eIF3a is a putative subunit of the eukaryotic translation initiation factor 3 complex. Accumulating evidence suggests that eIF3a may have a translational regulatory function by suppressing translation of a subset of mRNAs while accelerating that of other mRNAs. Albeit the suppression of mRNA translation may derive from eIF3a binding to the 5′-UTRs of target mRNAs, how eIF3a may accelerate mRNA translation remains unknown. In this study, we show that eIF3a up-regulates translation of Chk1 but not Chk2 mRNA by interacting with HuR, which binds directly to the 3′-UTR of Chk1 mRNA. The interaction between eIF3a and HuR occurs at the 10-amino-acid repeat domain of eIF3a and the RNA recognition motif domain of HuR. This interaction may effectively circularize Chk1 mRNA to form an end-to-end complex that has recently been suggested to accelerate mRNA translation. Together with previous findings, we conclude that eIF3a may regulate mRNA translation by directly binding to the 5′-UTR to suppress or by interacting with RNA-binding proteins at 3′-UTRs to accelerate mRNA translation.

Introduction

Eukaryotic translation initiation factor (eIF) 3 is the most complex eIF consisting of 13 putative subunits known as eIF3a through eIF3m [1–4]. It has been reported that different fractions of the purified eIF3 from embryonic chicken red muscle supported the translation of specific mRNAs in vitro [4]. It has also been reported that the existence of two types of eIF3 sub-complexes, eIF3e and eIF3m sub-complexes, in fission yeast and they were found to associate with different sets of mRNAs [5]. These findings suggest that eIF3 complexes of different compositions exist in cells and they may be responsible for regulating the translation of different subsets of mRNAs.

eIF3a is the largest putative subunit of eIF3 complex initially purified from rabbit reticulocyte lysate [6]. However, its functional importance in translational control and role in the eIF3 complex is still under investigation. The finding that eIF3a interacts with other subunits of eIF3 [7–9], eIF4B [10], and RNA [7,11,12] supports a role of eIF3a in the function of the eIF3 complex and in translation initiation. It has also been observed that eIF3 preparations relatively rich in eIF3a did not differ substantially in specific activity of stimulating formation of pre-initiation complexes from preparations that essentially lacked this protein [13], suggesting that eIF3a may not be essential for initiation of global protein synthesis. Cleavage of the eIF3a by 20S proteasome can differentially alter the translation rate of different mRNAs both in vitro and in vivo [14]. Our previous studies also showed that although a dramatic decrease in eIF3a expression only caused ∼25% drop in global protein synthesis in both H1299 and MCF7 cells, the malignant growth phenotype of these two cell lines were significantly reversed [15].

These findings suggest that eIF3a may have functions in regulating mRNA translation and cell growth. Indeed, eIF3a appears to regulate the synthesis of tyrosinated α-tubulin, ribonucleotide reductase M2, p27kip and DNA repairing proteins [15–18]. Interestingly, the regulation of eIF3a on the synthesis of these proteins is different. While eIF3a increases the synthesis of tyrosinated α-tubulin and ribonucleotide reductase M2, it reduces the synthesis of p27kip and DNA repairing proteins.

Previously, it has been observed that eIF3a expression oscillates with cell cycle and peaks in S-phase [19]. Down regulating eIF3a expression elongated cell doubling time and altered sensitivity of cells to environmental stresses that affect cell cycle, but did not change the cell cycle distribution. It has also been suggested that eIF3a may be essential for G1-S phase transition in yeast and it may be involved in growth control of yeast cells [20]. Therefore, we hypothesize that eIF3a may regulate the synthesis of proteins important for the transition of cells through cell cycle restriction points.

Checkpoint kinases (Chk's) are kinases that are involved in cell cycle control. Two checkpoint kinases, Chk1 and Chk2, have been identified. Chk1 is a central component of genome surveillance pathways and a key regulator of cell cycle and cell survival [21]. Chk1 is required for the initiation of DNA damage checkpoints and has been shown to play a role in normal (unperturbed) cell cycles. Chk1 impacts various stages of the cell cycle including S phase, G2/M transition and M phase [21]. Here we show that eIF3a positively regulates the translation of Chk1 mRNA via HuR (human antigen R) binding to its 3′-UTR. Hence, eIF3a regulation of cell cycle progression is possibly through regulating Chk1 synthesis.

Materials and methods

Materials

Antibodies against actin and GAPDH were from Sigma (ST. Louis, MO, U.S.A.) and Abcam (Cambridge, MA), respectively. HuR antibody, HuR siRNA and eIF3a siRNA were purchased from Santa Cruz Biotechnology (Santa Cruz, CA, U.S.A.). Chk1 and Chk2 antibodies were from Cell Signaling Technology (Beverly, MA, U.S.A.). Sp6 and T7 RNA polymerases, RNasin, RNase-free DNase, dual luciferase reporter assay kit and Streptavidin MagneSphere® Paramagnetic Particles were purchased from Promega (Madison, WI, U.S.A.). RNase T 1 and Biotin-11-CTP were from Roche Diagnostics (Indianapolis, IN, U.S.A.) and Magna RIP RNA-Binding Protein Immunoprecipitation Kit was from EMD Millipore (Billerica, MA). The enhanced chemiluminescence (ECL) system for Western blot analysis were from GE Healthcare (Piscataway, NJ, U.S.A.). Ni-NTA and Sepharose 4B beads were purchased from Qiagen (Germantown, MD, U.S.A.) and Amersham Biosciences (Piscataway, NJ, U.S.A.), respectively. Polyvinylidene difluoride (PVDF) membranes and concentrated protein assay dye reagents were from Bio-Rad (Hercules, CA, U.S.A.). All other reagents of molecular biology grade were obtained from Sigma or Fisher Scientific (Chicago, IL, U.S.A.).

Construct engineering

Luciferase reporter constructs were engineered by first releasing the luciferase-encoding region plus PolyA signal from pGL3 by digestion with Hind III and Bam HI and subcloning into pcDNA3 vector, resulting in pcLuc. The cDNAs encoding 5′-UTR, 3′-UTR and 3′-UTRM2 of Chk1 were amplified from RNAs extracted from H1299 cells using RT-PCR and primers listed in Table 1. The cDNA encoding 3′-UTRM3 was generated using a transformer site-directed mutagenesis kit (BD Biosciences, Clontech) with primer CH3UM3 and selection primer shown in Table 1 as instructed by the manufacturer. The 3′-UTRM1 construct was generated by digesting the 3′-UTR cDNA of Chk1 with Xba I and Eco RI and sub-cloning into pcLuc. All PCR products were first cloned into pGEM-T-easy vector and subcloned into pcLuc vector for reporter assay.

Table 1
Names and sequences of primers for RT-PCR and construct engineering
NameSequence
HuRF CCAGATCTATGTCTAATGGTTATGAAGACCAC 
HuRR CCCTCGAGTTATTTGTGGGACTTGTTTTTGAAGGA 
HuRM1 CCTCTGAGTTAGCACCAGCCGGAGGAGGCGTTTCC 
HuRM2 CCTCTGAGTTACTGGTTGGGGTTGGCTGCAAACTT 
HuRM3 CCTCTGAGTTAGATCACCTCTGAGCTCGGGCGAGC 
Chk5UF GGAAGCTTCTGGTTATCCTGACTTCAAGCTCC 
Chk5UR GGCCATGGGACTCCACCGAGCACCTCGGCGGA 
Chk3UF ATTCTAGATCGGACCATCGGCTCTGGGGAATC 
Chk3UR GGGGATCCTCACAAGAATTATGTCTTTATTGG 
Chk3UM2 GGGGATCCGGAAGATGTTTGGATAAACAGGG 
Chk3UM3 ACAAATAGGTTTGTAGAAGGGCTATCGTAGCAAACAAGCCGTATGTTTATTATGG 
Chk1RTF TGAGAATCCATCAGCAAGAATTACC 
Chk1RTR ATCCACTGGGAGACTCTGACACA 
eIF3aRTF TGATGAGGACAGAGGACCAAGAC 
eIF3aRTR TCAGCATTACGCCAGGATGA 
ChkRIPF CTGTCCTGCAAACTGCAAAT 
ChkRIPR CTGTCCTGCAAACTGCAAAT 
NameSequence
HuRF CCAGATCTATGTCTAATGGTTATGAAGACCAC 
HuRR CCCTCGAGTTATTTGTGGGACTTGTTTTTGAAGGA 
HuRM1 CCTCTGAGTTAGCACCAGCCGGAGGAGGCGTTTCC 
HuRM2 CCTCTGAGTTACTGGTTGGGGTTGGCTGCAAACTT 
HuRM3 CCTCTGAGTTAGATCACCTCTGAGCTCGGGCGAGC 
Chk5UF GGAAGCTTCTGGTTATCCTGACTTCAAGCTCC 
Chk5UR GGCCATGGGACTCCACCGAGCACCTCGGCGGA 
Chk3UF ATTCTAGATCGGACCATCGGCTCTGGGGAATC 
Chk3UR GGGGATCCTCACAAGAATTATGTCTTTATTGG 
Chk3UM2 GGGGATCCGGAAGATGTTTGGATAAACAGGG 
Chk3UM3 ACAAATAGGTTTGTAGAAGGGCTATCGTAGCAAACAAGCCGTATGTTTATTATGG 
Chk1RTF TGAGAATCCATCAGCAAGAATTACC 
Chk1RTR ATCCACTGGGAGACTCTGACACA 
eIF3aRTF TGATGAGGACAGAGGACCAAGAC 
eIF3aRTR TCAGCATTACGCCAGGATGA 
ChkRIPF CTGTCCTGCAAACTGCAAAT 
ChkRIPR CTGTCCTGCAAACTGCAAAT 

To engineer Flag-tagged expression constructs, the cDNAs encoding full-length HuR and its mutants were amplified by PCR using primers listed in Table 1 and cloned into pGEM-T-easy vector followed by releasing from pGEM-T-easy by Bgl II and Xho I digestion and subcloning into pCMV-Tag2B vector.

To generate GST-fusion protein-expressing constructs, the sequences encoding the PCI, SPT, and RP domains of eIF3a were amplified using PCR and primers in Table 1 and cloned into pGEM-T-easy vector. The cDNAs encoding these domains were then released from pGEM-T-easy by Eco RI and Xho I digestion and subcloned into the pGEX-4T-1 vector.

To generate His-tagged wild-type and mutant HuR constructs, total RNAs were extracted from H1299 cells and used as a template to amplify the sequences encoding full-length HuR and its mutants using RT-PCR and primers listed in Table 1, followed by cloning into pGEM-T-easy vector. These cDNA fragments were then released from pGEM-T-easy by Bgl II and Xho I digestion and subcloned into pET28a linearized by Bam HI and Xho I. All above constructs were authenticated using double-strand DNA sequencing.

RNA extraction and real-time RT-PCR

RNA extraction and real-time RT-PCR analysis was performed as described previously [22]. Briefly, total RNAs were extracted using RNeasy Mini Kit (Qiagen) and 1 µg of total RNAs were reverse transcribed to synthesize cDNA using iScriptTM cDNA Synthesis Kit (Bio-Rad). PCRs were carried out in ABI Prism@7000 Sequence Detection System (Applied Biosystems) using primers listed in Table 1 and SYBR Green diction according to manufacturer's instructions. The threshold cycle (Ct) was defined as the PCR cycle number at which the reporter fluorescence crosses the threshold reflecting a statistically significant point above the calculated baseline. The Ct of the target product was determined and normalized against that of GAPDH internal control. The relative RNA level = 2ΔCt.

Sample preparation, Western blot, and co-immunoprecipitation

Sample preparation and Western blot analyses were performed as previously described [16]. Briefly, cells were lysed in TNN-SDS buffer (50 mM Tris–HCl, pH 7.5, 150 mM NaCl, 0.5% Nonidet P-40, 50 mM NaF, 1 mM sodium orthovanadate, 1 mM DTT, 0.1% SDS and 2 mM phenylmethylsulfonyl fluoride) at 4°C for 30 min followed by centrifugation at 12,000g for 10 min. The supernatant was collected and protein concentration was measured using Bradford method [22].

Cell lysates were separated by SDS–PAGE, transferred to PVDF membranes and probed with various primary antibodies. The immunoreactivity was detected using secondary antibody-conjugated horseradish peroxidase. Signals were captured using enhanced chemiluminescence and x-ray film.

Immunoprecipitation was performed as previously described [16,23,24]. Briefly, cell lysates (400 µg) were first precleared by incubation with 1 µg of normal IgG at 4°C for 1 h, mixed with 50 µl of protein G agarose beads (50% slurry) and incubated at 4°C for 2 h followed by centrifugation at 500g for 5 min. The cleared supernatants were incubated with 5 µg of anti-FLAG or anti-HuR antibodies at 4°C for 4 h, mixed with 50 µl of 50% protein G-agarose slurry. After overnight incubation at 4°C, the reaction was centrifuged to collect precipitates which were then washed five times with lysis buffer before being subjected to separation by SDS–PAGE and Western blot analysis.

Pulse and pulse-chase labeling of cells

Pulse and pulse-chase labeling were performed as previously described [16]. Briefly, H1299 cells were incubated for 2 hrs in the methionine-free medium supplemented with 7.5 µCi/ml [35S]methionine followed by washing with PBS and lysate preparation for immunoprecipitation of Chk1. For the chase experiment, the pulse-labeled cells were washed twice with PBS and once with DMEM medium and incubated in DMEM medium supplemented with 100 µg/ml cold methionine. At different time points, the cells were harvested for cell lysate preparation and immunoprecipitation.

RNA pulldown assay

Biotin-labeled RNA probe was prepared using in vitro transcription as previously described [12]. Briefly, DNA templates were linearized using suitable restriction enzymes and used as a template for in vitro transcription using T7 or Sp6 RNA polymerase in the presence of Biotin-11-CTP. The biotin-labeled in vitro transcripts were purified using the Qiagen RNeasy mini kit and used as probes for pulldown assay by incubating with H1299 cell extracts at room temperature for 1 h. The RNA–protein complexes were then isolated using Streptavidin MagneSphere® Paramagnetic Particles and washed three times with wash buffer (10 mM N-2-hydroxyethylpiperazine- N′-2-ethanesulfonic acid, 20 mM KCl, 1 mM MgCl2, 1 mM dithiothreitol and 1 mM PMSF). The pulldown materials were then separated by SDS–PAGE and analyzed using Western blot probed by eIF3a or HuR antibodies.

In vitro pulldown assay

His-tagged proteins were expressed in BL21 (DE3) host and purified with Ni-NTA slurry while GST fusion proteins were expressed in DH5α host cells and purified using glutathione-Sepharose 4B according to manufacturer's instructions. Cell lysates were digested with RNase A to remove any RNAs that are potentially bound to eIF3a or HuR before purification.

In vitro pulldown assay was performed as previously described [9], Briefly, purified His-tagged proteins was mixed with GST-fusion protein-immobilized beads in binding buffer (20 mM Hepes-KOH, pH 7.9, 200 mM KCl, 0.1% Nonidet P-40, 5 mM MgCl2, 1% BSA, 10% glycerol) and incubated at room temperature for 1.5 h. After extensive washes with the same buffer, the pulldown materials were separated by SDS–PAGE, transferred to PVDF membranes, subjected to Western blot analysis using His-tagged antibody.

RNA gel shift assay

About 107 cells were lysed in 10 mM Hepes-KOH, pH 7.9, 10 mM KCl, 1.5 mM MgCl2, 0.5 mM PMSF, 1 mM DTT by incubation on ice for 15 min and addition of NP-40 to a final concentration of 0.7%, followed by centrifugation at 1500g for 5 min to remove cell debris. The supernatant was collected and subjected to further centrifugation at 16,000g for 10 min. The supernatant was collected and stored in aliquots at −80°C.

32P-UTP-labelled RNA probe was generated using in vitro transcription method as described above. About 105 CPM RNA probe were incubated with cell lysate at room temperature in binding buffer (15 mM Hepes-KOH, pH 7.9, 50 mM KCl, 10% glycerol, 0.2 mM DTT, 5 mM MgCl2, 200 µg/ml tRNA) for 30 min, followed by digestion with 100 Units of RNase T1 at 30°C for 15 min. For supershift assay, cell lysates were pre-incubated with HuR antibody for 30 min before incubation with RNA probes. The reaction mixture was then separated on a 5% native polyacrylamide gel and signals were captured by autoradiography using an X-ray film.

RNA-binding protein immunoprecipitation

RNA-binding protein immunoprecipitation was performed using Magna RIP RNA-Binding Protein Immunoprecipitation Kit (Millipore) according to the manufacturer's instructions. Briefly, cells were lysed in lysis buffer containing protease inhibitors, RNase inhibitors, and by freezing at −80°C overnight. The cell lysate was cleared by centrifugation at 12,000g for 10 min.

The magnetic beads-coupled with protein G was pre-incubated with HuR antibody for 30 min at room temperature followed by washing with RIP washing buffer for two times and mixing with cell lysate. Following incubation at 4°C for 6 h with rotation, the beads was washed with RIP wash buffer and the RNAs in the precipitate were extracted and used as a template for RT-PCR analysis.

Results

eIF3a regulates Chk1 protein level

Hydroxyurea (HU), a ribonucleotide reductase inhibitor that causes DNA replication arrest, has been reported to increase the phosphorylation but reduce protein level of Chk1 [25]. We previously also found that eIF3a expression sensitizes cellular response to HU [19]. To investigate the possible relationship between eIF3a and Chk1, we analyzed the expression of eIF3a and Chk1 in H1299 cells following HU treatment. We also tested Chk2 in parallel. As shown in Figure 1A,B, treatment with 0.4 mM HU for 48 h significantly decreased the total protein level of Chk1 and eIF3a but had little effect on Chk2 protein level. The time-course study showed that HU-induced eIF3a reduction precedes the reduction in Chk1 (Figure 1C).

eIF3a regulates Chk1 expression.

Figure 1.
eIF3a regulates Chk1 expression.

(A and B) effect of hydroxyurea treatment on eIF3a, Chk1, and Chk2 expression. H1299 cells were treated with or without 0.4 mM HU for 48 h followed by lysate preparation for Western blot analysis of eIF3a, Chk1, and Chk2. Panel B shows quantification of eIF3a, Chk1, and Chk2 of panel A from three independent experiments (*** P < 0.001, two-tailed t-test). (C) Time-dependent effect of hydroxyurea treatment on eIF3a, Chk1, and Chk2 expression. H1299 cells were treated with 0.4 mM HU for different times followed by Western blot analysis as described for panel A. (D and E) effect of eIF3a knockdown on Chk1 and Chk2 expression. H1299 cells were transiently transfected with eIF3a or scrambled control siRNA followed by Western blot analysis of eIF3a, Chk1, and Chk2. Panel E shows quantification of eIF3a, Chk1, and Chk2 of panel D from three independent experiments (*** P < 0.001, two-tailed t-test). (F and G) effect of eIF3a overexpression on Chk1 and Chk2 expression. RIE and NIH3T3 stable clones with eIF3a overexpression as determined using Western blot analysis. (HJ) effect of Chk1 or Chk2 overexpression (H), Chk1 (I) or Chk2 (J) knockdown on eIF3a expression. H1299 cells were transiently transfected with cDNAs overexpressing Flag-Chk1 and GFP-Chk2 or vector control (H), Chk1 siRNA (I), Chk2 siRNA (J) or scrambled control siRNA followed by Western blot analysis of eIF3a, Chk1, or Chk2. GAPDH or actin was used as loading controls.

Figure 1.
eIF3a regulates Chk1 expression.

(A and B) effect of hydroxyurea treatment on eIF3a, Chk1, and Chk2 expression. H1299 cells were treated with or without 0.4 mM HU for 48 h followed by lysate preparation for Western blot analysis of eIF3a, Chk1, and Chk2. Panel B shows quantification of eIF3a, Chk1, and Chk2 of panel A from three independent experiments (*** P < 0.001, two-tailed t-test). (C) Time-dependent effect of hydroxyurea treatment on eIF3a, Chk1, and Chk2 expression. H1299 cells were treated with 0.4 mM HU for different times followed by Western blot analysis as described for panel A. (D and E) effect of eIF3a knockdown on Chk1 and Chk2 expression. H1299 cells were transiently transfected with eIF3a or scrambled control siRNA followed by Western blot analysis of eIF3a, Chk1, and Chk2. Panel E shows quantification of eIF3a, Chk1, and Chk2 of panel D from three independent experiments (*** P < 0.001, two-tailed t-test). (F and G) effect of eIF3a overexpression on Chk1 and Chk2 expression. RIE and NIH3T3 stable clones with eIF3a overexpression as determined using Western blot analysis. (HJ) effect of Chk1 or Chk2 overexpression (H), Chk1 (I) or Chk2 (J) knockdown on eIF3a expression. H1299 cells were transiently transfected with cDNAs overexpressing Flag-Chk1 and GFP-Chk2 or vector control (H), Chk1 siRNA (I), Chk2 siRNA (J) or scrambled control siRNA followed by Western blot analysis of eIF3a, Chk1, or Chk2. GAPDH or actin was used as loading controls.

To further investigate the possible relationship between eIF3a and Chk1, we first tested if knocking down eIF3a affect Chk1 expression. We again tested Chk2 expression in parallel. As shown in Figure 1D,E, eIF3a knockdown significantly reduced Chk1 expression but had little effect on Chk2. Consistently, overexpressing eIF3a in RIE and NIH3T3 cells increased Chk1 expression (Figure 1F,G). On the other hand, overexpressing Chk1 or Chk2 and knocking down Chk1 or Chk2 had no effect on eIF3a expression (Figure 1H–J). These findings suggest that eIF3a may regulate the expression of Chk1 but not Chk2 and that Chk1 and Chk2 unlikely regulate the expression of eIF3a.

eIF3a regulates the synthesis of Chk1 protein

To determine the mechanism of eIF3a regulation of Chk1 expression, we first determined the mRNA level of Chk1 using real-time RT-PCR in H1299 cells following eIF3a knockdown. As shown in Figure 2A, compared with the dramatic reduction in eIF3a mRNA, eIF3a knockdown had no effect on the mRNA level of Chk1. We next performed pulse labeling and pulse-chase experiments to determine if eIF3a regulates the synthesis or degradation of Chk1. As shown in Figure 2B, eIF3a knockdown caused drastic reduction in newly synthesized Chk1. On the hand, eIF3a knockdown had no effect on Chk1 degradation (Figure 2C,D). Thus, we conclude that eIF3a likely regulates Chk1 expression by regulating its protein synthesis or translation of its mRNA.

eIF3a regulates Chk1 protein synthesis.

Figure 2.
eIF3a regulates Chk1 protein synthesis.

(A) Effect of eIF3a knockdown on Chk1 mRNA level. H1299 cells were transiently transfected with eIF3a or scrambled control siRNAs followed by real-time RT-PCR analysis of eIF3a and Chk1. (B) Effect of eIF3a knockdown on Chk1 protein synthesis. H1299 cells were transiently transfected with eIF3a or scrambled control siRNAs followed by pulse labeling with [35S]methionine and immunoprecipitation of Chk1. The precipitate was separated by SDS–PAGE for autoradiography. (C and D) Effect of eIF3a knockdown on Chk1 protein half-life. Following eIF3a knockdown and pulse labeling with [35S]methionine, H1299 cells were chased for different times with cold methionine before immunoprecipitation of Chk1 for SDS–PAGE separation and autoradiography. It is noteworthy that the overall level of Chk1 is lower in eIF3a knockdown cells and the Chk1 levels were normalized to the 0-time point for the time-course plot in panel D.

Figure 2.
eIF3a regulates Chk1 protein synthesis.

(A) Effect of eIF3a knockdown on Chk1 mRNA level. H1299 cells were transiently transfected with eIF3a or scrambled control siRNAs followed by real-time RT-PCR analysis of eIF3a and Chk1. (B) Effect of eIF3a knockdown on Chk1 protein synthesis. H1299 cells were transiently transfected with eIF3a or scrambled control siRNAs followed by pulse labeling with [35S]methionine and immunoprecipitation of Chk1. The precipitate was separated by SDS–PAGE for autoradiography. (C and D) Effect of eIF3a knockdown on Chk1 protein half-life. Following eIF3a knockdown and pulse labeling with [35S]methionine, H1299 cells were chased for different times with cold methionine before immunoprecipitation of Chk1 for SDS–PAGE separation and autoradiography. It is noteworthy that the overall level of Chk1 is lower in eIF3a knockdown cells and the Chk1 levels were normalized to the 0-time point for the time-course plot in panel D.

Localization of the regulatory cis-elements in Chk1 mRNA

It has previously been suggested that cis-elements in regulating mRNA translation may be localized in the 5′- and/or 3′-untranslated regions (UTRs) [26–28]. To identify the potential regulatory cis-element in Chk1 mRNA, we generated chimera luciferase reporter constructs with the reporter open reading frame flanked by the 5′- and 3′-UTRs of Chk1 mRNA (Figure 3A) and transiently transfected these constructs into cells with eIF3a overexpression or knockdown followed by determination of eIF3a effects on reporter expression. As shown in Figure 3C, eIF3a overexpression significantly up-regulated reporter expression in the presence of 3′-UTR alone or both 5′- and 3′-UTRs. Consistently, eIF3a knockdown significantly reduced reporter expression in the presence of 3′-UTR alone or both 5′- and 3′-UTRs (Figure 3D). Alteration of eIF3a expression had no effect on the reporter expression in the presence of the 5′-UTR alone (Figure 3C,D). These findings suggest that the regulatory cis-elements that are responsive to eIF3a may reside in the 3′-UTR of Chk1 mRNA.

Identification of cis-elements in the UTRs of Chk1 mRNA in regulating Chk1 synthesis by eIF3a.

Figure 3.
Identification of cis-elements in the UTRs of Chk1 mRNA in regulating Chk1 synthesis by eIF3a.

(A and B) Schematic structure of reporter constructs containing 5′ and 3′-UTRs of Chk1 mRNA. The open circles indicate HuR-binding sites in the 3′-UTR. (C and D) Effects of eIF3a overexpression (C) or knockdown (D) on expression of reporter mRNAs with different UTRs. Stable RIE clone with eIF3a overexpression (C) and H1299 cells transiently transfected with eIF3a siRNA (D) and their respective control cells were transfected with reporter constructs shown in panel A followed by determination of reporter activity. The reporter activity was first normalized to the control vector- or scrambled siRNA-transfected cells for each construct and the results were then normalized to that of the empty reporter vector control. (E) Effect of eIF3a overexpression on expression of reporter mRNAs containing wild-type and mutant 3′-UTRs. Stable RIE cells with eIF3a overexpression were transfected with reporter constructs shown in panel B followed by reporter assay and data analysis as described for panel C. The insets in panel C shows Western blot analysis of the cells with eIF3a overexpression for both panels C and E and that in panel D shows Western blot analysis of cells with eIF3a knockdown.

Figure 3.
Identification of cis-elements in the UTRs of Chk1 mRNA in regulating Chk1 synthesis by eIF3a.

(A and B) Schematic structure of reporter constructs containing 5′ and 3′-UTRs of Chk1 mRNA. The open circles indicate HuR-binding sites in the 3′-UTR. (C and D) Effects of eIF3a overexpression (C) or knockdown (D) on expression of reporter mRNAs with different UTRs. Stable RIE clone with eIF3a overexpression (C) and H1299 cells transiently transfected with eIF3a siRNA (D) and their respective control cells were transfected with reporter constructs shown in panel A followed by determination of reporter activity. The reporter activity was first normalized to the control vector- or scrambled siRNA-transfected cells for each construct and the results were then normalized to that of the empty reporter vector control. (E) Effect of eIF3a overexpression on expression of reporter mRNAs containing wild-type and mutant 3′-UTRs. Stable RIE cells with eIF3a overexpression were transfected with reporter constructs shown in panel B followed by reporter assay and data analysis as described for panel C. The insets in panel C shows Western blot analysis of the cells with eIF3a overexpression for both panels C and E and that in panel D shows Western blot analysis of cells with eIF3a knockdown.

We next analyzed the 3′-UTR sequence of Chk1 mRNA using RBPmap, a web server for mapping binding sites of RNA-binding proteins [29] and found three binding sites for HuR, a RNA binding protein. To test the possible involvement of these putative cis-elements on eIF3a regulation of the 3′-UTR activity, we systematically mutated these sites by deletion or mutation in the reporter constructs (Figure 3B). The wild-type and mutant constructs were then transiently transfected into RIE cells with stable eIF3a overexpression followed by the determination of luciferase activity. As shown in Figure 3E, complete removal of all three binding sites by deletion or combining deletion with mutation abolished eIF3a-stimulated reporter expression. These findings suggest that eIF3a may regulate the translation of Chk1 mRNA via HuR-binding sites in the 3′-UTR.

HuR binding to the 3′UTR of Chk1 mRNA

To determine the possible involvement of HuR in eIF3a regulation of Chk1 mRNA translation, we first performed RNA mobility shift assay to determine if HuR binds to the 3′-UTR of Chk1. As shown in Figure 4A, the mobility of the 3′-UTR probe shifted by a binding protein that was identified as HuR using HuR antibody in a supershift assay. This binding was abolished when cold Chk1 3′-UTR RNA competitor was added. However, the non-specific RNA competitor, the 5′-UTR of RPA mRNA without HuR binding sequence and the 5′-UTR of Chk1, had no effect on HuR binding to the 3′-UTR probe.

Specific binding of HuR to the 3′-UTR of Chk1 mRNA.

Figure 4.
Specific binding of HuR to the 3′-UTR of Chk1 mRNA.

(A and B) RNA gel-shift assay. The [32P]-labeled 3′-UTR probes were in vitro transcribed from wild-type 3′M2 and 3′M3 mutant constructs of Chk1 shown in Figure 3B. These probes were incubated with H1299 lysate preincubated without or with HuR antibody before separation on non-denaturing gel and autoradiography. (C and D) RNA-immunoprecipitation (RIP) assay. H1299 cell lysate was incubated with HuR antibody-coupled with Protein G-magnetic beads followed by isolation of HuR-bound RNAs for RT-PCR analyzed using agarose gel (C) or real-time method (D).

Figure 4.
Specific binding of HuR to the 3′-UTR of Chk1 mRNA.

(A and B) RNA gel-shift assay. The [32P]-labeled 3′-UTR probes were in vitro transcribed from wild-type 3′M2 and 3′M3 mutant constructs of Chk1 shown in Figure 3B. These probes were incubated with H1299 lysate preincubated without or with HuR antibody before separation on non-denaturing gel and autoradiography. (C and D) RNA-immunoprecipitation (RIP) assay. H1299 cell lysate was incubated with HuR antibody-coupled with Protein G-magnetic beads followed by isolation of HuR-bound RNAs for RT-PCR analyzed using agarose gel (C) or real-time method (D).

To ensure that the binding occurs at the HuR-binding site in the 3′-UTR of Chk1, we performed RNA mobility shift assay using the 3′-UTR containing mutations of the HuR-binding site in the 3′-UTR of Chk1 (see Figure 3B). As shown in Figure 4B, only the wild type 3′-UTR was able to bind to HuR.

To further validate HuR binding to the 3′-UTR of Chk1, we performed RNA immunoprecipitation (RIP) followed by quantification using real-time RT-PCR. Figure 4C,D show that HuR antibody was able to pull down the 3′-UTR of Chk1 likely via HuR. Thus, the putative HuR-binding sites in the 3′-UTR of Chk1 mRNA are active sites for HuR to bind.

HuR regulates Chk1 expression

The binding of HuR to the 3′-UTR of Chk1 mRNA suggests that it may regulate HuR expression. To test this hypothesis, we determined the effect of HuR knockdown on Chk1 expression and its relationship with eIF3a. As shown in Figure 5A,B, eIF3a and HuR knockdowns both decreased Chk1 expression. However, eIF3a knockdown did not significantly affect HuR expression and vice versa (Figure 5C). Thus, it is unlikely that eIF3a and HuR regulate Chk1 expression via regulating each other's expression. We next performed a pulldown assay using the 3′-UTR of Chk1 mRNA as a bait. As expected, the 3′-UTR of Chk1 mRNA successfully pulled down HuR protein (Figure 5D). Interestingly, it also pulled down eIF3a. The mutant 3′-UTR without the HuR binding sites were unable to pulldown either HuR or eIF3a while the mutant with a single HuR binding site pulled down significantly less eIF3a and HuR compared with the wild type 3′-UTR. These findings suggest that eIF3a may also bind to the HuR-binding sites in the 3′-UTR of Chk1 mRNA possibly by interacting with HuR.

HuR regulation of Chk1 expression.

Figure 5.
HuR regulation of Chk1 expression.

(A and B) Effect of eIF3a (A) or HuR (B) knockdown on Chk1 expression. H1299 cells were transiently transfected with eIF3a, HuR, or scrambled control siRNAs followed by Western blot analysis of eIF3a, HuR, and Chk1 proteins. (C) Relationship between HuR and eIF3a expression. H1299 cells were transiently transfected with eIF3a, HuR, or scrambled control siRNAs followed by Western blot analysis of eIF3a and HuR. Actin was used as a loading control. (D) RNA pulldown assay. Biotinylated wild-type and mutant 3′-UTR probes of Chk1 were first incubated with H1299 cell lysate. The probe-bound proteins were isolated using Streptavidin MagneSphere® Paramagnetic Particles and analyzed by Western blot analysis using antibodies against eIF3a and HuR.

Figure 5.
HuR regulation of Chk1 expression.

(A and B) Effect of eIF3a (A) or HuR (B) knockdown on Chk1 expression. H1299 cells were transiently transfected with eIF3a, HuR, or scrambled control siRNAs followed by Western blot analysis of eIF3a, HuR, and Chk1 proteins. (C) Relationship between HuR and eIF3a expression. H1299 cells were transiently transfected with eIF3a, HuR, or scrambled control siRNAs followed by Western blot analysis of eIF3a and HuR. Actin was used as a loading control. (D) RNA pulldown assay. Biotinylated wild-type and mutant 3′-UTR probes of Chk1 were first incubated with H1299 cell lysate. The probe-bound proteins were isolated using Streptavidin MagneSphere® Paramagnetic Particles and analyzed by Western blot analysis using antibodies against eIF3a and HuR.

eIF3a interaction with HuR

To determine if eIF3a may interact with HuR, we performed co-immunoprecipitation assay using HuR antibody and lysates from H1299 and CaCo-2 cells. As shown in Figure 6A, IP with HuR antibody pulled down endogenous eIF3a in both H1299 cells and CaCo-2 cells, suggesting that HuR interacts with eIF3a. To further determine if this interaction is direct and to map the eIF3a binding site in HuR, we first generated a set of truncation mutant HuR with Flag tag (Figure 6B), which were transiently transfected into H1299 cells followed by immunoprecipitation using Flag antibody. Figure 6C shows that the wild-type and mutant HuR's are equally expressed and that the mutant with the third RRM (RNA recognition motif) deleted maintains minimum activity in binding to eIF3a. Further deletion to remove the hinge region completely abolished the binding activity of the HuR to eIF3a. Thus, the third RRM of HuR including its upstream hinge region likely contributes to HuR interaction with eIF3a.

eIF3a interaction with HuR via its10-AA repeat domain and the third RRM of HuR.

Figure 6.
eIF3a interaction with HuR via its10-AA repeat domain and the third RRM of HuR.

(A) Interaction between eIF3a and HuR. H1299 or CaCo-2 cell lysate was subjected to co-immunoprecipitation using HuR antibody and the precipitates were analyzed by Western blot for eIF3a and HuR. (B and D) schematic structure of Flag-tagged HuR constructs for expression (B) and GST-tagged domain constructs of eIF3a for production of recombinant proteins (D). (C) Interaction between eIF3a and different domains of HuR. H1299 cells were transiently transfected with different HuR constructs shown in panel B to express different Flag-tagged HuR proteins as determined using Western blot analysis Flag tag (top panel). The different Flag-tagged HuR proteins were immunoprecipitated using Flag antibody followed by Western blot analysis of eIF3a (bottom panel). (E) interaction between HuR and the different domains of eIF3a. Purified GST-tagged domains of eIF3a (see panel D) as baits were incubated with purified His-tagged wild type and mutant HuR proteins (targets) followed by pulldown assay using immobilized glutathione. The pulldown materials were subjected to Western blot analysis of His-tagged HuR proteins.

Figure 6.
eIF3a interaction with HuR via its10-AA repeat domain and the third RRM of HuR.

(A) Interaction between eIF3a and HuR. H1299 or CaCo-2 cell lysate was subjected to co-immunoprecipitation using HuR antibody and the precipitates were analyzed by Western blot for eIF3a and HuR. (B and D) schematic structure of Flag-tagged HuR constructs for expression (B) and GST-tagged domain constructs of eIF3a for production of recombinant proteins (D). (C) Interaction between eIF3a and different domains of HuR. H1299 cells were transiently transfected with different HuR constructs shown in panel B to express different Flag-tagged HuR proteins as determined using Western blot analysis Flag tag (top panel). The different Flag-tagged HuR proteins were immunoprecipitated using Flag antibody followed by Western blot analysis of eIF3a (bottom panel). (E) interaction between HuR and the different domains of eIF3a. Purified GST-tagged domains of eIF3a (see panel D) as baits were incubated with purified His-tagged wild type and mutant HuR proteins (targets) followed by pulldown assay using immobilized glutathione. The pulldown materials were subjected to Western blot analysis of His-tagged HuR proteins.

Next, we mapped the domain in eIF3a responsible for interaction with HuR. For this purpose, we took advantage of the GST fusion protein containing three different domains of eIF3a (Figure 6D), which were generated in our previous study [9], and used them as baits for pulldown assay of purified His-tagged HuR. As shown in Figure 6E, only the purified RP (10-amino acid repeat) domain of eIF3a was able to pull down the purified wild-type His-tagged HuR. These findings suggest that eIF3a likely interacts with HuR directly via its RP domain.

To validate above findings, we generated His-tagged HuR mutants with different deletions as shown in Figure 6B, which were used as target for pulldown assay using GST-tagged domains of eIF3a. Figure 6E shows that the mutant HuR with the deletion of the third RRM retains minimal activity to interact with the RP domain of eIF3a. Further deletion of the hinge domain completely abolished the binding activity of HuR to the RP domain of eIF3a. These findings are consistent with the above observations of co-immunoprecipitation and indicate that the direct interaction between HuR and eIF3a is likely via interaction between the third RRM of HuR and the RP domain of eIF3a.

Discussion

In this study, we show that eIF3a positively regulates the expression of Chk1 at the translational level via interaction with HuR that binds to the 3′-UTR of Chk1 mRNA. The interaction between eIF3a and HuR occurs at the RP domain of eIF3a and the third RRM of HuR. The finding of the positive regulation of Chk1 synthesis by eIF3a is consistent with our previous finding that eIF3a regulates cell cycle progression but not distribution [19] due to Chk1's function in regulating all cell cycle checkpoints [21].

eIF3a has three putative domains including PCI, spectrin and RP domains (33). While we have shown previously that the spectrin domain is the docking site for eIF3b, g and i subunits to form the a:b:i:g subcomplex [9], the exact function of the PCI domain, which exists in proteasome, COP9, and initiation factor 3, remains unknown. In this study, we showed that the RP domain of eIF3a is responsible for its interaction with HuR in translational regulation of Chk1. Because the HuR-binding site is in the 3′-UTR of Chk1 mRNA and eIF3a may bind to the 5′-UTRs together with other initiation factors, it is possible that eIF3a may play a crucial role in accelerating Chk1 synthesis via circularizing its mRNA by bringing the 5′- and 3′-ends together to form an end-to-end complex (Figure 7) as previously suggested for the PABP-eIF4G complex (see below). This possible mechanism of translational regulation may also occur with other mRNAs that has a HuR-binding sequence in the 3′-UTR. One example is p53, which has been shown to be translationally regulated by HuR binding to the 3′-UTR [30].

Schematic model of eIF3a regulation in Chk1 mRNA translation via binding to HuR to circularize Chk1 mRNA.

Figure 7.
Schematic model of eIF3a regulation in Chk1 mRNA translation via binding to HuR to circularize Chk1 mRNA.
Figure 7.
Schematic model of eIF3a regulation in Chk1 mRNA translation via binding to HuR to circularize Chk1 mRNA.

3′-UTR is a well-known cis-element that plays important roles in regulating mRNA stability, intracellular localization and translation [31–33]. Interaction of polyadenylation-element-binding protein (PABP) in the 3′-UTR with eIF4G [34,35] and eIF4B [36,37] in the 5′-UTR circularizes mRNAs, resulting in enhanced translation of the mRNA [38,39]. Most recently, the binding between eIF3h and a RNA-binding protein, METTL3, circularizes a subset of mRNAs and enhances their translations, which may contribute to oncogenesis [40]. Together with our findings, these observations suggest that different eIF3 subunits may interact with different RNA-binding proteins to circularize different mRNAs for enhanced translation. It remains to be determined, however, if eIF3a regulation of protein synthesis via HuR contributes to oncogenesis and drug sensitivity.

Previously, it has been shown that eIF3a regulates mRNA translation via binding to the internal ribosome entry site sequence in 5′-UTRs [12]. In this case, eIF3a binding suppresses the translation of the target mRNA and may contribute to cellular drug sensitivity. The translation of several additional mRNAs have also been shown to be suppressed by eIF3a although the mechanism of the eIF3a suppression of these mRNA translations is not yet known [16–18].

eIF3a interaction with HuR that binds to the 3′-UTR of target mRNAs to accelerate their translation may represent a new mechanism of eIF3a regulation of protein synthesis. Although we showed that all three putative HuR-binding sites in the 3′-UTR of Chk1 mRNA may contributes to eIF3a regulation, whether they have synergy and co-ordinate HuR interactions with eIF3a remains unresolved. Mutations of each binding site individually or in different combinations may be needed to delineate the specific role of each binding site. It also remains unknown if translation of all mRNAs containing a HuR-binding site in their 3′-UTRs are regulated by eIF3a and if and how eIF3a regulates translation of mRNAs containing HuR-binding site in their 5′-UTRs. Whether eIF3a potentially interacts with other RNA-binding proteins such as PABP to circularize mRNAs in accelerating general protein synthesis also remains to be addressed. We are currently working to answer these questions.

The role of HuR in regulating protein synthesis has been shown previously by stimulating mRNA stability and translational efficiency [41–44]. Recent evidence suggests that HuR regulation of mRNA stability may be via inhibiting the function of microRNAs [45–47]. However, it has also been shown that HuR interacts with the 3′-UTR of the p53 mRNA and increases p53 protein synthesis rate without affecting the mRNA level [30]. Our findings here show that HuR regulation of protein synthesis may be via its interaction with eIF3a to accelerate mRNA translation initiation. It is, however, noteworthy that the third RRM of HuR may be responsible for interaction with eIF3a. Thus, it remains unclear if the binding of eIF3a to the third RRM of HuR possibly inhibits HuR recognition of and binding to the 3′-UTR of target mRNAs such as Chk1 or p53. Although this possibility appears to be contradictory to the finding that HuR binding to the 3′-UTR increases translation of the mRNA, future studies will be needed to evaluate this possibility.

Competing Interests

The authors declare that there are no competing interests associated with the manuscript.

Funding

This work was supported in part by a grant R01 CA211904 (JTZ) from the National Cancer Institute/NIH.

Author Contributions

Z.D. and J.T.Z designed the experiments. Z.D. and J.L. conducted the experiments. Z.D. and J.T.Z. drafted the manuscript.

Abbreviations

     
  • ECL

    enhanced chemiluminescence

  •  
  • HU

    Hydroxyurea

  •  
  • PABP

    polyadenylation-element-binding protein

  •  
  • PVDF

    polyvinylidene difluoride

  •  
  • RIP

    RNA immunoprecipitation

  •  
  • RRM

    RNA recognition motif

  •  
  • RT

    reverse transcription

  •  
  • UTRs

    untranslated regions

References

References
1
Dong
,
Z.
and
Zhang
,
J.T.
(
2006
)
Initiation factor eIF3 and regulation of mRNA translation, cell growth, and cancer
.
Crit. Rev. Oncol. Hematol.
59
,
169
180
2
Yin
,
J.Y.
,
Dong
,
Z.
,
Liu
,
Z.Q.
and
Zhang
,
J.T.
(
2011
)
Translational control gone awry: a new mechanism of tumorigenesis and novel targets of cancer treatments
.
Biosci. Rep.
31
,
1
15
3
Gomes-Duarte
,
A.
,
Lacerda
,
R.
,
Menezes
,
J.
and
Romao
,
L.
(
2018
)
eIF3: a factor for human health and disease
.
RNA Biol.
15
,
26
34
4
Heywood
,
S.M.
,
Kennedy
,
D.S.
and
Bester
,
A.J.
(
1974
)
Separation of specific initiation factors involved in the translation of myosin and myoglobin messenger RNAs and the isolation of a new RNA involved in translation
.
Proc. Natl Acad. Sci. U.S.A.
71
,
2428
2431
5
Zhou
,
C.
,
Arslan
,
F.
,
Wee
,
S.
,
Krishnan
,
S.
,
Ivanov
,
A.R.
,
Oliva
,
A.
et al (
2005
)
PCI proteins eIF3e and eIF3m define distinct translation initiation factor 3 complexes
.
BMC Biol.
3
,
14
6
Benne
,
R.
and
Hershey
,
J.W.
(
1976
)
Purification and characterization of initiation factor IF-E3 from rabbit reticulocytes
.
Proc. Natl Acad. Sci. U.S.A.
73
,
3005
3009
7
Block
,
K.L.
,
Vornlocher
,
H.P.
and
Hershey
,
J.W.
(
1998
)
Characterization of cDNAs encoding the p44 and p35 subunits of human translation initiation factor eIF3
.
J. Biol. Chem.
273
,
31901
31908
8
Methot
,
N.
,
Rom
,
E.
,
Olsen
,
H.
and
Sonenberg
,
N.
(
1997
)
The human homologue of the yeast Prt1 protein is an integral part of the eukaryotic initiation factor 3 complex and interacts with p170
.
J. Biol. Chem.
272
,
1110
1116
9
Dong
,
Z.
,
Qi
,
J.
,
Peng
,
H.
,
Liu
,
J.
and
Zhang
,
J.T.
(
2013
)
Spectrin domain of eukaryotic initiation factor 3a is the docking site for formation of the a:b:i:g subcomplex
.
J. Biol. Chem.
288
,
27951
27959
10
Methot
,
N.
,
Song
,
M.S.
and
Sonenberg
,
N.
(
1996
)
A region rich in aspartic acid, arginine, tyrosine, and glycine (DRYG) mediates eukaryotic initiation factor 4B (eIF4B) self-association and interaction with eIF3
.
Mol. Cell. Biol.
16
,
5328
5334
11
Buratti
,
E.
,
Tisminetzky
,
S.
,
Zotti
,
M.
and
Baralle
,
F.E.
(
1998
)
Functional analysis of the interaction between HCV 5′UTR and putative subunits of eukaryotic translation initiation factor eIF3
.
Nucleic Acids Res.
26
,
3179
3187
12
Yin
,
J.Y.
,
Dong
,
Z.Z.
,
Liu
,
R.Y.
,
Chen
,
J.
,
Liu
,
Z.Q.
and
Zhang
,
J.T.
(
2013
)
Translational regulation of RPA2 via internal ribosomal entry site and by eIF3a
.
Carcinogenesis
34
,
1224
1231
13
Chaudhuri
,
J.
,
Chakrabarti
,
A.
and
Maitra
,
U.
(
1997
)
Biochemical characterization of mammalian translation initiation factor 3 (eIF3). Molecular cloning reveals that p110 subunit is the mammalian homologue of Saccharomyces cerevisiae protein Prt1
.
J. Biol. Chem.
272
,
30975
30983
14
Baugh
,
J.M.
and
Pilipenko
,
E.V.
(
2004
)
20S proteasome differentially alters translation of different mRNAs via the cleavage of eIF4F and eIF3
.
Mol. Cell
16
,
575
586
15
Dong
,
Z.
,
Liu
,
L.H.
,
Han
,
B.
,
Pincheira
,
R.
and
Zhang
,
J.T.
(
2004
)
Role of eIF3 p170 in controlling synthesis of ribonucleotide reductase M2 and cell growth
.
Oncogene
23
,
3790
3801
16
Dong
,
Z.
and
Zhang
,
J.T.
(
2003
)
EIF3 p170, a mediator of mimosine effect on protein synthesis and cell cycle progression
.
Mol. Biol. Cell.
14
,
3942
3951
17
Liu
,
R.Y.
,
Dong
,
Z.
,
Liu
,
J.
,
Yin
,
J.Y.
,
Zhou
,
L.
,
Wu
,
X.
et al (
2011
)
Role of eIF3a in regulating cisplatin sensitivity and in translational control of nucleotide excision repair of nasopharyngeal carcinoma
.
Oncogene
30
,
4814
4823
18
Yin
,
J.Y.
,
Shen
,
J.
,
Dong
,
Z.Z.
,
Huang
,
Q.
,
Zhong
,
M.Z.
,
Feng
,
D.Y.
et al (
2011
)
Effect of eIF3a on response of lung cancer patients to platinum-based chemotherapy by regulating DNA repair
.
Clin. Cancer Res.
17
,
4600
4609
19
Dong
,
Z.
,
Liu
,
Z.
,
Cui
,
P.
,
Pincheira
,
R.
,
Yang
,
Y.
,
Liu
,
J.
et al (
2009
)
Role of eIF3a in regulating cell cycle progression
.
Exp. Cell Res.
315
,
1889
1894
20
Kovarik
,
P.
,
Hasek
,
J.
,
Valasek
,
L.
and
Ruis
,
H.
(
1998
)
RPG1: an essential gene of saccharomyces cerevisiae encoding a 110-kDa protein required for passage through the G1 phase
.
Curr. Genet.
33
,
100
109
21
Patil
,
M.
,
Pabla
,
N.
and
Dong
,
Z.
(
2013
)
Checkpoint kinase 1 in DNA damage response and cell cycle regulation
.
Cell. Mol. Life Sci.
70
,
4009
4021
22
Bradford
,
M.M.
(
1976
)
A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding
.
Anal. Biochem.
72
,
248
254
23
Yang
,
Y.
,
Li
,
Z.
,
Mo
,
W.
,
Ambadipudi
,
R.
,
Arnold
,
R.J.
,
Hrncirova
,
P.
et al (
2012
)
Human ABCC1 interacts and colocalizes with ATP synthase alpha, revealed by interactive proteomics analysis
.
J. Proteome Res.
11
,
1364
1372
24
Yang
,
Y.
,
Liu
,
Y.
,
Dong
,
Z.
,
Xu
,
J.
,
Peng
,
H.
,
Liu
,
Z.
et al (
2007
)
Regulation of function by dimerization through the amino-terminal membrane-spanning domain of human ABCC1/MRP1
.
J. Biol. Chem.
282
,
8821
8830
25
Cho
,
S.H.
,
Toouli
,
C.D.
,
Fujii
,
G.H.
,
Crain
,
C.
and
Parry
,
D.
(
2005
)
Chk1 is essential for tumor cell viability following activation of the replication checkpoint
.
Cell Cycle
4
,
131
139
26
Mayr
,
C.
(
2017
)
Regulation by 3′-untranslated regions
.
Annu. Rev. Genet.
51
,
171
194
27
Yamashita
,
A.
and
Takeuchi
,
O.
(
2017
)
Translational control of mRNAs by 3′-untranslated region binding proteins
.
BMB Rep.
50
,
194
200
28
Sonenberg
,
N.
(
1994
)
mRNA translation: influence of the 5′ and 3′ untranslated regions
.
Curr. Opin. Genet. Dev.
4
,
310
315
29
Paz
,
I.
,
Kosti
,
I.
,
Ares
, Jr,
M.
,
Cline
,
M.
and
Mandel-Gutfreund
,
Y.
(
2014
)
RBPmap: a web server for mapping binding sites of RNA-binding proteins
.
Nucleic Acids Res.
42
,
W361
W367
30
Mazan-Mamczarz
,
K.
,
Galban
,
S.
,
Lopez de Silanes
,
I.
,
Martindale
,
J. L.
,
Atasoy
,
U.
,
Keene
,
J. D.
et al (
2003
)
RNA-binding protein HuR enhances p53 translation in response to ultraviolet light irradiation
.
Proc. Natl Acad. Sci. U.S.A.
100
,
8354
8359
31
Coller
,
J.M.
,
Gray
,
N.K.
and
Wickens
,
M.P.
(
1998
)
mRNA stabilization by poly(A) binding protein is independent of poly(A) and requires translation
.
Genes Dev.
12
,
3226
3235
32
Mignone
,
F.
,
Gissi
,
C.
,
Liuni
,
S.
and
Pesole
,
G.
(
2002
)
Untranslated regions of mRNAs
.
Genome Biol.
3
,
REVIEWS0004
33
Wickens
,
M.
,
Anderson
,
P.
and
Jackson
,
R.J.
(
1997
)
Life and death in the cytoplasm: messages from the 3′ end
.
Curr. Opin. Genet. Dev.
7
,
220
232
34
Gallie
,
D.R.
(
1998
)
A tale of two termini: a functional interaction between the termini of an mRNA is a prerequisite for efficient translation initiation
.
Gene
216
,
1
11
35
Imataka
,
H.
,
Gradi
,
A.
and
Sonenberg
,
N.
(
1998
)
A newly identified N-terminal amino acid sequence of human eIF4G binds poly(A)-binding protein and functions in poly(A)-dependent translation
.
EMBO J.
17
,
7480
7489
36
Le
,
H.
,
Browning
,
K.S.
and
Gallie
,
D.R.
(
2000
)
The phosphorylation state of poly(A)-binding protein specifies its binding to poly(A) RNA and its interaction with eukaryotic initiation factor (eIF) 4F, eIFiso4F, and eIF4B
.
J. Biol. Chem.
275
,
17452
17462
37
Le
,
H.
,
Tanguay
,
R.L.
,
Balasta
,
M.L.
,
Wei
,
C.C.
,
Browning
,
K.S.
,
Metz
,
A.M.
et al (
1997
)
Translation initiation factors eIF-iso4G and eIF-4B interact with the poly(A)-binding protein and increase its RNA binding activity
.
J. Biol. Chem.
272
,
16247
16255
38
Christensen
,
A.K.
,
Kahn
,
L.E.
and
Bourne
,
C.M.
(
1987
)
Circular polysomes predominate on the rough endoplasmic reticulum of somatotropes and mammotropes in the rat anterior pituitary
.
Am. J. Anat.
178
,
1
10
39
Wells
,
S.E.
,
Hillner
,
P.E.
,
Vale
,
R.D.
and
Sachs
,
A.B.
(
1998
)
Circularization of mRNA by eukaryotic translation initiation factors
.
Mol. Cell
2
,
135
140
40
Choe
,
J.
,
Lin
,
S.
,
Zhang
,
W.
,
Liu
,
Q.
,
Wang
,
L.
,
Ramirez-Moya
,
J.
et al (
2018
)
mRNA circularization by METTL3-eIF3h enhances translation and promotes oncogenesis
.
Nature
561
,
556
560
41
Brennan
,
C.M.
and
Steitz
,
J.A.
(
2001
)
Hur and mRNA stability
.
Cell. Mol. Life Sci.
58
,
266
277
42
Hinman
,
M.N.
and
Lou
,
H.
(
2008
)
Diverse molecular functions of Hu proteins
.
Cell. Mol. Life Sci.
65
,
3168
3181
43
Abdelmohsen
,
K.
,
Kuwano
,
Y.
,
Kim
,
H.H.
and
Gorospe
,
M.
(
2008
)
Posttranscriptional gene regulation by RNA-binding proteins during oxidative stress: implications for cellular senescence
.
Biol. Chem.
389
,
243
255
44
Abdelmohsen
,
K.
and
Gorospe
,
M.
(
2010
)
Posttranscriptional regulation of cancer traits by HuR
.
Wiley Interdiscip Rev RNA.
1
,
214
229
45
Young
,
L.E.
,
Moore
,
A.E.
,
Sokol
,
L.
,
Meisner-Kober
,
N.
and
Dixon
,
D.A.
(
2012
)
The mRNA stability factor HuR inhibits microRNA-16 targeting of COX-2
.
Mol. Cancer Res.
10
,
167
180
46
Lu
,
Y.C.
,
Chang
,
S.H.
,
Hafner
,
M.
,
Li
,
X.
,
Tuschl
,
T.
,
Elemento
,
O.
et al (
2014
)
ELAVL1 modulates transcriptome-wide miRNA binding in murine macrophages
.
Cell Rep.
9
,
2330
2343
47
Poria
,
D.K.
,
Guha
,
A.
,
Nandi
,
I.
and
Ray
,
P.S.
(
2016
)
RNA-binding protein HuR sequesters microRNA-21 to prevent translation repression of proinflammatory tumor suppressor gene programmed cell death 4
.
Oncogene
35
,
1703
1715