysate was adjusted to 12%. Cell lysates were incubated at 4°C for 45 min and precipitated proteins were collected by centrifugation. Proteins were resuspended in lysis buffer containing 6 M Guanidinium–HCl, 100 mM K2HPO4, 20 mM Tris–HCl (pH 8.0), 100 mM NaCl, 0.1% Triton X-100, and 10 mM Imidazole. Purification was performed on Ni2+-NTA agarose beads (Qiagen) prewashed with lysis buffer, and incubated for 1 h at room temperature. The beads were washed with 8 M urea, 0.1 M Na2HPO4/NaH2PO4 (pH 6.3), 0.01 M Tris–HCl (pH 6.3), 10 mM Imidazole, 10 mM β-mercaptoethanol, 0.1% Triton X-100 before elution and western blot analysis using anti-HA (Covance), anti-HIS tag (Millipore), and polyclonal rabbit anti-Smt3 (a gift from B. Palancade) antibodies.

Fluorescence microscopy

Wide-field fluorescence images were acquired by a microscope (DMR; Leica) with a 100× Plan Apochromat HCX oil immersion objective and a CoolSNAP HQ2 charge-coupled device (CCD) camera (Photometrics). Rapid and precise z-positioning was accomplished by a piezoelectric motor (Linear Variable Differential Transformer; Physik Instrumente) mounted underneath the objective lens. Maximum intensity projections were performed using the ImageJ software. Identical processing parameters were used.

Chromatin immunoprecipitation analysis

ChIPs (chromatin immunoprecipitations) were performed as previously described [22]. Cell cultures were cross-linked for 10 min with 1.2% formaldehyde (37%; Sigma). Sonicated extracts were centrifuged for 20 min at 10 000 g at 4°C prior to overnight immunoprecipitation, using specific antibodies, and 50 μl of pre-washed protein G Sepharose beads (GE Healthcare) were added to each sample, and incubated for 2 h at room temperature. After reversing cross-linking, genomic DNA was purified using Qiagen PCR purification Kit and quantified by quantitative PCR using the SYBR Green mix (Roche) and the Light Cycler 480 system (Roche) with gene-specific primers described in Table 3. The antibodies used in this ChIP assay are an anti-CTD antibody that recognizes all forms of CTD (8WG16 antibody, Covance), anti-HA (clone HA.11, 16B12, Covance), anti-FLAG M2 (SIGMA), or anti-myc (9E10, Roche) antibodies. Non-specific signals were systematically assessed by analyzing immunoprecipitated DNA using primers for intergenic regions and used to normalize results when indicated.

Table 3
qPCR primers used in the present study
Name Sequence 
PYK1 5′ F TGGTTGCTTTGAGAAAGGCTGG 
PYK1 5′ R TTGGTGGTTTGGTGGGATTGG 
PYK1 3′ F TGGTTACCAGATGCCCAAGAG 
PYK1 3′ R CTTGAAACCTTGGATGGAAACG 
PMA1 5′ F TCAGCTCATCAGCCAACTCAAG 
PMA1 5′ R CGTCGACACCGTGATTAGATTG 
PMA1 Mid′ F TTGCCAGCTGTCGTTACCAC 
PMA1 Mid′ R TCGACACCAGCCAAGGATTC 
PMA1 3′ F TACTGTCGTCCGTGTCTGGATCT 
PMA1 3′ R CCTTCATTGGCTTACCGTTCA 
Intergenic F CGCATTACCAGACGGAGATGT 
Intergenic R CAAGCAAGCCTTGTGCATAAGA 
Name Sequence 
PYK1 5′ F TGGTTGCTTTGAGAAAGGCTGG 
PYK1 5′ R TTGGTGGTTTGGTGGGATTGG 
PYK1 3′ F TGGTTACCAGATGCCCAAGAG 
PYK1 3′ R CTTGAAACCTTGGATGGAAACG 
PMA1 5′ F TCAGCTCATCAGCCAACTCAAG 
PMA1 5′ R CGTCGACACCGTGATTAGATTG 
PMA1 Mid′ F TTGCCAGCTGTCGTTACCAC 
PMA1 Mid′ R TCGACACCAGCCAAGGATTC 
PMA1 3′ F TACTGTCGTCCGTGTCTGGATCT 
PMA1 3′ R CCTTCATTGGCTTACCGTTCA 
Intergenic F CGCATTACCAGACGGAGATGT 
Intergenic R CAAGCAAGCCTTGTGCATAAGA 

Co-immunoprecipitation assays

Cells deleted for endogenous ISW1 and bearing IOC2::13Myc, IOC3::13Myc, or IOC4::13Myc were transformed with a plasmid encoding either ISW1 WT-FLAG or isw1 KR-FLAG mutant and grown on selective medium. 100 OD600 of cells were collected, washed twice with 1× cold PBS and lysed with glass beads — using a MagNA Lyser device — in IP buffer [20 mM HEPES (pH 7.5), 150 mM NaCl, 5 mM MgCl2, 10% Glycerol, 0.5% Triton X-100, 20 mM N-ethylmaleimide and proteases inhibitors (Roche)].

Purification was performed on protein G-Sepharose beads (GE Healthcare) prewashed twice with cold IP buffer and incubated with anti-Flag M2 (Sigma–Aldrich) or anti-HA (clone HA.11, 16B12, Covance) for 90 min at 4°C. Cleared cell lysates were incubated for 90 min at 4°C with anti-Flag M2-coupled protein G-Beads were then washed four times with cold IP buffer and once with modified cold IP buffer containing 500 mM NaCl. Immunoprecipitated proteins were eluted from beads by boiling samples at 95°C for 5 min in Laemmli buffer and western blot analysis were performed using either anti-Flag M2, anti-c-Myc, or anti-Smt3 antibodies. For anti-Flag western blots, input lanes correspond to 10% and for anti-Smt3 blots, input lanes correspond to 20% of the total input engaged in the IP.

Antibodies

Antibodies used in the present study are anti-HA (clone HA.11, 16B12, Covance; WB: 1/1000; ChIP: 8 μg), anti-His (Millipore; WB: 1/2000), polyclonal anti-Smt3 (gift from B. Palancade; WB: 1/10 000), anti-myc (9E10, Roche; WB: 1/2000), anti-Flag M2 (SIGMA; WB: 1/6000), and anti-RNA polymerase II (anti-CTD 8WG16, Covance; ChIP: 5 μg). Western blot analyses were performed using appropriate horseradish peroxidase-coupled secondary antibodies and chemiluminescence protein immunoblotting reagents (Pierce).

Results

The chromatin remodeling factor Isw1 is strongly SUMOylated

The ISW1 complex is one of the major chromatin remodeling complexes in yeast. In order to understand whether its cellular functions could be regulated, we first analyzed the post-translational modifications of its catalytic subunit, Isw1. For this purpose, ubiquitylation and SUMOylation of Isw1 were analyzed in cells expressing genomically HA-tagged ISW1 as well as copper-induced 6His-tagged version of ubiquitin or SUMO. Modified proteins from denatured cell extracts were purified on Nickel column and analyzed using anti-HA antibodies [23,24]. Based on this approach, a tiny fraction of Isw1 was found monoubiquitylated (Figure 1A). Isw1 has been found in SUMO proteomic screens [25]. Accordingly, multi-SUMOylated species of Isw1 could be easily detected after purification but also in total extracts (input) (Figure 1B) and the observed pattern is totally consistent with what has been previously described [25]. SUMOylation is achieved by a cascade of enzymatic activities, consisting of a unique heterodimeric SUMO activating enzyme Uba2/Aos1, a unique SUMO-conjugating enzyme Ubc9 and various SUMO E3 ligases, with four members described in S. cerevisiae, Siz1, Siz2, Mms21, and Cst9 [2630]. Although deletion of either SIZ1 or SIZ2 did not abrogate Isw1 SUMOylation, deletion of these redundant SUMO E3s promoted a complete disappearance of SUMOylated Isw1 (Figure 1C). Yeast expresses two SUMO proteases, Ulp1 and 2. Ulp1 is essential for cell growth and is localized at the nuclear pore complex, whereas Ulp2 is encoded by a non-essential gene, distributed all over the nucleus, and sometimes enriched in the nucleolus [31,32]. Surprisingly, none of these SUMO proteases appears to cleave off SUMO from Isw1 (Figure 1D,E) and deletion of ULPs even led to a decrease in SUMOylated Isw1. This lack of apparent sensitivity to ULPs enzymatic activity could result from some redundancies between Ulp1 and Ulp2 and might account for the high expression of SUMOylated Isw1. The complete lack of Isw1 SUMOylation in ulp2Δ cells also suggests an indirect role of this enzyme in Isw1 modification. More precisely, this could be due to either stabilization of SUMO conjugates on other cellular proteins and decrease in the available SUMO pool or alternatively, impairment of Ulp-dependent pre-SUMO processing (see Figure 1D, lower panel).

Isw1 is ubiquitylated and SUMOylated.

Figure 1.
Isw1 is ubiquitylated and SUMOylated.

Ni-purified 6His-ubiquitin (Ub) or 6His-SUMO-conjugated forms of Isw1-HA or Isw1-Myc were extracted from cells transformed (+) or not transformed (−) with a plasmid encoding 6His-ubiquitin or 6His-SUMO, respectively, under the control of the CUP1 promoter. Ni-purified material (eluate, top) and cell lysates (middle) were examined by western blotting with anti-HA and anti-Myc antibodies, respectively. Ubiquitin and SUMO expression and efficiency of purification were controlled using an anti-6His or anti-SUMO antibody, respectively (bottom). Monoubiquitylated Isw1 is referred as mono-Ub Isw1-3HA and poly-SUMO-modified Isw1 are referred as (Sumo)n Isw1; the asterisk denotes an anti-HA cross-reactive band. (A) Analysis of ubiquitin-conjugated forms of genomically HA-tagged Isw1 in wild-type cells. (BE) SUMO-conjugated forms of genomically HA-tagged or Myc-tagged Isw1 were analyzed in wild-type cells (B); WT, siz1Δ, siz2Δ, and siz1Δsiz2Δ cells (C); WT and ulp2Δ cells (D); WT and ulp1ts cells (E). For these latter strains, WT and ulp1ts cells for analyzing SUMO-conjugated forms of Isw1 were grown overnight at the permissive temperature (25°C) and then shifted to the restrictive temperature (37°C) for 3 h. Each data has been reproduced at least in three independent experiments.

Figure 1.
Isw1 is ubiquitylated and SUMOylated.

Ni-purified 6His-ubiquitin (Ub) or 6His-SUMO-conjugated forms of Isw1-HA or Isw1-Myc were extracted from cells transformed (+) or not transformed (−) with a plasmid encoding 6His-ubiquitin or 6His-SUMO, respectively, under the control of the CUP1 promoter. Ni-purified material (eluate, top) and cell lysates (middle) were examined by western blotting with anti-HA and anti-Myc antibodies, respectively. Ubiquitin and SUMO expression and efficiency of purification were controlled using an anti-6His or anti-SUMO antibody, respectively (bottom). Monoubiquitylated Isw1 is referred as mono-Ub Isw1-3HA and poly-SUMO-modified Isw1 are referred as (Sumo)n Isw1; the asterisk denotes an anti-HA cross-reactive band. (A) Analysis of ubiquitin-conjugated forms of genomically HA-tagged Isw1 in wild-type cells. (BE) SUMO-conjugated forms of genomically HA-tagged or Myc-tagged Isw1 were analyzed in wild-type cells (B); WT, siz1Δ, siz2Δ, and siz1Δsiz2Δ cells (C); WT and ulp2Δ cells (D); WT and ulp1ts cells (E). For these latter strains, WT and ulp1ts cells for analyzing SUMO-conjugated forms of Isw1 were grown overnight at the permissive temperature (25°C) and then shifted to the restrictive temperature (37°C) for 3 h. Each data has been reproduced at least in three independent experiments.

Together these results show that the chromatin remodeling factor Isw1 is strongly SUMOylated by the concerted action of Ubc9 and Siz1/Siz2, whereas neither Ulp1 nor Ulp2 is sufficient to reverse this modification.

Isw1 is SUMOylated on multiple lysine residues

As shown in Figure 1, Isw1 displays multiple SUMOylated species. To distinguish poly-SUMOylation from multisite SUMOylation, we took advantage of a SUMO mutant in which all lysines have been mutated into arginines. This mutant is thus unable to form lysine-linked poly-SUMO chains [33]. Expression of this lysine-less SUMO variant (SUMO-KRall) as the only source of SUMO resulted in a change in the Isw1 SUMOylation pattern, but not in a complete disappearance of the (SUMO)n-conjugated forms of Isw1, indicating that Isw1 is likely modified on multiple sites and by poly-SUMOylation (Figure 2A).

Isw1 is SUMOylated on multiple lysine residues.

Figure 2.
Isw1 is SUMOylated on multiple lysine residues.

(A) Cells expressing a His-SUMO variant, in which all lysine residues were replaced by arginines (6His-SUMO-KRall) as the only source of SUMO, were used for Ni-purification to distinguish poly-SUMOylation from multisite SUMOylation. (B) Predicted SUMOylation sites by SUMOsp2.0 (upper scheme) as well as lysine residues near or within the SANT and the SLIDE domains or Isw1 are indicated on a schematic representation of Isw1. Lysine residues indicated in red have been tested in SUMOylation assay. Lysines 751/2/3, 928, 1102/3/5 (bold red) scored positive in this assay, as shown in (C). Each SUMOylation assay has been reproduced at least in three independent experiments. (D) Localization of GFP-tagged Isw1 wild-type (WT) and mutated variant (K1102R, K1103R, and K1105R) was examined by both fluorescence microscopy and differential interferential contrast (DIC). Scale bar, 5 μm. (E) Cells deleted for endogenous ISW1 were transformed with either WT ISW1-Flag or isw1 KR-Flag mutant. The stability of Isw1 was analyzed upon treatment with 100 µg/ml cycloheximide (CX) for the indicated times (h) at 30°C. Total cell extracts were examined by western blotting with anti-FLAG antibodies.

Figure 2.
Isw1 is SUMOylated on multiple lysine residues.

(A) Cells expressing a His-SUMO variant, in which all lysine residues were replaced by arginines (6His-SUMO-KRall) as the only source of SUMO, were used for Ni-purification to distinguish poly-SUMOylation from multisite SUMOylation. (B) Predicted SUMOylation sites by SUMOsp2.0 (upper scheme) as well as lysine residues near or within the SANT and the SLIDE domains or Isw1 are indicated on a schematic representation of Isw1. Lysine residues indicated in red have been tested in SUMOylation assay. Lysines 751/2/3, 928, 1102/3/5 (bold red) scored positive in this assay, as shown in (C). Each SUMOylation assay has been reproduced at least in three independent experiments. (D) Localization of GFP-tagged Isw1 wild-type (WT) and mutated variant (K1102R, K1103R, and K1105R) was examined by both fluorescence microscopy and differential interferential contrast (DIC). Scale bar, 5 μm. (E) Cells deleted for endogenous ISW1 were transformed with either WT ISW1-Flag or isw1 KR-Flag mutant. The stability of Isw1 was analyzed upon treatment with 100 µg/ml cycloheximide (CX) for the indicated times (h) at 30°C. Total cell extracts were examined by western blotting with anti-FLAG antibodies.

We previously reported that SUMO is conjugated to a lysine residue within a consensus site, ΨKxE/D, where Ψ is a large hydrophobic amino acid and x is any amino acid [34]. However, many proteins are SUMO-modified on non-consensus sites that could be predicted using different computational approaches. Using the SUMOsp2.0 software [35], we could indeed envisage many putative SUMOylation sites in Isw1 (Figure 2B, upper scheme). Deletion assays suggested that the region encompassing amino acids 430–690 was not SUMO-modified, but that the C-terminal region comprising the HAND, SANT, and SLIDE domains responsible for chromatin binding might participate in SUMO-conjugation (not shown). We thus developed a set of plasmids expressing FLAG-tagged Isw1 and carrying lysine to arginine mutations in each predicted SUMOylation site (except lysines 515 and 660) as well as in each lysine within or near the HAND, SANT, and SLIDE domains (Figure 2B, lower scheme). Of note, mutations of adjacent lysine residues were introduced on the same plasmid. These point mutants of Isw1 were expressed in isw1Δ cells and tested for SUMOylation. Within this collection, we could identify three lysine patches that participate in Isw1 SUMOylation. The K751/2/3 is located upstream the HAND, SANT, and SLIDE domains, K928 belongs to the SANT domain and K1102/3/5 corresponds to a consensus SUMO site located downstream of the SLIDE module. Deleting one of these sites was not sufficient for a reasonable decrease in SUMOylation, but a combination of mutations led to a significant inhibition of Isw1 SUMOylation (Figure 2C). Lysine residues 1102/3/5 are part of the bipartite NLS of Isw1 [36]. In addition, SUMO is essentially conjugated in the nuclear compartment [34]. Affecting nuclear import could thus indirectly result in a SUMOylation defect. However, GFP-tagged version of wt (wild-type) and K1102/3/5R mutant of Isw1 similarly localized in the nucleus at the steady state (Figure 2D), indicating that K1102/3/5R mutations did not affect the NLS function and that the decrease in SUMOylation of the corresponding mutant cannot be due to a perturbed nuclear localization of the protein. These data thus confirm that the K102/3/5 is indeed a SUMOylation site. Importantly, cycloheximide chase assays indicate that the SUMO-defective mutant of Isw1 combining mutations K751/2/3R, K928R, and K1102/3/5R (named Isw1 KR) was found as stable as the wt protein suggesting that SUMOylation of Isw1 does likely not influence ubiquitin-mediated degradation of this ATPase (Figure 2E).

These data thus indicate that SUMOylation of Isw1 follows a complex pattern, with multiple site and poly-SUMOylation, at least on some sites. Despite this complexity, we were able to develop a SUMO-defective mutant that could be used to analyze the function(s) of these modifications.

SUMOylation of Isw1 facilitates its interaction with its cofactor Ioc3

As previously mentioned, Isw1 associates with Ioc2/Ioc4 and Ioc3 cofactors to form two distinct complexes, Isw1b and a, respectively [1,7]. Since SUMOylation can regulate protein–protein interactions, the Isw1 mutant combining K751/2/3R, K928R, and K1102/3/5R mutations (Isw1 KR-FLAG) was analyzed for its ability to interact with Ioc proteins. Immunoprecipitation assays were performed on isw1Δ cells expressing a FLAG-tagged version of either wt or SUMO-defective mutant of Isw1 (Isw1 KR-FLAG). Immunoprecipitation of wt (Isw1 WT-FLAG) and western blotting analysis with anti-Smt3 (SUMO) antibodies revealed that SUMOylation of ectopically expressed Isw1 is well conserved under the experimental conditions used for immunoprecipitation and displayed a SUMOylation pattern similar to what was observed after expression of 6His-tagged version of SUMO and purification on Ni column (Figure 3A compare with Figure 1B). Importantly, the SUMOylation of the Isw1 KR-FLAG mutant was strongly decreased in the same experimental conditions (Figure 3A). Using strains expressing genomically 13Myc-tagged IOCs, co-precipitation of Ioc proteins 2, 3, and 4 with wt or SUMO-defective mutant Isw1-FLAG was precisely analyzed by western blotting (Figure 3B, left panel) and quantified (Figure 3B, right panel). Expression of plasmid-based expression was similar for both Isw1 WT-FLAG and KR-FLAG mutant. The amount of Ioc3 that co-precipitated with Isw1 was significantly decreased by 50% when SUMO sites were mutated, whereas the interaction of Ioc2 and Ioc4 proteins was not affected. None of the lysine mutated into arginine in the Isw1 KR-FLAG is directly involved in the interaction with Ioc3 [16], thus excluding a simple mutation-mediating effect on the interaction. To confirm this result, the interaction between Isw1-HA and Ioc3-Myc was analyzed in siz1Δ siz2Δ cells. Despite the fitness of these cells, we could reproducibly (in n = 4 independent experiments) observed a decrease by ∼30% of the interaction between Isw1 and Ioc3 in mutant cells (Figure 3C).

Isw1 SUMOylation facilitates the formation of Isw1a (Isw1 and Ioc3) but not Isw1b (Isw1, Ioc2, and Ioc4) complex.

Figure 3.
Isw1 SUMOylation facilitates the formation of Isw1a (Isw1 and Ioc3) but not Isw1b (Isw1, Ioc2, and Ioc4) complex.

(A) Cells deleted for endogenous ISW1 were transformed with either WT ISW1-Flag or isw1 KR-Flag mutant. Inputs and Flag-tagged proteins purified using anti-Flag M2-coupled protein G-Sepharose beads (IP Flag) were analyzed by western blotting using anti-Flag M2 or anti-Smt3. (B) Cells deleted for endogenous ISW1 and expressing Myc-tagged versions of Ioc 2, Ioc3, or Ioc4 were transformed with empty vector, WT ISW1-Flag or isw1 KR-Flag mutant. Inputs and IP Flag were analyzed by western blotting using anti-Flag M2 or anti-c-Myc antibodies. Signals were quantified and the ratio of Co-IP (co-immunoprecipitation) Ioc2-13Myc, Ioc3-13Myc, or Ioc4-13Myc relative to each IP Isw1-Flag in Isw1 KR mutant compared with that in Isw1 WT cells. The ratio of immunoprecipitated Isw1-Flag (Black bars) and Ioc-13myc (Grey bars) in isw1 KR-Flag cells relative to WT ISW1-Flag cells was quantified from three independent experiments. Histograms depict the mean and SEM and the significance of results was analyzed using Student's t-test (*P = 0.01–0.05). (C) Inputs and IP HA were analyzed in Wt and siz1Δ siz2Δ cells expressing Myc-tagged version of Ioc3 and HA-tagged version of Isw1, or WT cells expressing Myc-tagged version of Ioc3 and FLAG-tagged version of Isw1 as a control, by western blotting using anti-HA or anti-c-Myc antibodies. Signals were quantified as in (B) in four independent experiments.

Figure 3.
Isw1 SUMOylation facilitates the formation of Isw1a (Isw1 and Ioc3) but not Isw1b (Isw1, Ioc2, and Ioc4) complex.

(A) Cells deleted for endogenous ISW1 were transformed with either WT ISW1-Flag or isw1 KR-Flag mutant. Inputs and Flag-tagged proteins purified using anti-Flag M2-coupled protein G-Sepharose beads (IP Flag) were analyzed by western blotting using anti-Flag M2 or anti-Smt3. (B) Cells deleted for endogenous ISW1 and expressing Myc-tagged versions of Ioc 2, Ioc3, or Ioc4 were transformed with empty vector, WT ISW1-Flag or isw1 KR-Flag mutant. Inputs and IP Flag were analyzed by western blotting using anti-Flag M2 or anti-c-Myc antibodies. Signals were quantified and the ratio of Co-IP (co-immunoprecipitation) Ioc2-13Myc, Ioc3-13Myc, or Ioc4-13Myc relative to each IP Isw1-Flag in Isw1 KR mutant compared with that in Isw1 WT cells. The ratio of immunoprecipitated Isw1-Flag (Black bars) and Ioc-13myc (Grey bars) in isw1 KR-Flag cells relative to WT ISW1-Flag cells was quantified from three independent experiments. Histograms depict the mean and SEM and the significance of results was analyzed using Student's t-test (*P = 0.01–0.05). (C) Inputs and IP HA were analyzed in Wt and siz1Δ siz2Δ cells expressing Myc-tagged version of Ioc3 and HA-tagged version of Isw1, or WT cells expressing Myc-tagged version of Ioc3 and FLAG-tagged version of Isw1 as a control, by western blotting using anti-HA or anti-c-Myc antibodies. Signals were quantified as in (B) in four independent experiments.

These data thus clearly support that SUMOylation of Isw1 is required for an optimal interaction of this ATPase with its Ioc3 cofactor.

SUMOylation of ISW1 facilitates its recruitment onto chromatin

To evaluate whether the SUMO-dependent interaction of the Isw1a complex is required for a correct recruitment of Isw1 onto active genes, ChIP assays were first performed on two constitutive genes, PMA1 and PYK1, in wt cells or cells affected in Isw1 E3 ligases, siz1Δ, siz2Δ, and siz1Δ siz2Δ cells. As shown in Figure 4A, inactivation of both SIZ1 and SIZ1 significantly decreased the detection of Isw1 all along the gene body, whereas deletion of either SIZ1 or SIZ2 had no significant effect. However, we observed that deleting both SUMO E3s also strongly altered the recruitment of the RNA polII (CTD) over the same genes (Figure 4B). As a consequence, deletion of Isw1 E3 ligases did not affect the Isw1/CTD ratio on PMA1 and PYK1 genes (Figure 4C). This could indicate that either SUMOylation of Isw1 is required for its recruitment onto chromatin as well as for CTD recruitment, or alternatively that loss of SUMO ligases affects transcriptional activity.

SUMOylation of Isw1 is required for its efficient recruitment on active genes.

Figure 4.
SUMOylation of Isw1 is required for its efficient recruitment on active genes.

(A–C) Recruitment of Isw1-HA (A) or RNA polymerase II C-terminal domain (CTD) (B) on the PMA1 or PYK1 gene was analyzed by ChIP experiments performed on extracts prepared from WT, siz1Δ+siz2Δ, siz1Δ, and siz2Δ cells grown overnight at 30°C using anti-HA antibody (against Isw1-3HA) or anti-CTD antibody (against CTD). Ratio of Isw1/CTD recruitment was calculated in each experiment (C). Histograms depict the mean and SEM of four independent experiments. Significance of the differences observed between WT and mutant cells was evaluated using Student's t-test (* P = 0.01–0.1; **P = 0.001–0.01). (DF) Recruitment of CTD (D), Isw1-HA (E), Ioc3-Myc, and Ioc4-Myc (F) on extracts prepared from isw1Δ cells expressing or not Isw1 and isw1-KR. Histograms depict the mean and SEM of three to five independent experiments. Significance of the differences observed between isw1Δ cells expressing WT and mutant Isw1 was evaluated using Student's t-test using paired samples (* P = 0.01–0.1; **P = 0.001–0.01).

Figure 4.
SUMOylation of Isw1 is required for its efficient recruitment on active genes.

(A–C) Recruitment of Isw1-HA (A) or RNA polymerase II C-terminal domain (CTD) (B) on the PMA1 or PYK1 gene was analyzed by ChIP experiments performed on extracts prepared from WT, siz1Δ+siz2Δ, siz1Δ, and siz2Δ cells grown overnight at 30°C using anti-HA antibody (against Isw1-3HA) or anti-CTD antibody (against CTD). Ratio of Isw1/CTD recruitment was calculated in each experiment (C). Histograms depict the mean and SEM of four independent experiments. Significance of the differences observed between WT and mutant cells was evaluated using Student's t-test (* P = 0.01–0.1; **P = 0.001–0.01). (DF) Recruitment of CTD (D), Isw1-HA (E), Ioc3-Myc, and Ioc4-Myc (F) on extracts prepared from isw1Δ cells expressing or not Isw1 and isw1-KR. Histograms depict the mean and SEM of three to five independent experiments. Significance of the differences observed between isw1Δ cells expressing WT and mutant Isw1 was evaluated using Student's t-test using paired samples (* P = 0.01–0.1; **P = 0.001–0.01).

To distinguish a specific effect of Isw1 SUMOylation on Isw1 recruitment from a general consequence of SUMOylation on transcription, ChIP assays were performed on isw1Δ cells expressing or not a FLAG-tagged version of either wt or SUMO-defective mutant of Isw1 (isw1 KR). Expressing wt or mutated Isw1 did not alter the recruitment of RNA polII compared with what observed in isw1Δ cells, indicating that expression of Isw1 does not significantly influence transcriptional activity ([7,9]; Figure 4D). In contrast, affecting Isw1 SUMOylation reproducibly correlates with a decreased recruitment of mutated Isw1 on both PMA1 and PYK1 genes (Figure 4E). To analyze whether this decreased recruitment of Isw1 affects preferentially Isw1a or Isw1b complexes, or both, the recruitment of Ioc3 (Isw1a) and Ioc4 (Isw1b) was analyzed in the same conditions. As shown in Figure 4F, the recruitment of Ioc3 onto active genes was facilitated by the expression of Isw1 (compare isw1Δ cells expressing or not a FLAG-tagged version of wt Isw1), but significantly decreased upon expression of isw1 KR mutant. In contrast, Ioc4 was ChIPed at the same level in the absence or in the presence of wt and mutant Isw1 (Figure 4F), thus confirming the ability of Ioc4 to directly interact with methylated H3K36 independently of Isw1 [11].

This result thus indicates that SUMOylation of Isw1 facilitates the recruitment and/or stabilizes Isw1, and in particular Isw1a, onto active genes most likely by affecting the correct formation and/or stabilization of the Isw1a complex.

SUMOylation of Isw1 does not participate in the SUMO-mediated DNA-damage response pathway

SUMOylation appears as an essential modification for an optimal cell response to various stresses, including heat shock, oxidative, and genotoxic stress [37]. Interestingly, it has been previously described that deletion of Isw1 or any member of the ISW1 complex led to an increased sensitivity to the DNA-damaging agent methyl methane sulfonate (MMS), thus suggesting a role in the DNA damage response [38,39]. Many factors involved in DNA repair have been shown to be SUMOylated in response to DNA damage, although inhibiting modification of individual repair factor is not sufficient to induce a significant phenotype, whereas simultaneous mutations of SUMO sites of several proteins of the same pathway trigger some DNA repair defects [33]. In addition, it has been proposed that both the Mec1/Rad53-mediated checkpoint pathway and the DNA-damage-induced SUMOylation of repair factors are required to fully support cell response to genotoxic stress [33,40]. However, exposure to MMS or to the replicative stress-inducing agent hydroxyurea did not increase Isw1 SUMOylation (Figure 5A) nor growth of isw1Δ cells (Figure 5B and not shown). Together these results thus indicate that Isw1 SUMOylation is unlikely to participate in the SUMO-mediated DNA-damage response pathway and rather plays a constitutive role in Isw1a complex formation and recruitment onto chromatin.

SUMOylation of Isw1 is independent from genotoxic stress.

Figure 5.
SUMOylation of Isw1 is independent from genotoxic stress.

(A) Isw1 SUMOylation was analyzed as in Figure 1 in cells treated with (+) or without (−) MMS (0.02%) or 100 mM HU for 90 min. These data have been reproduced at least in three independent experiments. (B) MMS sensitivity analysis of wt and isw1Δ mutant cells. Serial dilutions of indicated wt and mutant cells were spotted without or with MMS (0.01%).

Figure 5.
SUMOylation of Isw1 is independent from genotoxic stress.

(A) Isw1 SUMOylation was analyzed as in Figure 1 in cells treated with (+) or without (−) MMS (0.02%) or 100 mM HU for 90 min. These data have been reproduced at least in three independent experiments. (B) MMS sensitivity analysis of wt and isw1Δ mutant cells. Serial dilutions of indicated wt and mutant cells were spotted without or with MMS (0.01%).

Discussion

In the present paper, we show that Isw1 is SUMOylated by the concerted action of two major SUMO E3 ligases Siz1/Siz2, on multiple sites within its C-terminal part comprising the HAND, SANT, and SLIDE domains. Our data support that SUMOylation facilitates and/or stabilizes the interaction of Isw1 with its cofactor Ioc3, thereby influencing the efficient recruitment of this remodeler to chromatin.

Despite the fact that we were not able to completely abolish the SUMOylation of Isw1 by pinpointing unique lysine residues, we could significantly inhibit this post-translational modification by combining seven lysine to arginine mutations located just before the HAND domain (K751/2/3), in the SANT domain (K928), and at the C-terminus (K1102/3/5). Such a multiSUMOylation is not unique to Isw1. Progress in SUMO proteomics reveals an increasing number of proteins that are multi-SUMOylated, but the function(s) of such a multi-modification is still unclear and may be specific for each concerned protein [41]. In contrast, concerted SUMOylation of proteins involved in the same functional pathway (or SUMO group modification) can mediate the spatial clustering of the modified proteins and their partners, thus participating in the spatial regulation of some functions, such as DNA repair [33].

Isw1 is the common enzymatic ATPase subunit of both Isw1a (Isw1/Ioc3) and Isw1b (Isw1/Ioc2/Ioc4) chromatin remodeling complexes [7]. All three Ioc partners interact with the C-terminal region of Isw1 ATPase with distinct affinities [1,15]. Indeed, Ioc2 and Ioc4 are interdependent for their interaction with Isw1 and are able to bind both the SANT and SLIDE modules, whereas Ioc3 interacts with the SLIDE domain that is essential for nucleosome recognition and sliding activity of Isw1 [1416]. Defining multiple SUMOylation sites in this C-terminal region of Isw1 responsible for both chromatin binding and interactions with the Ioc proteins predicted a putative impact of these modifications on the capacity of Isw1 to either recognize and bind to chromatin, or alternatively to influence the formation and/or the stabilization of Isw1 complexes.

Our data indeed indicate that preventing Isw1 SUMOylation specifically affected the interaction of Isw1 with its Ioc3 partner. The interaction between Ioc3 and the SLIDE domain of Isw1 has been precisely defined by X-Ray analysis and requires a pocket determined by four α-helices of the Ioc3 protein (corresponding to amino acids 179–191, 385–402, 404–414, and 608–613) in which the SLIDE module of Isw1 is retained [16]. In addition, a defined HAND/SANT/SLIDE binding loop (residues 316–361) extends from Ioc3 and bulges across SLIDE to reach the SANT domain containing the SUMOylated residue K928 [16]. Together this may suggest that conjugation of K928 by SUMO could interfere with or facilitate the proper binding of the SANT domain to the Ioc3 loop. However, altering SUMOylation of K928 was not sufficient to affect the interaction of Isw1 with Ioc3 (not shown), indicating that SUMOylation on the other residues participates in the stabilization of the Isw1a complex in vivo. SUMO conjugates typically mediate protein–protein interactions by binding to a specific SUMO-Interacting Motif (SIM) [25,42]. Although highly variable, most SIMs are characterized by a loose consensus sequence composed of 3–4 aliphatic residues or hydrophobic core and flanking acidic and/or phosphorylatable amino acids [43]. Interestingly, two distinct software programs predicted a high-score SIM module within the region of Ioc3 required for its interaction with Isw1 (residues 389–393aa) [16,44,45].

Our ChIP experiments indicated that SUMOylation of Isw1 facilitates the recruitment and/or stabilizes Isw1 on active genes. More precisely, the recruitment of the Isw1a complex is affected, whereas that of Isw1b is not. This last point is in agreement with the ability of the Isw1b to be recruited independently of Isw1, via the direct interaction between the PWWP motif of Ioc4 and methylated H3K36 [11]. It has been proposed that Isw1–Ioc3 interacts with two nucleosomes simultaneously, with one DNA copy bound or External linker bound only to Ioc3 and the second DNA copy or internal linker DNA bound to SANT and SLIDE domains of Isw1 and Ioc3 [16]. Affecting the Isw1–Ioc3 interaction by inhibiting Isw1 SUMOylation, and also maybe the SANT/DNA interaction, is thus predicted to decrease Isw1 recruitment onto chromatin. However, the SUMO-insensitive interaction of Isw1 with Ioc2 and Ioc4 in the Isw1b complex is likely responsible for the modest effect of SUMO inhibition on Isw1 recruitment onto chromatin.

Finally, we found that SUMOylation of Isw1, unlike many SUMOylation events in yeast [46], is insensitive to genotoxic or replication stresses. This constitutive high level of Isw1 SUMOylation likely participates in a correct Isw1 formation and recruitment onto chromatin, proposed to be involved for a proper repression of inducible genes [1].

Abbreviations

     
  • ChIP

    chromatin immunoprecipitation

  •  
  • Co-IP

    co-immunoprecipitation

  •  
  • MMS

    methyl methane sulfonate

  •  
  • SD

    synthetic medium

  •  
  • wt

    wild-type

  •  
  • YPD

    yeast extract, peptone, and dextrose

Author Contribution

Experiments and data analysis were performed by Q.S., N.B., and L.M.-B., Q.S., N.B., and C.D. designed the experiments and analyzed the data; C.D. wrote the manuscript. All authors drafted the manuscript, approved the version to be published, and agreed to be accountable for all aspects of the work in ensuring that questions related to the accuracy or integrity of any part of the work are appropriately investigated and resolved.

Funding

This work was supported by the Who am I? Laboratory of excellence [grant ANR-11-LABX-0071] funded by the ‘Investments for the Future' program operated by The French National Research Agency [grant ANR-11-IDEX-0005-01], the Fondation pour la Recherche Medicale, the National Institute of Cancer (INCA) and the Cancéropole Ile de France.

Acknowledgments

We thank T. Tsukiyama, S. Jentsch, B. Palancade, and J. Mellor for providing us with reagents and strains. We are grateful to members of Dargemont laboratory and B. Palancade for their helpful discussions.

Competing Interests

The Authors declare that there are no competing interests associated with the manuscript.

References

References
1
Mellor
,
J.
and
Morillon
,
A.
(
2004
)
ISWI complexes in Saccharomyces cerevisiae
.
Biochim. Biophys. Acta, Gene Struct. Expr.
1677
,
100
112
doi:
2
Hota
,
S.K.
and
Bartholomew
,
B.
(
2011
)
Diversity of operation in ATP-dependent chromatin remodelers
.
Biochim. Biophys. Acta, Gene Regul. Mech.
1809
,
476
487
doi:
3
Narlikar
,
G.J.
,
Sundaramoorthy
,
R.
and
Owen-Hughes
,
T.
(
2013
)
Mechanisms and functions of ATP-dependent chromatin-remodeling enzymes
.
Cell
154
,
490
503
doi:
4
Swygert
,
S.G.
and
Peterson
,
C.L.
(
2014
)
Chromatin dynamics: interplay between remodeling enzymes and histone modifications
.
Biochim. Biophys. Acta, Gene Regul. Mech.
1839
,
728
736
doi:
5
Gkikopoulos
,
T.
,
Schofield
,
P.
,
Singh
,
V.
,
Pinskaya
,
M.
,
Mellor
,
J.
,
Smolle
,
M.
et al. 
(
2011
)
A role for Snf2-related nucleosome-spacing enzymes in genome-wide nucleosome organization
.
Science
333
,
1758
1760
doi:
6
Ocampo
,
J.
,
Chereji
,
R.V.
,
Eriksson
,
P.R.
and
Clark
,
D.J.
(
2016
)
The ISW1 and CHD1 ATP-dependent chromatin remodelers compete to set nucleosome spacing in vivo
.
Nucleic Acids Res.
44
,
4625
4635
doi:
7
Vary
, Jr,
J.C.
,
Gangaraju
,
V.K.
,
Qin
,
J.
,
Landel
,
C.C.
,
Kooperberg
,
C.
,
Bartholomew
,
B.
et al. 
(
2003
)
Yeast Isw1p forms two separable complexes in vivo
.
Mol. Cell. Biol.
23
,
80
91
doi:
8
Yen
,
K.
,
Vinayachandran
,
V.
,
Batta
,
K.
,
Koerber
,
R.T.
and
Pugh
,
B.F.
(
2012
)
Genome-wide nucleosome specificity and directionality of chromatin remodelers
.
Cell
149
,
1461
1473
doi:
9
Lenstra
,
T.L.
,
Benschop
,
J.J.
,
Kim
,
T.S.
,
Schulze
,
J.M.
,
Brabers
,
N.A.C.H.
,
Margaritis
,
T.
et al. 
(
2011
)
The specificity and topology of chromatin interaction pathways in yeast
.
Mol. Cell
42
,
536
549
doi:
10
Cheung
,
V.
,
Chua
,
G.
,
Batada
,
N.N.
,
Landry
,
C.R.
,
Michnick
,
S.W.
,
Hughes
,
T.R.
et al. 
(
2008
)
Chromatin- and transcription-related factors repress transcription from within coding regions throughout the Saccharomyces cerevisiae genome
.
PLoS Biol.
6
,
e277
doi:
11
Smolle
,
M.
,
Venkatesh
,
S.
,
Gogol
,
M.M.
,
Li
,
H.
,
Zhang
,
Y.
,
Florens
,
L.
et al. 
(
2012
)
Chromatin remodelers Isw1 and Chd1 maintain chromatin structure during transcription by preventing histone exchange
.
Nat. Struct. Mol. Biol.
19
,
884
892
doi:
12
Tirosh
,
I.
,
Sigal
,
N.
and
Barkai
,
N.
(
2010
)
Widespread remodeling of mid-coding sequence nucleosomes by Isw1
.
Genome Biol.
11
,
R49
doi:
13
Babour
,
A.
,
Shen
,
Q.
,
Dos-Santos
,
J.
,
Murray
,
S.
,
Gay
,
A.
,
Challal
,
D.
et al. 
(
2016
)
The chromatin remodeler ISW1 is a quality control factor that surveys nuclear mRNP biogenesis
.
Cell
167
,
1201
1214.e15
doi:
14
Grüne
,
T.
,
Brzeski
,
J.
,
Eberharter
,
A.
,
Clapier
,
C.R.
,
Corona
,
D.F.
,
Becker
,
P.B.
et al. 
(
2003
)
Crystal structure and functional analysis of a nucleosome recognition module of the remodeling factor ISWI
.
Mol. Cell
12
,
449
460
doi:
15
Pinskaya
,
M.
,
Nair
,
A.
,
Clynes
,
D.
,
Morillon
,
A.
and
Mellor
,
J.
(
2009
)
Nucleosome remodeling and transcriptional repression are distinct functions of Isw1 in Saccharomyces cerevisiae
.
Mol. Cell. Biol.
29
,
2419
2430
doi:
16
Yamada
,
K.
,
Frouws
,
T.D.
,
Angst
,
B.
,
Fitzgerald
,
D.J.
,
DeLuca
,
C.
,
Schimmele
,
K.
et al. 
(
2011
)
Structure and mechanism of the chromatin remodelling factor ISW1a
.
Nature
472
,
448
453
doi:
17
Santos-Rosa
,
H.
,
Schneider
,
R.
,
Bernstein
,
B.E.
,
Karabetsou
,
N.
,
Morillon
,
A.
,
Weise
,
C.
et al. 
(
2003
)
Methylation of histone H3 K4 mediates association of the Isw1p ATPase with chromatin
.
Mol. Cell
12
,
1325
1332
doi:
18
Rosonina
,
E.
,
Duncan
,
S.M.
and
Manley
,
J.L.
(
2012
)
Sumoylation of transcription factor Gcn4 facilitates its Srb10-mediated clearance from promoters in yeast
.
Genes Dev.
26
,
350
355
doi:
19
Raman
,
N.
,
Nayak
,
A.
and
Muller
,
S.
(
2013
)
The SUMO system: a master organizer of nuclear protein assemblies
.
Chromosoma
122
,
475
485
doi:
20
Rouvière
,
J.O.
,
Geoffroy
,
M.-C.
and
Palancade
,
B.
(
2013
)
Multiple crosstalks between mRNA biogenesis and SUMO
.
Chromosoma
122
,
387
399
doi:
21
Longtine
,
M.S.
,
McKenzie
, III,
A.
,
Demarini
,
D.J.
,
Shah
,
N.G.
,
Wach
,
A.
,
Brachat
,
A.
et al. 
(
1998
)
Additional modules for versatile and economical PCR-based gene deletion and modification in Saccharomyces cerevisiae
.
Yeast
14
,
953
961
doi:
22
Gwizdek
,
C.
,
Iglesias
,
N.
,
Rodriguez
,
M.S.
,
Ossareh-Nazari
,
B.
,
Hobeika
,
M.
,
Divita
,
G.
et al. 
(
2006
)
Ubiquitin-associated domain of Mex67 synchronizes recruitment of the mRNA export machinery with transcription
.
Proc. Natl Acad. Sci. U.S.A.
103
,
16376
16381
doi:
23
Hayakawa
,
A.
,
Babour
,
A.
,
Sengmanivong
,
L.
and
Dargemont
,
C.
(
2012
)
Ubiquitylation of the nuclear pore complex controls nuclear migration during mitosis in S. cerevisiae
.
J. Cell Biol.
196
,
19
27
doi:
24
Niño
,
C.A.
,
Guet
,
D.
,
Gay
,
A.
,
Brutus
,
S.
,
Jourquin
,
F.
,
Mendiratta
,
S.
et al. 
(
2016
)
Posttranslational marks control architectural and functional plasticity of the nuclear pore complex basket
.
J. Cell Biol.
212
,
167
180
doi:
25
Hannich
,
J.T.
,
Lewis
,
A.
,
Kroetz
,
M.B.
,
Li
,
S.-J.
,
Heide
,
H.
,
Emili
,
A.
et al. 
(
2005
)
Defining the SUMO-modified proteome by multiple approaches in Saccharomyces cerevisiae
.
J. Biol Chem.
280
,
4102
4110
doi:
26
Johnson
,
E.S.
and
Gupta
,
A.A.
(
2001
)
An E3-like factor that promotes SUMO conjugation to the yeast septins
.
Cell
106
,
735
744
doi:
27
Zhao
,
X.
and
Blobel
,
G.
(
2005
)
A SUMO ligase is part of a nuclear multiprotein complex that affects DNA repair and chromosomal organization
.
Proc. Natl Acad. Sci. U.S.A.
102
,
4777
4782
doi:
28
Takahashi
,
Y.
,
Kahyo
,
T.
,
Toh-e
,
A.
,
Yasuda
,
H.
and
Kikuchi
,
Y.
(
2001
)
Yeast Ull1/Siz1 is a novel SUMO1/Smt3 ligase for septin components and functions as an adaptor between conjugating enzyme and substrates
.
J. Biol. Chem.
276
,
48973
48977
doi:
29
Takahashi
,
Y.
,
Toh-e
,
A.
and
Kikuchi
,
Y.
(
2003
)
Comparative analysis of yeast PIAS-type SUMO ligases in vivo and in vitro
.
J. Biochem.
133
,
415
422
doi:
30
Cheng
,
C.-H.
,
Lo
,
Y.-H.
,
Liang
,
S.-S.
,
Ti
,
S.-C.
,
Lin
,
F.-M.
,
Yeh
,
C.-H.
et al. 
(
2006
)
SUMO modifications control assembly of synaptonemal complex and polycomplex in meiosis of Saccharomyces cerevisiae
.
Genes Dev.
20
,
2067
2081
doi:
31
Hickey
,
C.M.
,
Wilson
,
N.R.
and
Hochstrasser
,
M.
(
2012
)
Function and regulation of SUMO proteases
.
Nat. Rev. Mol. Cell Biol.
13
,
755
766
doi:
32
Srikumar
,
T.
,
Lewicki
,
M.C.
and
Raught
,
B.
(
2013
)
A global S. cerevisiae small ubiquitin-related modifier (SUMO) system interactome
.
Mol. Syst. Biol.
9
,
668
doi:
33
Psakhye
,
I.
and
Jentsch
,
S.
(
2012
)
Protein group modification and synergy in the SUMO pathway as exemplified in DNA repair
.
Cell
151
,
807
820
doi:
34
Rodriguez
,
M.S.
,
Dargemont
,
C.
and
Hay
,
R.T.
(
2001
)
SUMO-1 conjugation in vivo requires both a consensus modification motif and nuclear targeting
.
J. Biol. Chem.
276
,
12654
12659
doi:
35
Ren
,
J.
,
Gao
,
X.
,
Jin
,
C.
,
Zhu
,
M.
,
Wang
,
X.
,
Shaw
,
A.
et al. 
(
2009
)
Systematic study of protein sumoylation: development of a site-specific predictor of SUMOsp 2.0
.
Proteomics
9
,
3409
3412
doi:
36
Vasicova
,
P.
,
Stradalova
,
V.
,
Halada
,
P.
,
Hasek
,
J.
and
Malcova
,
I.
(
2013
)
Nuclear import of chromatin remodeler Isw1 is mediated by atypical bipartite cNLS and classical import pathway
.
Traffic
14
,
176
193
doi:
37
Zhou
,
W.
,
Ryan
,
J.J.
and
Zhou
,
H.
(
2004
)
Global analyses of sumoylated proteins in Saccharomyces cerevisiae. Induction of protein sumoylation by cellular stresses
.
J. Biol. Chem.
279
,
32262
32268
doi:
38
Kapitzky
,
L.
,
Beltrao
,
P.
,
Berens
,
T.J.
,
Gassner
,
N.
,
Zhou
,
C.
,
Wüster
,
A.
et al. 
(
2010
)
Cross-species chemogenomic profiling reveals evolutionarily conserved drug mode of action
.
Mol. Syst. Biol.
6
,
451
doi:
39
Murakami-Sekimata
,
A.
,
Huang
,
D.
,
Piening
,
B.D.
,
Bangur
,
C.
and
Paulovich
,
A.G.
(
2010
)
The Saccharomyces cerevisiae RAD9, RAD17 and RAD24 genes are required for suppression of mutagenic post-replicative repair during chronic DNA damage
.
DNA Repair
9
,
824
834
doi:
40
Cremona
,
C.A.
,
Sarangi
,
P.
,
Yang
,
Y.
,
Hang
,
L.E.
,
Rahman
,
S.
and
Zhao
,
X.
(
2012
)
Extensive DNA damage-induced sumoylation contributes to replication and repair and acts in addition to the mec1 checkpoint
.
Mol. Cell
45
,
422
432
doi:
41
Hendriks
,
I.A.
and
Vertegaal
,
A.C.O.
(
2016
)
A comprehensive compilation of SUMO proteomics
.
Nat. Rev. Mol. Cell Biol.
17
,
581
595
doi:
42
Hecker
,
C.-M.
,
Rabiller
,
M.
,
Haglund
,
K.
,
Bayer
,
P.
and
Dikic
,
I.
(
2006
)
Specification of SUMO1- and SUMO2-interacting motifs
.
J. Biol. Chem.
281
,
16117
16127
doi:
43
Kerscher
,
O.
,
Felberbaum
,
R.
and
Hochstrasser
,
M.
(
2006
)
Modification of proteins by ubiquitin and ubiquitin-like proteins
.
Annu. Rev. Cell Dev. Biol.
22
,
159
180
doi:
44
Zhao
,
Q.
,
Xie
,
Y.
,
Zheng
,
Y.
,
Jiang
,
S.
,
Liu
,
W.
,
Mu
,
W.
et al. 
(
2014
)
GPS-SUMO: a tool for the prediction of sumoylation sites and SUMO-interaction motifs
.
Nucleic Acids Res.
42
,
W325
W330
doi:
45
Beauclair
,
G.
,
Bridier-Nahmias
,
A.
,
Zagury
,
J.-F.
,
Saïb
,
A.
and
Zamborlini
,
A.
(
2015
)
JASSA: a comprehensive tool for prediction of SUMOylation sites and SIMs
.
Bioinformatics
31
,
3483
3491
doi:
46
García-Rodríguez
,
N.
,
Wong
,
R.P.
and
Ulrich
,
H.D.
(
2016
)
Functions of ubiquitin and SUMO in DNA replication and replication stress
.
Front. Genet.
7
,
87
doi:
47
Bretes
,
H.
,
Rouviere
,
J.O.
,
Leger
,
T.
,
Oeffinger
,
M.
,
Devaux
,
F.
,
Doye
,
V.
et al. 
(
2014
)
Sumoylation of the THO complex regulates the biogenesis of a subset of mRNPs
.
Nucleic Acids Res.
42
,
5043
5058
doi:
48
Vitaliano-Prunier
,
A.
,
Menant
,
A.
,
Hobeika
,
M.
,
Géli
,
V.
,
Gwizdek
,
C.
and
Dargemont
,
C.
(
2008
)
Ubiquitylation of the COMPASS component Swd2 links H2B ubiquitylation to H3K4 trimethylation
.
Nat. Cell Biol.
10
,
1365
1371
doi: