The pluripotency factor, OCT4 gene is a stemness marker that is involved in the tumorigenicity of different cancer types and knowing about molecular mechanisms of its regulation is crucially important. To date, a few microRNAs (miRNAs) are known to be regulators of OCT4 gene expression. Looking for the novel miRNAs which are capable of regulating OCT4 gene expression, our bioinformatics analysis introduced hsa-miR-3658 (miR-3658) as a bona fide candidate. Then, RT-qPCR results indicated that miR-3658 expression is decreased in colorectal cancer (CRC) tumor tissues, compared with normal pairs. Furthermore, RT-qPCR and western blot analysis showed that the OCT4 gene has been down-regulated following the miR-3658 overexpression. Consistently, dual-luciferase assay supported the direct interaction of miR-3658 with the 3′-UTR sequence of OCT4 gene. Unlike in HCT116 cells, overexpression of miR-3658 in SW480 cells brought about growth inhibition, cell cycle arrest and reduced cell migration, detected by flow cytometry, and scratch test assay. Overall, these findings demonstrated that miR-3658 as a tumor suppressor miRNA exerts its effect against OCT4 gene expression, and it has the potential of being used as a prognostic marker and therapeutic target against colorectal cancer.

Introduction

Colorectal cancer (CRC) as a major health problem in industrialized countries, is the third most commonly diagnosed malignancy worldwide and the fourth most common cause of death [1,2]. Despite advances in screening procedures, up to 50% of all patients with CRC will develop metastases [3]. Although the genetic and molecular basis of CRC metastasis is poorly understood, some recent studies suggested that OCT4 (OCT3/4 or POU5F1) as a transcription factor that controls the properties of immortality, un-differentiation, and invasion of cancer cells, may be involved in CRC metastasis [4–6].

OCT4 gene, a well-known pluripotent stem cell marker, encodes a protein member of POU family and has been implicated in solid tumors including non-small cell lung carcinomas, esophageal squamous cell carcinoma, and glioma, as well as gastric, breast [6–10], bladder cancers [11], and CRC tumors [12]. It is also suggested that OCT4 is closely related to tumor progression [13], self-renewal [14], and drug resistance [15,16]. Therefore, finding a new modulator capable of regulating this transcription factor is necessary for new diagnostic and therapeutic strategies.

Oct4, Sox2, and Nanog are considered to be essential transcription factors for the maintenance of the pluripotent embryonic stem cell phenotype. The cooperative interaction of Sox2 and Oct4 is required for transcription of pluripotency gene expression [17,18].

MicroRNAs (miRNAs) are a family of mature noncoding small RNAs that act as negative gene regulators through destabilization or translational repression in the cytoplasm [19,20]. However, recent studies indicated the positive regulatory effect of miRNAs by targeting promoter elements [21]. Notably, many studies reported that miRNAs exhibit temporally and cell-specific regulated expression patterns [22] and might regulate diverse physiological and developmental processes [23] such as proliferation, differentiation [24], and stemness [25]. An abnormal miRNA expression signature could be an indicator of various types of cancer including CRC [26–28].

Here, we have introduced miR-3658 as a novel negative regulator of OCT4 gene expression and suggested a tumor suppressor role for it in CRC cells. Functional analysis of this miRNA revealed a negative posttranscriptional regulatory effect of miR-3658 on OCT4 gene expression which was followed by inhibition of proliferation and migration of CRC-originated SW480 cell line.

Material and methods

Bioinformatics analysis

A bioinformatics phase was conducted to predict the potential miRNAs capable of targeting OCT4 mRNA. The 3′UTR sequence of human OCT4 mRNA was retrieved using Entrez (http://www.ncbi.nlm.nih.gov/Entrez/), then Several online tools such as target scan (http://www.targetscan.org/vert_72/) and miRmap (http://mirmap.ezlab.org/app/), were used for prediction of miRNA target genes. Conservation of miRNA recognition elements (MREs) was evaluated via Blat search from the UCSC genome browser (https://genome.ucsc.edu/). The expression data of CRC tissues and cell lines were retrieved from TCGA (https://tcga-data.nci.nih.gov/) NCBI and GEO (https://www.ncbi.nlm.nih. gov/geo/) databases.

DNA construct

A 490 bp of human genomic DNA, representing pre-miR-3658 sequence along with the flanking region was amplified by PCR and cloned into the pEGFP-C1 vector downstream of the GFP sequence. To construct reporter plasmid, the entire 3′UTR sequence of human OCT4 and Her2 gene was PCR-amplified, using a pair of oligonucleotides and cloned into pTG19-R/T vector. Then, it was subcloned downstream of the Renilla luciferase gene in the psi-CHECK-2 vector. For the mutant construct, Using OCT4 3′-UTR wild type as a template DNA, the F1 and R2 primers were used to amplify an upstream fragment with no putative miR-3658 binding sites. Primers and oligo sequences used in this study are listed in Table 1. All recombinant vectors were SANGER sequenced to verify the fidelity of the insert sequence.

Table 1.
Primers used in the current study
Primer namePrimer sequences 5′ to 3′ end
Pre-miR-3658 Forward; AAGAGCTCGACCAATGGCTGTCTCAACG
Reverse; AAGTCGACACACAACAGGCAATTTCCCC 
miR-3658 Forward; TTTAAGAAAACACCATGGAGA 
OCT4-3′UTR Forward; CTCGAGCATTCAAACTGAGGTGCCTG
Reverse; GCGGCCGCACAAACCAAGATAAGTGTGTCTATC 
OCT4-3′UTR mutant Forward; CTCGAGCATTCAAACTGAGGTGCCTG
Reverse; AAAAAAAAAAGCGGCCGCGGGATTAAAATCAAGAGCATC 
U48 Forward; TGACCCCAGGTAACTCTGAGTGTGT 
Anchored oligo(dT) GCGTCGACTAGTACAACTCAAGGTTCTTCCAGTCACGACG (T)18V 
Universal Reverse; GCGTCGACTAGTACAACTCAAG 
GAPDH Forward; GCCACATCGCTCAGACAC
Reverse; GGCAACAATATCCACTTTACCAG 
B2M Forward; CTACTCTCTCTTTCTGGCCTG
Reverse; GACAAGTCTGAATGCTCCAC 
OCT4 Forward; TCGCAAGCCCTCATTTC
Reverse; CCATCACCTCCACCACCT 
PCNA Forward; AGCACCAAACCAGGAGAAAGT
Reverse; TCACTCCGTCTTTTGCACAG 
Zeb1 Forward; TGCACTGAGTGTGGAAAAGC
Reverse; TGGTGATGCTGAAAGAGACG 
SNAIL Forward; ACCCCACATCCTTCTCACTG
Reverse; TACAAAAACCCACGCAGACA 
B-Catenin Forward; AGAACAGAGCCAATGGCTTG
Reverse; CCTGGCCATATCCACCAGAG 
Cloudin1 Forward; CTTCATTCTCGCCTTCCT
Reverse; TGACGCCATCCTCATCTT 
Primer namePrimer sequences 5′ to 3′ end
Pre-miR-3658 Forward; AAGAGCTCGACCAATGGCTGTCTCAACG
Reverse; AAGTCGACACACAACAGGCAATTTCCCC 
miR-3658 Forward; TTTAAGAAAACACCATGGAGA 
OCT4-3′UTR Forward; CTCGAGCATTCAAACTGAGGTGCCTG
Reverse; GCGGCCGCACAAACCAAGATAAGTGTGTCTATC 
OCT4-3′UTR mutant Forward; CTCGAGCATTCAAACTGAGGTGCCTG
Reverse; AAAAAAAAAAGCGGCCGCGGGATTAAAATCAAGAGCATC 
U48 Forward; TGACCCCAGGTAACTCTGAGTGTGT 
Anchored oligo(dT) GCGTCGACTAGTACAACTCAAGGTTCTTCCAGTCACGACG (T)18V 
Universal Reverse; GCGTCGACTAGTACAACTCAAG 
GAPDH Forward; GCCACATCGCTCAGACAC
Reverse; GGCAACAATATCCACTTTACCAG 
B2M Forward; CTACTCTCTCTTTCTGGCCTG
Reverse; GACAAGTCTGAATGCTCCAC 
OCT4 Forward; TCGCAAGCCCTCATTTC
Reverse; CCATCACCTCCACCACCT 
PCNA Forward; AGCACCAAACCAGGAGAAAGT
Reverse; TCACTCCGTCTTTTGCACAG 
Zeb1 Forward; TGCACTGAGTGTGGAAAAGC
Reverse; TGGTGATGCTGAAAGAGACG 
SNAIL Forward; ACCCCACATCCTTCTCACTG
Reverse; TACAAAAACCCACGCAGACA 
B-Catenin Forward; AGAACAGAGCCAATGGCTTG
Reverse; CCTGGCCATATCCACCAGAG 
Cloudin1 Forward; CTTCATTCTCGCCTTCCT
Reverse; TGACGCCATCCTCATCTT 

Human tissue samples and cell lines

Total RNA was extracted from 15 pairs of fresh frozen CRC tumor tissue samples and their non-tumor adjacent tissues obtained from patients undergoing surgery in Emam hospital. The study protocol was approved by the research committee at Tarbiat Modares University and all patients provided informed consent for using of specimens in research. The CRC cell lines, SW480, and HCT116 cells were obtained from Pasteur Institute/Iran and cultured in DMEM-HG (Invitrogen) and RPMI (Invitrogen), respectively. HT29 and HEK293t cell lines were purchased from the National Center for Genetic and biological reserves in Iran and cultured in DMEM-HG (Invitrogen) and DMEM-F12 (Invitrogen), respectively. These media were supplemented with 100 U/ml penicillin, 100 µg/ml streptomycin (Sigma), and 10% fetal bovine serum (Invitrogen) at 37°C with 5% CO2.

Transfections

For miRNA overexpression analysis, SW480, HT29, and HCT116 cells were seeded onto 12-well plates (1.2 × 105 cells per well) and 32 h later (∼70% confluent), were transfected with two micrograms of a pEGFP-C1 expression vector containing miR-3658 precursor using TurboFect transfection reagent (Thermo Fisher). Twenty-four hours after transfection, green fluorescent protein (GFP) expression was visually examined by fluorescent microscopy (Nikon Eclipses Te2000-s) and cells were harvested 48 h after transfection for the following experiments.

Dual-luciferase assay

To study the direct interaction of miR-3658 and the 3′UTR sequence of the OCT4 gene, Hek293T cells were seeded onto 48-well plates (3 × 104 per well). Cells (∼70% confluent) were transfected with psi-CHECK-2 luciferase reporters (200 ng) and pre-miRNAs (400 ng) or mock (400 ng) using TurboFect transfection reagent (Thermo Fisher). Forty-eight hours after transfection using the dual-luciferase reporter system, the activities of the Firefly and Renilla luciferases were measured sequentially from cell lysates, according to the manufacturer's instructions (Promega). Firefly luciferase units were normalized against Renilla luciferase units to control the transfection efficiency. All experiments were done in triplicate.

RNA extraction and quantitative reverse transcription-PCR

Total RNA was isolated from the cells and tissues using Riboex reagent (GeneAll) according to the manufacturer's protocol. To synthesize cDNA, the RNA quality and quantity were analyzed by using agarose gel electrophoresis and spectrophotometry, respectively. Then, RNA was treated with DNase I (Takara Bio), followed by cDNA synthesis using prime script II reverse transcriptase (Takara Bio) as recommended by the manufacturer. For miRNA detection, before cDNA synthesis, poly A tail was added to the 3′ end of RNAs by using poly-A polymerase (Takara Bio) according to the manufacturer's protocol. Real-time quantitative PCR was performed using brilliant Sybr green qPCR reagent (BioFact) on an ABI instrument (Applied Biosystems, StepOne). Warrington, U.K.). The relative expression level for miRNAs was normalized to U48, and for mRNAs were normalized to B2M using the 2-ΔΔCt method. Primers and oligo sequences used in this study are listed in Table 1.

Western blot analysis

SDS–PAGE was carried out on 12% polyacrylamide gels and then Solubilized proteins (30 μg/μl) extracted from SW480 and HCT116 cells were separated by electrophoresis. Next, the gels were electroblotted onto PVDF membranes (Santa Cruz) at 100 V for 1.5 h at room temperature. The blocking of the membrane was carried out with 5% BSA in Phosphate-buffered saline containing 0.1% Tween for 1 h at room temperature. Overnight incubation of Oct4 primary antibody (1 : 500, Santa Cruz) was done at 4°C and later, was washed and incubated with a goat anti-mouse secondary antibody solution (1 : 1000, Santa Cruz) for 1 h at room temperature. Using enhanced chemiluminescence (ECL) detection system (Amersham, Piscataway, NJ) the protein bands were visualized and then quantitated by GelQuantNET Software. For verification of protein loading, the membranes were stripped and re-probed with β-actin antibody (Santa Cruz).

Cell cycle and MTT assay

Cell cycle analysis was performed on SW480 and HCT116 cells 48 h after transfection with either pre-miR3658 or mock control. Cells were trypsinized and washed twice with cold PBS, later fixed in 70% cold ethanol, and incubated with propidium iodide (PI). All of the samples were examined by a FACS Calibur flow cytometer, and the cell cycle populations were determined by using Cell Quest software (BDBiosciences).

For MTT assay analysis, SW480 and HCT116 cells were seeded onto 96-well plates (8000 cells per well) in tetra plicate. Forty-eight hours after transfection, 20 µl of the MTT solution was added to each well and then the cells were continued to culture for 4 h in 37°C with 5% CO2 incubator. The culture medium was then discarded and 100 μl DMSO (Sigma) was added to each well and the ELISA reader was used to measure the absorbance at 570 nm (Biotek) after crystals were dissolved completely.

Cell migration assay

To assess the migration capabilities of SW480 cells, a scratch wound assay was done. SW480 cells were transfected with pre-miR-3658 or mock control vectors and an artificial wound was created 24 after transfection using a 200-μl pipette tip on the confluent cell monolayer. Photomicrographs were obtained at 0, 24, 48, and 72 h using a 4X objective on a Nikon Eclipse inverted microscope and recorded using cellSens software. The data were analyzed using Image J software to estimate the rate of cell migration.

Statistical analysis

The Real-time experiment data were analyzed using the CT method by Data Assist software V3.0 and normalized by endogenous control U48 small nuclear RNA and B2M genes. Other statistical analysis was performed using GraphPad Prism 5.04 (GraphPad, San Diego, CA). All experiments were repeated at least twice with duplicate samples in each experiment and all of the results are presented as the means ± SEM.

Result

Analysis of miR-3658 expression in CRC tumor tissues and cell lines and prediction of its putative target gene

About 6000 target genes were predicted for miR-3658 of between, the OCT4 gene was prominent. Both target scan and miRmap software predicted one putative binding site for miR-3658 within the 3′UTR sequence of OCT4 mRNA (Figure 1A). Algorithm scores implied on strong base pairing between miR-3658 and the OCT4 3′UTR MRE sequence (Figure 1B) and also, recognition site was conserved among Human, Chimp, Rhesus, Rabbit, Pig, and Cow using UCSC blat tool and target scan algorithm (Figure 1C).

. Analysis of miR-3658 expression level in CRC tissues and prediction of the OCT4 gene as its target gene.

Figure 1
. Analysis of miR-3658 expression level in CRC tissues and prediction of the OCT4 gene as its target gene.

(A) Schematic representation of the 3′-UTR sequence of the OCT4 gene showing the position and sequences of the predicted miR-3658 binding site. The conservation status of the OCT4 gene 3′-UTR sequence is shown underneath, which indicates the miR-3658 binding site is relatively conserved. The numbers indicate the distance from the stop codon of the OCT4 gene. This shape was designed with adaptation from the UCSC and the target scan web sites. (B) Shows the pairing status of miR-3658 with its binding site within the OCT4 gene 3′-UTR sequence. (C) Shows the conservation status of binding site nucleotides between the genomes of different animals. This shape was designed with adaptation from the UCSC and the target scan web sites. (D) Analysis of GSE81581 (Colorectal tissues) microarray data adopted from GEO indicated a significant reduction of miR-3658 expression in the colorectal liver metastasis in comparison with non-tumor colorectal tissues. p-value = 0.0149. (E) Analysis of GSE72412 (Colorectal cell lines) microarray data indicated a significant reduction of miR-3658 expression in SW620 (high metastasis) versus SW480 (low metastasis) cells. p-value = 0.0132. (F) RT-qPCR results indicated miR-5638 expression level has been reduced in 15 colorectal cancer tumor tissues, compared with normal pairs. p-value < 0.0001. (G) RT-qPCR results indicated OCT4 expression level has been increased in 15 colorectal cancer tumor tissues, compared with normal pairs. p-value = 0.042. (H) Differential expression of the OCT4 gene in colorectal cancer and non-cancerous tissues from the TCGA database. p-value = 0.05. Statistical analysis was conducted using the Student t-test.

Figure 1
. Analysis of miR-3658 expression level in CRC tissues and prediction of the OCT4 gene as its target gene.

(A) Schematic representation of the 3′-UTR sequence of the OCT4 gene showing the position and sequences of the predicted miR-3658 binding site. The conservation status of the OCT4 gene 3′-UTR sequence is shown underneath, which indicates the miR-3658 binding site is relatively conserved. The numbers indicate the distance from the stop codon of the OCT4 gene. This shape was designed with adaptation from the UCSC and the target scan web sites. (B) Shows the pairing status of miR-3658 with its binding site within the OCT4 gene 3′-UTR sequence. (C) Shows the conservation status of binding site nucleotides between the genomes of different animals. This shape was designed with adaptation from the UCSC and the target scan web sites. (D) Analysis of GSE81581 (Colorectal tissues) microarray data adopted from GEO indicated a significant reduction of miR-3658 expression in the colorectal liver metastasis in comparison with non-tumor colorectal tissues. p-value = 0.0149. (E) Analysis of GSE72412 (Colorectal cell lines) microarray data indicated a significant reduction of miR-3658 expression in SW620 (high metastasis) versus SW480 (low metastasis) cells. p-value = 0.0132. (F) RT-qPCR results indicated miR-5638 expression level has been reduced in 15 colorectal cancer tumor tissues, compared with normal pairs. p-value < 0.0001. (G) RT-qPCR results indicated OCT4 expression level has been increased in 15 colorectal cancer tumor tissues, compared with normal pairs. p-value = 0.042. (H) Differential expression of the OCT4 gene in colorectal cancer and non-cancerous tissues from the TCGA database. p-value = 0.05. Statistical analysis was conducted using the Student t-test.

Analysis of microarray data adopted from GEO (GSE81581) demonstrated a significant differential expression of miR-3658 where it showed a higher expression level in non-tumor colorectal tissue samples, compared with colorectal-liver metastasis (Figure 1D). Data analysis of another microarray study of CRC cell lines with different metastasis states (GSE72412) showed a significantly higher expression level of miR-3658 in SW480 versus SW620 cells (Figure 1E). To verify the suppression of miR-3658 in CRC specimens, the mature miR-3658 expression level was measured using RT-qPCR. The results indicated that miR-3658 expression was strong (>70%) down-regulated in 15 CRC specimens in comparison with matched normal tissues (Figure 1F). Moreover, In the TCGA cohort, OCT4 gene expression although not significant but seemed to be increased in the CRC tissues compared with the normal ones (Figure 1H). Eventually, consistent to the RT-qPCR results against OCT4 gene expression in CRC tissue specimens (Figure 1G), bioinformatics analysis suggested that miR-3658 could have important functions in CRC through regulating the OCT4 gene expression.

Experimental expression analysis of miR-3658 and OCT4 gene in CRC originated cell lines

The expression status of miR-3658 and the OCT4 gene was also investigated in SW480 cells (grade III CRC) and HCT116 cells (grade II CRC), using RT-qPCR. While the miR-3658 expression level in SW480 cells was lower than its level in HCT-116 cells (Figure 2), the expression level of its putative target gene (OCT4) was an inverse (Figure 2). Hence, a reverse expression pattern between miR-3658 and OCT4 was deduced in these two CRCs originated cell lines. Later, these cells were used for subsequent experiments.

The reverse expression level of miR-3658 with the OCT4 gene in CRC originated cell lines.

Figure 2.
The reverse expression level of miR-3658 with the OCT4 gene in CRC originated cell lines.

From RT-qPCR results, a negative correlation was deduced between miR-3658 and OCT4 gene expression in SW480 (high grade) and HCT116 (low grade) CRC originated cell lines. While miR-3658 had a relatively lower expression level in SW480 cells, it had a higher level in HCT116 cells, quiet reverse to the relative expression levels of OCT4 gene expression in these cell lines. U48 and Actin genes have been used as an internal control. p-value = 0.0058 and 0.0020, respectively. Error bars indicate SEM of two experiments. Statistical analysis was conducted using the Student t-test.

Figure 2.
The reverse expression level of miR-3658 with the OCT4 gene in CRC originated cell lines.

From RT-qPCR results, a negative correlation was deduced between miR-3658 and OCT4 gene expression in SW480 (high grade) and HCT116 (low grade) CRC originated cell lines. While miR-3658 had a relatively lower expression level in SW480 cells, it had a higher level in HCT116 cells, quiet reverse to the relative expression levels of OCT4 gene expression in these cell lines. U48 and Actin genes have been used as an internal control. p-value = 0.0058 and 0.0020, respectively. Error bars indicate SEM of two experiments. Statistical analysis was conducted using the Student t-test.

Cell-specific overexpression effect of miR-3658 against OCT4 gene expression

Transfection of the pEGFP-C1 vector containing pre-miR-3658 into SW480 and HCT116 cells resulted in significant overexpression of miR-3658 in both of these cell lines, detected by RT-qPCR (Figure 3A). Then, RT-qPCR and western blot analysis indicated that ectopic overexpression of miR-3658 in SW480 cells was followed by reducing endogenous OCT4 gene expression both at the mRNA (Figure 3B) and protein levels (Figure 3D). However, such an effect was not detected in HCT116 cells (Figure 3B,D). Also, overexpression of miR-3658 in SW480 cells resulted in a reduced SOX2 expression level, detected through RT-qPCR (Figure 3C).

Experimental evidences for cell-specific suppression of OCT4 gene expression following miR-3658 overexpression.

Figure 3.
Experimental evidences for cell-specific suppression of OCT4 gene expression following miR-3658 overexpression.

(A) Successful overexpression of miR-3658 in both SW480 and HCT116 cell lines. RT-qPCR results indicated more than 35-fold and 130-fold increased level of miR-3658 expression, following the transfection of the pEGFP-C1 recombinant vector into SW480 and HCT116 cells, respectively. p-value = 0.0008 and 0.01, respectively, for two replicates. (B) Shows, SW480 cell-specific down-regulation of OCT4 gene expression following the overexpression of miR-3658, detected by RT-qPCR. Overexpression of miR-3658, in HCT116 cells, did not have such an effect on OCT4 gene expression. p-value = 0.0008 and 0.2761, respectively, for two replicates. (C) Overexpression of miR-3658 in SW480 cells, also resulted in reduced SOX2 gene expression, detected by RT-qPCR. B2m gene expression was used as internal control throughout the experiment. p-value = 0.0024 for two replicates. (D) Down-regulation of the Oct4 protein level following the overexpression of miR-3658 in SW480 cells was confirmed through western blotting analysis. Such an effect was not observed in HCT116 cells. The top shows the quantified bands of the bottom gel image. B-actin protein was used as an internal control. Quantification was performed using GelQuantNet software. p-value = 0.0039 and 0.37, respectively, for three replicates. (E) Dual-luciferase reporter experiments were performed on HEK293T cells transfected with indicated Renilla luciferase (OCT4-3′-UTR wild type, mutated or HER2-3′-UTR (as non-target)) and miR-3658 construct. Results supported miR-3658 direct interaction with wild type 3′-UTR sequences of the OCT4 target gene and lack of interaction between miR-3658 and mutated OCT4-3′-UTR or HER2 3′-UTR. Error bars indicate SEM of triplicate experiments. p-value = 0.0.0007, 0.94, and 0.06, respectively, for three replicates.

Figure 3.
Experimental evidences for cell-specific suppression of OCT4 gene expression following miR-3658 overexpression.

(A) Successful overexpression of miR-3658 in both SW480 and HCT116 cell lines. RT-qPCR results indicated more than 35-fold and 130-fold increased level of miR-3658 expression, following the transfection of the pEGFP-C1 recombinant vector into SW480 and HCT116 cells, respectively. p-value = 0.0008 and 0.01, respectively, for two replicates. (B) Shows, SW480 cell-specific down-regulation of OCT4 gene expression following the overexpression of miR-3658, detected by RT-qPCR. Overexpression of miR-3658, in HCT116 cells, did not have such an effect on OCT4 gene expression. p-value = 0.0008 and 0.2761, respectively, for two replicates. (C) Overexpression of miR-3658 in SW480 cells, also resulted in reduced SOX2 gene expression, detected by RT-qPCR. B2m gene expression was used as internal control throughout the experiment. p-value = 0.0024 for two replicates. (D) Down-regulation of the Oct4 protein level following the overexpression of miR-3658 in SW480 cells was confirmed through western blotting analysis. Such an effect was not observed in HCT116 cells. The top shows the quantified bands of the bottom gel image. B-actin protein was used as an internal control. Quantification was performed using GelQuantNet software. p-value = 0.0039 and 0.37, respectively, for three replicates. (E) Dual-luciferase reporter experiments were performed on HEK293T cells transfected with indicated Renilla luciferase (OCT4-3′-UTR wild type, mutated or HER2-3′-UTR (as non-target)) and miR-3658 construct. Results supported miR-3658 direct interaction with wild type 3′-UTR sequences of the OCT4 target gene and lack of interaction between miR-3658 and mutated OCT4-3′-UTR or HER2 3′-UTR. Error bars indicate SEM of triplicate experiments. p-value = 0.0.0007, 0.94, and 0.06, respectively, for three replicates.

To investigate a direct interaction between miR-3658 and OCT4 gene transcripts, luciferase reporter in pSICHECK2 vector was fused to indicate 3′UTR sequences (OCT4 3′UTR wild type, mutated OCT4 3′UTR, and HER2 3′UTR sequences). The HER2 3′UTR sequence was used as non-target, showing no target site for miR-3658. Then, luciferase reporters in pSICHECK2 vector along with pEGFP-C1 vector overexpressing miR-3658 were co-transfected in Heck293 cells. The pre-miR-3658 overexpression resulted in a significant (∼40%) suppression of the luciferase activity while it was fused to wild type 3′UTR sequence of the OCT4 gene. However, it did not affect the luciferase activity of HER2 reporter or mutated OCT4 3′UTR, compared with the mock control (Figure 3E). Taken together, these data supported the direct interaction of miR-3658 with the 3′UTR sequence of the OCT4 transcript.

Hsa-miR-3658 overexpression effect on cell cycle status in SW480 and HCT116 cells

To investigate the miR-3658 overexpression effect on HCT116 and SW480 cells, the relevant expression vector was transfected into these cells. Then, flow cytometry results indicated that the population of the transfected cells in the sub-G1 stage has been significantly increased in SW480 cells, while the G1 stage has been decreased, compared with the mock control transfection (Figure 4A). On the other hand, a repeat of this experiment in HCT116 cells resulted in no significant change of the cell population in sub-G1 or G1 stages, rather it resulted in the increased cell population at S and G2 phases (Figure 4B). The tumor suppressor effect of miR-3658 overexpression in SW480 cells was further supported via qRT-PCR against marker genes. While, overexpression of miR-3658 resulted in the reduced expression level of PCNA, Cyclin-D1, and c-Myc genes in SW480 cells, it resulted in no significant change in HCT116 cells (Figure 4C,D).

The effects of miR-3658 overexpression on cell cycle progression and proliferation.

Figure 4.
The effects of miR-3658 overexpression on cell cycle progression and proliferation.

(A,B) are flow cytometry histograms of two colorectal cancer originated cell lines in which miR-3658 or mock control has been overexpressed. It also shows miR-3658 overexpression effect on the cell cycle status measured by flow cytometry. Overexpression of miR-3658 has led to the cell cycle arrest in SW480 (high expression of OCT4) cells while in HCT116 (low expression of OCT4) cells, the number of s-phased cells have been increased. Error bars indicate SEM of two experiments. Statistical analysis was conducted using the Student t-test. (C,D) show QRT-PCR against Cyclin-D1, c-Myc, and PCNA genes confirmed the cell cycle arrest of miR-3658 in SW480 cells. miR-3658 overexpression led to decreased c-Myc and PCNA expression levels in SW480 cells while in HCT116 does not affect. Error bars indicate SEM of two experiments. Statistical analysis was conducted using the Student t-test. (E) Represents the MTT assay results of SW480, HCT116, and HT29 cells under miR-3658 overexpression in different time points. Unlike in HCT116 cells and HT29 cells, a significant survival rate reduction was detected when miR-3658 was overexpressed in SW480 cells. Error bars indicate SEM of three experiments. Statistical analysis was conducted using the Student t-test.

Figure 4.
The effects of miR-3658 overexpression on cell cycle progression and proliferation.

(A,B) are flow cytometry histograms of two colorectal cancer originated cell lines in which miR-3658 or mock control has been overexpressed. It also shows miR-3658 overexpression effect on the cell cycle status measured by flow cytometry. Overexpression of miR-3658 has led to the cell cycle arrest in SW480 (high expression of OCT4) cells while in HCT116 (low expression of OCT4) cells, the number of s-phased cells have been increased. Error bars indicate SEM of two experiments. Statistical analysis was conducted using the Student t-test. (C,D) show QRT-PCR against Cyclin-D1, c-Myc, and PCNA genes confirmed the cell cycle arrest of miR-3658 in SW480 cells. miR-3658 overexpression led to decreased c-Myc and PCNA expression levels in SW480 cells while in HCT116 does not affect. Error bars indicate SEM of two experiments. Statistical analysis was conducted using the Student t-test. (E) Represents the MTT assay results of SW480, HCT116, and HT29 cells under miR-3658 overexpression in different time points. Unlike in HCT116 cells and HT29 cells, a significant survival rate reduction was detected when miR-3658 was overexpressed in SW480 cells. Error bars indicate SEM of three experiments. Statistical analysis was conducted using the Student t-test.

To further validate the anticancer role of miR-3658 in CRC, its effect on different CRC cell lines (SW480, HCT116, and HT29) viability was investigated using MTT assay in different time points. The results demonstrated that miR-3658 overexpression significantly attenuated SW480 cells viability at 24, 48, and 72 h after transfection. While, it did not affect HCT116 and HT29 cell viability, detected through MTT assay (Figure 4E).

Suppression of SW480 cell migration following miR-3658 overexpression

Considering the role of OCT4 in promoting cell migration, we investigated the effect of miR-3658 overexpression on the migration capacity of SW480 cells, using a wound-healing assay. Results indicated that the migration rate of SW480 cells has been significantly reduced following the overexpression of miR-3658, compared with mock control (Figure 5A). Once again, these data further denoted the biological importance of miR-3658 in CRC progression.

Effect of miR-3658 overexpression on SW480 cell migration.

Figure 5.
Effect of miR-3658 overexpression on SW480 cell migration.

(A) Represent the images from the result of the wound healing assay in SW480 cells. The up-regulation of miR-3658 inhibited the migration of SW480 cells at the given time point. Error bars indicate SEM of three experiments. (B) RT-qPCR showing the expression of epithelial and mesenchymal markers in SW480 cells upon miR-3658 transfection compared with mock vector-transfected cells. Error bars indicate SEM of two experiments. Statistical analysis was conducted using the Student t-test.

Figure 5.
Effect of miR-3658 overexpression on SW480 cell migration.

(A) Represent the images from the result of the wound healing assay in SW480 cells. The up-regulation of miR-3658 inhibited the migration of SW480 cells at the given time point. Error bars indicate SEM of three experiments. (B) RT-qPCR showing the expression of epithelial and mesenchymal markers in SW480 cells upon miR-3658 transfection compared with mock vector-transfected cells. Error bars indicate SEM of two experiments. Statistical analysis was conducted using the Student t-test.

Secondly, to assess the miR-3658 effect on epithelial-to-mesenchymal transition, Claudin1, B-catenin (epithelial marker [29,30]), ZEB1, and Snail (mesenchymal markers [30,31]) genes expression were checked in SW480 cells. An increase in the expression of the epithelial marker and a decrease in expression of the mesenchymal markers indicated that overexpression of miR-3658 reduced SW480 invasive capacity (Figure 5B).

Discussion

CRC is one of the most prevalent malignant tumors in the world in terms of high cellular/molecular heterogeneity [32]. Increasing evidence has demonstrated the importance of cancer stem cells in cancer recurrence, drug resistance and metastatic epithelial-to-mesenchymal transition [33–35]. Recent studies support the contribution of Oct4 protein as a key transcription factor in self-renewal and pluripotency of embryonic stem cells, in multiple pathological processes that contribute to tumorigenesis [36–38]. That is why understanding the molecular mechanism of OCT4 deregulation and finding the regulators of this gene could be beneficial for future cancer research. Recent studies have shown the presence of cancer stem cells in a variety of leukemia and tumor tissues. These cell types play an important role in the process of tumor cell invasion and metastasis. Tumor microenvironment, miRNAs and their controlling factors are also important regulators of cancer stem cell function [39,40].

Given that, miRNAs are involved in the regulation of multiple pathological processes through targeting numerous genes and play important role in cancer progression [40,41], we have searched for the candidate miRNAs which are potentially involved in CRC incidence through regulating OCT4 gene expression.

RT-qPCR expression analysis of miR-3658 in 15 pairs of CRC specimens consistent with RNA seq data indicated that this miRNA is down-regulated in CRC. Consistently, the expression status of OCT4 gene was investigated both in CRC specimens and RNAseq data and results indicated the up-regulation of this gene in tumors.

The oncogenic function of OCT4 has already been reported in several cancers such as breast, bladder, cervical, etc. [42,43]. Moreover, Zhou et al., [44] have introduced OCT4 as a CRC marker so that the expression of it, is significantly associated with the development and prognosis of CRC. Besides, it is reported that the up-regulation of the OCT4 transcript in somatic tissues is associated with cancer stem cells [45].

We have used HT29, HCT116, and SW480 CRC originated cell lines in our experiments, representing different grads of CRC progression. However, the expression level difference of both miR-3658 and OCT4 expression in these cell lines could be attributed to the different environmental status of these cell lines.

The interactions between miRNAs and environmental factors are play critical roles in determining abnormal phenotypes and diseases [46]. So, the cell lines selection is a critical first step in miRNA research. There are different CRC cell lines [3–5] which are representing different grads and stages of this cancer.

Caco2 and HT29 are the models of less metastatic and more differentiated colon cancer cells. However, HCT116 and SW480 cell lines contain CSCs [47]. Specially, SW480 cells are frequently used as a model of more metastatic undifferentiated cancer cells. Besides, the SW480 had higher expression of OCT4 at both the gene and protein levels signifying SW480 has properties of CSCs [47,48]. Here, due to the presence of CSCs in the SW480 and HCT116 cell lines, they were selected for investigating the expression status of miR-3658 and OCT4 gene at RNA and protein levels.

Consistent with other studies [49], the results of the expression analysis, indicated that the OCT4 expression level in SW480 cells was relatively higher than its level in HCT116 cells. However, the miR-3658 expression level in both cell lines was reverse to the expression level of the OCT4 gene (Figure 2). Consistent with the notion that miR-3658 is a negative regulator of OCT4 gene expression, miR-3658 overexpression in SW480 cells resulted in reduced OCT4 expression levels both at the mRNA and protein levels. Interestingly, such inhibitory effect for miR-3658 against OCT4 gene expression was not detected in HCT116 cells, probably due to the much lower level of OCT4 gene expression in this cell line. Based on previous studies, miRNA target genes with low mRNA expression levels are probably under strong regulation by endogenous miRNAs. Likewise, miRNA target genes with high mRNA expression are less likely to have strong internal miRNA regulation [50]. Therefore, since the expression of OCT4 in HCT116 cells is relatively lower and the expression of miR-3658 is higher than in SW480 cells (Figure 2), consistent to the observed results OCT4 gene expression was less affected in HCT116 cells, following the overexpression of exogenous miR-3658 (Figure 3).

SOX2 transcription factor and stemness marker is known to be regulated by Oct4 protein. In SW480 cells with up-regulated miR-3658 expression level, SOX2 gene expression was reduced, compared with cells transfected with the mock control construct. Down-regulation of SOX2 following the overexpression of miR-3658 in SW480 cells, is consistent to its effect on OCT4 gene expression.

Since the only ∼20% of changes in expression patterns of target genes could be attributed to the direct miRNA–mRNA interactions, investigation of direct interaction of miR-3658 with OCT4 3′-UTR seemed necessary. The results of the dual-luciferase assay supported the direct interaction of miR-3658 with the OCT4 gene 3′UTR transcript. Once again, these results supported the regulatory effect of miR-3658 against OCT4 gene expression through direct interaction.

Multiple studies supporting the role of OCT4 in cell cycle and apoptosis regulation by modulating cell cycle progression in G0/G1. Indeed, both the N-terminal and C-terminal transactivation domains of Oct-4 are important for the stimulation of S-phase entry [51]. For instance, OCT4, regulates CCND1 expression, as a bottleneck gene, and subsequently promoting cell cycle progression [52]. P21, a member of the universal cyclin-dependent kinase inhibitors (CDKIs), is another gene which its expression can be regulated by OCT4 and plays critical roles in the regulation of the G1/S transition [53]. To further explore the putative tumor-suppressive effect of miR-3658 in human CRC cell lines, the mechanism of miR-3658 effect on the cell growth and viability in SW480 and HCT116 cell lines was examined. Results indicated that unlike in HCT116 cells in which OCT4 expression level is low, overexpression of miR-3658 in SW480 cells significantly inhibited cell proliferation as evidenced by cell cycle, cell cycle-associated genes expression, and MTT assays (Figure 4). The negative effect of miR-3658 on SW480 cell cycle and survival was confirmed through RT-qPCR against c-Myc (transcription factors associated with cell cycle control) and PCNA (a marker of replicating cells) genes, as well. Unlike in HCT116 cells, results supported that miR-3658 gain of function led to suppressing cell cycle progression in SW480 cells (Figure 4C,D). Together with the observed miR-3658 effects on cell cycle proliferation, these results suggest that miR-3658 regulates SW480 cell growth, at least in part, by targeting OCT4.

Metastasis is the neoplastic process that is responsible for the causes of cancer death. Recent studies reported that OCT4 may be involved in metastasis of CRC through the epithelial-mesenchymal transition (EMT) process [54,55]. EMT plays a critical role during the progression of cancers and it is necessary for metastasis of epithelial cancer [56]. CRC cells acquire the invasive phenotypes through alterations in cell morphology, cell–cell adhesion, the activity of cellular signaling pathways, and the extracellular matrix [57]. OCT4 gene has been described as one of the important factors through the regulation of epithelial-to-mesenchymal transition [58–60]. To further investigate whether the miR-3658 is associated with the progression of CRC, the wound-healing assay was performed in SW480 cells. Consistent with its suggested tumor suppressor effect, the up-regulation of miR-3658 was followed by inhibition of SW480 cell migration in a scratch-based assay (Figure 5). This migration suppressing effect of miR-3658, is probably related to the role of this miRNA in regulating OCT4 gene expression. Likewise, EMT-involved genes expression in SW480 cells was decreased upon miR-3658 overexpression, which suggests that miR-3658 may also function as a metastasis suppressor probably, by regulation OCT4 gene expression.

In summary, our findings suggested that down-regulated miR-3658 expression in CRC samples is related to CRC progression. The results of the current study show that, miR-3658 is a regulator of cell proliferation and migration in SW480 cells by targeting the OCT4 gene, suggesting that miR-3658 may serve as a promising target and diagnostic marker for treatment of CRC patients. Although these findings are promising, further data collection would be needed to determine exactly how miR-3658 is down-regulated and affects CRC.

Competing Interests

The authors declare that there are no competing interests associated with the manuscript.

Author Contributions

F.H. and B.M.S. conceived and designed the experiments. F.H. performed the experiments. F.H. and B.M.S. analyzed the data. B.M.S., S.H., and H.B., administrative and financial support. F.H and B.M.S. wrote the manuscript.

Funding

This study was funded by the Tarbiat Modares University and the National Institute for Medical Research Development (NIMAD) to B.M.S.

Acknowledgements

We express our appreciation to the members of the 4402 laboratory in TMU and Hassan Ansari at Royan Institute for their technical assistance.

Abbreviations

     
  • CRC

    colorectal cancer

  •  
  • EMT

    epithelial-mesenchymal transition

  •  
  • GFP

    green fluorescent protein

  •  
  • miRNAs

    microRNAs

  •  
  • MRE

    recognition element

References

References
1
Hadjipetrou
,
A.
,
Anyfantakis
,
D.
,
Galanakis
,
C.G.
,
Kastanakis
,
M.
and
Kastanakis
,
S.
(
2017
)
Colorectal cancer, screening and primary care: a mini literature review
.
World J. Gastroenterol.
23
,
6049
6058
2
Fakih
,
M.G.
(
2015
)
Metastatic colorectal cancer: current state and future directions
.
J. Clin. Oncol.
33
,
1809
1824
3
Kindler
,
H.L.
and
Shulman
,
K.L.
(
2001
)
Metastatic colorectal cancer
.
Curr. Treat Options Oncol.
2
,
459
471
4
Wen
,
K.
,
Fu
,
Z.
,
Wu
,
X.
,
Feng
,
J.
,
Chen
,
W.
and
Qian
,
J.
(
2013
)
Oct-4 is required for an antiapoptotic behavior of chemoresistant colorectal cancer cells enriched for cancer stem cells: effects associated with STAT3/Survivin
.
Cancer Lett.
333
,
56
65
5
Grünert
,
S.
,
Jechlinger
,
M.
and
Beug
,
H.
(
2003
)
Diverse cellular and molecular mechanisms contribute to epithelial plasticity and metastasis
.
Nat. Rev. Mol. Cell Biol.
4
,
657
6
Dai
,
X.
,
Ge
,
J.
,
Wang
,
X.
,
Qian
,
X.
,
Zhang
,
C.
and
Li
,
X.
(
2013
)
OCT4 regulates epithelial-mesenchymal transition and its knockdown inhibits colorectal cancer cell migration and invasion
.
Oncol. Rep.
29
,
155
160
7
El Moneim
,
N.A.
,
El Feky
,
S.
,
Ibrahim
,
F.-M.
,
Ahmed
,
M.
,
Kadhem
,
K.
and
Sheweita
,
S.A.
(
2017
)
Significance of stem cell markers OCT4 and Nanog expression in the diagnosis of breast cancer
.
Breast
32
,
S52
8
Xie
,
R.
,
Xu
,
J.
,
Hu
,
Y.
,
Zhao
,
J.
and
Tuo
,
B.J.G.
(
2018
)
Sa1199-acidic microenvironment upregulates Nanog and Oct4 expressions through Trpv4/calcium axis to promote cancer stem cell-like properties in human gastric cancer
.
Gastroenterology
154
,
S-275
9
van Schaijik
,
B.
,
Davis
,
P.F.
,
Wickremesekera
,
A.C.
,
Tan
,
S.T.
and
Itinteang
,
T.
(
2018
)
Subcellular localisation of the stem cell markers OCT4, SOX2, NANOG, KLF4 and c-MYC in cancer: a review
.
J. Clin. Pathol.
71
,
88
89
10
Wang
,
Y.-J.
and
Herlyn
,
M.
(
2015
)
The emerging roles of Oct4 in tumor-initiating cells
.
Am. J. Physiol. Cell Physiol.
309
,
C709-18
11
Atlasi
,
Y.
,
Mowla
,
S.J.
,
Ziaee
,
S.A.
and
Bahrami
,
A.R.
(
2007
)
OCT-4, an embryonic stem cell marker, is highly expressed in bladder cancer
.
Int. J. Cancer
120
,
1598
1602
12
Gazouli
,
M.
,
Roubelakis
,
M.G.
,
Theodoropoulos
,
G.E.
,
Papailiou
,
J.
,
Vaiopoulou
,
A.
,
Pappa
,
K.I.
et al (
2012
)
OCT4 spliced variant OCT4B1 is expressed in human colorectal cancer
.
Mol. Carcinog.
51
,
165
173
13
Huang
,
Z.J.
,
You
,
J.
,
Luo
,
W.Y.
,
Chen
,
B.S.
,
Feng
,
Q.Z.
,
Wu
,
B.L.
et al (
2015
)
Reduced tumorigenicity and drug resistance through the downregulation of octamer-binding protein 4 and Nanog transcriptional factor expression in human breast stem cells
.
Mol. Med. Rep.
11
,
1647
1654
14
Koo
,
B.
,
Lee
,
S.
,
Kim
,
J.
,
Huang
,
S.
,
Kim
,
S.
,
Rho
,
Y.
et al (
2015
)
Oct4 is a critical regulator of stemness in head and neck squamous carcinoma cells
.
Oncogene
34
,
2317
15
Wang
,
X.Q.
,
Ongkeko
,
W.M.
,
Chen
,
L.
,
Yang
,
Z.F.
,
Lu
,
P.
,
Chen
,
K.K.
et al (
2010
)
Octamer 4 (Oct4) mediates chemotherapeutic drug resistance in liver cancer cells through a potential Oct4–AKT–ATP-binding cassette G2 pathway
.
Hepatology
52
,
528
539
16
Samardzija
,
C.
,
Luwor
,
R.B.
,
Volchek
,
M.
,
Quinn
,
M.A.
,
Findlay
,
J.K.
and
Ahmed
,
N.
(
2015
)
A critical role of Oct4A in mediating metastasis and disease-free survival in a mouse model of ovarian cancer
.
Mol. Cancer
14
,
152
17
Strebinger
,
D.
,
Deluz
,
C.
,
Friman
,
E.T.
,
Govindan
,
S.
,
Alber
,
A.B.
and
Suter
,
D.M.
(
2019
)
Endogenous fluctuations of OCT4 and SOX2 bias pluripotent cell fate decisions
.
Molecular systems biology
15
,
e9002
18
Wang
,
Z.
,
Oron
,
E.
,
Nelson
,
B.
,
Razis
,
S.
and
Ivanova
,
N.
(
2012
)
Distinct lineage specification roles for NANOG, OCT4, and SOX2 in human embryonic stem cells
.
Cell Stem Cell
10
,
440
454
19
Blenkiron
,
C.
and
Miska
,
E.A.
(
2007
)
miRNAs in cancer: approaches, aetiology, diagnostics and therapy
.
Hum. Mol. Genet.
16
,
R106-13
20
Meltzer
,
P.S.
(
2005
)
Small RNAs with big impacts
.
Nature
435
,
745
21
Xiao
,
M.
,
Li
,
J.
,
Li
,
W.
,
Wang
,
Y.
,
Wu
,
F.
,
Xi
,
Y.
et al (
2017
)
MicroRNAs activate gene transcription epigenetically as an enhancer trigger
.
RNA Biol.
14
,
1326
1334
22
Kumar
,
B.
,
Rosenberg
,
A.Z.
,
Choi
,
S.M.
,
Fox-Talbot
,
K.
,
De Marzo
,
A.M.
,
Nonn
,
L.
et al (
2018
)
Cell-type specific expression of oncogenic and tumor suppressive microRNAs in the human prostate and prostate cancer
.
Sci. Rep.
8
,
7189
23
He
,
L.
and
Hannon
,
G.J.
(
2004
)
MicroRNAs: small RNAs with a big role in gene regulation
.
Nat. Rev. Genet.
5
,
522
24
Shenoy
,
A.
and
Blelloch
,
R.H.
(
2014
)
Regulation of microRNA function in somatic stem cell proliferation and differentiation
.
Nat. Rev. Mol. Cell Biol.
15
,
565
25
Gangaraju
,
V.K.
and
Lin
,
H.
(
2009
)
MicroRNAs: key regulators of stem cells
.
Nat. Rev. Mol. Cell Biol.
10
,
116
26
Visone
,
R.
and
Croce
,
C.M.
(
2009
)
MiRNAs and cancer
.
Am. J. Pathol.
174
,
1131
1138
27
Michael
,
M.Z.
,
O'Connor
,
S.M.
,
van Holst Pellekaan
,
N.G.
,
Young
,
G.P.
and
James
,
R.J.
(
2003
)
Reduced accumulation of specific microRNAs in colorectal neoplasia
.
Mol. Cancer Res.
1
,
882
891
PMID:
[PubMed]
28
Moridikia
,
A.
,
Mirzaei
,
H.
,
Sahebkar
,
A.
and
Salimian
,
J.
(
2018
)
MicroRNAs: potential candidates for diagnosis and treatment of colorectal cancer
.
J. Cell Physiol.
233
,
901
913
29
Lim
,
S.-C.
and
Lee
,
M.-S.
(
2002
)
Significance of E-cadherin/β-catenin complex and cyclin D1 in breast cancer
.
Oncol. Rep.
9
,
915
928
PMID:
[PubMed]
30
Martínez-Estrada
,
O.M.
,
Cullerés
,
A.
,
Soriano
,
F.X.
,
Peinado
,
H.
,
Bolós
,
V.
,
Martínez
,
F.O.
et al (
2006
)
The transcription factors Slug and Snail act as repressors of Claudin-1 expression in epithelial cells
.
Biochem. J.
394
,
449
457
31
Wu
,
H.-T.
,
Zhong
,
H.-T.
,
Li
,
G.-W.
,
Shen
,
J.-X.
,
Ye
,
Q.-Q.
,
Zhang
,
M.-L.
et al (
2020
)
Oncogenic functions of the EMT-related transcription factor ZEB1 in breast cancer
.
J. Trans. Med.
18
, 5
1
32
Testa
,
U.
,
Pelosi
,
E.
and
Castelli
,
G.
(
2018
)
Colorectal cancer: genetic abnormalities, tumor progression, tumor heterogeneity, clonal evolution and tumor-initiating cells
.
Med. Sci.
6
,
31
33
Vaiopoulos
,
A.G.
,
Kostakis
,
I.D.
,
Koutsilieris
,
M.
and
Papavassiliou
,
A.G.
(
2012
)
Colorectal cancer stem cells
.
Stem Cells
30
,
363
371
34
Dalerba
,
P.
,
Dylla
,
S.J.
,
Park
,
I.-K.
,
Liu
,
R.
,
Wang
,
X.
,
Cho
,
R.W.
et al (
2007
)
Phenotypic characterization of human colorectal cancer stem cells
.
Proc. Natl. Acad. Sci. U.S.A.
104
,
10158
10163
35
Lu
,
J.
,
Ye
,
X.
,
Fan
,
F.
,
Xia
,
L.
,
Bhattacharya
,
R.
,
Bellister
,
S.
et al (
2013
)
Endothelial cells promote the colorectal cancer stem cell phenotype through a soluble form of Jagged-1
.
Cancer Cell
23
,
171
185
36
Linn
,
D.E.
,
Yang
,
X.
,
Sun
,
F.
,
Xie
,
Y.
,
Chen
,
H.
,
Jiang
,
R.
et al (
2010
)
A role for OCT4 in tumor initiation of drug-resistant prostate cancer cells
.
Genes Cancer
1
,
908
916
37
Guerra-Rebollo
,
M.
,
Garrido
,
C.
,
Sánchez-Cid
,
L.
,
Soler-Botija
,
C.
,
Meca-Cortés
,
O.
,
Rubio
,
N.
et al (
2019
)
Targeting of replicating CD133 and OCT4/SOX2 expressing glioma stem cells selects a cell population that reinitiates tumors upon release of therapeutic pressure
.
Sci. Rep.
9
,
1
13
38
El-Guindy
,
D.M.
,
Wasfy
,
R.E.
,
Ghafar
,
M.T.A.
,
Ali
,
D.A.
and
Elkady
,
A.M.
(
2019
)
Oct4 expression in gastric carcinoma: association with tumor proliferation, angiogenesis and survival
.
J. Egypt. Natl. Cancer Inst.
31
,
3
39
Clarke
,
M.F.
and
Hass
,
A.T.
(
2006
)
Cancer stem cells
.
Rev. Cell Biol. Mol. Med
.
4
,
221
40
Khan
,
A.Q.
,
Ahmed
,
E.I.
,
Elareer
,
N.R.
,
Junejo
,
K.
,
Steinhoff
,
M.
and
Uddin
,
S.
(
2019
)
Role of miRNA-regulated cancer stem cells in the pathogenesis of human malignancies
.
Cells
8
,
840
41
Ru
,
T.
,
Prieto-Vila
,
M.
,
Kohama
,
I.
and
Ochiya
,
T.
(
2019
)
Development of miRNA-based therapeutic approaches for cancer patients
.
Cancer Sci.
110
,
1140
42
Wei
,
Y.
,
Liu
,
H.
,
Wang
,
C.
,
Zhang
,
W.
,
Wen
,
X.
,
Long
,
H.
et al (
2019
)
Clinicopathological and prognostic significance of octamer-binding transcription factor 4 in patients with gastric cancer: a systematic review and meta-analysis
.
Biomark. Med.
13
,
219
234
43
Li
,
H.
,
Wang
,
L.
,
Shi
,
S.
,
Xu
,
Y.
,
Dai
,
X.
,
Li
,
H.
et al (
2019
)
The prognostic and clinicopathologic characteristics of OCT4 and lung cancer: a meta-analysis
.
Curr. Mol. Med.
19
,
54
75
44
Zhou
,
H.
,
Hu
,
Y.
,
Wang
,
W.
,
Mao
,
Y.
,
Zhu
,
J.
,
Zhou
,
B.
et al (
2015
)
Expression of Oct-4 is significantly associated with the development and prognosis of colorectal cancer
.
Oncol. Lett.
10
,
691
696
45
Santagata
,
S.
,
Ligon
,
K.L.
and
Hornick
,
J.L.
(
2007
)
Embryonic stem cell transcription factor signatures in the diagnosis of primary and metastatic germ cell tumors
.
Am. J. Surg. Pathol.
31
,
836
845
46
Wang
,
J.
and
Cui
,
Q.
(
2012
)
Specific roles of microRNAs in their interactions with environmental factors
.
J. Nucleic Acids
2012
,
978384
47
Xiong
,
B.
,
Ma
,
L.
,
Hu
,
X.
,
Zhang
,
C.
and
Cheng
,
Y.
(
2014
)
Characterization of side population cells isolated from the colon cancer cell line SW480
.
Int. J. Oncol.
45
,
1175
1183
48
Pérez-Moreno
,
P.
,
Indo
,
S.
,
Niechi
,
I.
,
Huerta
,
H.
,
Cabello
,
P.
,
Jara
,
L.
et al (
2020
)
Endothelin-converting enzyme-1c promotes stem cell traits and aggressiveness in colorectal cancer cells
.
Mol. Oncol.
14
,
347
362
49
Rao
,
G.-H.
,
Liu
,
H.-M.
,
Li
,
B.-W.
,
Hao
,
J.-J.
,
Yang
,
Y.-L.
,
Wang
,
M.-R.
et al (
2013
)
Establishment of a human colorectal cancer cell line P6C with stem cell properties and resistance to chemotherapeutic drugs
.
Acta Pharmacol. Sin.
34
,
793
804
50
Khan
,
A.A.
,
Betel
,
D.
,
Miller
,
M.L.
,
Sander
,
C.
,
Leslie
,
C.S.
and
Marks
,
D.S.
(
2009
)
Transfection of small RNAs globally perturbs gene regulation by endogenous microRNAs
.
Nat. Biotechnol.
27
,
549
51
Lee
,
J.
,
Go
,
Y.
,
Kang
,
I.
,
Han
,
Y.-M.
and
Kim
,
J.
(
2010
)
Oct-4 controls cell-cycle progression of embryonic stem cells
.
Biochem. J.
426
,
171
181
52
Li
,
Z.
,
Li
,
X.
,
Li
,
C.
,
Su
,
Y.
,
Fang
,
W.
,
Zhong
,
C.
et al (
2014
)
Transcription factor OCT4 promotes cell cycle progression by regulating CCND1 expression in esophageal carcinoma
.
Cancer Lett.
354
,
77
86
53
Lu
,
Y.
,
Qu
,
H.
,
Qi
,
D.
,
Xu
,
W.
,
Liu
,
S.
,
Jin
,
X.
et al (
2019
)
OCT4 maintains self-renewal and reverses senescence in human hair follicle mesenchymal stem cells through the downregulation of p21 by DNA methyltransferases
.
Stem Cell Res. Ther.
10
,
1
16
54
Cheng
,
L.
(
2004
)
Establishing a germ cell origin for metastatic tumors using OCT4 immunohistochemistry
.
Cancer
101
,
2006
2010
55
Saigusa
,
S.
,
Tanaka
,
K.
,
Toiyama
,
Y.
,
Yokoe
,
T.
,
Okugawa
,
Y.
,
Ioue
,
Y.
et al (
2009
)
Correlation of CD133, OCT4, and SOX2 in rectal cancer and their association with distant recurrence after chemoradiotherapy
.
Ann. Surg. Oncol
16
,
3488
3498
56
Lu
,
W.
and
Kang
,
Y.
(
2019
)
Epithelial-mesenchymal plasticity in cancer progression and metastasis
.
Dev. Cell
49
,
361
374
57
Gurzu
,
S.
,
Silveanu
,
C.
,
Fetyko
,
A.
,
Butiurca
,
V.
,
Kovacs
,
Z.
and
Jung
,
I.
(
2016
)
Systematic review of the old and new concepts in the epithelial-mesenchymal transition of colorectal cancer
.
World J. Gastroenterol.
22
,
6764
58
Chiou
,
S.-H.
,
Wang
,
M.-L.
,
Chou
,
Y.-T.
,
Chen
,
C.-J.
,
Hong
,
C.-F.
,
Hsieh
,
W.-J.
et al (
2010
)
Coexpression of Oct4 and Nanog enhances malignancy in lung adenocarcinoma by inducing cancer stem cell-like properties and epithelial–mesenchymal transdifferentiation
.
Cancer Res.
70
,
10433
10444
59
Hu
,
J.
,
Guo
,
H.
,
Li
,
H.
,
Liu
,
Y.
,
Liu
,
J.
,
Chen
,
L.
et al (
2012
)
MiR-145 regulates epithelial to mesenchymal transition of breast cancer cells by targeting Oct4
.
PLoS One
7
,
e45965-e
60
Wang
,
D.
,
Lu
,
P.
,
Zhang
,
H.
,
Luo
,
M.
,
Zhang
,
X.
,
Wei
,
X.
et al (
2014
)
Oct-4 and Nanog promote the epithelial-mesenchymal transition of breast cancer stem cells and are associated with poor prognosis in breast cancer patients
.
Oncotarget
5
,
10803