Continuous exposure to peritoneal dialysis (PD) fluid results in peritoneal fibrosis and ultimately causes ultrafiltration failure. Noncoding RNAs, including long noncoding RNAs (lncRNAs) and microRNAs (miRNAs), have been reported to participate in ultrafiltration failure in PD. Therefore, our study aimed to investigate the mechanism of lncRNA 6030408B16RIK in association with miR-326-3p in ultrafiltration failure in PD. Peritoneal tissues were collected from uremic patients with or without PD. A uremic rat model with PD was first established by 5/6 nephrectomy. The relationship between lncRNA 6030408B16RIK, miR-326-3p and WISP2 was identified using luciferase reporter, RNA pull-down and RIP assays. After ectopic expression and depletion treatments in cells, expression of α-SMA, phosphorylated β-catenin, FSP1, E-cadherin and Vimentin was evaluated by RT-qPCR and Western blot analyses, and Collagen III and CD31 expression by immunohistochemistry. Ultrafiltration volume and glucose transport capacity were assessed by the peritoneal equilibration test. Expression of lncRNA 6030408B16RIK and WISP2 was up-regulated and miR-326-3p expression was poor in peritoneal tissues of uremic PD patients and model rats. LncRNA 6030408B16RIK competitively bound to miR-326-3p and then elevated WISP2 expression. Silencing of lncRNA 6030408B16RIK and WISP2 or overexpression of miR-326-3p was shown to decrease the expression of α-SMA, phosphorylated β-catenin, FSP1, Vimentin, Collagen III and CD31, while reducing glucose transport capacity and increasing E-cadherin expression and ultrafiltration volume in uremic PD rats. In summary, lncRNA 6030408B16RIK silencing exerts an anti-fibrotic effect on uremic PD rats with ultrafiltration failure by inactivating the WISP2-dependent Wnt/β-catenin pathway via miR-326-3p.

Introduction

Peritoneal dialysis (PD) is a long-term and slow dialysis method that is effective as a measure to permit restoration of residual renal function [1]. It is acknowledged that PD is one of the major therapies for uremia [2], and has undergone a 10-fold increase in use in mainland China over the past decade, with a very sharp rise between 2012 and 2014 [3]. Regarding survival, cost and quality of life, PD is superior to hemodialysis (HD) [4]. However, ultrafiltration failure related to peritoneal membrane impairment is a major complication for patients receiving long-term PD [5]. Ultrafiltration failure refers to the inability to achieve a net ultrafiltration of at least 400 ml during the 4 h residence period with 4.25% glucose [6]. Ultrafiltration failure is attributed to peritoneal fibrosis, which results from continuous exposure to high glucose dialysate [7]. Therefore, understanding the molecular mechanisms underlying peritoneal fibrosis can provide a pivotal target for the prevention and treatment of ultrafiltration failure.

Recently, noncoding RNAs, including long noncoding RNAs (lncRNAs) and microRNAs (miRNAs or miRs), have emerged as key participants in the process of peritoneal fibrosis [8]. LncRNAs, which are defined as ncRNAs exceeding 200 nucleotides in length, are mediators of multiple cellular pathways [9,10]. Increasing evidence indicates that lncRNAs have important regulatory potential in peritoneal fibrosis induced by PD. For example, microarray expression profiles in a prior study revealed that lncRNA AK089579, lncRNA AK080622 and lncRNA ENSMUST00000053838 are differentially expressed in the fibrotic peritoneum and contributes to peritoneal fibrosis [11]. In this study, we intended to exploit a novel lncRNA, lncRNA 6030408B16RIK, the role of which has been scarcely understood in any events, in ultrafiltration failure in PD. Moreover, a biological prediction website (https://cm.jefferson.edu/rna22/) in our study predicted a binding site between lncRNA 6030408B16RIK and miR-326-3p. Alterations of miRNA expression change various critical molecular pathways, exerting great effects on maintaining peritoneal cavity homeostasis during PD treatment [12]. A previous study showed that miR-326-3p plays a pivotal part in nephrotoxicity caused by cadmium [13]. Also, possible binding sites between miR-326-3p and WNT1-inducible-signaling pathway protein 2 (WISP2) were predicted by the biological prediction website (https://cm.jefferson.edu/rna22/) in our study. WISP2, also known as CCN5, belongs to the ephroblastoma overexpressed (CCN) family, which serves as a regulator of fibrosis [14]. Furthermore, WISP2 is highly expressed in mesenchymal stem cells, fibroblasts and adipogenic precursor cells [15]. However, knowledge of the mechanisms by which the lncRNA 6030408B16RIK/miR-326-3p/WISP2 signaling regulates ultrafiltration failure in PD is still very limited. Hence, this study set out with the intention to investigate the possible mechanism of the lncRNA 6030408B16RIK/miR-326-3p/WISP2 signaling axis in ultrafiltration failure in PD, and to provide additional insights advancing our understanding of the basic biology of peritoneal fibrosis.

Materials and methods

Ethics statement

This study was approved by the Ethics Committee of Linyi People's Hospital and conducted in strict accordance with the Declaration of Helsinki. All participating patients signed informed consent documents prior to sample collection. Animal work took place in the animal laboratory of Linyi People's Hospital. Animal experiments and procedures were performed with the approval of the Animal Ethics Committee of Linyi People's Hospital. Extensive efforts were made to ensure minimal numbers and discomfort of the animals used during the study.

Patient enrollment

A total of 16 uremic patients without PD (9 males and 7 females; aged 22–63 years with an average of 45.44 ± 13.55 years) under treatment at the Linyi People's Hospital from 2014 to 2017 were recruited in the study for peritoneal tissue sample collection. There were five cases of chronic glomerulonephritis, four cases of hypertensive renal damage, three cases of diabetic nephropathy, two cases of chronic interstitial nephritis and two cases of polycystic kidney disease. The peritoneal samples of patients were extracted during the first abdominal perforation. At the same time, peritoneal tissue samples from 16 uremic PD patients (10 males and 6 females; aged 23–72 years with an average of 43.56 ± 12.89 years) at the Linyi People's Hospital from 2014 to 2017 were collected. The dialysis time was not less than half a year and the patients were not extubated due to refractory peritonitis. The median PD was 26 months, with an average of 6–50 months. There were six cases of chronic glomerulonephritis, three cases of hypertensive renal damage, five cases of diabetic nephropathy, one case of chronic interstitial nephritis and one case of polycystic kidney disease. A total of seven cases of peritoneal biopsy samples were collected during extubation, five cases were obtained during renal transplantation and four cases were harvested during re-intubation. Clinical characteristics of PD patients and patients without PD are depicted in Table 1.

Table 1.
Clinical characteristics of peritoneal dialysis patients and patients without peritoneal dialysis
VariablePatients without peritoneal dialysis (n = 16)Peritoneal dialysis patients (n = 16)P
Gender 9 males and 7 females 10 males and 6 females 0.42 
Age (year) 45.44 ± 13.55 43.56 ± 12.89 0.76 
Primary uremia    
Chronic glomerulonephritis 5 cases 6 cases >0.05 
Hypertensive renal damage 4 cases 3 cases >0.05 
Diabetic nephropathy 3 cases 5 cases >0.05 
Chronic interstitial nephritis 2 cases 1 case >0.05 
Polycystic kidney disease 2 cases 1 case >0.05 
VariablePatients without peritoneal dialysis (n = 16)Peritoneal dialysis patients (n = 16)P
Gender 9 males and 7 females 10 males and 6 females 0.42 
Age (year) 45.44 ± 13.55 43.56 ± 12.89 0.76 
Primary uremia    
Chronic glomerulonephritis 5 cases 6 cases >0.05 
Hypertensive renal damage 4 cases 3 cases >0.05 
Diabetic nephropathy 3 cases 5 cases >0.05 
Chronic interstitial nephritis 2 cases 1 case >0.05 
Polycystic kidney disease 2 cases 1 case >0.05 

Uremic rat model establishment

A total of 96 clean-grade healthy Sprague Dawley rats (license number: SCXK (Yue 2013-0002), Guangdong Provincial Medical Laboratory Animal Center, Guangdong, China) were selected in this experiment. Six rats received no treatment and six rats received sham operation as controls, while the remaining 84 rats were utilized for induction of the uremic model. All rats were acclimated with adequate food and water for 1 week under the environment of proper temperature and humidity. The uremic model was constructed using 5/6 nephrectomy. The rats were fasted for 8 h one night before the operation, and anesthetized through intraperitoneal injections with 3% sodium pentobarbital (P3761, Sigma–Aldrich Chemical Company, St Louis, MO, U.S.A.). Then, the rats were fixed on the thermal operation table in a lateral position. After iodine disinfection, the left-back incision was first made, which was 1.5 cm from the subcostal muscle and 1 cm from the spine. After the skin, fascia and muscle of the rats were dissected in sequence, the abdominal cavity was opened, the left kidney was identified and its capsule was peeled off. Then, one-third of the upper and lower poles of the left kidney were removed and weighed. Immediately thereafter, the kidney incision was pressed with a gelatin sponge to stop bleeding. After hemostasis, the left kidney was repositioned, and then the overlying muscles, fascia and skin were sutured in layers. After the operation, rats were placed on an insulating blanket for recover. Right nephrectomy was performed 1 week later, again under anesthesia with 3% sodium pentobarbital. After the right-back incision was made, the right kidney was located, and its pedicle was ligated with the silk thread at the renal hilum. The right kidney was cut off from the ligation of the renal hilum with ophthalmic scissors. After both surgeries, rats were injected with penicillin for 3 days to prevent infection. Sham-operated rats only underwent bilateral renal capsule stripping without resection. Six weeks after the left nephrectomy, a venous blood sample was collected from the inner canthus of all rats. Serum creatinine and urea nitrogen were measured to determine whether the modeled rats had progressed to uremia. The uremia model was successfully generated with serum creatinine and urea nitrogen exceeding 2–3 times that of normal rats.

Some uremic rats did not receive PD, and other uremic rats underwent 4-week PD and were intravenously injected with small interfering RNA (si)-negative control (NC), si-lncRNA 6030408B16RIK, mimic NC, miR-326-3p mimic, inhibitor NC, miR-326-3p inhibitor, XAV-939 or overexpression (oe)-NC and oe-WISP2.

PD rats were injected with 4.25% glucose peritoneal dialysate (3 ml/100 g) using a PD tube at 4:00 a.m. daily for 4 weeks. The rats were fasted overnight before the operation. The rats were anesthetized with 3% sodium pentobarbital (P3761, Sigma–Aldrich Chemical Company, St Louis, MO, U.S.A.) and fixed in a supine position on the insured operating table. The right middle abdomen skin was incised as the entrance for the PD tube and to make a purse string. The abdominal end of the homemade PD tube was placed in the incision, and the cuff was placed at the incision to tighten the purse. The tube was flushed with 10 ml normal saline to observe whether the tube was unobstructed and whether the purse was leaked obviously. If the tube was unobstructed and there was no obvious leakage of the purse, a subcutaneous tunnel was made, and the PD tube was extended 1 cm below the midpoint of the line connecting the back of the neck. The PD tube was fixed, and 5 ml of normal saline was again administered for peritoneal lavage to ensure unobstructed and non-leaking PD tube, whereupon the skin was sutured. A total of 50 IU heparin was injected into the PD tube and the tube was closed with a heparin cap. Within 1 week after this, the tube was injected daily with 2 ml normal saline containing 50 IU heparin. si-lncRNA 6030408B16RIK, miR-326-3p mimic, miR-326-3p inhibitor and NCs were purchased from Guangzhou RiboBio Co., Ltd. (Guangzhou, China).

Peritoneal equilibration test (PET)

Two days after PD induction, 2 ml of 4.25% double peritoneal dialysate was injected into rats and 0.1 ml of dialysate was used to test the ultrafiltration volume and glucose transport capacity at 0 h. After 2 h, the rats were anesthetized by intraperitoneal injections of 3% sodium pentobarbital (P3761, Sigma–Aldrich Chemical Company, St Louis, MO, U.S.A.). Then, the abdominal cavity was cut along the white line of the abdomen of the rats and the intraperitoneal fluid of the rats was extracted with a syringe and accurately measured. Finally, the residual liquid in the abdominal cavity was removed by gauze, which was reweighed to calculate the entire volume of fluid.

Hematoxylin-eosin (HE) staining

After PET, the rats were killed and the peritoneal tissue was collected, sectioned and dried at room temperature for ∼1–2 h. After removal of oxidized impurities by filtering, the tissue sections were stained with hematoxylin for 5 min. The excess hematoxylin staining solution was washed away with distilled water, and 1% hydrochloric acid alcohol was then added for 5–10 s of differentiation. The sample was then washed under a stream of water for 30 min, until the cells were blue. Subsequently, the sections were stained using 0.1% eosin for 1 min, dehydrated by gradient alcohol (70%, 80%, 95% and 100%, of which the sections were washed twice using 95% and 100% alcohol, 5 min for each). The sections were cleared twice using xylene, 5 min each time. Then, the excess xylene around the samples was wiped off, and neutral gum was immediately added to the samples before the xylene had been dried. Then, the samples were covered with a cover slip and dried overnight. The samples were finally observed under an upright microscope, and micrographs were recorded using the corneal topography system (CTS) imaging system.

Masson's trichrome staining

The samples were fixed with 10% formaldehyde solution, dehydrated and embedded. The paraffin sections were then dewaxed. The nucleus was stained with Weigert hematoxylin. After washing, the sections were soaked in Masson ponceau acid liquid for 8 min and in 2% glacial acetic acid aqueous solution for 1 min. The sections were differentiated with 1% phosphomolybdic acid aqueous solution for 4 min, and then aniline blue was used to stain sections for 5 min. The sections were immersed in 0.2% aqueous glacial acetic acid solution for 2 min and in 95% pure alcohol. At last, the sections were cleared with xylene and sealed with neutral gum.

Immunohistochemistry

The sections were fixed with 10% formaldehyde, embedded in paraffin and cut into 4 μm-thick serial sections. The sections were heated in a 60°C incubator for 1 h, dewaxed conventionally using xylene and then dehydrated with gradient alcohol, followed by incubation for 30 min at 37°C in 3% H2O2 (Sigma–Aldrich Chemical Company, St Louis, MO, U.S.A.). After phosphate-buffered saline (PBS) washing, the sections were boiled in 0.01 M citric acid buffer at 95°C for 20 min. After cooling down to room temperature, the sections were washed by PBS, blocked with normal goat serum at 37°C for 10 min and incubated with primary antibody rabbit anti-Collagen III (ab7778, 1 : 100, Abcam Inc., Cambridge, U.K.) for 12 h at 4°C. Then, the sections were re-probed with biotin-labeled secondary antibody goat anti-rabbit immunoglobulin G (IgG) (ab150077, 1 : 100, Abcam Inc., Cambridge, U.K.) at room temperature for 10 min. After washing, horseradish peroxidase-labeled streptavidin working solution (S-A/HRP) was added to the sections and reacted at room temperature for 10 min. Next, the sections were visualized using 3, 3′-diaminobenzidine (DAB) and stored in a dark room at room temperature for 8 min. The samples were counterstained with hematoxylin, dehydrated, cleared, mounted and observed under an optical microscope.

Isolation and identification of rat peritoneal mesothelial cells (RPMCs)

Portions of rat peritoneal tissues were collected and cut with surgical scissors, after which they were seeded into a culture flask and cultured in Dulbecco's modified Eagle's medium (DMEM)/Ham's F-12 (F12) (GNM-12500-S, Jingke Chemical Technology Co., Ltd., Shanghai, China) containing 20% fetal calf serum at 37°C in a 5% CO2 incubator. After a large number of epithelial cells were detached from walls, the medium was renewed. The cells were further cultured, and the medium was renewed every 3 days. Upon reaching 80–90% confluence, the cells were passaged. The medium was discarded and the cells were detached with 2 ml 0.25% trypsin (25200-056, Gibco, Carlsbad, CA, U.S.A.) for 3–5 min at 37°C, which was terminated with DMEM/F12 medium containing 10% serum. The cells were triturated and dispersed, whereupon the cell suspension was harvested. The suspension was then centrifuged at 1000 r/min for 6–8 min at 4°C and seeded into the complete medium (INV-00002, Inuit Biomedical Company, Wuxi, Jiangsu province, China), followed by passage at a ratio of 1 : 3. RPMCs were then transferred into a six-well plate with cover slips, and the medium was discarded after the cells had fused to a monolayer. Cells were then fixed using 4% paraformaldehyde. Each coverslip was added with 5 ml primary rabbit antibodies (Abcam Inc., Cambridge, U.K.) against Vimentin (ab137321, 1 : 100), Keratins (ab185627, 1 : 100), factor VIII (ab6994, 1 : 100) and CD45 (ab10558, 1 : 100) for 18 h of reaction at room temperature and 20 min of incubation at 37°C. A total of 50 μl of HRP-labeled secondary antibody was added to each coverslip and the cells were incubated for 10 min at room temperature. Streptavidin–biotin complex reagent was added and the cells were incubated at 37°C for 20 min. Finally, the cells were stained with 10 μl DAB, dehydrated and sealed.

Fluorescence in situ hybridization (FISH) assay

The expression of lncRNA 6030408B16RIK was examined in situ in RPMCs using the FISH Kit. In short, cell slides were placed at the bottom of a 24-well plate and cells were cultured at a density of ∼6 × 104 cells/well until cell confluence had reached 60–70%. The cells were then fixed with 4% formaldehyde at room temperature, and added with 1 ml pre-cooled permeable solution and allowed to stand at 4°C for 5 min. After discarding the permeable solution, a 200 μl pre-hybridization solution was added to each well, followed by blocking at 37°C for 30 min. At the same time, the hybridization solution was preheated at 37°C. A total of 2.5 μl of 20 μM FISH Probe Mix stock solution was added to the hybridization solution under dark conditions. The pre-hybridization solution in each well was discarded, and hybridization solution containing the probes was added, followed by overnight hybridization at 37°C under dark conditions. The cells were washed three times with the lotion I to reduce the background signal, once with lotion II and once with lotion III, always at 42°C under dark conditions. The cells were subsequently stained with 4′,6-diamidino-2-phenylindole (DAPI) staining solution under the conditions devoid of light. Coverslips were carefully collected from the wells in subdued light and fixed on a glass slide with sealing solution for fluorescence detection.

Dual-luciferase reporter assay

The potential binding sites between miR-326-3p with WISP2 and lncRNA 6030408B16RIK were analyzed using a biological prediction website (https://cm.jefferson.edu/rna22/), and the fragment sequence containing binding sites was obtained. The full-length of lncRNA 6030408B16RIK and the 3′-untranslated region (UTR) of WISP2 were cloned and amplified into the pmirGLO Luciferase vector, namely lncRNA p6030408B16RIK-wide type (WT) and pWISP2-WT. Next, bioinformatics software was used to predict the binding site between miR-326-3p and lncRNA 6030408B16RIK, and between miR-326-3p and WISP2, followed by site-directed mutagenesis. The p6030408B16RIK-mutant (MUT) and pWISP2-MUT vectors were separately constructed. The pRL-TK vector expressing Renilla luciferase was used as an internal reference. miR-326-3p mimic and miR-326-3p NC were then co-transfected into HEK-293T cells with luciferase reporter vectors, respectively. At last, the luciferase activity was measured using a fluorescence detector.

RNA pull-down assay

RPMCs were transfected with 50 nM biotinylated WT-bio-miR-326-3p and MUT-bio-miR-326-3p. After 48 h, the cells were harvested and incubated for 10 min in specific lysis buffer. The cell lysate was incubated with M-280 streptavidin magnetic beads pre-coated with RNase-free bovine serum albumin (BSA) and yeast transfer RNA (tRNA). The beads were then incubated for 3 h at 4°C and washed twice with pre-cooled lysis buffer. The beads were washed three times with low salt buffer and once with high salt buffer. The bound RNA was purified by Trizol, and then reverse transcription-quantitative polymerase chain reaction (RT-qPCR) was performed to examine the enrichment of lncRNA 6030408B16RIK.

RNA binding protein immunoprecipitation (RIP)

The cells were collected after 48 h of transfection with FLAG-Argonaute 2 (Ago2) vectors. A total of 1 ml lysis buffer was then cleaved with a mixture of RNasin and protease inhibitor. The supernatant was centrifuged at 12 000×g for 30 min and incubated with 30 ml of anti-FLAG M2 magnetic beads for 4 h at 4°C, followed by three washes using wash buffer. Thereafter, RNA was extracted from magnetic beads using TRIzol and lncRNA 6030408B16RIK was examined using RT-qPCR.

RT-qPCR

Total RNA was extracted from RPMCs and rat peritoneal tissues using TRIzol, with the concentration and purity of the extracted RNA determined using a Nano Drop2000 spectrophotometer. The PRIMER5.0 and mirprimer2 software were used to design primers for RT-qPCR according to the published gene sequences in the Genbank database and the miRbase database. The primers were synthesized by Shanghai GenePharma Co. Ltd. (Shanghai, China) after confirmation of the sequences (Table 2). RT-qPCR was performed using the ABI PRISM 7500 real-time PCR System (Applied Biosystems, Oyster Bay, NY, U.S.A.). β-actin and U6 were used as internal references and the expression of the target gene was calculated using relative quantification (the 2−△△Ct method).

Table 2.
Primer sequences for RT-qPCR
GeneForward sequence (5′-3′)Reverse sequence (5′-3′)
LncRNA 6030408B16RIK CGCCATCCAGAGTTCATTTC AGTCCATCACCACAAGCACA 
miR-326-3p TGCGGCCTCTGGGCCCTTCCT CCAGTGCAGGGTCCGAGGT 
WISP2 CCTACACACACAGCCTATATC CCTTCTCTTCATCCTACCC 
α-SMA TGCTGACAGAGGCACCACTGAA CAGTTGTACGTCCAGAGGCATA 
E-cadherin GTATCGTCCCCGTCCAGC GGTTGCCCCATTCGTTCA 
Vimentin ATGAAAGTGTGGCTGCCAAGAAC GTGACTGCACCTGTCTCCGGTA 
FSP1 GTCCACCTTCCACAAAATACTCA GCACTATGCTCACAGCCAAC 
β-actin GGAGATTACTGCCCTGGCTCCTA GACTCATCGTACTCCTGCTTGCTG 
U6 GCTTCGGGCAGCACATATACTAAAAT CGCTTCACGAATTTGCGTGTCAT 
GeneForward sequence (5′-3′)Reverse sequence (5′-3′)
LncRNA 6030408B16RIK CGCCATCCAGAGTTCATTTC AGTCCATCACCACAAGCACA 
miR-326-3p TGCGGCCTCTGGGCCCTTCCT CCAGTGCAGGGTCCGAGGT 
WISP2 CCTACACACACAGCCTATATC CCTTCTCTTCATCCTACCC 
α-SMA TGCTGACAGAGGCACCACTGAA CAGTTGTACGTCCAGAGGCATA 
E-cadherin GTATCGTCCCCGTCCAGC GGTTGCCCCATTCGTTCA 
Vimentin ATGAAAGTGTGGCTGCCAAGAAC GTGACTGCACCTGTCTCCGGTA 
FSP1 GTCCACCTTCCACAAAATACTCA GCACTATGCTCACAGCCAAC 
β-actin GGAGATTACTGCCCTGGCTCCTA GACTCATCGTACTCCTGCTTGCTG 
U6 GCTTCGGGCAGCACATATACTAAAAT CGCTTCACGAATTTGCGTGTCAT 

Note: RT-qPCR, reverse transcription-quantitative polymerase chain reaction; miR-326-3p, microRNA-326-3p; WISP2, Wnt1-inducible-signaling pathway protein 2; α-SMA, α-smooth muscle actin; FSP1, fibroblast-specific protein 1.

Western blot analysis

The total protein was extracted from RPMCs and rat peritoneal tissues, after which the protein concentration was determined using a bicinchoninic acid (BCA) kit according to the instructions. The protein was then separated by 10% polyacrylamide gel electrophoresis, and electroblotted to a polyvinylidene fluoride (PVDF) membrane using the wet transfer method at a constant pressure of 100 mV. The membrane was blocked with 5% BSA for 1 h at room temperature, followed by overnight culture with primary rabbit antibodies (Abcam Inc., Cambridge, U.K.) to WISP2 (ab38317, 1 : 100), β-catenin (ab6302, 1 : 500), α-smooth muscle actin (α-SMA, ab32575, 1 : 500), phosphorylated β-catenin (ab27798, 1 : 500), fibroblast-specific protein 1 (FSP1, ab197896, 1 : 500), E-cadherin (ab181296, 1 : 500), Vimentin (ab137321, 1 : 500) and β-actin (ab8227, 1 : 1000) at 4°C. The corresponding secondary antibody goat anti-rabbit IgG (ab6721, 1 : 500, Abcam Inc., Cambridge, U.K.) was added to the membrane and incubated for 1 h at room temperature. The membrane was then developed using a chemiluminescence reagent. Image J software was used to quantify band intensities. β-actin was used as an internal reference and the ratio of the gray value of the target band to β-actin was representative of the relative protein expression.

Statistical analysis

Statistical analyses were performed using the SPSS 21.0 software (IBM Corp. Armonk, NY, U.S.A.). Measurement data obeying normal distribution and homogeneity of variance were expressed as mean ± standard deviation. Data between two groups were compared using unpaired t-test while data among multiple groups were compared by one-way analysis of variance (ANOVA), followed with Tukey's post hoc test. Pearson correlation coefficient was utilized for correlation analysis between indicators. A value of P < 0.05 indicated statistical significance.

Results

Knockdown of lncRNA 6030408B16RIK delayed ultrafiltration failure in PD

To investigate the effect of lncRNA 6030408B16RIK on the development of ultrafiltration failure in PD, the uremic rat model was first induced. During uremic modeling, four rats died of postoperative bleeding and were excluded. The serum creatinine and urea nitrogen in the iliac vein blood of rats were measured to determine whether the uremic rat model was successfully established. The results showed no significant difference in blood creatinine and urea nitrogen in sham-operated rats. The serum creatinine content in the blood of uremic rats was 2.981 folds to that of normal rats, and the urea nitrogen value was 2.782 folds (Figure 1A,B). These results demonstrated the successful establishment of the uremic rat model. The PD model was further induced in the uremic rats. During the dialysis, two rats developed peritonitis and were excluded from further study. Next, RT-qPCR was used to examine lncRNA 6030408B16RIK expression in rat peritoneal tissues. As shown in Figure 1C, lncRNA 6030408B16RIK expression was increased by PD treatment in the peritoneal tissues of uremic rats. In uremic rats undergoing PD, lncRNA 6030408B16RIK expression was lowered by treatment with si-lncRNA 6030408B16RIK.

Knockdown of lncRNA 6030408B16RIK expression represses ultrafiltration failure in rats undergoing PD.

Figure 1.
Knockdown of lncRNA 6030408B16RIK expression represses ultrafiltration failure in rats undergoing PD.

(A) Serum creatinine levels in the blood of rats. (B) Urea nitrogen levels in the blood of rats. Uremic rats were treated or not treated with PD, PD + si-NC or PD + si-lncRNA 6030408B16RIK. (C) Expression of lncRNA 6030408B16RIK in rat peritoneal tissues determined by RT-qPCR, normalized to β-actin. (D) HE staining, Masson's trichrome staining and immunohistochemistry of rat peritoneal tissues (×400). (E) Rat peritoneal thickness. (F) Collagen III and CD31 expression in rat peritoneal tissues determined by immunohistochemistry. (G) Ultrafiltration volume of rats. (H) Glucose transport capacity of rats. (I) Expression of lncRNA 6030408B16RIK, α-SMA, FSP1, E-cadherin and Vimentin in rat peritoneal tissues determined by RT-qPCR, normalized to β-actin. (J) Western blot analysis of α-SMA, FSP1, E-cadherin and Vimentin proteins in rat peritoneal tissues normalized to β-actin. Measurement data (mean ± standard deviation) among multiple groups were compared using one-way ANOVA, followed with Tukey's post hoc test. * P < 0.05 vs. normal rats or uremic rats, # P < 0.05 vs. uremic rats treated with PD + si-NC. n = 6. PD, peritoneal dialysis; NC, negative control; HE, hematoxylin-eosin staining; CD31, platelet endothelial adhesion molecule; α-SMA, α-smooth muscle actin; FSP1, fibroblast-specific protein 1.

Figure 1.
Knockdown of lncRNA 6030408B16RIK expression represses ultrafiltration failure in rats undergoing PD.

(A) Serum creatinine levels in the blood of rats. (B) Urea nitrogen levels in the blood of rats. Uremic rats were treated or not treated with PD, PD + si-NC or PD + si-lncRNA 6030408B16RIK. (C) Expression of lncRNA 6030408B16RIK in rat peritoneal tissues determined by RT-qPCR, normalized to β-actin. (D) HE staining, Masson's trichrome staining and immunohistochemistry of rat peritoneal tissues (×400). (E) Rat peritoneal thickness. (F) Collagen III and CD31 expression in rat peritoneal tissues determined by immunohistochemistry. (G) Ultrafiltration volume of rats. (H) Glucose transport capacity of rats. (I) Expression of lncRNA 6030408B16RIK, α-SMA, FSP1, E-cadherin and Vimentin in rat peritoneal tissues determined by RT-qPCR, normalized to β-actin. (J) Western blot analysis of α-SMA, FSP1, E-cadherin and Vimentin proteins in rat peritoneal tissues normalized to β-actin. Measurement data (mean ± standard deviation) among multiple groups were compared using one-way ANOVA, followed with Tukey's post hoc test. * P < 0.05 vs. normal rats or uremic rats, # P < 0.05 vs. uremic rats treated with PD + si-NC. n = 6. PD, peritoneal dialysis; NC, negative control; HE, hematoxylin-eosin staining; CD31, platelet endothelial adhesion molecule; α-SMA, α-smooth muscle actin; FSP1, fibroblast-specific protein 1.

HE staining, Masson's trichrome staining and immunohistochemistry (Figure 1D) revealed that in uremic rats, cells became round and columnar, the mesothelial cells were detached and the mesothelial matrix was increased, accompanied by many fibroblast-like cells, collagen deposition, macrophage infiltration and elevation in peritoneal thickness and mesothelial fibers of the rats after PD treatment. Peritoneal vascular specific proteins CD31 and Collagen III were examined by immunohistochemistry. The results showed that the rat peritoneum thickness and Collagen III and CD31 positive expression were increased in uremic rats by PD treatment, whereas opposite effects were seen in uremic rats undergoing PD after silencing lncRNA 6030408B16RIK (Figure 1E,F). PET revealed that PD treatment decreased ultrafiltration and enhanced glucose transport capacity in uremic rats, while uremic rats undergoing PD exhibited opposite effects after the silencing of lncRNA 6030408B16RIK (Figure 1G,H). In addition, RT-qPCR and Western blot analysis (Figure 1I,J) displayed up-regulated expression of α-SMA, FSP1 and Vimentin, yet down-regulated E-cadherin expression in uremic PD rats, which was reversed by silencing lncRNA 6030408B16RIK. The above results suggested that poor expression of lncRNA 6030408B16RIK could delay the occurrence of ultrafiltration failure in PD.

LncRNA 6030408B16RIK directly bound to miR-326-3p

We then attempted to reveal the mechanism by which lncRNA 6030408B16RIK affects the progression of ultrafiltration failure in PD. RPMCs were first isolated from rat peritoneal tissues and identified. The results (Figure 2A) revealed that keratin antigen and Vimentin antigen were positive in primary cultured cells, and factor VIII-related antigen and leukocyte CD45 antigen were negative, which was consistent with the characteristics of mesothelial cells, thus confirming the successful isolation and culture of RPMCs. FISH (Figure 2B) revealed that lncRNA 6030408B16RIK was localized in the cytoplasm and was down-regulated after si-lncRNA 6030408B16RIK treatment. A possible binding site between lncRNA 6030408B16RIK and miR-326-3p was predicted by the biological website (https://cm.jefferson.edu/rna22/) (Figure 2C). Then dual-luciferase reporter assay was used to verify the predicted binding relationship. The luciferase activity of pWT-lncRNA 6030408B16RIK was significantly reduced by miR-326-3p mimic (P < 0.05), while that of pMUT-lncRNA 6030408B16RIK did not change significantly (P > 0.05; Figure 2D). This indicated that miR-326-3p specifically bound to lncRNA 6030408B16RIK. Meanwhile, RIP experiments showed that the enrichment of lncRNA 6030408B16RIK in the Ago2 protein was increased, indicating that lncRNA 6030408B16RIK could bind to Ago2 protein (Figure 2E). Furthermore, the RNA-pull down assay showed increased enrichment of lncRNA 6030408B16RIK in the WT-miR-326-3p (Figure 2F). The aforementioned results suggested that lncRNA 6030408B16RIK could directly bind to miR-326-3p.

LncRNA 6030408B16RIK directly bound to miR-326-3p.

Figure 2.
LncRNA 6030408B16RIK directly bound to miR-326-3p.

(A) Immunohistochemistry of keratin and Vimentin proteins in RPMCs (×200). (B) Expression and localization of lncRNA 6030408B16RIK in RPMCs detected by FISH (×400). (C) The binding site between lncRNA 6030408B16RIK and miR-326-3p predicted by a biological website available at https://cm.jefferson.edu/rna22/. (D) The binding of lncRNA 6030408B16RIK to miR-326-3p verified by dual-luciferase reporter assay. (E) The relationship between lncRNA 6030408B16RIK and Ago2 tested by RIP. (F) The binding relationship between lncRNA 6030408B16RIK and miR-326-3p tested by RNA-pull down. Measurement data (mean ± standard deviation) between the two groups were compared using unpaired t-test. * P < 0.05 vs. the treatment with NC, # P < 0.05 vs. the treatment with IgG. The experiments were conducted three times independently. RPMCs, rat peritoneal mast cells; FISH, fluorescence in situ hybridisation; CD45, hematopoietic-specific transmembrane protein tyrosine phosphatase; NC, negative control; DAPI, 4′6-diamidino-2-phenylindole.

Figure 2.
LncRNA 6030408B16RIK directly bound to miR-326-3p.

(A) Immunohistochemistry of keratin and Vimentin proteins in RPMCs (×200). (B) Expression and localization of lncRNA 6030408B16RIK in RPMCs detected by FISH (×400). (C) The binding site between lncRNA 6030408B16RIK and miR-326-3p predicted by a biological website available at https://cm.jefferson.edu/rna22/. (D) The binding of lncRNA 6030408B16RIK to miR-326-3p verified by dual-luciferase reporter assay. (E) The relationship between lncRNA 6030408B16RIK and Ago2 tested by RIP. (F) The binding relationship between lncRNA 6030408B16RIK and miR-326-3p tested by RNA-pull down. Measurement data (mean ± standard deviation) between the two groups were compared using unpaired t-test. * P < 0.05 vs. the treatment with NC, # P < 0.05 vs. the treatment with IgG. The experiments were conducted three times independently. RPMCs, rat peritoneal mast cells; FISH, fluorescence in situ hybridisation; CD45, hematopoietic-specific transmembrane protein tyrosine phosphatase; NC, negative control; DAPI, 4′6-diamidino-2-phenylindole.

Inhibition of miR-326-3p promoted ultrafiltration failure in uremic PD rats

Next, we investigated whether miR-326-3p affects the occurrence of ultrafiltration failure in PD. The results of HE staining, Masson's trichrome staining and immunohistochemistry depicted in Figure 3A showed that the peritoneal thickness and mesothelial fibers were reduced in uremic PD rats treated with miR-326-3p mimic. However, injection with miR-326-3p inhibitor elevated peritoneal thickness and mesothelial fibers of uremic PD rats, accompanied by mesothelial cell exfoliation. In addition, the peritoneal thickness, as well as the expression of CD31 and Collagen III, was decreased in uremic PD rats injected with miR-326-3p mimic, which was negated by injection with miR-326-3p inhibitor. PET results showed increased ultrafiltration and glucose transport capacity in uremic PD rats treated with miR-326-3p mimic, while miR-326-3p inhibitor caused opposite results (Figure 3D,E). RT-qPCR and Western blot analysis (Figure 3F–G) displayed that expression of α-SMA, FSP1 and Vimentin was decreased in the uremic PD rats injected with miR-326-3p mimic, while that of miR-326-3p and E-cadherin was increased. However, these effects were reversed following injection with miR-326-3p inhibitor. In conclusion, overexpression of miR-326-3p could inhibit ultrafiltration failure in uremic rats with PD.

Up-regulation of miR-326-3p suppressed ultrafiltration failure in uremic PD rats.

Figure 3.
Up-regulation of miR-326-3p suppressed ultrafiltration failure in uremic PD rats.

Uremic PD rats were injected with mimic NC, miR-326-3p mimic, inhibitor NC or miR-326-3p inhibitor. (A) HE staining, Masson's trichrome staining and immunohistochemistry of rat peritoneal tissues (×400). (B) Peritoneal thickness of rats. (C) Expression of Collagen III and CD31 in rat peritoneal tissues. (D) Ultrafiltration volume of rats. (E) Glucose transport capacity of rats. (F) Expression of miR-326-3p, α-SMA, FSP1, E-cadherin and Vimentin in rat peritoneal tissues determined by RT-qPCR, normalized to U6 and β-actin. (G) Western blot analysis ofα-SMA, FSP1, E-cadherin and Vimentin proteins in rat peritoneal tissues, normalized to β-actin. * P < 0.05 vs. the uremic PD rats injected with mimic NC, # P < 0.05 vs. the uremic PD rats injected with inhibitor NC. Measurement data (mean ± standard deviation) between two groups were compared using unpaired t-test while data among multiple groups were compared by one-way ANOVA, followed with Tukey's post hoc test. n = 6. PD, peritoneal dialysis; HE, hematoxylin-eosin staining; CD31, platelet endothelial adhesion molecule; NC, negative control; α-SMA, α-smooth muscle actin; FSP1, fibroblast-specific protein 1.

Figure 3.
Up-regulation of miR-326-3p suppressed ultrafiltration failure in uremic PD rats.

Uremic PD rats were injected with mimic NC, miR-326-3p mimic, inhibitor NC or miR-326-3p inhibitor. (A) HE staining, Masson's trichrome staining and immunohistochemistry of rat peritoneal tissues (×400). (B) Peritoneal thickness of rats. (C) Expression of Collagen III and CD31 in rat peritoneal tissues. (D) Ultrafiltration volume of rats. (E) Glucose transport capacity of rats. (F) Expression of miR-326-3p, α-SMA, FSP1, E-cadherin and Vimentin in rat peritoneal tissues determined by RT-qPCR, normalized to U6 and β-actin. (G) Western blot analysis ofα-SMA, FSP1, E-cadherin and Vimentin proteins in rat peritoneal tissues, normalized to β-actin. * P < 0.05 vs. the uremic PD rats injected with mimic NC, # P < 0.05 vs. the uremic PD rats injected with inhibitor NC. Measurement data (mean ± standard deviation) between two groups were compared using unpaired t-test while data among multiple groups were compared by one-way ANOVA, followed with Tukey's post hoc test. n = 6. PD, peritoneal dialysis; HE, hematoxylin-eosin staining; CD31, platelet endothelial adhesion molecule; NC, negative control; α-SMA, α-smooth muscle actin; FSP1, fibroblast-specific protein 1.

miR-326-3p targeted WISP2 and inhibited the up-regulation of WISP2 by lncRNA 6030408B16RIK

The downstream regulatory target genes of miR-326-3p were then identified. A possible binding site was predicted between miR-326-3p and WISP2 by the biological website (https://cm.jefferson.edu/rna22/) (Figure 4A). Then, the dual-luciferase reporter assay further demonstrated that the luciferase activity of the WISP2-WT 3′UTR was inhibited by miR-326-3p mimic (P < 0.05), while miR-326-3p mimic had no effect on the luciferase activity of WISP2-MUT 3′UTR (P > 0.05; Figure 4B). This indicated that miR-326-3p specifically bound to 3′UTR of WISP2 and down-regulated WISP2 at the post-transcriptional level. In addition, WISP2 expression in PMCs of uremic PD rats examined by RT-qPCR and Western blot analysis was lowered after silencing lncRNA 6030408B16RIK, while it was rescued by miR-326-3p inhibitor (Figure 4C–E). Collectively, miR-326-3p targeted WISP2 and reversed the up-regulation of WISP2 by lncRNA 6030408B16RIK.

miR-326-3p targeted WISP2 and negated the promoting effect of lncRNA 6030408B16RIK on WISP2 expression.

Figure 4.
miR-326-3p targeted WISP2 and negated the promoting effect of lncRNA 6030408B16RIK on WISP2 expression.

(A) The binding site between WISP2 and miR-326-3p predicted using a biological website. (B) The binding of miR-326-3p to WISP2 confirmed by dual-luciferase reporter assay. (C) WISP2 mRNA expression in cells determined by RT-qPCR, normalized to β-actin. (D,E) Western blot analysis of WISP2 protein in cells, normalized to β-actin.* P < 0.05 vs. the uremic PD rats injected with mimic NC or si-NC + inhibitor NC, # P < 0.05 vs. the uremic PD rats injected with si-lncRNA 6030408B16RIK + inhibitor NC. Measurement data (mean ± standard deviation) between two groups were compared using unpaired t-test while data among multiple groups were compared by one-way ANOVA, followed with Tukey's post hoc test. The experiment was conducted three times independently. PD, peritoneal dialysis; NC, negative control; WISP2, WNT1-inducible-signaling pathway protein 2.

Figure 4.
miR-326-3p targeted WISP2 and negated the promoting effect of lncRNA 6030408B16RIK on WISP2 expression.

(A) The binding site between WISP2 and miR-326-3p predicted using a biological website. (B) The binding of miR-326-3p to WISP2 confirmed by dual-luciferase reporter assay. (C) WISP2 mRNA expression in cells determined by RT-qPCR, normalized to β-actin. (D,E) Western blot analysis of WISP2 protein in cells, normalized to β-actin.* P < 0.05 vs. the uremic PD rats injected with mimic NC or si-NC + inhibitor NC, # P < 0.05 vs. the uremic PD rats injected with si-lncRNA 6030408B16RIK + inhibitor NC. Measurement data (mean ± standard deviation) between two groups were compared using unpaired t-test while data among multiple groups were compared by one-way ANOVA, followed with Tukey's post hoc test. The experiment was conducted three times independently. PD, peritoneal dialysis; NC, negative control; WISP2, WNT1-inducible-signaling pathway protein 2.

LncRNA 6030408B16RIK induced peritoneal fibrosis and subsequent ultrafiltration failure through mediating the miR-326-3p/WISP2/Wnt/β-catenin pathway

To further investigate whether lncRNA 6030408B16RIK, miR-326-3p and WISP2 affected the pathogenesis of ultrafiltration failure through pathways, lncRNA 6030408B16RIK and miR-326-3p were first inhibited and WISP2 was overexpressed in uremic rats undergoing PD. RT-qPCR results revealed that dual treatment by si-lncRNA 6030408B16RIK and oe-WISP2 or both si-lncRNA 6030408B16RIK and inhibitor NC triggered a decline in lncRNA 6030408B16RIK expression and an enhancement in miR-326-3p expression (P < 0.05). In addition, WISP2 expression was found to be increased in response to treatment with both si-lncRNA 6030408B16RIK and miR-326-3p inhibitor (P < 0.05; Figure 5A). HE staining, Masson's trichrome staining and immunohistochemistry (Figure 5B–D) showed that silencing lncRNA 6030408B16RIK decreased peritoneal thickness and mesothelial fibers of uremic rats treated with PD, which was restored by additional treatment with oe-WISP2 or miR-326-3p inhibitor. In addition, as illustrated in Figure 5C,D, there was a reduction in peritoneal thickness and the expression of CD31 and Collagen III in uremic rats treated with PD after lncRNA 6030408B16RIK silencing, which was abolished by additional treatment of oe-WISP2 or miR-326-3p inhibitor. Furthermore, PET (Figure 5E,F) revealed that in uremic rats treated with PD, ultrafiltration volume was elevated and glucose transport capacity was diminished by silencing lncRNA 6030408B16RIK, which was abrogated by additional treatment of oe-WISP2 or miR-326-3p inhibitor.

LncRNA 6030408B16RIK activated WISP2-dependent Wnt/β-catenin pathway by binding to miR-326-3p, thus promoting peritoneal fibrosis and subsequent ultrafiltration failure in uremic rats with PD.

Figure 5.
LncRNA 6030408B16RIK activated WISP2-dependent Wnt/β-catenin pathway by binding to miR-326-3p, thus promoting peritoneal fibrosis and subsequent ultrafiltration failure in uremic rats with PD.

Uremic PD rats were injected with si-NC + oe-NC, si-NC + inhibitor NC, si-lncRNA 6030408B16RIK + oe-WISP2, si-lncRNA 6030408B16RIK + inhibitor NC or si-lncRNA 6030408B16RIK + miR-326-3p inhibitor. (A) Expression of lncRNA 6030408B16RIK, miR-326-3p and WISP2 in rats detected by RT-qPCR. (B) HE staining, Masson's trichrome staining and immunohistochemistry of rat peritoneal tissues (×400). (C) Peritoneal thickness of rats. (D) Immunohistochemistry of Collagen III and CD31 expression in rat peritoneal tissues. (E) Ultrafiltration volume in rats. (F) Glucose transport capacity of rats. (G,H) Western blot analysis of phosphorylated β-catenin, α-SMA, FSP1, E-cadherin and Vimentin proteins in rat peritoneal tissues, normalized to β-actin. Uremic rats were treated or not treated with PD or PD + XAV-939. (I) HE staining, Masson's trichrome staining and immunohistochemistry of rat peritoneal tissues (×400). (J) Peritoneal thickness of rats. (K) Expression of CD31 and Collagen III in rat peritoneal tissues detected by immunohistochemistry. (L) Ultrafiltration volume of rats. (M) Glucose transport capacity of rats. * P < 0.05 vs. uremic PD rats injected with si-NC + oe-NC or si-NC + inhibitor NC or uremia rats. # P < 0.05 vs. uremic PD rats injected with si-lncRNA 6030408B16RIK + inhibitor NC. Measurement data (mean ± standard deviation) between two groups were compared using unpaired t-test while data among multiple groups were compared by one-way ANOVA, followed with Tukey's post hoc test. n = 6. PD, peritoneal dialysis; NC, negative control; WISP2, WNT1-inducible-signaling pathway protein 2; HE, hematoxylin-eosin staining; CD31, platelet endothelial adhesion molecule; α-SMA, α-smooth muscle actin; FSP1, fibroblast-specific protein 1.

Figure 5.
LncRNA 6030408B16RIK activated WISP2-dependent Wnt/β-catenin pathway by binding to miR-326-3p, thus promoting peritoneal fibrosis and subsequent ultrafiltration failure in uremic rats with PD.

Uremic PD rats were injected with si-NC + oe-NC, si-NC + inhibitor NC, si-lncRNA 6030408B16RIK + oe-WISP2, si-lncRNA 6030408B16RIK + inhibitor NC or si-lncRNA 6030408B16RIK + miR-326-3p inhibitor. (A) Expression of lncRNA 6030408B16RIK, miR-326-3p and WISP2 in rats detected by RT-qPCR. (B) HE staining, Masson's trichrome staining and immunohistochemistry of rat peritoneal tissues (×400). (C) Peritoneal thickness of rats. (D) Immunohistochemistry of Collagen III and CD31 expression in rat peritoneal tissues. (E) Ultrafiltration volume in rats. (F) Glucose transport capacity of rats. (G,H) Western blot analysis of phosphorylated β-catenin, α-SMA, FSP1, E-cadherin and Vimentin proteins in rat peritoneal tissues, normalized to β-actin. Uremic rats were treated or not treated with PD or PD + XAV-939. (I) HE staining, Masson's trichrome staining and immunohistochemistry of rat peritoneal tissues (×400). (J) Peritoneal thickness of rats. (K) Expression of CD31 and Collagen III in rat peritoneal tissues detected by immunohistochemistry. (L) Ultrafiltration volume of rats. (M) Glucose transport capacity of rats. * P < 0.05 vs. uremic PD rats injected with si-NC + oe-NC or si-NC + inhibitor NC or uremia rats. # P < 0.05 vs. uremic PD rats injected with si-lncRNA 6030408B16RIK + inhibitor NC. Measurement data (mean ± standard deviation) between two groups were compared using unpaired t-test while data among multiple groups were compared by one-way ANOVA, followed with Tukey's post hoc test. n = 6. PD, peritoneal dialysis; NC, negative control; WISP2, WNT1-inducible-signaling pathway protein 2; HE, hematoxylin-eosin staining; CD31, platelet endothelial adhesion molecule; α-SMA, α-smooth muscle actin; FSP1, fibroblast-specific protein 1.

Western blot analysis demonstrated that (Figure 5G,H) PMCs of uremic rats treated with PD had decreased phosphorylated levels of β-catenin, and expression of Vimentin, FSP1 and α-SMA yet increased E-cadherin expression following silencing of lncRNA 6030408B16RIK. These effects were abrogated by additional treatment with oe-WISP2 or miR-326-3p inhibitor.

To further validate the role of the Wnt/β-catenin pathway in ultrafiltration failure of rats with PD, the Wnt/β-catenin pathway inhibitor XAV-939 was used. First, HE staining, Masson's trichrome staining and immunohistochemistry (Figure 5I) showed an increase in the peritoneal thickness, thickened mesothelial fibers and mesothelial cell detachment in rats after PD treatment, which was restored by treatment of XAV-939. As described in Figure 5J,K, the peritoneal thickness as well as the expression of CD31 and Collagen III was increased in uremic rats with PD, which was reversed by inhibition of the Wnt/β-catenin pathway. The PET results (Figure 5L,M) showed a significant reduction in ultrafiltration volume and an elevation in glucose transport capacity in the uremic rats upon PD treatment, which was rescued by the treatment with XAV-939. Altogether, lncRNA 6030408B16RIK mediated the miR-326-3p/WISP2/Wnt/β-catenin pathway which was involved in the regulation of epithelial-mesenchymal transition (EMT) in RPMCs, thus promoting peritoneal fibrosis and inducing ultrafiltration failure.

LncRNA 6030408B16RIK up-regulated WISP2 expression by binding to miR-326-3p in clinical samples from uremic patients

To verify the mechanism of lncRNA 6030408B16RIK binding to miR-326-3p in uremic patients, samples of peritoneal tissue from uremic patients were collected from 32 patients, of whom, 16 received PD (PD) and 16 did not (uremia). RT-qPCR (Figure 6A–C) showed that the expression of lncRNA 6030408B16RIK and WISP2 was much higher in the peritoneal tissues of PD patients than that in the peritoneal tissues of patients without PD, while miR-326-3p expression was lower (P < 0.05). Correlation analysis (Figure 6D,E) showed that miR-326-3p expression was negatively correlated with lncRNA 6030408B16RIK and WISP2 expression, and there was a positive correlation between 6030408B16RIK expression and WISP2 expression (Figure 6F). In summary, lncRNA 6030408B16RIK could bind to miR-326-3p, thus positively regulating WISP2 in uremic patients with PD.

LncRNA 6030408B16RIK up-regulated WISP2 expression by binding with miR-326-3p in uremic patients undergoing PD.

Figure 6.
LncRNA 6030408B16RIK up-regulated WISP2 expression by binding with miR-326-3p in uremic patients undergoing PD.

(A) LncRNA 6030408B16RIK expression in the peritoneal tissues of patients examined by RT-qPCR, normalized to β-actin (n = 16). (B) miR-326-3p expression in the peritoneal tissues of patients examined by RT-qPCR, normalized to U6 (n = 16). (C) WISP2 expression in the peritoneal tissues of patients examined by RT-qPCR, normalized to β-actin (n = 16). (D) Correlation analysis of miR-326-3p and lncRNA 6030408B16RIK expression. (E) Correlation analysis of miR-326-3p and WISP2 expression. (F) Correlation analysis of lncRNA 6030408B16RIK and WISP2 expression. * P < 0.05 vs. uremic patients without PD. Measurement data (mean ± standard deviation) between two groups were compared using unpaired t-test. Pearson correlation coefficient was utilized for correlation analysis between indicators. The cell experiment was conducted three times independently.

Figure 6.
LncRNA 6030408B16RIK up-regulated WISP2 expression by binding with miR-326-3p in uremic patients undergoing PD.

(A) LncRNA 6030408B16RIK expression in the peritoneal tissues of patients examined by RT-qPCR, normalized to β-actin (n = 16). (B) miR-326-3p expression in the peritoneal tissues of patients examined by RT-qPCR, normalized to U6 (n = 16). (C) WISP2 expression in the peritoneal tissues of patients examined by RT-qPCR, normalized to β-actin (n = 16). (D) Correlation analysis of miR-326-3p and lncRNA 6030408B16RIK expression. (E) Correlation analysis of miR-326-3p and WISP2 expression. (F) Correlation analysis of lncRNA 6030408B16RIK and WISP2 expression. * P < 0.05 vs. uremic patients without PD. Measurement data (mean ± standard deviation) between two groups were compared using unpaired t-test. Pearson correlation coefficient was utilized for correlation analysis between indicators. The cell experiment was conducted three times independently.

Discussion

PD is one of the major options for renal replacement therapy [16], having many advantages such as more autonomy of the patient, fewer hospital visits and better preservation of residual renal function [17]. However, it also has disadvantages, since continuous ambulatory PD changes the structure of the peritoneal membrane, like fibrosis, vasculopathy, and thus reducing ultrafiltration capacity [18]. The molecular mechanisms underlying ultrafiltration failure and peritoneal fibrosis in PD, therefore, need to be explored [19]. In this study, we investigated the mechanism of lncRNA 6030408B16RIK, miR-326-3p and WISP2 underlying PD ultrafiltration failure. The gathered findings suggested that lncRNA 6030408B16RIK could promote peritoneal fibrosis by mediating the miR-326-3p/WISP2/Wnt/β-catenin pathway, thereby triggering ultrafiltration failure in PD.

Long-term daily intraperitoneal exposure to PD fluid has been known to cause fibrosis and angiogenesis, inducing ultrafiltration failure [20]. LncRNAs play a crucial part in peritoneal fibrosis [8]. For instance, Liu et al. [11] conducted microarray analysis to study the role of lncRNAs and miRs in peritoneal fibrosis, finding the up-regulation of several lncRNAs including lncRNA AV310809, lncRNA uc007eib.1, lncRNA AK142426 and lncRNA ENSMUST00000053838 in peritoneal fibrosis. These findings indirectly supported our present results that lncRNA 6030408B16RIK was highly expressed in the peritoneal tissues of patients and rats with uremic PD, and that down-regulation of lncRNA 6030408B16RIK reduced peritoneal fibrosis and promoted ultrafiltration volume accompanied by decreased α-SMA, FSP1 and Vimentin expression and increased E-cadherin expression. Ultrafiltration volume is the sum of solute-free- and solute-coupled-water removal in PD [21]. Our findings showed that the expression of α-SMA, FSP1 and Vimentin all had the same trend of tissue fibrosis. Similarly, the traditional medicine Bu-Shen-Huo-Xue can treat renal fibrosis in rats with 5/6 nephrectomy through increasing E-cadherin expression and decreasing α-SMA expression [22]. FSP1 has been suggested as a fibroblast-specific marker in normal and fibrotic tissues [23]. α-SMA-positive cells were increased in the thickened peritoneum in a rat model with daily intraperitoneal injections of 20 mM methylglyoxal in PD solution for 3 weeks [24]. The expression of Wnts and β-catenin was elevated accompanied with altered expression of E-cadherin and α-SMA in patients who have undergone PD for more than a year [25]. Therefore, lncRNA 6030408B16RIK down-regulation suppressed the ultrafiltration failure by regulating fibrosis-related factors to reduce peritoneal fibrosis.

LncRNAs are reported to decoy miRNAs and then to regulate the expression of target mRNAs [26]. For example, lncRNA PFAL regulated CTGF by competitively binding miR-18a to induce lung fibrosis [27]. Moreover, the binding relationship of miR-326-3p to lncRNA 6030408B16RIK and WISP2 was detected in our study. miR-326-3p was under-expressed in peritoneal tissues of patients and rats with uremic PD, and repressed peritoneal fibrosis in rat with uremic PD. Similarly, miR-200a improves peritoneal fibrosis and functional deterioration in a PD rat model [28]. Up-regulation of miR-15a-5p inhibits the inflammation and fibrosis of PD-induced PMCs through targeting vascular endothelial growth factor A [29]. miR-129-5p is down-regulated in mesothelial cells collected from patients with PD [30]. Besides, miR-326-3p also has a close relation with fibrosis, and attenuates high glucose and fibrotic injury-induced byox-LDL-IC in renal mesangial cells through targeting FcγRIII [31]. Another prior study elucidated that miR-326 could suppress endometrial fibrosis of intrauterine adhesions via the TGF-β1/Smad3 pathway [32]. Furthermore, WISP2 is able to mediate fibrosis [14]. Studies have confirmed that abnormal activation of the Wnt/β-catenin signaling pathway may be related to peritoneal fibrosis, and that the Wnt/β-catenin and TGF-β signaling pathways may interact each other, possibly contributing to EMT of various cells and the process of fibrous diseases [33].

On the basis of the above findings, our study suggested that lncRNA 6030408B16RIK silencing suppressed ultrafiltration failure in rats with uremic PD via miR-326-3p-mediated WISP2 inhibition. These findings may contribute to our understanding of the mechanisms that lead to ultrafiltration failure in PD and provide a novel therapeutic strategy in ultrafiltration failure treatment. Further investigations into the interaction between lncRNA 6030408B16RIK, miR-326-3p and WISP2 are still required to validate their translatability into practice.

Competing Interests

The authors declare that there are no competing interests associated with the manuscript.

Funding

This study was supported by the Natural Science Foundation of Shandong Province (General Program) [ZR2019MH126] and the Shandong Provincial Medical and Health Science and Technology Development Plan Project [2018WS404].

Author Contributions

Z.W. and Z.Z. designed the study, collated the data and carried out data analyses. W.J. and L.S. produced the initial draft of the manuscript. Y.M., J.W. and H.Z. contributed substantially to its revision. All authors have read and approved the final submitted manuscript and authorship.

Acknowledgements

The authors thank the colleagues for technical help and stimulating discussions.

Abbreviations

     
  • AGO2

    Argonaute2

  •  
  • ANOVA

    analysis of variance

  •  
  • BCA

    bicinchoninic acid

  •  
  • CCN

    ephroblastoma overexpressed

  •  
  • CTS

    corneal topography system

  •  
  • DAB

    3, 3′-diaminobenzidine

  •  
  • DAPI

    4′,6-diamidino-2-phenylindole

  •  
  • DMEM

    Dulbecco's modified Eagle's medium

  •  
  • EMT

    epithelial-mesenchymal transition

  •  
  • F12

    Ham's F-12

  •  
  • FISH

    fluorescence in situ hybridization

  •  
  • FSP1

    fibroblast-specific protein 1

  •  
  • HD

    hemodialysis

  •  
  • HE

    hematoxylin-eosin

  •  
  • HRP

    horseradish peroxidase

  •  
  • IgG

    immunoglobulin G

  •  
  • lncRNAs

    long noncoding RNAs

  •  
  • miRNAs or miRs

    microRNAs

  •  
  • MUT

    mutant

  •  
  • NC

    negative control

  •  
  • oe

    overexpression

  •  
  • PBS

    phosphate-buffered saline

  •  
  • PD

    peritoneal dialysis

  •  
  • PET

    peritoneal equilibration test

  •  
  • PVDF

    polyvinylidene fluoride

  •  
  • RIP

    RNA binding protein immunoprecipitation

  •  
  • RPMCs

    rat peritoneal mesothelial cells

  •  
  • RT-qPCR

    reverse transcription-quantitative polymerase chain reaction

  •  
  • si

    small interfering RNA

  •  
  • tRNA

    transfer RNA

  •  
  • UTR

    untranslated region

  •  
  • WISP2

    WNT1-inducible-signaling pathway protein 2

  •  
  • WT

    wild-type

  •  
  • α-SMA

    α-smooth muscle actin

References

References
1
Moriishi
,
M.
,
Kawanishi
,
H.
and
Tsuchiya
,
S.
(
2010
)
Impact of combination therapy with peritoneal dialysis and hemodialysis on peritoneal function
.
Adv. Perit. Dial.
26
,
67
70
PMID:
[PubMed]
2
Ronco
,
C.
,
Dell'Aquila
,
R.
,
Rodighiero
,
M.P.
,
Di Loreto
,
P.
and
Spano
,
E.
(
2006
)
Integration of peritoneal dialysis in the treatment of uremia
.
Contrib. Nephrol.
150
,
226
234
3
Li
,
P.K.
,
Chow
,
K.M.
,
Van de Luijtgaarden
,
M.W.
,
Johnson
,
D.W.
,
Jager
,
K.J.
,
Mehrotra
,
R.
et al (
2017
)
Changes in the worldwide epidemiology of peritoneal dialysis
.
Nat. Rev. Nephrol.
13
,
90
103
4
Chaudhary
,
K.
,
Sangha
,
H.
and
Khanna
,
R.
(
2011
)
Peritoneal dialysis first: rationale
.
Clin. J. Am. Soc. Nephrol.
6
,
447
456
5
Asano
,
M.
,
Ishii
,
T.
,
Hirayama
,
A.
,
Mizuno
,
M.
,
Suzuki
,
Y.
,
Sakata
,
F.
et al (
2019
)
Differences in peritoneal solute transport rates in peritoneal dialysis
.
Clin. Exp. Nephrol.
23
,
122
134
6
Teitelbaum
,
I.
(
2015
)
Ultrafiltration failure in peritoneal dialysis: a pathophysiologic approach
.
Blood Purif.
39
,
70
73
7
Li
,
L.
,
Shen
,
N.
,
Wang
,
N.
,
Wang
,
W.
,
Tang
,
Q.
,
Du
,
X.
et al (
2018
)
Inhibiting core fucosylation attenuates glucose-induced peritoneal fibrosis in rats
.
Kidney Int.
93
,
1384
1396
8
Zhou
,
Q.
,
Bajo
,
M.A.
,
Del Peso
,
G.
,
Yu
,
X.
and
Selgas
,
R.
(
2016
)
Preventing peritoneal membrane fibrosis in peritoneal dialysis patients
.
Kidney Int.
90
,
515
524
9
Li
,
J.
,
Li
,
Z.
,
Zheng
,
W.
,
Li
,
X.
,
Wang
,
Z.
,
Cui
,
Y.
et al (
2017
)
LncRNA-ATB: an indispensable cancer-related long noncoding RNA
.
Cell Prolif.
50
,
e12381
10
Dastmalchi
,
N.
,
Safaralizadeh
,
R.
and
Nargesi
,
M.M.
(
2019
)
LncRNAs: potential novel prognostic and diagnostic biomarkers in colorectal cancer
.
Curr. Med. Chem.
27
11
Liu
,
Y.
,
Guo
,
R.
,
Hao
,
G.
,
Xiao
,
J.
,
Bao
,
Y.
,
Zhou
,
J.
et al (
2015
)
The expression profiling and ontology analysis of noncoding RNAs in peritoneal fibrosis induced by peritoneal dialysis fluid
.
Gene
564
,
210
219
12
Lopez-Anton
,
M.
,
Bowen
,
T.
and
Jenkins
,
R.H.
(
2015
)
microRNA regulation of peritoneal cavity homeostasis in peritoneal dialysis
.
Biomed. Res. Int.
2015
,
929806
13
Yuan
,
W.
,
Liu
,
L.
,
Liang
,
L.
,
Huang
,
K.
,
Deng
,
Y.
,
Dong
,
M.
et al (
2020
)
MiR-122-5p and miR-326-3p: potential novel biomarkers for early detection of cadmium exposure
.
Gene
724
,
144156
14
Grunberg
,
J.R.
,
Elvin
,
J.
,
Paul
,
A.
,
Hedjazifar
,
S.
,
Hammarstedt
,
A.
and
Smith
,
U.
(
2018
)
CCN5/WISP2 and metabolic diseases
.
J. Cell Commun. Signal.
12
,
309
318
15
Grunberg
,
J.R.
,
Hammarstedt
,
A.
,
Hedjazifar
,
S.
and
Smith
,
U.
(
2014
)
The novel secreted adipokine WNT1-inducible signaling pathway protein 2 (WISP2) is a mesenchymal cell activator of canonical WNT
.
J. Biol. Chem.
289
,
6899
6907
16
Bargman
,
J.M.
and
Girsberger
,
M.
(
2018
)
Visions in a crystal ball: the future of peritoneal dialysis
.
Blood Purif.
45
,
218
223
17
Mihalache
,
O.
,
Doran
,
H.
,
Mustatea
,
P.
,
Bobirca
,
F.
,
Georgescu
,
D.
,
Birligea
,
A.
et al (
2018
)
Surgical complications of peritoneal dialysis
.
Chirurgia (Bucur)
113
,
611
624
18
Yucel
,
S.K.
,
Arikan
,
H.
,
Tugtepe
,
H.
,
Cakalagaoglu
,
F.
,
Tuglular
,
S.
,
Akoglu
,
E.
et al (
2014
)
Cysteinyl 1 receptor antagonist montelukast, does not prevent peritoneal membrane damage in experimental chronic peritoneal dialysis model in rats
.
Kidney Blood Press. Res.
39
,
648
657
19
Li
,
Z.
,
Yan
,
H.
,
Yuan
,
J.
,
Cao
,
L.
,
Lin
,
A.
,
Dai
,
H.
et al (
2018
)
Pharmacological inhibition of heparin-binding EGF-like growth factor promotes peritoneal angiogenesis in a peritoneal dialysis rat model
.
Clin. Exp. Nephrol.
22
,
257
265
20
Fabbrini
,
P.
,
Schilte
,
M.N.
,
Zareie
,
M.
,
ter Wee
,
P.M.
,
Keuning
,
E.D.
,
Beelen
,
R.H.
et al (
2009
)
Celecoxib treatment reduces peritoneal fibrosis and angiogenesis and prevents ultrafiltration failure in experimental peritoneal dialysis
.
Nephrol. Dial. Transplant.
24
,
3669
3676
21
Fischbach
,
M.
,
Zaloszyc
,
A.
,
Schaefer
,
B.
and
Schmitt
,
C.P.
(
2017
)
Should sodium removal in peritoneal dialysis be estimated from the ultrafiltration volume?
Pediatr. Nephrol.
32
,
419
424
22
Lu
,
J.R.
,
Han
,
H.Y.
,
Hu
,
J.
,
Zhang
,
C.F.
,
Chen
,
J.
,
Chen
,
X.F.
et al (
2018
)
Mechanism research of Bu-Shen-Huo-Xue formula against renal fibrosis in rats with 5/6 nephrectomy via E-cadherin, alpha-SMA, and TGF-beta1
.
Clin. Nephrol.
90
,
53
58
23
Kong
,
P.
,
Christia
,
P.
,
Saxena
,
A.
,
Su
,
Y.
and
Frangogiannis
,
N.G.
(
2013
)
Lack of specificity of fibroblast-specific protein 1 in cardiac remodeling and fibrosis
.
Am. J. Physiol. Heart Circ. Physiol.
305
,
H1363
H1372
24
Fan
,
Y.P.
,
Hsia
,
C.C.
,
Tseng
,
K.W.
,
Liao
,
C.K.
,
Fu
,
T.W.
,
Ko
,
T.L.
et al (
2016
)
The therapeutic potential of human umbilical mesenchymal stem cells from wharton's jelly in the treatment of Rat peritoneal dialysis-induced fibrosis
.
Stem Cells Transl. Med.
5
,
235
247
25
Guo
,
Y.
,
Sun
,
L.
,
Xiao
,
L.
,
Gou
,
R.
,
Fang
,
Y.
,
Liang
,
Y.
et al (
2017
)
Aberrant Wnt/Beta-Catenin pathway activation in dialysate-Induced peritoneal fibrosis
.
Front. Pharmacol.
8
,
774
26
Yoon
,
J.H.
,
Abdelmohsen
,
K.
and
Gorospe
,
M.
(
2014
)
Functional interactions among microRNAs and long noncoding RNAs
.
Semin Cell Dev. Biol.
34
,
9
14
27
Li
,
X.
,
Yu
,
T.
,
Shan
,
H.
,
Jiang
,
H.
,
Sun
,
J.
,
Zhao
,
X.
et al (
2018
)
lncRNA PFAL promotes lung fibrosis through CTGF by competitively binding miR-18a
.
FASEB J.
32
,
5285
5297
28
Wei
,
X.
,
Bao
,
Y.
,
Zhan
,
X.
,
Zhang
,
L.
,
Hao
,
G.
,
Zhou
,
J.
et al (
2019
)
MiR-200a ameliorates peritoneal fibrosis and functional deterioration in a rat model of peritoneal dialysis
.
Int. Urol. Nephrol.
51
,
889
896
29
Shang
,
J.
,
He
,
Q.
,
Chen
,
Y.
,
Yu
,
D.
,
Sun
,
L.
,
Cheng
,
G.
et al (
2019
)
miR-15a-5p suppresses inflammation and fibrosis of peritoneal mesothelial cells induced by peritoneal dialysis via targeting VEGFA
.
J. Cell Physiol.
234
,
9746
9755
30
Xiao
,
L.
,
Zhou
,
X.
,
Liu
,
F.
,
Hu
,
C.
,
Zhu
,
X.
,
Luo
,
Y.
et al (
2015
)
MicroRNA-129-5p modulates epithelial-to-mesenchymal transition by targeting SIP1 and SOX4 during peritoneal dialysis
.
Lab. Invest.
95
,
817
832
31
Wang
,
Y.
,
Zhang
,
R.
,
Zhang
,
J.
and
Liu
,
F.
(
2018
)
MicroRNA-326-3p ameliorates high glucose and ox-LDL-IC- induced fibrotic injury in renal mesangial cells by targeting FcgammaRIII
.
Nephrology (Carlton)
23
,
1031
1038
32
Ning
,
J.
,
Zhang
,
H.
and
Yang
,
H.
(
2018
)
MicroRNA326 inhibits endometrial fibrosis by regulating TGFbeta1/Smad3 pathway in intrauterine adhesions
.
Mol. Med. Rep.
18
,
2286
2292
33
Baarsma
,
H.A.
,
Spanjer
,
A.I.
,
Haitsma
,
G.
,
Engelbertink
,
L.H.
,
Meurs
,
H.
,
Jonker
,
M.R.
et al (
2011
)
Activation of WNT/beta-catenin signaling in pulmonary fibroblasts by TGF-beta(1) is increased in chronic obstructive pulmonary disease
.
PLoS One
6
,
e25450