The translocator protein (TSPO) has been proposed to act as a key component in a complex important for mitochondrial cholesterol importation, which is the rate-limiting step in steroid hormone synthesis. However, TSPO function in steroidogenesis has recently been challenged by the development of TSPO knockout (TSPO-KO) mice, as they exhibit normal baseline gonadal testosterone and adrenal corticosteroid production. Here, we demonstrate that despite normal androgen levels in young male TSPO-KO mice, TSPO deficiency alters steroidogenic flux and results in reduced total steroidogenic output. Specific reductions in the levels of progesterone and corticosterone as well as age-dependent androgen deficiency were observed in both young and aged male TSPO-KO mice. Collectively, these findings indicate that while TSPO is not critical for achieving baseline testicular and adrenal steroidogenesis, either indirect effects of TSPO on steroidogenic processes, or compensatory mechanisms and functional redundancy, lead to subtle steroidogenic abnormalities which become exacerbated with aging.

Introduction

The synthesis of pregnenolone (P5) from cholesterol, catalyzed by the P450 side-chain cleavage (P450scc), is the rate-limiting step in steroidogenesis [1]. The rate of this reaction is determined by substrate availability, which is controlled by mitochondrial cholesterol import [2]. Although essential for life, the molecular mechanisms mediating mitochondrial cholesterol transfer for steroidogenesis remain controversial. The translocator protein (TSPO), which binds cholesterol with high affinity and is enriched in the mitochondria of steroidogenic organs, has been proposed to mediate mitochondrial cholesterol importation for steroidogenesis [3,4]. A role for TSPO in steroidogenesis was first suggested pharmacologically, with a range of structurally and chemically distinct, high-affinity TSPO ligands found to stimulate steroidogenesis both in vitro and in vivo in various cell types and tissues [510]. More recently, a common TSPO polymorphism altering the cholesterol-binding domain has been associated with impaired cholesterol metabolism and reduced ability to synthesize P5 [11,12]. Structural studies have provided insights into the potential mechanism of TSPO ligand-mediated cholesterol import, finding that ligand binding stabilizes the tertiary structure of TSPO [13], hypothesized to facilitate cholesterol movement via a sliding mechanism along the external surface of TSPO [14].

However, the recent development of testis-specific and global TSPO knockout (TSPO-KO) mice has demonstrated that TSPO is not essential for testicular testosterone (T) or adrenal corticosteroid (CORT) synthesis [1517], except perhaps under acute stress [18]. Evidence of compensatory changes in the testis of TSPO-KO mice, including depleted cholesterol stores and increased expression of the luteinizing hormone receptor [18], has led to the suggestion that TSPO may be functionally redundant [19,20]. However, others have argued that these changes may be an indirect consequence of steroidogenesis-independent functions of TSPO leading to altered cholesterol availability, rather than evidence of compensation and redundancy [21,22].

Despite the controversy surrounding TSPO function in steroidogenesis, widespread interest in the potential therapeutic application of steroidogenic TSPO ligands remains. This includes for the treatment of androgen deficiency in the aging male [20,23,24], which is associated with dysfunction and disease in androgen-responsive tissues including bone, muscle, adipose and the brain [25]. In aging rats, TSPO ligands can stimulate androgen production restoring T levels to those observed in young rats, even though the testes are insensitive to stimulation with the luteinizing hormone [24]. Therefore, steroidogenic TSPO ligands may offer an alternative to T replacement therapy with reduced risks of adverse events such as prostate cancer and cardiovascular disease [26] through the stimulation of T production at physiological concentrations.

Here, we investigate the effect of TSPO deficiency on testicular and adrenal function in not only in healthy, young adult male mice but also in aging mice. The testis provides a good model for investigating the potential role of TSPO in gonadal steroidogenesis since the types of steroids produced do not change, unlike the ovary where levels of steroidogenic enzymes and types of secreted steroids fluctuate throughout the reproductive cycle [27]. Using liquid chromatography tandem mass spectrometry (LC–MS/MS), we measure serum levels of androgens (T & 5α-dihydrotestosterone or DHT) and corticosteroids (CORT and aldosterone or ALDO), as well as their major bioactive precursors, P5 and progesterone (P4). As an indicator of steroidogenic flux, we examine precursor–metabolite relationships, an approach used to detect steroidogenic abnormalities both clinically and in animal models of disease [2830]. The aim of these studies is to examine the potentially complex changes in the steroidogenic cascade resulting from loss of TSPO function, which may facilitate reconciliation of genetic and pharmacological studies into TSPO function in steroidogenesis.

Materials and methods

Animals

For generation of TSPO-KO mice, the targeting construct was electroporated into C57BL/6 embryonic stem cells for homologous recombination. Correctly targeted cells were injected into C57BL/6 blastocysts generating chimeric mice. Female TSPOfl/fl mice were crossed with male CaMKIIa-Cre mice [RIKEN C57BL/6-TgN(a-CaMKII-nlCre)/10] expressing Cre in germ cells, generating heterozygous global TSPO-KO mice. To remove the Cre transgene, animals were bred to wild-type (WT) C57BL/6J mice (CLEAR, Japan), and the resulting heterozygous mice were used to breed homozygous offspring (TSPO-KO). Homozygous TSPO-KO mice on a C57BL/6J background were used to maintain the colony and generate mice used for the experiment. Mice were genotyped by PCR using DNA isolated from tail biopsies (forward primer probe: ATAGATGGAAACAGGATTGAAGTGA; reverse primer probe: ATTGTGTTTAAGTGCTTCAGTCCAT). WT C57BL/6J mice were purchased (CLEAR, Japan) and maintained at the National Institute of Radiological Sciences vivarium facilities with food and water available ad libitum.

For serum steroid hormone measurements, mice were anesthetized with isoflurane [3% (v/v) for induction and 1.5% (v/v) for maintenance], and blood was collected via cardiac puncture prior to euthanasia (4 months old, n = 10/group; 10 months old, n = 5/group; 22 months old, n = 5/group). For autoradiography and immunohistochemistry, anesthetized mice (4 months old, n = 3/group) were perfused with 0.9% saline, then organs immediately frozen and stored at −80°C until sectioning by cryostat (20 µm; HM560, Carl Zeiss).

All experimentation was approved by the National Institutes for Quantum and Radiological Science and Technology Institutional Animal Care and Use Committee.

Autoradiography

18F-FEDAA1106, a selective imaging agent for TSPO, was radiosynthesized according to the previously described methods [31]. Sections were incubated in 50 mM Tris–HCl with 5% ethanol (pH 7.4) containing 0.5 nM 18F-FEDAA1106 (specific activity 135.9 GBq/µM) in the presence or absence of 10 µM unlabeled PK-11195, a widely used TSPO ligand. Sections were then washed in 50 mM Tris–HCl (pH 7.4) containing 5% ethanol, rinsed in water and dried before contacting to an imaging plate (BAS-MS; Fuji Film), which was digitally scanned (BAS5000 system, Fuji Film).

Immunohistochemistry

Sections were fixed in 4% paraformaldehyde in PBS (pH 7.4) for 10 min and washed in PBS prior to Oil red O staining or immunolabeling. Oil red O (Sigma–Aldrich) staining was performed in 60% isopropyl alcohol for 30 min, prior to counterstaining with hematoxylin (Sigma–Aldrich) for 5 min. For immunolabeling, sections were incubated with blocking reagent (PerkinElmer) for 1 h at room temperature and then incubated overnight at 4°C with anti-TSPO (1 : 1000; Abcam ab109497). Sections were then washed three times in PBS and incubated for 1 h at room temperature with anti-rabbit IgG biotin (1 : 1000). Immunostaining was visualized using tetramethylrhodamine-labeled tyramide signal amplification (PerkinElmer). Sections were mounted in Vectashield antifade mounting medium with 4′,6-diamidino-2-phenylindole, dihydrochloride (DAPI, Vector Laboratories) and images were captured with a fluorescence microscope/digital camera (BZ-X700, Keyence).

LC–MS/MS assessment of steroid hormones

Samples and internal standards were diluted in 0.1 M KH2PO4 and then added to 4 ml of methyl tert-butyl ether (MTBE) for extraction. The organic phase was dried and purified with a solid-phase extraction cartridge (adande:1 TM PAX0301, Shiseido, Tokyo, Japan). The cartridge was washed with 1 ml of distilled water, 1 ml of methanol/distilled water/acetic acid (45 : 45 : 1), and 1 ml of 1% pyridine, before eluting the steroids with 1 ml of methanol/pyridine (100 : 1). The purified sample was dissolved in 0.5 ml of acetate/hexane/acetic acid (15 : 35 : 1) and applied to a preconditioned InertSep SI cartridge. The fraction containing P4 was eluted with 2.5 ml of MTBE solution, and the fraction containing P5, T and DHT was eluted with 2.5 ml of acetone–hexane (7 : 3). Fractions were dried, and P4 was converted to its O-ethyl oxime derivatives. The derivatives were then dissolved in acetonitrile/distilled water (2 : 3) and used for LC–MS/MS analysis.

The LC–MS/MS system consisted of a API 5000 triple-stage quadruple mass spectrometer (AB Sciex, Foster City, CA) equipped with a Shimadzu HPLC system (SCL-10Avp system controller, LC-20AD pump, SIL-HTc column oven, CTO-20A auto-sampler; Shimadzu Co. Ltd, Kyoto, Japan). The MS was operated with electrospray ionization in the positive ion mode. T and P4 standards were purchased from Tokyo Chemical Industry (Tokyo, Japan). P5 was purchased from Sigma–Aldrich Corp. (St. Louis, MO, U.S.A.). Data were analyzed using Analyst 1.6.1 (AB Sciex, MA, U.S.A.). The SRM transitions of the derivatives of P5, P4, T and DHT were m/z 422/281, 400/300, 394/253 and 396/203, respectively. The accuracy of all steroid measurement was between 92.5 and 109.0%.

Statistics

Data were analyzed by Student's t-test (equal variance not assumed) or two-way ANOVA using the Statistical Package for Social Sciences (SPSS, version 11.5; SPSS, Inc., IL, U.S.A.). Levine's and Shapiro–Wilk tests were used to assess homoscedasticity and normality. Non-parametric data were transformed prior to ANOVA analysis. Spearman's correlation was used to examine linear and non-linear relationships between steroidogenic precursors and metabolites. Extreme values were identified using Grubb's test, but were included in statistical analyses. Significance was set at a threshold of P < 0.05 and pair-wise comparisons were made for significant interactions. Data are presented as mean ± SEM unless otherwise specified.

Results

Generation of global TSPO-KO mice

Global TSPO-KO mice were generated through the targeted deletion of exons 2 and 3 (Figure 1A). Deletion of TSPO was confirmed by PCR and in vitro autoradiography in sections from the testis, ovary, adrenal, kidney, liver and heart using the TSPO radioligand 18F-FEDAA1106 (Figure 1). Immunofluorescence analysis confirmed the complete absence of TSPO in the testis and the adrenal TSPO-KO mice (Figure 2A,B, top panel). No differences in cellular morphology or neutral lipid accumulation assessed by Oil red O staining were observed between WT and TSPO-KO mice in either the testis or adrenal (Figure 2A,B, bottom panel).

Validation of TSPO-KO mice.

Figure 1.
Validation of TSPO-KO mice.

(A) TSPO-KO mice were created by deleting TSPO exons 2 and 3 by flanking with loxP sites (red arrowheads), using a vector containing a neomycin cassette (Neo) inserted between exons 3 and 4. Remaining exons 1 and 4 did not contain start codons in TSPO reading frames. (B) The absence of TSPO in the KO strain (–/–) was confirmed by PCR. (C) 18F-FEDAA1106 autoradiography in the testis, ovary, adrenal, kidney, liver and heart sections of WT and TSPO-KO mice. Binding specificity was confirmed by displacement of 18F-FEDAA1106 with unlabeled PK11195 (10 µM).

Figure 1.
Validation of TSPO-KO mice.

(A) TSPO-KO mice were created by deleting TSPO exons 2 and 3 by flanking with loxP sites (red arrowheads), using a vector containing a neomycin cassette (Neo) inserted between exons 3 and 4. Remaining exons 1 and 4 did not contain start codons in TSPO reading frames. (B) The absence of TSPO in the KO strain (–/–) was confirmed by PCR. (C) 18F-FEDAA1106 autoradiography in the testis, ovary, adrenal, kidney, liver and heart sections of WT and TSPO-KO mice. Binding specificity was confirmed by displacement of 18F-FEDAA1106 with unlabeled PK11195 (10 µM).

TSPO and steroidogenesis in the mouse testis and adrenal.

Figure 2.
TSPO and steroidogenesis in the mouse testis and adrenal.

TSPO immunoreactivity (top panel) and Oil red O with hematoxylin staining (bottom panel) in the testes (A) and adrenal (B) of WT and TSPO-KO mice. Inset shows TSPO immunoreactivity (red) localized in Leydig cells of testes counterstained with DAPI (blue). (C) Major androgen steroidogenic pathway in mouse testis following mitochondrial cholesterol importation. Firstly, cholesterol is converted to P5 by P450scc in the mitochondria. P5 is rapidly converted into P4 by 3β-HSD, which is found exclusively in the mitochondrial and is closely associated with P450scc [32]. P4 then diffuses into the ER where P450c17 catalyzes its conversion to A4 in a two-step reaction, forming 17P4 as an intermediate. To a lesser extent, P450c17 also has activity on P5, converting it to DHEA via a two-step reaction and forming 17P5 as an intermediate. T and DHT are synthesized in the ER by 17β-HSD and 5α-reductase (5α-SRD), respectively. Mitochondrial 3β-HSD also has activity on 17P5, DHEA and A4 to produce 17P4, A4 and T, respectively. (D) Major CORT steroidogenic pathway in mouse adrenal. Unlike the testis, 3β-HSD is found in both the mitochondria and ER in the adrenal. As P450c17 is not expressed in mouse adrenal [32], P5 is metabolized to P4 by 3β-HSD exclusively. P4 is then converted into deoxycorticosterone (DOC) by cytochrome P450 21 (P450c21) in the ER, which is subsequently converted into CORT and ALDO in the mitochondria by cytochromes P450 11 (P450c11) and P450 18 (P450c18), respectively. Steroid hormones measured in the current study highlighted in red.

Figure 2.
TSPO and steroidogenesis in the mouse testis and adrenal.

TSPO immunoreactivity (top panel) and Oil red O with hematoxylin staining (bottom panel) in the testes (A) and adrenal (B) of WT and TSPO-KO mice. Inset shows TSPO immunoreactivity (red) localized in Leydig cells of testes counterstained with DAPI (blue). (C) Major androgen steroidogenic pathway in mouse testis following mitochondrial cholesterol importation. Firstly, cholesterol is converted to P5 by P450scc in the mitochondria. P5 is rapidly converted into P4 by 3β-HSD, which is found exclusively in the mitochondrial and is closely associated with P450scc [32]. P4 then diffuses into the ER where P450c17 catalyzes its conversion to A4 in a two-step reaction, forming 17P4 as an intermediate. To a lesser extent, P450c17 also has activity on P5, converting it to DHEA via a two-step reaction and forming 17P5 as an intermediate. T and DHT are synthesized in the ER by 17β-HSD and 5α-reductase (5α-SRD), respectively. Mitochondrial 3β-HSD also has activity on 17P5, DHEA and A4 to produce 17P4, A4 and T, respectively. (D) Major CORT steroidogenic pathway in mouse adrenal. Unlike the testis, 3β-HSD is found in both the mitochondria and ER in the adrenal. As P450c17 is not expressed in mouse adrenal [32], P5 is metabolized to P4 by 3β-HSD exclusively. P4 is then converted into deoxycorticosterone (DOC) by cytochrome P450 21 (P450c21) in the ER, which is subsequently converted into CORT and ALDO in the mitochondria by cytochromes P450 11 (P450c11) and P450 18 (P450c18), respectively. Steroid hormones measured in the current study highlighted in red.

TSPO-KO perturbs testicular and adrenal steroidogenesis in young mice

To evaluate the effect of TSPO deficiency on steroidogenesis, concentrations of the key components of the testicular and adrenergic steroidogenic pathways (Figure 2C,D), including androgens (T and DHT), corticosteroids (CORT and ALDO) and their precursors (P5 and P4), were measured in the serum of young adult mice (4 months old, n = 10/group). As an indicator of steroidogenic capacity, we examined the sum of all measured steroidogenic metabolites, which are generated from cholesterol in a series of sequential reactions with an 1 : 1 reaction stoichiometry. Overall, a significant decrease in the total quantity of steroid hormones measured in TSPO-KO mice was observed (P5 + P4 + T + DHT + CORT + ALDO; t = 4.0, P = 0.001; Figure 3A). The most abundant hormone, CORT, which represented more than 90% of all measured steroidogenic metabolites, was depleted by more than 40% in TSPO-KO mice (t = 4.2, P = 0.001; Figure 3B). P4 was also markedly reduced by more than 65% in TSPO-KO mice (t = 4.4, P = 0.002; Figure 3B). No significant difference in P5, ALDO, T or DHT levels was observed between the genotypes, although a trend toward reduced P5 and elevated androgen levels in TSPO-KO mice approached significance (P5: t = 1.9, P = 0.08; T: t = −2.1, P = 0.07; DHT: t = −2.1, P = 0.07; Figure 3B).

TSPO-KO perturbs testicular and adrenal steroidogenesis in young mice.

Figure 3.
TSPO-KO perturbs testicular and adrenal steroidogenesis in young mice.

(A) Total measured steroids were significantly reduced in TSPO-KO mice. For both WT and TSPO-KO mice, CORT was the most abundantly synthesized hormone and accounted for the majority of the difference between genotypes. Inset shows the distribution of P5, P4, ALDO, T and DHT, comprising less than 10% of the total measured steroids. Median and interquartile range shown. (B) Serum levels of P5, P4, CORT, ALDO, T and DHT in 4-month-old WT and TSPO-KO mice. Synthesized in both mitochondria and ER in adrenal. **P < 0.002.

Figure 3.
TSPO-KO perturbs testicular and adrenal steroidogenesis in young mice.

(A) Total measured steroids were significantly reduced in TSPO-KO mice. For both WT and TSPO-KO mice, CORT was the most abundantly synthesized hormone and accounted for the majority of the difference between genotypes. Inset shows the distribution of P5, P4, ALDO, T and DHT, comprising less than 10% of the total measured steroids. Median and interquartile range shown. (B) Serum levels of P5, P4, CORT, ALDO, T and DHT in 4-month-old WT and TSPO-KO mice. Synthesized in both mitochondria and ER in adrenal. **P < 0.002.

Altered correlations between steroid hormone precursors and metabolites

TSPO deficiency was associated with altered steady-state correlations between steroid precursors and downstream metabolites (Figure 4). While a positive correlation between P5 and P4 was observed irrespective of genotype (R2 = 0.50, P = 0.01; Figure 4A), a strong positive correlation was observed between P4 and CORT levels in TSPO-KO (R2 = 0.79, P = 0.01; Figure 4B), but not in WT mice (R2 = 0.14, P = 0.35; Figure 4B). Interestingly, a strong positive correlation between P5 and T (R2 = 0.76, P = 0.006; Figure 4D), but not P4 (R2 = 0.46, P = 0.09), was observed in TSPO-KO mice. In contrast, the opposite relationship between P5 and T was observed in WT mice (R2 = −0.68, P = 0.01; Figure 4D). No significant association was observed between CORT and ALDO concentrations in either WT or TSPO-KO mice (WT: R2 = 0.33, P = 0.18; TSPO-KO: R2 = 0.18, P = 0.6; Figure 4C), while a strong, positive correlation was observed between T and its metabolite, DHT, in both WT (R2 = 0.53, P = 0.05) and TSPO-KO mice (R2 = 0.97, P < 0.001; Figure 4E).

Altered correlations between serum levels of steroidogenic precursor metabolites in TSPO-KO mice.

Figure 4.
Altered correlations between serum levels of steroidogenic precursor metabolites in TSPO-KO mice.

Graphical representation of the relationship between serum P5–P4 (A), P4–CORT (B), CORT–ALDO (C), P5–T (D) and T–DHT (E) in young, adult WT and TSPO-KO mice. *P < 0.05, **P < 0.01, ***P < 0.001.

Figure 4.
Altered correlations between serum levels of steroidogenic precursor metabolites in TSPO-KO mice.

Graphical representation of the relationship between serum P5–P4 (A), P4–CORT (B), CORT–ALDO (C), P5–T (D) and T–DHT (E) in young, adult WT and TSPO-KO mice. *P < 0.05, **P < 0.01, ***P < 0.001.

TSPO-KO induces age-related androgen depletion

Next, we compared serum P5, P4, CORT, T and DHT levels with aging male mice (10 months and 22 months old, n = 5/group; Figure 5). As in young groups, a significant reduction in P4 and CORT levels was observed in TSPO-KO mice (P4 genotype effect: F = 27.89, P < 0.001; CORT genotype effect: F = 9.13, P = 0.005), although in aged TSPO-KO mice CORT levels were highly dispersed. Interestingly, a significant interaction between genotype and age was observed on T and DHT (genotype × age interaction: T, F = 13.89, P < 0.001; DHT, F = 33.98, P = 0.05), but not P5, P4 or CORT levels. We found TSPO to play an important role in maintaining androgen levels in aging, with serum T and DHT levels declining by greater than 90% in TSPO-KO mice by 22 months of age (P < 0.001 compared with all other groups; Figure 5A).

Age-dependent impairment of androgen production in TSPO-KO mice.

Figure 5.
Age-dependent impairment of androgen production in TSPO-KO mice.

Serum levels of P5, P4, CORT, T and DHT in 10- and 22-month-old WT and TSPO-KO mice. Individual values (circles) and median (line) shown. Extreme values were observed in P5, P4 and CORT of one 22-month-old TSPO-KO mouse (red hollow circle), and T and DHT levels of one 10-month-old TSPO-KO mouse (red hollow diamond). All data, including extreme values, were included in statistical analyses. (B–E) Steady-state precursor–metabolite correlations between serum P5–P4 (B), P4–CORT (C), P5–T (D) and T–DHT (E) in aging WT and TSPO-KO mice (10 months old and 22 months old). P < 0.05 compared with TSPO-KO. *P < 0.05 compared with all other groups. **P < 0.01.

Figure 5.
Age-dependent impairment of androgen production in TSPO-KO mice.

Serum levels of P5, P4, CORT, T and DHT in 10- and 22-month-old WT and TSPO-KO mice. Individual values (circles) and median (line) shown. Extreme values were observed in P5, P4 and CORT of one 22-month-old TSPO-KO mouse (red hollow circle), and T and DHT levels of one 10-month-old TSPO-KO mouse (red hollow diamond). All data, including extreme values, were included in statistical analyses. (B–E) Steady-state precursor–metabolite correlations between serum P5–P4 (B), P4–CORT (C), P5–T (D) and T–DHT (E) in aging WT and TSPO-KO mice (10 months old and 22 months old). P < 0.05 compared with TSPO-KO. *P < 0.05 compared with all other groups. **P < 0.01.

Steroid hormone precursor–metabolite relationships in aging TSPO-KO mice

To investigate if the effect of TSPO-KO on precursor–metabolite relationships was altered as a function of aging, we examined correlations between serum hormone concentrations in the aged mice (Figure 5B–E). While no significant correlation was observed between P5 and P4 in aged animals, when combined with data from young animals, a highly significant positive correlation was observed (R2 = 0.40, P = 0.008; Figure 5B). As in young adult mice, a strong positive correlation was observed between P4 and CORT in aged TSPO-KO (R2 = 0.79, P = 0.006) but not in WT mice (R2 = 0.14, P = 0.35; Figure 5C). While a strong positive correlation between P5 and T was observed in young TSPO-KO mice, no such association was observed in aged mice (R2 = 0.25, P = 0.27; Figure 5D). As in young mice, T concentrations positively correlated with its metabolite, DHT, in both WT (R2 = 0.69, P = 0.02) and TSPO-KO mice (R2 = 0.86, P < 0.003; Figure 5E).

Discussion

Here, we demonstrate that although TSPO is not critical for maintaining steroid levels essential for life, TSPO deficiency is associated with reduced steroidogenic output, with specific reductions in levels of P4 and CORT in both young and aged male mice. Marked changes in the relationship between steady-state levels of steroidogenic precursors and metabolites suggest that loss of TSPO function was associated with abnormalities in steroidogenic flux. Furthermore, TSPO was critical for maintaining androgen production in aging, supporting the notion that TSPO may represent a therapeutic target for the treatment of hypogonadism and age-related androgen deficiency. These findings provide new insights into the complex interactions between TSPO and steroidogenesis, and may help resolve controversies surrounding apparent discrepancies in genetic versus pharmacological studies examining TSPO function.

It is of interest to note that the synthesis of both P4 and CORT, which were impaired in TSPO-KO mice, occurs predominantly in the mitochondria [1]. Meanwhile, androgens, which are synthesized predominantly in the endoplasmic reticulum (ER) [1], were unaltered by TSPO-KO, with a tendency toward elevated concentrations. A trend toward elevated T levels has also been observed in the testis-specific TSPO-KO model [16]. One possible explanation is that TSPO-KO may alter the global mitochondrial environment, impairing steroidogenesis in the mitochondrial compartment. For example, TSPO may alter mitochondrial redox states [33] leading to impaired electron transfer from catalytic redox partners, essential for P450 and hydroxysteroid dehydrogenase (HSD) enzyme activity [34]. However, this explanation seems unlikely since no effect of TSPO-KO was observed on ALDO, which is also exclusively synthesized in the mitochondria. Previous studies have examined the effect of conditional and global TSPO-KO on transcriptional expression of the steroidogenic enzymes in the testes or adrenal, including StAR, P450scc and 3β-HSD, finding no difference between WT and TSPO-KO mice [1518]. However, this does not address potential differences in protein level, subcellular compartment distribution or enzymatic activity. Analysis of precursor–metabolite relationships has proved useful in the diagnosis of disorders associated with steroidogenic enzyme deficiencies [2830] and may provide mechanistic insights into the observed reduction in P4 and CORT in TSPO-KO mice. Assuming the steroidogenic system is operating at steady state, precursor–metabolite relationships can be used as an indicator of steroidogenic flux [35,36]. The validity of steady-state analysis is supported by the evidence that most metabolic systems operate close to steady state even in disease [36] and mathematical models of steroidogenesis have used steady-state assumptions to reliability predict the effects of endocrine disruptors on in vitro steroidogenic systems [37].

In TSPO-KO mice, despite a marked reduction in P4 levels, the relationship between P4 and its precursor, P5, was unaltered, suggesting normal 3β-HSD functionality. A linear relationship was observed between P5 and P4, consistent with first-order reaction kinetics where substrate concentration is directly proportional to the reaction rate. Reduced efficiency of P5 conversion to P4 resulting from a modest, non-significant reduction in substrate availability could lead to a marked reduction in P4 concentrations, as seen in the TSPO-KO mice. Interestingly, a marked difference in the relationship between P4 and CORT was observed between WT and TSPO-KO mice. In TSPO-KO mice, P4 was positively associated with CORT by a power function, consistent with second-order reaction kinetics. In contrast, no association was observed between P4 and CORT in WT mice, suggesting zero-order reaction kinetics whereby substrate concentration does not affect reaction efficiency. These differences in the P4–CORT relationship are consistent with a typical saturation curve, where P4 concentrations in WT mice exceed the maximal reaction efficiency. The relationship (or lack of) between CORT and ALDO in both WT and TSPO-KO was also consistent with zero-order reaction kinetics. Given the high absolute concentrations of CORT, we hypothesize that excess CORT substrate was available even in TSPO-KO mice, leading to saturation of aldosterone synthase (P450c18) activity.

Perhaps, the most striking difference between WT and TSPO-KO mice was the association between T and P5, with a strong positive correlation observed in TPSO-KO mice versus a negative relationship observed in WT mice. This could potentially be explained by compensatory steroidogenic activity in the ER, or a switch to the synthesis of the androgens via P5 → dehydroepiandrosterone (DHEA), rather than the normally predominant P4-substrate pathway [38] (Figure 2C). In normal mouse testis, P5 is competitively metabolized by 3β-HSD and cytochrome P450 17 (P540c17) to form P4 and DHEA, respectively [39]. Enzyme–substrate proximity is thought to result in the preferential conversion of P5 to P4 by mitochondrial 3β-HSD, which is found to be closely associated with P450scc in the mitochondria [40]. However, P5 may also diffuse into the ER where it becomes available for conversion to the intermediate, 17α-hydroxypregnenolone (17-P5), by P450c17, which is then converted into DHEA → androstenedione (A4) → T, promoting androgen synthesis via an alternative pathway. Modeling of the competitive P4 → A4 versus P5 → DHEA synthesis pathway has demonstrated how reductions in P5 supply can paradoxically lead to increased 17-P5 → DHEA production accompanied by a reduction in P4 production [35]. Future studies could evaluate this hypothesis in pulse-labeled experiments in TSPO-KO models using a radiolabeled cholesterol substrate.

One such pulse-labeled study has been carried out in isolated mitochondria from TSPO-KO mouse testis, reporting no difference in P5 production between WT and TSPO-KO mice [17]. However, there are several key limitations in the interpretation of the present study. Firstly, the authors quantified radioactivity in fractions separated by chromatography to determine the cholesterol : P5 ratio, but no control experiments were carried out to confirm the recovery, specificity and reproducibility of cholesterol : P5 fractionation and purification [17]. Secondly, no quality control experiments were reported to confirm the quality and steroidogenic functionality of isolated mitochondria. For example, the ability to stimulate or disrupt steroidogenesis (e.g. using specific enzymatic inhibitors such as aminoglutethimide) or time-dependent accumulation of P5 would be appropriate positive controls. Furthermore, while the study also evaluated serum P5 in WT and TSPO-KO mice, the concentrations reported were 1000-fold higher than the normal expected range (e.g. [41]), adding to difficulty interpreting the findings. Finally, since P5 is rapidly converted to downstream steroid hormones due to the much higher reaction efficiency of subsequent reactions relative to P450scc (Km = 63 µM), steady-state serum P5 levels are a poor indicator of steroidogenic output. This is reflected in the very low steady-state serum concentrations of P5, representing less than 0.3% of total steroid hormones measured in the current study. Here, we consider the sum of all measured hormones as an indicator of steroidogenic capacity to circumvent this problem, since P5 is converted to downstream products with a 1 : 1 stoichiometry.

In contrast with the current findings, previous studies have reported no effect of TSPO-KO on CORT levels [15], or impaired CORT production in response to adrenocorticotropic hormone stimulation [18]. Reasons for the discrepancies between these studies are not clear, but differences in sex, blood collection procedure, anesthesia and hormone measurement methods may be contributing factors. For example, different classes of anesthesia differentially promote CORT production [42,43], which could potentially mask or reveal TSPO-dependent differences in adrenal function.

Importantly, our findings indicate a critical role of TSPO in maintaining androgen levels during aging. Of note, in aged mice, no relationship was observed between P5 and T, in contrast with the strong positive correlation observed in young–adult TSPO-deficient mice. Meanwhile, TSPO deficiency was associated with reduced P4 and CORT levels irrespective of age, and in aged mice, the relationship between steady-state levels of P5 and CORT and T and DHT mirrored observations in young mice. These findings suggest an interaction between TSPO function and age-related changes in the testis. Such an interaction could involve age-induced changes in the supply of cholesterol [44], steroidogenic enzyme expression [45] or antioxidant capacity and ER stress [46]. Interestingly, although previous studies have found that TSPO mRNA, protein and binding sites decrease by up to 50% in the aging rat testes [47,48], the steroidogenic capacity of synthetic TSPO ligands is preserved in the testis of aged rats with hypogonadism [24]. Taken together with the current findings, the therapeutic potential of TSPO-targeted treatments for the management of age-related androgen deficiency warrants further investigation.

Steroid hormones are essential for life, and understanding the mechanisms mediating their synthesis has broad implications for our understanding of not only basic biology but also the treatment of disease. The present study provides new evidence that TSPO modulates steroidogenic pathways, adding to the growing literature elucidating complex interactions between TSPO and steroidogenic pathways.

Abbreviations

     
  • 17-P4

    17α-hydroxyprogesterone

  •  
  • 17-P5

    17α-hydroxypregnenolone

  •  
  • A4

    androstenedione

  •  
  • ALDO

    aldosterone

  •  
  • CORT

    corticosteroid

  •  
  • DAPI

    4′,6-diamidino-2-phenylindole, dihydrochloride

  •  
  • DHEA

    dehydroepiandrosterone

  •  
  • DHT

    dihydrotestosterone

  •  
  • DOC

    deoxycorticosterone

  •  
  • ER

    endoplasmic reticulum

  •  
  • HSD

    hydroxysteroid dehydrogenase

  •  
  • LC–MS/MS

    liquid chromatography–tandem mass spectrometry

  •  
  • MTBE

    methyl tert-butyl ether

  •  
  • P4

    progesterone

  •  
  • P5

    pregnenolone

  •  
  • P450c17

    cytochrome P450 17

  •  
  • P450c18

    aldosterone synthase

  •  
  • P450scc

    cytochrome P450 side-chain cleavage

  •  
  • T

    testosterone

  •  
  • TSPO

    translocator protein

  •  
  • TSPO-KO

    translocator protein knockout

  •  
  • WT

    wild type.

Author Contribution

A.M.B., T.S., M.H. and B.J. designed the research; A.M.B., B.J. and S.K. performed the research; A.M.B., M.H. and B.J. analyzed the data and wrote the paper.

Funding

This work is supported by Grants-in-Aid for Core Research for Evolutional Science and Technology to T.S. and M.H. [14533254], the Brain Mapping by Integrated Neurotechnologies for Disease Studies [15653129], Research and Development Grants for Dementia [16768966] to M.H. and the Strategic Research Program for Brain Sciences to T.S. from the Japan Agency for Medical Research and Development and the Japan Advanced Molecular Imaging Program and Scientific Research on Innovative Areas [23111009 to M.H.] from the Ministry of Education, Culture, Sports, Science and Technology, Japan.

Acknowledgments

The authors thank T. Minamihisamatsu, S. Sasaki and S. Uchida for the technical support and assistance, M.-R. Zhang for radiosynthesis (National Institutes for Quantum and Radiological Science and Technology) and P. Matthews (Imperial College London) for the insightful discussion on the manuscript.

Competing Interests

The Authors declare that there are no competing interests associated with the manuscript.

References

References
1
Payne
,
A.H.
and
Hales
,
D.B.
(
2004
)
Overview of steroidogenic enzymes in the pathway from cholesterol to active steroid hormones
.
Endocr. Rev.
25
,
947
970
2
Stocco
,
D.M.
(
2000
)
Intramitochondrial cholesterol transfer
.
Biochim. Biophys. Acta, Mol. Cell Biol. Lipids
1486
,
184
197
3
Papadopoulos
,
V.
,
Baraldi
,
M.
,
Guilate
,
T.R.
,
Knudsen
,
T.B.
,
Lacapere
,
J.-J.
,
Lindemann
,
P.
et al. 
(
2006
)
Translocator protein (18 kDa): new nomenclature for the peripheral-type benzodiazepine receptor based on its structure and molecular function
.
Trends Pharmacol. Sci.
27
,
402
409
4
Miller
,
W.L.
and
Bose
,
H.S.
(
2011
)
Early steps in steroidogenesis: intracellular cholesterol trafficking
.
J. Lipid Res.
52
,
2111
2135
5
Krueger
,
K.E.
and
Papadopoulos
,
V.
(
1990
)
Peripheral-type benzodiazepine receptors mediate translocation of cholesterol from outer to inner mitochondrial membranes in adrenocortical cells
.
J. Biol. Chem.
265
,
15015
15022
PMID:
[PubMed]
6
Mukhin
,
A.G.
,
Papadopoulos
,
V.
,
Costa
,
E.
and
Krueger
,
K.E.
(
1989
)
Mitochondrial benzodiazepine receptors regulate steroid biosynthesis
.
Proc. Natl Acad. Sci. U.S.A.
86
,
9813
9816
7
Bitran
,
D.
,
Foley
,
M.
,
Audette
,
D.
,
Leslie
,
N.
and
Frye
,
C.A.
(
2000
)
Activation of peripheral mitochondrial benzodiazepine receptors in the hippocampus stimulates allopregnanolone synthesis and produces anxiolytic-like effects in the rat
.
Psychophamacology
151
,
64
71
8
Romeo
,
E.
,
Cavallaro
,
S.
,
Korneyev
,
A.
,
Kozikowski
,
A.P.
,
Ma
,
D.
,
Polo
,
A.
et al. 
(
1993
)
Stimulation of brain steroidogenesis by 2-aryl-indole-3-acetamide derivatives acting at the mitochondrial diazepam-binding inhibitor receptor complex
.
J. Pharmacol. Exp. Ther.
267
,
462
471
PMID:
[PubMed]
9
Serra
,
M.
,
Madau
,
P.
,
Chessa
,
M.F.
,
Caddeo
,
M.
,
Sanna
,
E.
,
Trapani
,
G.
et al. 
(
1999
)
2-Phenyl-imidazo[1,2-a]pyridine derivatives as ligands for peripheral benzodiazepine receptors: stimulation of neurosteroid synthesis and anticonflict action in rats
.
Br. J. Pharmacol.
127
,
177
187
10
Verleye
,
M.
,
Akwa
,
Y.
,
Liere
,
P.
,
Ladurelle
,
N.
,
Pianos
,
A.
,
Eychenne
,
B.
et al. 
(
2005
)
The anxiolytic etifoxine activates the peripheral benzodiazepine receptor and increases the neurosteroid levels in rat brain
.
Pharmacol. Biochem. Behav.
82
,
712
720
11
Li
,
F.
,
Liu
,
J.
,
Valls
,
L.
,
Hiser
,
C.
and
Ferguson-Miller
,
S.
(
2015
)
Identification of a key cholesterol binding enhancement motif in translocator protein 18 kDa
.
Biochemistry
54
,
1441
1443
12
Costa
,
B.
,
Pini
,
S.
,
Gabelloni
,
P.
,
Da Pozzo
,
E.
,
Abelli
,
M.
,
Lari
,
L.
et al. 
(
2009
)
The spontaneous Ala147Thr amino acid substitution within the translocator protein influences pregnenolone production in lymphomonocytes of healthy individuals
.
Endocrinology
150
,
5438
5445
13
Jaremko
,
Ł.
,
Jaremko
,
M.
,
Giller
,
K.
,
Becker
,
S.
and
Zweckstetter
,
M.
(
2014
)
Structure of the mitochondrial translocator protein in complex with a diagnostic ligand
.
Science
343
,
1363
1366
14
Li
,
F.
,
Liu
,
J.
,
Zheng
,
Y.
,
Garavito
,
R.M.
and
Ferguson-Miller
,
S.
(
2015
)
Crystal structures of translocator protein (TSPO) and mutant mimic of a human polymorphism
.
Science
347
,
555
558
15
Tu
,
L.N.
,
Morohaku
,
K.
,
Manna
,
P.R.
,
Pelton
,
S.H.
,
Butler
,
W.R.
,
Stocco
,
D.M.
et al. 
(
2014
)
Peripheral benzodiazepine receptor/translocator protein global knock-out mice are viable with no effects on steroid hormone biosynthesis
.
J. Biol. Chem.
289
,
27444
27454
16
Morohaku
,
K.
,
Pelton
,
S.H.
,
Daugherty
,
D.J.
,
Butler
,
W.R.
,
Deng
,
W.
and
Selvaraj
,
V.
(
2014
)
Translocator protein/peripheral benzodiazepine receptor is not required for steroid hormone biosynthesis
.
Endocrinology
155
,
89
97
17
Banati
,
R.B.
,
Middleton
,
R.J.
,
Chan
,
R.
,
Hatty
,
C.R.
,
Wai-Ying Kam
,
W.
,
Quin
,
C.
et al. 
(
2014
)
Positron emission tomography and functional characterization of a complete PBR/TSPO knockout
.
Nat. Commun.
5
,
5452
18
Fan
,
J.
,
Campioli
,
E.
,
Midzak
,
A.
,
Culty
,
M.
and
Papadopoulos
,
V.
(
2015
)
Conditional steroidogenic cell-targeted deletion of TSPO unveils a crucial role in viability and hormone-dependent steroid formation
.
Proc. Natl Acad. Sci. U.S.A.
112
,
7261
7266
19
Midzak
,
A.
,
Zirkin
,
B.
and
Papadopoulos
,
V.
(
2015
)
Translocator protein: pharmacology and steroidogenesis
.
Biochem. Soc. Trans.
43
,
572
578
20
Papadopoulos
,
V.
,
Aghazadeh
,
Y.
,
Fan
,
J.
,
Campioli
,
E.
,
Zirkin
,
B.
and
Midzak
,
A.
(
2015
)
Translocator protein-mediated pharmacology of cholesterol transport and steroidogenesis
.
Mol .Cell. Endocrinol.
408
,
90
98
21
Selvaraj
,
V.
,
Tu
,
L.N.
and
Stocco
,
D.M.
(
2016
)
Crucial role reported for TSPO in viability and steroidogenesis is a misconception. Commentary: conditional steroidogenic cell-targeted deletion of TSPO unveils a crucial role in viability and hormone-dependent steroid formation
.
Front. Endocrinol.
7
,
91
22
Tu
,
L.N.
,
Zhao
,
A.H.
,
Hussein
,
M.
,
Stocco
,
D.M.
and
Selvaraj
,
V.
(
2016
)
Translocator protein (TSPO) affects mitochondrial fatty acid oxidation in steroidogenic cells
.
Endocrinology
157
,
1110
1121
23
Campanella
,
M.
(
2014
)
Peptide targeting of mitochondria elicits testosterone formation
.
Mol. Ther.
22
,
1727
1729
24
Chung
,
J.-Y.
,
Chen
,
H.
,
Midzak
,
A.
,
Burnett
,
A.L.
,
Papadopoulos
,
V.
and
Zirkin
,
B.R.
(
2013
)
Drug ligand-induced activation of translocator protein (TSPO) stimulates steroid production by aged brown Norway rat Leydig cells
.
Endocrinology
154
,
2156
2165
25
Swerdloff
,
R.S.
and
Wang
,
C.
(
2004
)
Androgens and the ageing male
.
Best Pract. Res. Clin. Endocrinol. Metab.
18
,
349
362
26
Spitzer
,
M.
,
Huang
,
G.
,
Basaria
,
S.
,
Travison
,
T.G.
and
Bhasin
,
S.
(
2013
)
Risks and benefits of testosterone therapy in older men
.
Nat. Rev. Endocrinol.
9
,
414
424
27
Hanukoglu
,
I.
(
1992
)
Steroidogenic enzymes: structure, function, and role in regulation of steroid hormone biosynthesis
.
J. Steroid. Biochem. Mol. Biol.
43
,
779
804
28
Hicks
,
R.A.
,
Yee
,
J.K.
,
Mao
,
C.S.
,
Graham
,
S.
,
Kharrazi
,
M.
,
Lorey
,
F.
et al. 
(
2014
)
Precursor-to-product ratios reflect biochemical phenotype in congenital adrenal hyperplasia
.
Metabolomics
10
,
123
131
29
Keefe
,
C.C.
,
Goldman
,
M.M.
,
Zhang
,
K.
,
Clarke
,
N.
,
Reitz
,
R.E.
and
Welt
,
C.K.
(
2014
)
Simultaneous measurement of thirteen steroid hormones in women with polycystic ovary syndrome and control women using liquid chromatography-tandem mass spectrometry
.
PLoS ONE
9
,
e93805
30
Sondhi
,
V.
,
Owen
,
B.M.
,
Liu
,
J.
,
Chomic
,
R.
,
Kliewer
,
S.A.
,
Hughes
,
B.A.
et al. 
(
2016
)
Impaired 17,20-lyase activity in male mice lacking cytochrome b5 in Leydig cells
.
Mol. Endocrinol.
30
,
469
478
31
Ji
,
B.
,
Maeda
,
J.
,
Sawada
,
M.
,
Ono
,
M.
,
Okauchi
,
T.
,
Inaji
,
M.
et al. 
(
2008
)
Imaging of peripheral benzodiazepine receptor expression as biomarkers of detrimental versus beneficial glial responses in mouse models of Alzheimer's and other CNS pathologies
.
J. Neurosci.
28
,
12255
12267
32
Pelletier
,
G.
,
Li
,
S.
,
Luu-The
,
V.
,
Tremblay
,
Y.
,
Belanger
,
A.
and
Labrie
,
F.
(
2001
)
Immunoelectron microscopic localization of three key steroidogenic enzymes (cytochrome P450(scc), 3 beta-hydroxysteroid dehydrogenase and cytochrome P450(c17)) in rat adrenal cortex and gonads
.
J. Endocrinol.
171
,
373
383
33
Gatliff
,
J.
,
East
,
D.
,
Crosby
,
J.
,
Abeti
,
R.
,
Harvey
,
R.
,
Craigen
,
W.
et al. 
(
2014
)
TSPO interacts with VDAC1 and triggers a ROS-mediated inhibition of mitochondrial quality control
.
Autophagy
10
,
2279
2296
34
Miller
,
W.L.
(
2005
)
Minireview: regulation of steroidogenesis by electron transfer
.
Endocrinology
146
,
2544
2550
35
Nguyen
,
P.T.T.
,
Lee
,
R.S.F.
,
Conley
,
A.J.
,
Sneyd
,
J.
and
Soboleva
,
T.K.
(
2012
)
Variation in 3β-hydroxysteroid dehydrogenase activity and in pregnenolone supply rate can paradoxically alter androstenedione synthesis
.
J. Steroid Biochem. Mol. Biol.
128
,
12
20
36
Voit
,
E.O.
(
2000
)
Computational Analysis of Biochemical Systems: A Practical Guide for Biochemists and Molecular Biologists
,
Cambridge University Press
37
Breen
,
M.S.
,
Villeneuve
,
D.L.
,
Breen
,
M.
,
Ankley
,
G.T.
and
Conolly
,
R.B.
(
2007
)
Mechanistic computational model of ovarian steroidogenesis to predict biochemical responses to endocrine active compounds
.
Ann. Biomed. Eng.
35
,
970
981
38
Ficher
,
M.
and
Steinberger
,
E.
(
1971
)
In vitro progesterone metabolism by rat testicular tissue at different stages of development
.
Acta Endocrinol.
68
,
285
292
PMID:
[PubMed]
39
Conley
,
A.J.
and
Bird
,
I.M.
(
1997
)
The role of cytochrome P450 17α-hydroxylase and 3β-hydroxysteroid dehydrogenase in the integration of gonadal and adrenal steroidogenesis via the Δ5 and Δ4 pathways of steroidogenesis in mammals
.
Biol. Reprod.
56
,
789
799
40
Simard
,
J.
,
Ricketts
,
M.-L.
,
Gingras
,
S.B.
,
Soucy
,
P.
,
Feltus
,
F.A.
and
Melner
,
M.H.
(
2005
)
Molecular biology of the 3β-hydroxysteroid dehydrogenase/Δ5-Δ4 isomerase gene family
.
Endocr. Rev.
26
,
525
582
41
Tagawa
,
N.
,
Sugimoto
,
Y.
,
Yamada
,
J.
and
Kobayashi
,
Y.
(
2006
)
Strain differences of neurosteroid levels in mouse brain
.
Steroids
71
,
776
784
42
Jacobsen
,
K.R.
,
Kalliokoski
,
O.
,
Teilmann
,
A.C.
,
Hau
,
J.
and
Abelson
,
K.S.P.
(
2012
)
The effect of isoflurane anaesthesia and vasectomy on circulating corticosterone and ACTH in BALB/c mice
.
Gen. Comp. Endocrinol.
179
,
406
413
43
Arnold
,
M.
and
Langhans
,
W.
(
2010
)
Effects of anesthesia and blood sampling techniques on plasma metabolites and corticosterone in the rat
.
Physiol. Behav.
99
,
592
598
44
Liao
,
C.
,
Reaven
,
E.
and
Azhar
,
S.
(
1993
)
Age-related decline in the steroidogenic capacity of isolated rat Leydig cells: a defect in cholesterol mobilization and processing
.
J. Steroid Biochem. Mol. Biol.
46
,
39
47
45
Luo
,
L.
,
Chen
,
H.
and
Zirkin
,
B.R.
(
1996
)
Are Leydig cell steroidogenic enzymes differentially regulated with aging?
J. Androl.
17
,
509
515
46
Huang
,
D.
,
Wei
,
W.
,
Xie
,
F.
,
Zhu
,
X.
,
Zheng
,
L.
and
Lv
,
Z.
(
2017
)
Steroidogenesis decline accompanied with reduced antioxidation and endoplasmic reticulum stress in mice testes during ageing
.
Andrologia
636
,
e12816
47
Culty
,
M.
,
Luo
,
L.
,
Yao
,
Z.X.
,
Chen
,
H.
,
Papadopoulos
,
V.
and
Zirkin
,
B.R.
(
2002
)
Cholesterol transport, peripheral benzodiazepine receptor, and steroidogenesis in aging Leydig cells
.
J. Androl.
23
,
439
447
PMID:
[PubMed]
48
Sun
,
Z.
,
Shen
,
W.-J.
,
Sucheta
,
S.-L.
and
Azhar
,
S.
(
2008
)
Impact of aging on cholesterol transport protein expression and steroidogenesis in rat testicular Leydig cells
.
Open Longev. Sci.
2
,
76
85