CGA-N12, an antifungal peptide derived from chromogranin A, has specific antagonistic activity against Candida spp., especially against Candida tropicalis, by inducing cell apoptosis. However, the effect of CGA-N12 on the Candida cell wall is unknown. The Candida protein KRE9, which possesses β-1,6-glucanase activity, was screened by affinity chromatography after binding to CGA-N12. In this study, the effect of CGA-N12 on KRE9 and the interaction between CGA-N12 and KRE9 was studied to clarify the effect of CGA-N12 on C. tropicalis cell wall synthesis. The effect of CGA-N12 on recombinant KRE9 β-1,6-glucanase activity was investigated by analyzing the consumption of glucose. The results showed that CGA-N12 inhibited the activity of KRE9. After C. tropicalis was treated with CGA-N12, the structure of the C. tropicalis cell wall was damaged. The interaction between CGA-N12 and KRE9 was analyzed by isothermal titration calorimetry (ITC). The results showed that their interaction process was involved an endothermic reaction, and the interaction force was mainly hydrophobic with a few electrostatic forces. The results of the fluorescence resonance energy transfer (FRET) assay showed that the distance between CGA-N12 and KRE9 was 7 ∼ 10 nm during their interaction. Therefore, we concluded that the target of CGA-N12 in the C. tropicalis cell membrane is KRE9, and that CGA-N12 weakly binds to KRE9 within a 7 ∼ 10 nm distance and inhibits KRE9 activity.

Introduction

Candidemia poses a serious threat to immunocompromised patients. Candida species are opportunistic pathogens that cause superficial and systemic infections with increasingly invasive mycosis [1,2]. A major concern of invasive candidiasis is its association with an excess attributable mortality rate of 10–57% [3,4]. Non-albicans Candida infections are becoming important clinical pathogenic conditions [5,6]. Candida tropicalis has been widely considered the second most virulent Candida species, preceded only by C. albicans [7–10]. The yeast cell wall is an extracellular matrix consisting of insoluble chitin, glycoproteins, and glucan polymers cross-linked into a complex structural array at the cell surface [11] and has essential roles in growth and morphogenesis. β-Glucans, which are composed of (1–3)-β-linked polymers and (1–6)-β-glucan polymers, are abundant yeast cell surface polysaccharides that compose approximately half of the total cell wall dry weight [12,13]. The cross-linked arrangement of these polysaccharides to each other and to chitin in the cell wall renders a large fraction of the glucan material insoluble in alkaline conditions [14].

Although β-1,6-glucan is a relatively minor component of the cell wall, it is critical for maintaining cell wall organization. β-1,6-Glucan is linked not only to β-1,3-glucan and chitin but also to GPI-anchored proteins, which are the major mannoproteins in the cell wall [14,15]. KRE9, which maintains β-1,6-glucanase activity, is a soluble form of a secretory protein and appears to be localized to the cell surface [16–19].

With the shortage of antifungal drugs and the continuous emergence of conventional antibiotic-resistant Candida strains, antimicrobial peptides (AMPs), which are novel antibiotic candidates, have attracted increasing interest. AMPs, which are widespread in nature, are also called natural antibiotics [20–22]. Due to their unique mechanism of action, AMPs are becoming potential candidates for controlling drug-resistant microbial pathogens [23]. Chromogranin A (CGA) is a protein that is widely present in neurons [24,25]. CGA-derived peptides are involved in innate immunity [26]. Those CGA-derived peptides, particularly in the N-terminal domain, exhibit antibacterial and antifungal activity [27]. CGA-N12corresponding to the region from the 65th to 76th amino acid of the N terminus of CGA has been shown to have specific anti-Candida activity with less haemolytic activity [28] and therapeutic effects in infected animal models [29]. CGA-N12 induces an overgeneration of intracellular reactive oxygen species and a dissipation of mitochondrial membrane potential. It is capable of inducing apoptosis in C. tropicalis cells through mitochondrial dysfunction and metacaspase activation [30]; however, the effect of CGA-N12 on the C. tropicalis cell wall remains unknown. In the present study, the target of CGA-N12 in Candida was screened by affinity chromatography. The KRE9 gene was cloned and recombinant KRE9 (rKRE9) was expressed. The effect of CGA-N12 on rKRE9 β-1,6-glucanase activity was investigated by analyzing the consumption of glucose. The interaction between CGA-N12 and KRE9 was investigated by isothermal titration calorimetry (ITC) and fluorescence resonance energy transfer (FRET) assays.

Materials and methods

Microorganism and materials

The plasmids used in this study are listed in Table 1. The strains used in this study are listed in Table 2. The primers for PCR used in this study are listed in Table 3. The AMP CGA-N12 with N-terminal and C-terminal deprotection was synthesized by performing solid-phase synthesis according to a previously reported method [28]. Other chemicals used in the present study were of analytical grade and from commercial suppliers.

Table 1
Plasmids used in this study
Name Characteristic References 
pET28a Expression vector, Kanr Novagen 
pETDute-1 Expression vector, Ampr Novagen 
pET-28-CFP The cyan fluorescent protein gene was ligated and cloned into the multiple cloning site of pET28a Novagen 
pET-28-YFP The yellow fluorescent protein gene was ligated and cloned into the multiple cloning site of pET28a Novagen 
pET-28-KRE9 The KRE9 gene was ligated and cloned into the multiple cloning site of pET28a This study 
pETDuet-KRE9-CFP The KRE9-CFP fusion gene was ligated and cloned into the multiple cloning site of pETDuet-1. This study 
pETDuet-YFP-N12 The YFP-CGA-N12 fusion gene was ligated and cloned into the multiple cloning site of pETDuet-1 This study 
pETDuet-PT7-KRE9-CFP-PT7-YFP-N12 The KRE9-CFP fusion gene and YFP-CGA-N12 fusion gene were cloned into the two multiple cloning sites downstream of pETDuet-1. This study 
Name Characteristic References 
pET28a Expression vector, Kanr Novagen 
pETDute-1 Expression vector, Ampr Novagen 
pET-28-CFP The cyan fluorescent protein gene was ligated and cloned into the multiple cloning site of pET28a Novagen 
pET-28-YFP The yellow fluorescent protein gene was ligated and cloned into the multiple cloning site of pET28a Novagen 
pET-28-KRE9 The KRE9 gene was ligated and cloned into the multiple cloning site of pET28a This study 
pETDuet-KRE9-CFP The KRE9-CFP fusion gene was ligated and cloned into the multiple cloning site of pETDuet-1. This study 
pETDuet-YFP-N12 The YFP-CGA-N12 fusion gene was ligated and cloned into the multiple cloning site of pETDuet-1 This study 
pETDuet-PT7-KRE9-CFP-PT7-YFP-N12 The KRE9-CFP fusion gene and YFP-CGA-N12 fusion gene were cloned into the two multiple cloning sites downstream of pETDuet-1. This study 
Table 2
Bacterial strains used in this study
Name Characteristic References 
E. coli DH5α F ϕ80 lacZΔM15 Δ(lacZYA-argF)U169 recA1 endA1 hsdR17(rk, mk+) supE44λ-thi-1 Novagen 
E. coli BL21 (DE3) F ompT gal dcm lon hsdSB(rBmB) λ(DE3) Novagen 
E. coli BL21 (pETDuet-KRE9-CFP) E. coli BL21(DE3) harbouring pETDuet-KRE9-CFP This study 
E. coli BL21 (pETDuet-YFP-N12) E. coli BL21(DE3) harbouring pETDuet-YFP-N12 This study 
E. coli BL21(pETDuet-PT7-KRE9-CFP-PT7-YFP-N12) E. coli BL21(DE3) harbouring pETDuet-PT7-KRE9-CFP-PT7-YFP-N12 This study 
Name Characteristic References 
E. coli DH5α F ϕ80 lacZΔM15 Δ(lacZYA-argF)U169 recA1 endA1 hsdR17(rk, mk+) supE44λ-thi-1 Novagen 
E. coli BL21 (DE3) F ompT gal dcm lon hsdSB(rBmB) λ(DE3) Novagen 
E. coli BL21 (pETDuet-KRE9-CFP) E. coli BL21(DE3) harbouring pETDuet-KRE9-CFP This study 
E. coli BL21 (pETDuet-YFP-N12) E. coli BL21(DE3) harbouring pETDuet-YFP-N12 This study 
E. coli BL21(pETDuet-PT7-KRE9-CFP-PT7-YFP-N12) E. coli BL21(DE3) harbouring pETDuet-PT7-KRE9-CFP-PT7-YFP-N12 This study 
Table 3
Primers used in this study
Primer Sequence(5′–3′) References 
KRE9-F1 (BamH I) CTGGATCCATGAGATTCTTT This study 
KRE9-R1 (Hind III) ACAAGCTTTTACTAATCTAACCA This study 
KRE9-F2 (BamH I) CAGGATCCGGATGTTGATATTACTTCACCATCT This study 
KRE9-R2 CTCCACCCCCATCTAACCATCTTCTTCTCTTGGTA This study 
CFP-F AAGATGGTTAGATGGGGGTGGAGGCTCTGGGGGTGGAGGCTCTATGGTGAGCAAGGGCG This study 
CFP-R (Hind III) GCAAGCTTTTACTTGTACAGCTCGTCCATGC This study 
YFP-CGA-N12-F (Nde I) TACATATGGTGAGCAAGGGC This study 
YFP-CGA-N12-R (Kpn I) AGGGTACCTTACTGCTGATGTGCCCTCTCCTTGGCGCCTTGGAGAGCCTTGTACAGCTCGTC This study 
Primer Sequence(5′–3′) References 
KRE9-F1 (BamH I) CTGGATCCATGAGATTCTTT This study 
KRE9-R1 (Hind III) ACAAGCTTTTACTAATCTAACCA This study 
KRE9-F2 (BamH I) CAGGATCCGGATGTTGATATTACTTCACCATCT This study 
KRE9-R2 CTCCACCCCCATCTAACCATCTTCTTCTCTTGGTA This study 
CFP-F AAGATGGTTAGATGGGGGTGGAGGCTCTGGGGGTGGAGGCTCTATGGTGAGCAAGGGCG This study 
CFP-R (Hind III) GCAAGCTTTTACTTGTACAGCTCGTCCATGC This study 
YFP-CGA-N12-F (Nde I) TACATATGGTGAGCAAGGGC This study 
YFP-CGA-N12-R (Kpn I) AGGGTACCTTACTGCTGATGTGCCCTCTCCTTGGCGCCTTGGAGAGCCTTGTACAGCTCGTC This study 

Note: The bold nucleic acid sequence in primer KRE9-R2 is complementary with the bold nucleic acid sequence in primer CFP-F. The bold nucleic acid sequence in primer YFP-CGA-N12-R is the nucleic acid sequence of CGA-N12. The underlined sequences indicate the restriction endonuclease recognition sites.

Physicochemical property analysis

The physicochemical properties of the peptides, including the molecular mass, isoionic point (PI), and GRAVY, were predicted using the structural prediction software ProtParam tool on the bioinformatics website ExPASy (http://www.expasy.ch/tools/). The hydrophilicity and hydrophobicity of the peptide was predicted by GRAVY. The peptide was hydrophobic when the GRAVY value was positive; otherwise, it was hydrophilic [28]. The net charge was calculated from the sum of the charged amino acids.

Affinity chromatography

Total protein was extracted from C. tropicalis using the Total Protein Extraction Kit (Sangon Biotech, Shanghai, China), and the proteins that bound CGA-N12 were isolated by using affinity chromatography. The affinity chromatography process was performed as described below. CNBr-activated agarose powder (Sangon Biotech, Shanghai, China) was hydrated in HCl solution (1 mmol/l) (1 : 10, w/v) for 15 min at room temperature. After being washed with cold HCl solution (1 mmol/l) followed by cold coupling buffer (0.5 mol/l NaCl and 0.l mol/l NaHCO3, pH 8.3), 100 µl of CGA-N12 solution in coupling buffer was added to 20 µl of wet resin, and the resin suspension was incubated on a rotator for 16–20 h at 4°C. To block the unresponsive coupling sites, ethanolamine (1 mo1/l, pH 8.0) was added at 4°C, and then the resin was washed with a high-pH buffer (0.5 mol/l NaCl and 0.1 mol/l Tris–HCl, pH 8.3) and low-pH buffer (0.5 mol/l NaCl and 0.1 mo1/l acetic acid/sodium acetate buffer, pH 4.0) three times each. Phosphoric acid buffer was used as the equilibration buffer. The coupled resin was further washed with equilibration buffer followed by elution buffer and was packed into a column for affinity chromatography.

MS/MS analysis

CGA-N12-binding proteins were analyzed using a high-performance liquid chromatography-chip/electrospray ionization-quadrupole time-of-flight/tandem mass spectrometry (HPLC-Chip/ESI-QTOF/MS/MS). Protein digestion and peptide extraction were performed according to a previously reported protocol by Fang et al. [31]. The MS/MS procedure was conducted according to a previously reported procedure by Zhang et al. [32]. Ten microliters of trypsin solution (with a final concentration of 10 ng/µl) was added to a sample and incubated for 14 h at 37°C. To extract the peptide fragments from the trypsin-digested sample, 30 µl extraction buffer I (5% TFA) was added and incubated at 37°C for 1 h. Then, the supernatant was transferred into a new tube. The supernatant was concentrated to 20 µl using a Speed-Vac system (RVC 2–18, Marin Christ, Germany) for HPLC-Chip/ESI-QTOF/MS/MS system equipped with an autosampler G1377D (maintained at 4°C), a capillary sample loading pump (G1382A), a nano pump (G2225A) and an HPLC-Chip interface (Chip Cube G4240A) (Agilent Technologies, Santa Clara, CA). The HPLC-Chip (Phosphochip, G4240-620021, Agilent Technologies) consisted of an RP/TiO2/RP enrichment column and a ReproSil-Pur C18-AQ analytical column (75 µm × 150 mm, 5 µm), both with graphitized carbon (5 mm) as the stationary phase. All data were acquired in positive ionization mode within a mass to charge ratio (m/z) range of 300–3000. Tandem mass spectra were retrieved and stored in a combined mgf file using MassHunter software (Agilent Technologies). MS/MS data extracted from raw format were searched against a database containing protein sequences of Candida tropicalis MYA-3404 (6 254 entries) using in-house PEAKS software (version 6.0, Bioinformatics Solutions Inc.). The following modifications were applied: carbamidomethylation (C)/+57.02 Da was selected fixed modification and oxidation (M)/+15.99 Da was selected as variable modifications. The other parameters used were the following: parent ion mass tolerance, 20.0 ppm; fragment ion mass tolerance, 0.05 Da; enzyme, trypsin; maximum missed cleavages per peptide, 2; maximum allowed variable PTM per peptide, 3. The false discovery rate (FDR) was filtered to ≤1.0% (−10 log P ≥ 20.0) and unique peptides ≥1 with a target-decoy database searching strategy to distinguish positive and negative identifications.

Extraction of chromosomal DNA of C. tropicalis

To investigate the interaction between CGA-N12 and KRE9, the KRE9 gene was isolated and expressed by using recombinant DNA technology. All molecular biology experiments were performed according to a previously reported method [33].

The KRE9 open reading frame was identified in chromosome X [11]. C. tropicalis cells were collected in the exponential growth phase. Each cell lysate (0.1 g wet weight) was suspended in 1 ml of freshly prepared cell lysis buffer (0.5 mol/l NaCl, 50 mmol/l Tris–HCl (pH 8.0), 180 mmol/l EDTA (pH 8.0), and 1% SDS). Quartz sand was subsequently added into the mixture at three-thenths of the liquid volume. The mixture was oscillated for 10 min followed by incubation in a 65°C water bath for 30 min. A total of 600 µl of 7.5 µmol/l ammonium acetate solution was added and incubated in an ice bath for 10 min. After centrifugation, 1/10 volume of 3 mol/l NaAc and 3/5 volume of isopropanol were added to precipitate nucleic acids. After RNA and contaminated proteins were removed, the chromosomal DNA was extracted and purified.

Gene cloning and recombinant plasmid construction

PCR was used to amplify the KRE9 coding sequence. The chromosomal DNA of C. tropicalis was used as the PCR template. The KRE9 coding sequence was amplified using the primers KRE-F1 and KRE-R1 shown in Table 3. The PCR products were inserted into the pET-28a vector. The recombinant plasmid pET-28-KRE9 was constructed.

Overlapping PCR [34] was used to amplify the KRE9-CFP fusion gene. pET-28-CFP was used as the CFP PCR template with the primers CFP-F and CFP-R shown in Table 3. The chromosomal DNA of C. tropicalis was used as the template to amplify KRE9 using the primers KRE-F2 and KRE-R2 shown in Table 3. The products of CFP and KRE9 were mixed as the templates of the overlapping PCR with the primers CFP-R and KRE9-F2. The final PCR products of the KRE9-CFP fusion gene were inserted into the pETDuet-1 vector. The recombinant plasmid pETDuet-KRE9-CFP was constructed.

The YFP-CGA-N12 fusion gene, which consists of the YFP gene and the CGA-N12 gene, was amplified via the following procedure. The recombinant plasmid pET-28-YFP was used as a template for the YFP gene using the primers YFP-CGA-N12-F and YFP-CGA-N12-R shown in Table 3. The CGA-N12 coding gene was inserted into the 3′ terminus of the primer YFP-CGA-N12-R. The PCR product, which was the YFP-CGA-N12 fusion gene, was inserted into the pETDuet-1 vector. The recombinant plasmid pETDuet-YFP-N12 was constructed.

A recombinant plasmid containing pETDuet-PT7-KRE9-CFP-PT7-YFP-N12 was constructed by digesting the PCR products of KRE9-CFP and pETDuet-YFP-N12 with restriction endonuclease BamH I/Hind III and ligating with T4 DNA ligase. The PCR products of KRE9-CFP were inserted into the multiple cloning site downstream of PT7 in the pETDuet-1 plasmid.

In vivo protein expression and purification

The recombinant plasmids pET-28-KRE9, pETDuet-YFP-N12, pETDuet-KRE9-CFP, and pETDuet-PT7-KRE9-CFP-PT7-YFP-N12 were transformed into E. coli BL21 (DE3) for expression. The newly engineered strains were cultured in 100 ml fresh LB broth at 37°C in a shaker. Isopropyl β-D-thiogalactoside was added to the culture at a final concentration of 0.4 mmol/l in the mid-exponential growth phase (OD600 nm = 0.6–0.8), and the strains were further cultured at 20°C for 20 h to induce protein expression. The engineered E. coli BL21 (pET-28-KRE9) cell pellets were collected after isopropyl β-D-thiogalactoside induction and ultrasonically disrupted. The KRE9 protein was purified using the His-tag Protein Purification Kit (Beyotime, China) from the ultrasonic suspension and was analyzed by 16% sodium dodecyl sulfate-polyacrylamide gel electrophoresis. The purified recombinant protein was confirmed using an anti-His mouse monoclonal antibody (Sangon Biotech, China).

β-1,6-glucanase activity assay

To determine the impact of CGA-N12 on KRE9 β-1,6-glucanase activity, CGA-N12 (60 µg/ml) was preheated with KRE9 (10 µg/ml) at 40°C for 10 min. A 6 ml glucose solution (25 mg/ml) that was pre-warmed at 25°C was added and incubated at 40°C for 10, 20, 30, 40, 50, and 60 min. Then, 1.5 ml of 3,5-dinitrosalicylic acid (DNS) solution was added and further incubated in a water bath at 100°C for 10 min. The absorbances were measured by spectrophotometry at a wavelength of 540 nm. The enzymatic kinetics of KRE9 were expressed as glucose consumption using the regression equation y = 0.0011x − 0.0229 (R2 = 0.994) that was obtained by a standard curve of glucose. β-1,6-Glucanase was used as a positive control, and H2O was used as a negative control.

Transmission electron microscopy

The cell wall ultrastructure of C. tropicalis was observed with transmission electron microscopy following a previously reported method [35]. C. tropicalis (1 × 105 CFU/ml) in the exponential growth phase was incubated with CGA-N12 (0.1 mg/ml) for 4, 8, and 12 h at 28°C. The bacterial pellets were fixed in 5% glutaraldehyde in 20 mmol/l PBS (pH 7.0) overnight at 4°C. After being washed with PBS, the yeast pellets were fixed with 1% OsO4 in PBS for 2 h. They were then dehydrated by being washed in increasing concentrations (30, 50, 70, and 95%) of acetone (twice per concentration) for 10 min each and further dehydrated in absolute acetone with three washes at 10 min each. The samples were embedded in Epon 812. Ultrathin sections were stained with uranyl acetate for 1 h, followed by staining with lead nitrate, and then the samples were imaged with a JEOL electron microscope (JEM-1400, Japan).

Isothermal titration calorimetry (ITC)

ITC was performed using a MicroCal ITC 200 (GE Instrument Co., Beijing, China) to investigate the binding affinity between CGA-N12 and KRE9 according to a previously reported method [36]. Phosphate buffer (10 mM, pH 6.0) was prepared and degassed under ultrasonic cleaner prior to use. 2 µl for each injection of aliquots of 0.3 mM CGA-N12 were injected into the microcalorimetric cell containing 200 µl KRE9 (0.05 mM) at an interval of 120 s. The complete titration consisted of 20 injections. A high feedback level of mode/gain was selected, and the reaction cell was continuously stirred at 300 rpm. The titrations were performed at 25°C. The reaction heat was recorded. Raw data were corrected by subtracting the heat of dilution of CGA-12 in buffer. The ITC data were analyzed using a MicroCal Origin 5.0 package. The first data point was not considered and removed from analysis. A one-site binding model was selected to fit the data and determine the equilibrium association constant (Ka), binding stoichiometry (N), enthalpy change (ΔH) and the binding affinity (Kd). The Gibbs free energy (ΔG) and entropy change (ΔS) were calculated using the thermodynamic equations ΔG = RTlnKa and ΔS = (ΔH − ΔG)/T, respectively.

FRET

FRET [37,38] was employed in vivo to detect the interaction between KRE9-CFP and YFP-CGA-N12. The expression of the proteins of the engineered bacteria BL21 (pETDuet-KRE9-CFP), BL21 (pETDuet-YFP-N12), and BL21 (pETDuet-PT7-KRE9-CFP-PT7-YFP-N12) was induced in vivo at 20°C and 150 rpm for 20 h under isopropyl β-d-thiogalactoside induction. The fusion protein KRE9-CFP was expressed in the engineered bacteria BL21 (pETDuet-KRE9-CFP). The fusion protein YFP-CGA-N12 was expressed in the engineered bacteria BL21 (pETDuet-YFP-N12). The fusion proteins KRE9-CFP and YFP-CGA-N12 were co-expressed in the engineered bacteria BL21 (pETDuet-PT7-KRE9-CFP-PT7-YFP-N12). The cell pellets were resuspended in cold PBS and dropped on slides for observation under a laser confocal microscope (Olympus FV1000, Japan) at λex/λem = 405/488 nm for CFP, λex/λem = 488/527 nm for YFP and λex/λem = 405/527 nm for CFP-YFP-FRET.

Results

Binding proteins of CGA-N12

The proteins that bound to CGA-N12 by affinity chromatography were eluted and subjected to tandem mass spectrometry (MS/MS) analysis. The proteins are shown in the Supplementary Materials. A total of 17 proteins were eluted (see Supplementary Table), among which the protein KRE9, a β-1,6-glucanase, is involved in cell wall synthesis. After the MS/MS scores and research values were compared, KRE9 was investigated as a substrate of CGA-N12 that affects C. tropicalis cell wall synthesis.

Isolation of KRE9 gene and construction of recombinant plasmids

The KRE9 gene was acquired via polymerase chain reaction (PCR) methods using KRE9-F1 and KRE9-R1 as primers and the chromosomal DNA of C. tropicalis as template. The recombinant plasmid pET28a-KRE9, which bears the KRE9 gene, was constructed as shown in Figure 1. The CFP and KRE9 genes were fused by overlapping PCR (Figure 2A). The recombinant plasmid pET28a-KRE9-CFP, which bears the KRE9-CFP fusion gene was constructed as shown in Figure 2B. The fusion gene YFP-CGA-N12, consisting of the YFP gene and the CGA-N12 gene was obtained as shown in Figure 3A. The recombinant plasmid pETDuet-YFP-N12, which bears the YFP-CGA-N12 fusion gene, was constructed as shown in Figure 3B. The recombinant plasmid pETDuet-PT7-KRE9-CFP-PT7-YFP-N12 was constructed, as shown in Figure 4, and the fusion genes KRE9-CFP and YFP-CGA-N12 have T7 promoters.

Construction of the recombinant plasmid pET28a-KRE9.

Figure 1.
Construction of the recombinant plasmid pET28a-KRE9.

The KRE9 gene with Hind III and BamH I endonuclease sites at the 5′- and 3′- ends was amplified in the presence of C. tropicalis chromosomal DNA as a template. Restriction enzyme digestion of the KRE9 gene and plasmid pET28a was performed with Hind III and BamH I. The fragments KRE9/ Hind III + BamH I and pET28a/Hind III + BamH I were isolated by electrophoresis and ligated, and the recombinant plasmid pET28-KRE9 was obtained.

Figure 1.
Construction of the recombinant plasmid pET28a-KRE9.

The KRE9 gene with Hind III and BamH I endonuclease sites at the 5′- and 3′- ends was amplified in the presence of C. tropicalis chromosomal DNA as a template. Restriction enzyme digestion of the KRE9 gene and plasmid pET28a was performed with Hind III and BamH I. The fragments KRE9/ Hind III + BamH I and pET28a/Hind III + BamH I were isolated by electrophoresis and ligated, and the recombinant plasmid pET28-KRE9 was obtained.

Preparation of fusion gene KRE9-CFP and construction of the recombinant plasmid pETDuet-KRE9-CFP.

Figure 2.
Preparation of fusion gene KRE9-CFP and construction of the recombinant plasmid pETDuet-KRE9-CFP.

(A) Overlapping PCR flow chart of KRE9-CFP. The KRE9 gene was amplified with C. albicans chromosomal DNA as the temple and in the presence of primers KRE9-F2 and KRE9-R2. The CFP gene was amplified by using a commercial plasmid pET-28-CFP bearing the CFP gene and in the presence of primers CFP-F and CFP-R. Because there is a complimentary sequence in KRE9-R2 and CFP-F, the fusion gene KRE9-CFP was produced in the second cycle of the amplification. (B) Construction of the recombinant plasmid pETDuet-KRE9-CFP. Restriction enzyme digestion of the fusion gene KRE9-CFP and the plasmid pETDuet-1 with Hind III and BamH I. The fragments KRE9-CFP/Hind III + BamH I and pETDuet-1/Hind III + BamH I were isolated by electrophoresis and ligated by ligase. The recombinant plasmid pETDuet-KRE9-CFP was obtained.

Figure 2.
Preparation of fusion gene KRE9-CFP and construction of the recombinant plasmid pETDuet-KRE9-CFP.

(A) Overlapping PCR flow chart of KRE9-CFP. The KRE9 gene was amplified with C. albicans chromosomal DNA as the temple and in the presence of primers KRE9-F2 and KRE9-R2. The CFP gene was amplified by using a commercial plasmid pET-28-CFP bearing the CFP gene and in the presence of primers CFP-F and CFP-R. Because there is a complimentary sequence in KRE9-R2 and CFP-F, the fusion gene KRE9-CFP was produced in the second cycle of the amplification. (B) Construction of the recombinant plasmid pETDuet-KRE9-CFP. Restriction enzyme digestion of the fusion gene KRE9-CFP and the plasmid pETDuet-1 with Hind III and BamH I. The fragments KRE9-CFP/Hind III + BamH I and pETDuet-1/Hind III + BamH I were isolated by electrophoresis and ligated by ligase. The recombinant plasmid pETDuet-KRE9-CFP was obtained.

Preparation of fusion gene YFP-CGA-N12 and construction of the recombinant plasmid pETDuet-YFP-N12.

Figure 3.
Preparation of fusion gene YFP-CGA-N12 and construction of the recombinant plasmid pETDuet-YFP-N12.

(A) PCR flow chart of YFP-CGA-N12. The YFP gene was amplified by using the commercial plasmid pET-28a-YFP bearing the YFP gene and in the presence of primers YFP-F and YFP-R, which harbour the CGA-N12 gene. (B) Construction of the recombinant plasmid pETDuet-YFP-N12. Restriction enzyme digestion of the fusion gene YFP-CGA-N12 and the plasmid pETDuet with Nde I and Kpn I. The fragments KRE9-CFP/ Nde I + Kpn I and pETDuet/Nde I + Kpn I were isolated by electrophoresis and ligated by ligase. The recombinant plasmid pETDuet-YFP-N12 was obtained.

Figure 3.
Preparation of fusion gene YFP-CGA-N12 and construction of the recombinant plasmid pETDuet-YFP-N12.

(A) PCR flow chart of YFP-CGA-N12. The YFP gene was amplified by using the commercial plasmid pET-28a-YFP bearing the YFP gene and in the presence of primers YFP-F and YFP-R, which harbour the CGA-N12 gene. (B) Construction of the recombinant plasmid pETDuet-YFP-N12. Restriction enzyme digestion of the fusion gene YFP-CGA-N12 and the plasmid pETDuet with Nde I and Kpn I. The fragments KRE9-CFP/ Nde I + Kpn I and pETDuet/Nde I + Kpn I were isolated by electrophoresis and ligated by ligase. The recombinant plasmid pETDuet-YFP-N12 was obtained.

Construction of the recombinant plasmid pETDuet-KRE9-CFP-YFP-N12.

Figure 4.
Construction of the recombinant plasmid pETDuet-KRE9-CFP-YFP-N12.

The pETDuet-YFP-N12 fragment was digested from the recombinant plasmid with Hind III and BamH I and ligated with fragment KRE9-CFP/Hind III + BamH I to obtain the recombinant plasmid pETDuet-PT7-KRE9-CFP-PT7-YFP-N12.

Figure 4.
Construction of the recombinant plasmid pETDuet-KRE9-CFP-YFP-N12.

The pETDuet-YFP-N12 fragment was digested from the recombinant plasmid with Hind III and BamH I and ligated with fragment KRE9-CFP/Hind III + BamH I to obtain the recombinant plasmid pETDuet-PT7-KRE9-CFP-PT7-YFP-N12.

Recombinant KRE9 expression and purification

The recombinant protein KRE9 with a 3 × His tag was expressed in the engineered E. coli BL21(pET28-KRE9) under isopropyl β-d-thiogalactoside induction and was purified with the His-tag Protein Purification Kit (Beyotime, Shanghai, China). rKRE9, a protein with a molecular mass of 35 kD, was purified (Figure 5).

After protein expression was induced, the engineered strains E. coli (pET-28-KRE9) were ultrasonically disrupted.

Figure 5.
After protein expression was induced, the engineered strains E. coli (pET-28-KRE9) were ultrasonically disrupted.

The expressed recombinant KRE9 protein in the supernatant was purified after undergoing affinity chromatography and was analyzed by (A) sodium dodecyl sulfate-polyacrylamide gel electrophoresis and (B) western blot.

Figure 5.
After protein expression was induced, the engineered strains E. coli (pET-28-KRE9) were ultrasonically disrupted.

The expressed recombinant KRE9 protein in the supernatant was purified after undergoing affinity chromatography and was analyzed by (A) sodium dodecyl sulfate-polyacrylamide gel electrophoresis and (B) western blot.

Physicochemical properties of CGA-N12 and KRE9

The amino acid sequences of CGA-N12 and KRE9 were analyzed using the software ProtParam tool (http://www.expasy.ch/tools/). The physicochemical properties of CGA-N12 and KRE9 were predicted, as shown in Table 4. The net charge of CGA-N12 is positive. The net charge of KRE9 is negative. Their grand average of hydropathicity (GRAVITY) is negative, indicating that they are hydrophilic proteins.

Table 4
Physicochemical properties of CGA-N12
 CGA-N12 KRE9 
Molecular mass 1336.4 29 378.5 
PI 8.80 4.98 
Net Charge +2 −6 
GRAVITY −1.400 −0.228 
 CGA-N12 KRE9 
Molecular mass 1336.4 29 378.5 
PI 8.80 4.98 
Net Charge +2 −6 
GRAVITY −1.400 −0.228 

The physicochemical properties of CGA-N12 were predicted using the bioinformatic software ProtParam (http://www.expasy.ch/tools/) by analyzing the amino acid sequence of CGA-N12. GRAVITY is the abbreviation for the grand average hydropathicity.

CGA-N12 reduces KRE9 β-1,6-glucanase activity

Glucose consumption was measured to investigate the effect of CGA-N12 on KRE9 β-1,6-glucanase activity. The results indicated that the glucose content was significantly reduced in the presence of rKRE9, while CGA-N12 inhibited its polymerization activity (Figure 6).

Effect of CGA-N12 on KRE9 β-1,6-glucanase activity.

Figure 6.
Effect of CGA-N12 on KRE9 β-1,6-glucanase activity.

Effect of CGA-N12 on KRE9 β-1,6-glucanase activity was expressed as glucose consumption using the regression equation y = 0.0011x − 0.0229 (R2 = 0.994) that was obtained by a standard curve of glucose. H2O was used as a negative control, and β-1,6-glucanase was used as the positive control.

Figure 6.
Effect of CGA-N12 on KRE9 β-1,6-glucanase activity.

Effect of CGA-N12 on KRE9 β-1,6-glucanase activity was expressed as glucose consumption using the regression equation y = 0.0011x − 0.0229 (R2 = 0.994) that was obtained by a standard curve of glucose. H2O was used as a negative control, and β-1,6-glucanase was used as the positive control.

C. tropicalis cell wall attenuation

β-1,3-Glucan and chitin are the major components of the yeast cell wall. β-1,6-Glucan is linked to β-1,3-glucan and chitin. A disturbance in the β-1,6-glucanase activity of KRE9 causes yeast cell wall attenuation. The results of transmission electron microscopy (TEM) analysis (Figure 7) showed that the control cells (antifungal-agent free) had a thick and integrated cell wall and cell membrane structure, normal organelles, and clear cytoplasm. Compared with the control, after treatment with CGA-N12 at the minimal inhibitory concentration, the cell wall of C. tropicalis was thin, and the cell membrane appeared shrunken with a myeloid cytoplasm. With increasing time, pathological changes became increasingly obvious.

The ultrastructure of C. tropicalis cells after treatment with CGA-N12 was observed under TEM.

Figure 7.
The ultrastructure of C. tropicalis cells after treatment with CGA-N12 was observed under TEM.

The visual changes in the cell wall thickness were determined by comparing the treated and control cells.

Figure 7.
The ultrastructure of C. tropicalis cells after treatment with CGA-N12 was observed under TEM.

The visual changes in the cell wall thickness were determined by comparing the treated and control cells.

Binding force of CGA-N12 and KRE9

The binding affinity and thermodynamic parameters of CGA-N12 and rKRE9 were determined using ITC by titrating the peptide CGA-N12 into rKRE9 at 25°C. After analysis, the best fit for the complete process was obtained using a one-site binding equation [39]. The thermodynamics of the interaction properties of KRE9 and CGA-N12 demonstrated that hydrophobic force may be the main binding force between them. The binding affinity (Kd) between CGA-N12 and rKRE9 was determined to be 0.53 mM and indicated a relatively weak interaction, most likely due to the interactions of hydrophobic forces between the peptide and the protein (Figure 8 and Table 5).

The binding of CGA-N12 and rKRE9 monitored by isothermal calorimetric titration.

Figure 8.
The binding of CGA-N12 and rKRE9 monitored by isothermal calorimetric titration.

A 0.3 mM CGA-N12 solution was injected into 0.05 mM rKRE9 at 25°C, and a one-site binding model was selected to fit the data.

Figure 8.
The binding of CGA-N12 and rKRE9 monitored by isothermal calorimetric titration.

A 0.3 mM CGA-N12 solution was injected into 0.05 mM rKRE9 at 25°C, and a one-site binding model was selected to fit the data.

Table 5
Thermodynamic parameters of the interaction between the AMP CGA-N12 and KRE9
 Endothermic process 
Ka (mM−11.87 
0.721 
ΔH (kcal.mol−163.0 
ΔS (kcal.mol−1deg−10.226 
ΔG (kcal.mol−1−4.35 
Kd (mM) 0.53 
 Endothermic process 
Ka (mM−11.87 
0.721 
ΔH (kcal.mol−163.0 
ΔS (kcal.mol−1deg−10.226 
ΔG (kcal.mol−1−4.35 
Kd (mM) 0.53 

The interaction between CGA-N12 and KRE9 was speculated by ITC. Ka, the equilibrium association constant; N, binding stoichiometry; ΔH, enthalpy change; ΔS, entropy change; ΔG, Gibbs free energy; Kd, the binding affinity.

FRET between CGA-N12 and KRE9

The recombinant plasmids pETDuet-KRE9-CFP, pETDuet-YFP-N12, and pETDuet-PT7-KRE9-CFP-PT7-YFP-N12 were transformed into E. coli BL21(DE3). The fusion proteins KRE9-CFP and YFP-CGA-N12 were individually expressed or co-expressed in vivo under the induction of isopropyl β-D-thiogalactoside. FRET results are shown in Figure 9. The fluorescence of BL21 (pETDuet-KRE9-CFP) was observed only in the CFP channel, and the fluorescence of BL21 (pETDuet-YFP-N12) was observed only in the YFP channel. Under the FRET channel, the fluorescence of BL21 (pETDuet-PT7-KRE9-CFP-PT7-YFP-N12) was observed in the CFP, YFP, and FRET channels. The fluorescence enhancement in the FRET channel of BL21 (pETDuet-PT7-KRE9-CFP-PT7-YFP-N12) indicated that an energy transfer from CFP to YFP occurred when CGA-N12 interacted with KRE9 within a distance of 7 ∼ 10 nm.

The fusion proteins KRE9-CFP and YFP-CGA-N12 were expressed in E. coli (pETDuet-KRE9-CFP) and E. coli (pETDuet-YFP-N12) and co-expressed in E. coli (pETDuet-KRE9-CFP-YFP-N12).

Figure 9.
The fusion proteins KRE9-CFP and YFP-CGA-N12 were expressed in E. coli (pETDuet-KRE9-CFP) and E. coli (pETDuet-YFP-N12) and co-expressed in E. coli (pETDuet-KRE9-CFP-YFP-N12).

There was no FRET in the engineered E. coli, in which KRE9-CFP or YFP-CGA-N12 was expressed independently. There was FRET in the engineered E. coli, in which KRE9-CFP and YFP-CGA-N12 were co-expressed, and the interaction of CGA-N12 and KRE9 was detected by FRET from CFP to YFP.

Figure 9.
The fusion proteins KRE9-CFP and YFP-CGA-N12 were expressed in E. coli (pETDuet-KRE9-CFP) and E. coli (pETDuet-YFP-N12) and co-expressed in E. coli (pETDuet-KRE9-CFP-YFP-N12).

There was no FRET in the engineered E. coli, in which KRE9-CFP or YFP-CGA-N12 was expressed independently. There was FRET in the engineered E. coli, in which KRE9-CFP and YFP-CGA-N12 were co-expressed, and the interaction of CGA-N12 and KRE9 was detected by FRET from CFP to YFP.

Discussion

With the misuse of antibiotics, drug-resistant strains of Candida have increased in abundance. The cell wall protects Candida cells from adverse environments. Therefore, the cell wall is an ideal drug target for Candida cells. Increasing reports have indicated the mechanism of action of AMPs. Increasing studies have reported the effects of AMPs on cell membranes and organelles, with few reports on the effects of AMPs on the cell wall [40–42]. The microbial cell wall, which is an essential structural feature conserved among broad classes of bacteria, serves to shape the cell, mediates functional imperatives, and prevents cell lysis due to high internal osmotic pressure [43]. The cell wall further serves as a structural scaffold to anchor many membrane components. One target for eukaryotic host defence peptides is the bacterial cell wall [44]. In fungi, the cell wall comprises a complex network of β-1,6-glucan, β-1,3-glucan, chitin, and other biopolymers. In yeast, the KRE9 gene in chromosome X encodes a β-1,6-glucanase, which is involved in the synthesis of β-1,6-glucan. The map and coding sequence of the KRE9 gene has been isolated [11]. KRE9 is also involved in several additional cell wall-related phenotypes, including the budding morphology, mating and the formation of projections in the presence of the alpha factor [18].

Currently, natural and synthetic antifungal peptides have been suggested to induce cell death and exert an antifungal effect mainly by membrane pore formation or lysis followed by the loss of cytoplasm [45–47]. As research has progressed, certain antifungal peptides have also been discovered that can interfere with or destroy other structural or physiological metabolic activities of fungi [48], resulting in the loss of cell surface smoothness, wrinkles, local cell surface breaks and the appearance of gaps. In the present study, the antifungal peptide CGA-N12 affected the external morphology of Candida cells, reducing the visual thickness of the cell wall at the minimal inhibitory concentration.

CGA-N12 is a nonmembrane-active antifungal peptide that can enter C. tropicalis cells without rupturing the plasma membrane [30]. The binding proteins of C. tropicalis cells targeting CGA-N12 were screened by affinity chromatography. KRE9, one of the CGA-N12-binding proteins, is a β-1,6-glucanase. Further research on the effect of CGA-N12 on KRE9, we found CGA-N12 inhibit KRE9 β-1,6-glucanase activity.

ITC can directly measure minute enthalpy changes accompanying the binding of a peptide to a membrane [49] or to a protein [50,51]. In the present study, ITC was used as the main tool to investigate the thermodynamics of the interaction between CGA-N12 and KRE9. Unlike spectroscopic techniques, ITC allows the simultaneous measurement of the reaction enthalpy (ΔH) and the binding constant (K), providing a full thermodynamic characterization of a binding event.

FRET is a technique that is used to visually observe protein–protein interactions in living cells while simultaneously showing the intermolecular distance between interacting proteins [38,52,53]. In this study, CGA-N12 was fusion-expressed with YFP, and KRE9 was fusion-expressed with CFP in E. coli cells. The FRET between CFP and YFP showed a close interaction with a 7 ∼ 10 nm distance between CGA-N12 and KRE9.

The results of ITC and FRET demonstrated the interaction between CGA-N12 and KRE9. The inhibition of CGA-N12 on the KRE9 β-1,6-glucanase activity suggested that the KRE9 protein is an active substrate of the antifungal peptide CGA-N12 in inhibiting the growth of C. tropicalis. While the relationship of CGA-N12 inhibition effect on KRE9 β-1,6-glucanase activity and MIC data, the β-1,6-glucose content in cell wall post treatment of CGA-N12 need further investigation.

Abbreviations

     
  • AMPs

    antimicrobial peptides

  •  
  • CFP

    cyan fluorescent protein

  •  
  • CGA

    chromagranin A

  •  
  • CGA-N12

    the amino acid sequence from the 65th to the 76th of chromagranin A N terminus

  •  
  • FRET

    fluorescence resonance energy transfer

  •  
  • HPLC-Chip/ESI-QTOF/MS/MS

    high-performance liquid chromatography coupled to electrospray ionization and quadrupole time-of-flight-mass spectrometry

  •  
  • ITC

    isothermal titration calorimetry

  •  
  • Ka

    the equilibrium association constant

  •  
  • MALDI-TOF-MS

    matrix-assisted laser desorption/ionization time of flight mass spectrometry

  •  
  • MS

    mass spectrum

  •  
  • N

    binding stoichiometry

  •  
  • PCR

    polymerase chain reaction

  •  
  • rKRE9

    recombinant KRE9

  •  
  • YFP

    yellow fluorescence protein

  •  
  • ΔG

    Gibbs free energy

  •  
  • ΔH

    enthalpy change

  •  
  • ΔS

    entropy change

Author Contribution

R.L. drafted the manuscript and participated in the design and coordination of the experiments. Z.L. carried out the experiments and drafted the manuscript. W.D. carried out ITC experiment. L.Z. gave guidelines on MS/MS technology. B.Z. participated aided in the FRET experiment. D.L. took part in the editing pictures. C.F. participated aided in the construction of the recombinant plasmids. All authors have read and approved the final manuscript.

Funding

This study was supported by the National Natural Science Foundation of China [31572264 and 31071922], the Innovative Research Team (in Science and Technology) at the University of Henan Province [19IRTSTHN008], and the National Engineering Laboratory for Wheat & Corn Further Processing, Henan University of Technology [NL2016010].

Competing Interests

The authors declare that there are no competing interests associated with the manuscript.

References

References
1
Yapar
,
N.
(
2014
)
Epidemiology and risk factors for invasive candidiasis
.
Ther. Clin. Risk Manag.
10
,
95
105
2
Pappas
,
P.G.
,
Kauffman
,
C.A.
,
Andes
,
D.R.
,
Clancy
,
C.J.
and
Sobel
,
J.D.
(
2016
)
Clinical practice guideline for the management of candidiasis: 2016 update by the infectious diseases society of America
.
Clin. Infect. Dis.
62
,
409
417
3
Hirota
,
K.
,
Yumoto
,
H.
,
Sapaar
,
B.
,
Matsuo
,
T.
,
Ichikawa
,
T.
and
Miyake
,
Y.
(
2017
)
Pathogenic factors in Candida biofilm-related infectious diseases
.
J. Appl. Microbiol.
122
,
321
330
4
Zhang
,
W.
,
Song
,
X.
,
Wu
,
H.
and
Zheng
,
R.
(
2019
)
Epidemiology, risk factors and outcomes of Candida albicans vs. non-albicans candidaemia in adult patients in Northeast China
.
Epidemiol. Infect.
147
,
e277
5
Miceli
,
M.H.
,
Díaz
,
J.A.
and
Lee
,
S.A.
(
2011
)
Emerging opportunistic yeast infections
.
Lancet Infect. Dis.
11
,
142
151
6
Sanguinetti
,
M.
,
Posteraro
,
B.
and
Lass-Flörl
,
C.
(
2015
)
Antifungal drug resistance among candida species: mechanisms and clinical impact
.
Mycoses
58
,
2
13
7
Treviño-Rangel
,
R.J.
,
Bodden-Mendoza
,
B.A.
,
Montoya
,
A.M.
,
Villanueva-Lozano
,
H.
,
Elizondo-Zertuche
,
M.
,
Robledo-Leal
,
E.
et al (
2018
)
Phenotypical characterization and molecular identification of clinical isolates of Candida tropicalis
.
Rev. Iberoam. Micol.
35
,
17
21
8
Kothavade
,
R.J.
,
Kura
,
M.M.
,
Valand
,
A.G.
and
Panthaki
,
M.H.
(
2010
)
Candida tropicalis: its prevalence, pathogenicity and increasing resistance to fluconazole
.
J. Med. Microbiol.
59
,
873
880
9
Muñoz
,
P.
,
Giannella
,
M.
,
Fanciulli
,
C.
,
Guinea
,
J.J.
,
Valerio
,
M.
,
Rojas
,
L.
et al (
2011
)
Candida tropicalis fungaemia: incidence, risk factors and mortality in a general hospital
.
Clin. Microbiol. Infect.
17
,
1538
1545
10
Zuza-Alves
,
D.L.
,
Silva-Rocha
,
W.P.
and
Chaves
,
G.M.
(
2017
)
An update on Candida tropicalis based on basic and clinical approaches
.
Front. Microbiol.
8
,
19273
11
Brown
,
J.L.
,
Kossaczka
,
Z.
,
Jiang
,
B.
and
Bussey
,
H.
(
1993
)
A mutational analysis of killer toxin resistance in Saccharomyces cerevisiae identifies new genes involved in cell wall (1–6)-13-glucan synthesis
.
Genetics
133
,
837
849
12
Janeczko
,
M.
(
2018
)
Emodin reduces the activity of (1,3)-β-D-glucan synthase from Candida albicans and does not interact with Caspofungin
.
Pol. J. Microbiol.
67
,
463
470
13
Aimanianda
,
V.
,
Clavaud
,
C.
,
Simenel
,
C.
,
Fontaine
,
T.
,
Delepierre
,
M.
and
Latge
,
J.P.
(
2009
)
Cell wall β-(1,6)-glucan of Saccharomyces cerevisiae: structural characterization and in situ synthesis
.
J. Biol. Chem.
284
,
13401
13412
14
She
,
X.D.
,
Calderone
,
R.
,
Kruppa
,
M.
,
Lowman
,
D.
,
Williams
,
D.
,
Zhang
,
L.L.
et al (
2016
)
Cell wall N-linked mannoprotein biosynthesis requires Goa1p, a putative regulator of mitochondrial complex I in Candida albicans
.
PLoS ONE
11
,
e0147175
15
Lowman
,
D.W.
,
West
,
L.J.
,
Bearden
,
D.W.
,
Wempe
,
M.F.
,
Power
,
T.D.
,
Ensley
,
H.E.
et al (
2011
)
New insights into the structure of (1→3,1→6)-β-D-glucan side chains in the Candida glabrata cell wall
.
PLoS ONE
6
,
e27614
16
Brown
,
J.L.
and
Bussey
,
H.
(
1993
)
The yeast KRE9 gene encodes an O glycoprotein involved in cell surface beta-glucan assembly
.
Mol. Cell Biol.
13
,
6346
6356
17
Lussier
,
M.
,
Sdicu
,
A.M.
,
Shahinian
,
S.
and
Bussey
,
H.
(
1998
)
The Candida albicans KRE9 gene is required for cell wall β-1,6-glucan synthesis and is essential for growth on glucose
.
Proc. Natl Acad. Sci. U.S.A.
95
,
9825
9830
18
Pan
,
H.P.
,
Wang
,
N.
,
Tachikawa
,
H.
,
Nakanishi
,
H.
and
Gao
,
X.D.
(
2017
)
β-1,6-glucan synthesis-associated genes are required for proper spore wall formation in Saccharomyces cerevisiae
.
Yeast
34
,
431
446
19
Lesage
,
G.
and
Bussey
,
H.
(
2006
)
Cell wall assembly in Saccharomyces cerevisiae
.
Microbiol. Mol. Biol. Rev.
70
,
317
343
20
Zasloff
,
M.
(
2002
)
Antimicrobial peptides of multicellular organisms
.
Nature
415
,
389
395
21
Agarwal
,
S.
,
Sharma
,
G.
,
Dang
,
S.
,
Gupta
,
S.
and
Gabrani
,
R.
(
2016
)
Antimicrobial peptides as anti-infectives against Staphylococcus epidermidis
.
Med. Princ. Pract.
25
,
301
308
22
Agier
,
J.
and
Brzezińska-Błaszczyk
,
E.
(
2016
)
Cathelicidins and defensins regulate mast cell antimicrobial activity
.
Postepy Hig. Med. Dosw. (Online)
70
,
618
636
23
Shagaghi
,
N.
,
Palombo
,
E.A.
,
Clayton
,
A.H.A.
and
Bhave
,
M.
(
2018
)
Antimicrobial peptides: biochemical determinants of activity and biophysical techniques of elucidating their functionality
.
World J. Microbiol. Biotechnol.
34
,
62
24
Simon
,
J.P.
and
Aunis
,
D.
(
1989
)
Biochemistry of the chromogranin A protein family
.
Biochem. J.
262
,
1
13
25
Cohn
,
D.V.
,
Elting
,
J.J.
,
Frick
,
M.
and
Elde
,
R.
(
1984
)
Selective localization of the parathyroid secretory protein-I/adrenal medulla chromogranin A protein family in a wide variety of endocrine cells of the rat
.
Endocrinology
114
,
1963
1974
26
Aslam
,
R.
,
Atindehou
,
M.
,
Lavaux
,
T.
,
HaïKel
,
Y.
,
Schneider
,
F.
and
Metz-Boutigue
,
M.H.
(
2012
)
Chromogranin A-derived peptides are involved in innate immunity
.
Curr. Med. Chem.
19
,
4115
4123
27
Lugardon
,
K.
,
Raffner
,
R.
,
Goumon
,
Y.
,
Corti
,
A.
,
Delmas
,
A.
,
Bulet
,
P.
et al (
2000
)
Antibacterial and antifungal activities of Vasostatin 1, the N terminal fragment of chromogranin A
.
J. Biol. Chem.
275
,
10745
10753
28
Li
,
R.
,
Lu
,
Y.
,
Lu
,
Y.
,
Zhang
,
H.
,
Huang
,
L.
,
Yin
,
Y.
et al (
2015
)
Antiproliferative effect and characterization of a novel antifungal peptide derived from human chromogranin A
.
Exp. Ther. Med.
10
,
2289
2294
29
Li
,
R.
,
Zhang
,
L.
,
Zhang
,
H.
,
Yi
,
Y.
,
Wang
,
L.
,
Chen
,
L.
et al (
2017
)
Protective effect of a novel antifungal peptide derived from human chromogranin a on the immunity of mice infected with Candida krusei
.
Exp. Ther. Med.
13
,
2429
2434
30
Li
,
R.
,
Zhang
,
R.
,
Yang
,
Y.
,
Wang
,
X.
,
Yi
,
Y.
,
Fan
,
P.
et al (
2018
)
CGA-N12, a peptide derived from chromogranin A, promotes apoptosis of Candida tropicalis by attenuating mitochondrial functions
.
Biochem. J.
475
,
1385
1396
31
Fang
,
Y.
,
Song
,
F.
,
Zhang
,
L.
,
Aleku
,
D.W.
,
Han
,
B.
,
Feng
,
M.
et al (
2012
)
Differential antennal proteome comparison of adult honeybee drone, worker and queen (Apis mellifera L.)
.
J. Proteomics
75
,
756
773
32
Zhang
,
L.
,
Fang
,
Y.
,
Li
,
R.
,
Feng
,
M.
,
Han
,
B.
,
Zhou
,
T.
et al (
2012
)
Towards posttranslational modification proteome of royal jelly
.
J. Proteomics
75
,
5327
5341
33
Sambrook
,
J.
,
Fritsch
,
E.F.
and
Maniatis
,
T.
(
1989
)
Molecular Cloning: A Laboratory Manual
, 2nd edn,
Cold Spring Harbor Laboratory
,
Cold Spring Harbor, NY
34
Schenk
,
D.
,
Song
,
G.
,
Ke
,
Y.
and
Wang
,
Z.
(
2017
)
Amplification of overlapping DNA amplicons in a single-tube multiplex PCR for targeted next-generation sequencing of BRCA1 and BRCA2
.
PLoS ONE
12
,
e0181062
35
Li
,
R.
,
Yan
,
X.
,
Lu
,
Y.
,
Lu
,
Y.
,
Zhang
,
H.
,
Chen
,
S.
et al (
2015
)
Anti-candidal activity of a novel peptide derived from human chromogranin a and its mechanism of action against Candida krusei
.
Exp. Ther. Med.
10
,
1768
1776
36
Sun
,
Y.
,
Dong
,
W.
,
Sun
,
L.
,
Ma
,
L.
and
Shang
,
D.
(
2015
)
Insights into the membrane interaction mechanism and antibacterial properties of chensinin-1b
.
Biomaterials
37
,
299
311
37
Zhang
,
X.
,
Hu
,
Y.
,
Yang
,
X.
,
Tang
,
Y.
,
Han
,
S.
,
Kang
,
A.
et al (
2019
)
FÖrster resonance energy transfer (FRET)-based biosensors for biological applications
.
Biosens. Bioelectron.
138
,
111314
38
Grecco
,
H.E.
and
Verveer
,
P.J.
(
2015
)
FRET in cell biology: still shining in the age of super-resolution?
Chemphyschem
12
,
484
490
39
Delgadillo
,
R.F.
,
Mueser
,
T.C.
,
Zaleta-Rivera
,
K.
,
Carnes
,
K.A.
,
González-Valdez
,
J.
and
Parkhurst
,
L.J.
(
2019
)
Detailed characterization of the solution kinetics and thermodynamics of biotin, biocytin and HABA binding to avidin and streptavidin
.
PLoS ONE
14
,
e0204194
40
Garibotto
,
F.M.
,
Garro
,
A.D.
,
Masman
,
M.F.
,
Rodríguez
,
A.M.
,
Luiten
,
P.G.
,
Raimondi
,
M.
et al (
2010
)
New small-size peptides possessing antifungal activity
.
Bioorg. Med. Chem.
18
,
158
167
41
Travkova
,
O.G.
,
Moehwald
,
H.
and
Brezesinski
,
G.
(
2017
)
The interaction of antimicrobial peptides with membranes
.
Adv. Colloid Interface Sci.
247
,
521
532
42
Naito
,
A.
,
Matsumori
,
N.
and
Ramamoorthy
,
A.
(
2018
)
Dynamic membrane interactions of antibacterial and antifungal biomolecules, and amyloid peptides, revealed by solid-state NMR spectroscopy
.
Biochim. Biophys. Acta
1862
,
307
323
43
Rogers
,
H. J.
,
Perkins
,
H. R.
and
Ward
,
J. B
. (
1980
) The cell wall in the growth and cell division of bacteria. In
Microbial Cell Walls and Membranes
, pp.
508
541
,
Springer
,
Dordrecht
44
Yount
,
N.Y.
and
Yeaman
,
M.R.
(
2013
)
Peptide antimicrobials: cell wall as a bacterial target
.
Ann. N. Y. Acad. Sci.
1277
,
127
138
45
Breukink
,
E.
,
Wiedemann
,
I.
,
Kraaij
,
C.V.
,
Kuipers
,
O.P.
,
Sahl
,
H.G.
and
Kruijff
,
B.D.
(
2015
)
Use of the cell wall precursor lipid ii by a pore-forming peptide antibiotic
.
Science
286
,
2361
2364
46
Choi
,
H.
,
Hwang
,
J.-S.
and
Lee
,
D.G.
(
2013
)
Antifungal effect and pore-forming action of lactoferricin B like peptide derived from centipede Scolopendra subspinipes mutilans
.
Biochim. Biophys. Acta
1828
,
2745
2750
47
Wimley
,
W.C.
(
2010
)
Describing the mechanism of antimicrobial peptide action with the interfacial activity model
.
ACS Chem. Biol.
5
,
905
917
48
Maurya
,
I.K.
,
Pathak
,
S.
,
Sharma
,
M.
,
Sanwal
,
H.
,
Chaudhary
,
P.
,
Tupe
,
S.
et al (
2011
)
Antifungal activity of novel synthetic peptides by accumulation of reactive oxygen species (ROS) and disruption of cell wall against Candida albicans
.
Peptides
32
,
1732
1740
49
Huang
,
R.
and
Lau
,
B.L.T.
(
2016
)
Biomolecule-nanoparticle interactions: elucidation of the thermodynamics by isothermal titration calorimetry
.
Biochim Biophys. Acta
1860
,
945
956
50
Menting
,
J.G.
,
Whittaker
,
J.
,
Margetts
,
M.B.
,
Whittaker
,
L.J.
,
Kong
,
G.K.-W.
,
Smith
,
B.J.
et al (
2013
)
How insulin engages its primary binding site on the insulin receptor
.
Nature
493
,
241
245
51
Luo
,
Q.
,
Chen
,
D.
,
Boom
,
R.M.
and
Janssen
,
A.E.M.
(
2018
)
Revisiting the enzymatic kinetics of pepsin using isothermal titration calorimetry
.
Food Chem.
268
,
94
100
52
Xing
,
S.
,
Wallmeroth
,
N.
,
Berendzen
,
K.W.
and
Grefen
,
C.
(
2016
)
Techniques for the analysis of protein-protein interactions in vivo
.
Plant Physiol.
171
,
727
758
53
Gregorio
,
G.G.
,
Masureel
,
M.
,
Hilger
,
D.
,
Terry
,
D.S.
,
Juette1
,
M.
,
Zhao
,
H.
et al (
2017
)
Single-molecule analysis of ligand efficacy in β2AR–G-protein activation
.
Nature
547
,
68
73
This is an open access article published by Portland Press Limited on behalf of the Biochemical Society and distributed under the Creative Commons Attribution License 4.0 (CC BY-NC-ND).

Supplementary data