Metacaspases are novel cysteine proteases found in apicomplexan whose function is poorly understood. Our earlier studies on Plasmodium falciparum metacaspase-2 (PfMCA-2) revealed that the caspase inhibitor, Z-FA-FMK efficiently inhibited PfMCA-2 activity and, expression, and significantly blocked in vitro progression of the parasite developmental cycle via apoptosis-like parasite death. Building on these findings, we synthesized a set of novel inhibitors based on structural modification of Z-FA-FMK with the amides of piperic acid and investigated their effect on PfMCA-2. One of these analogs, SS-5, specifically inhibited the activity and expression of PfMCA-2. The activities of some other known malarial proteases (falcipains, plasmepsins and vivapain), and human cathepsins-B, D and L, and caspase-3 and -7 were not inhibited by SS-5. SS-5 blocked the development of P. falciparum in vitro (IC50 1 µM) and caused prominent morphological distortions. Incubation with SS-5 led to persistent parasite oxidative stress accompanied by depolarization of mitochondrial potential and accumulation of intracellular Ca2+. SS-5 also inhibited the development of P. berghei in a murine model. Our results suggest that the inhibition of PfMCA-2 results in oxidative stress, leading to apoptosis-like parasite death. Thus, SS-5 offers a starting point for the optimization of new antimalarials, and PfMCA-2 could be a novel target for antimalarial drug discovery.

Introduction

Apoptosis is a highly regulated phenomenon important for the maintenance of homeostasis in tissues and during embryonic development [1]. Its characteristic hallmarks include morphologic changes such as cell shrinkage, pyknosis and extensive plasma membrane blebbing followed by karyorrhexis and separation of cell fragments into apoptotic bodies [1]. In metazoans, the process of apoptosis is controlled and executed by caspases [2], and several therapeutic molecules target these proteins to treat many pathologies, including cardiac disease, neoplasia and neurologic disorders [3–5]. In non-metazoans, the apoptosis events were also reported with few limitations. First study where authors reported that caspase-3 like subfamily member was associated with Plasmodium berghei ookinete apoptosis. The prominent features of cell death reported were chromatin condensation, DNA fragmentation and exposure of phosphatidylserine [6]. Similar DNA fragmentation/degradation in response to chloroquine treatment was reported in the P. falciparum culture [6]. Additionally, the growth of P. falciparum was halted in response to stress induced by natural sunlight which led to parasite death in late trophozoites and schizonts stage [7]. Moreover, apoptosis events were also reported in other protozoa such as Leishmania and Trypanosoma [8,9].

Non-metazoan ‘metacaspases’ (MCAs) are cysteine-dependent proteases sharing the conserved His-Cys catalytic dyad of caspases. These proteases are members of the C14 family, clan CD, with a difference in substrate specificity compared with caspases. Metacaspases have a highly acidic S1 pocket leading to arginine and lysine substrate specificity at the P1 position, compared with the aspartic acid specificity reported for caspases [10,11]. Evidence for the occurrence of apoptosis in unicellular organisms has increased over time [12–19]. For instance, Leishmania and Tyrpanosoma metacaspases were found to be responsible for the regulation of stress-induced programmed cell death [20–22]. Metacaspases are attractive targets for chemotherapy due to their important role in parasites and their absence in humans [23].

In our recent report, the caspase inhibitor Z-FA-FMK caused oxidative stress by inhibiting P. falciparum metacaspase-2 (PfMCA-2) activity and expression which in turn led to the occurrence of cell death as indicated by phosphatidylserine externalization and DNA fragmentation in vitro [24]. Thus, PfMCA-2 seems to be an important enzyme for the maintenance of parasite growth and development. We now describe the rational design and synthesis of specific PfMCA-2 inhibitors. We considered chemical moieties contained in established antimalarials to modify Z-FA-FMK, specifically amides of piperic acid (PA), i.e. piperine, C-1; PA, C-2; PA-Pip (Bzl)-OH, C-3; PA-Inp-NHCF3, SS-1; PA-Inp-NH-NH-Ph-F2, SS-3 and PA-Pip (Bzl)-TFEA, SS-5. In the current study, we designed five compounds based on chemical modification of Z-FA-FMK and assessed effects of the respective modifications on PfMCA-2 activity, expression, and P. falciparum in vitro and in vivo growth and cell death.

Material and methods

Ethics statement

Malaria parasite bank of National Institute of Malaria Research, New Delhi has been approved by the Institutional Ethical Committee for in vitro culture of P. falciparum. All animal experiments were performed as per the protocols approved by the Institutional Animal Ethics Committee (IAEC) of National Institute of Immunology under the sanctioned no. 483/18. The Committee for the Purpose of Control and Supervision of Experiments on Animals (CPCSEA) is a statutory body formed by the Act of the Indian Parliament under the Prevention of Cruelty to Animals Act 1960. This statutory body is under the Ministry of Environment, Forest and Climate change and CPCSEA comes under the wildlife division of the ministry (http://moef.gov.in/wildlife). The guidelines followed for experiments are as described in the website (http://cpcsea.nic.in/Content/55_1_GUIDELINES.aspx).

Chemical synthesis of Z-FA-FMK based compounds

All the reagents were obtained from commercial sources and used without purification piperine is an alkaloid present in black pepper and was obtained commercially from Alfa-Aesar and PA was synthesized from the piperine by hydrolysis. Piperine has been used as bio enhancer [25]. A peptide containing amino acids has been reported as an important component of biologically active natural products such as taxol, bleomycin and cytotoxic microcystin [26]. The tert-butoxycarbonyl (Boc) group was used for N-terminal protection, while C-terminal was protected as methyl ester. Deprotection of Boc and methyl ester was performed using 30% trifluoroacetic acid (TFA) in dichloromethane (DCM) and saponification, respectively. The coupling reactions were performed by using 1-ethyl-3-(3-dimethylaminopropyl) carbodiimide hydrochloride (EDC.HCl) in the presence of N-methylmorpholine (NMM). Thin-layer chromatography was used to monitor the progress of the reaction. The purification was performed by column chromatography using silica gel (60–120 mesh) as a stationary phase and MeOH/CHCl3 as a mobile phase. The final compounds were purified using high-performance liquid chromatography (HPLC) on reversed-phase C18 column (10 mm × 250 mm) using methanol/water gradients. The characterization of all the peptides and conjugates achieved by HRMS having QTOF analyzer (Agilent Technologies 6540), 1H and 13C NMR spectra, which were recorded on a Bruker 500 (500.13 MHz for 1H; 125.76 MHz for 13C), in either in CDCl3 or DMSO-d6. The chemical shift (δ) values are reported in parts per million (ppm). The coupling constant (J) values are given in hertz (Hz). All the reagents were obtained from commercial sources. The procedures for the synthesis of each compound are summarized in the Supplementary material.

Recombinant and native PfMCA-2 inhibition assay

Recombinant PfMCA-2 was expressed in E. coli BL21DE3 and purified by Ni-NTA affinity chromatography (Qiagen, U.S.A.) as described earlier [24]. The enzymatic activity of PfMCA-2 was checked by measuring the cleavage of the fluorogenic substrates Z-GRR-AMC as reported earlier [24]. Equal amounts of recombinant PfMCA-2 or P. falciparum schizonts and gametocytes extract containing PfMCA-2 activity were incubated with different concentrations of SS1–5 in 50 mM phosphate buffer (pH 7.4) supplemented with 5 mM DTT for 10–15 min at 28°C. Assay reactions were performed with 20 µg of PfMCA-2 and the release of AMC was measured after 10 min with fluoro-spectrophotometer (Shimadzu Analytical, India). Effect of most potent compounds on other parasite proteases like Falcipain-2 and 3 (FP-2 and FP-3), Vivapain-2 (VP-2) and Plasmepsin-II (PM-II) along with human caspase-3, -7; cathepsin (L, B and D) was assessed as described earlier [27–31]. All reactions were run in duplicates and data were analyzed using Prism and Sigma plot software. The inhibitory constant (Ki) of the most effective compound (SS-5) was calculated using the Michaelis–Menten equation based on non-linear regression in Prism GraphPad software.

Real-time PCR (RT-PCR)

For PfMCA-2 gene expression analysis, routine RT-PCR was performed using Forward (AGATCCAAACAGTGGCGTTT) and Reverse (GTTCTTGTGCTATCAGTGCCTTT) RT-MCA-2 oligonucleotides. Briefly, total RNA was isolated from the SS-1, SS-3 and SS-5 treated synchronized schizonts and gametocytes stage parasite culture using Trizol (Invitrogen, California) method. First-strand cDNA was synthesized using Verso cDNA synthesis Kit (Thermo Scientific, U.S.A). Illumina Eco Real-Time PCR machine was used to assess the gene expression by SYBR green qPCR master mix (Thermo Scientific, U.S.A). PCR parameters were used as described earlier [24]. The parasite 18S-rRNA gene was used as a normalizing control. Quantitative analysis was done by the measurement of threshold cycle (CT) values during the exponential phase of amplification. ΔCT value was calculated by the difference between the CT values of SS-1, -3 and -5 treated and the CT value of 18S RNA gene. Finally, Relative quantifications were calculated by using this equation: 2 − ΔCT/[average of (2 − ΔCT)] [24,32].

Plasmodium falciparum culture

P. falciparum 3D7 strain was cultured at 37°C and 5% CO2 in RPMI-1640 media containing 10% AB+ serum or 10% Albumax-II (Invitrogen) and 5% sodium bicarbonate, supplemented with 50 mg/l gentamycin and 50 mg/l hypoxanthine at 4–5% hematocrit in RBC [33,34]. Synchronization of the parasites in culture was achieved by sorbitol treatment [35] and gametocytes were obtained as described previously [24,33,36].

P. falciparum growth inhibition assay

The effect of different compounds was assessed on the parasite asexual and sexual developmental cycle in vitro. Compound stocks (50 mM in 100% DMSO) were diluted 1 : 25 in sterile water. An additional 1 : 10 dilution was performed, resulting in a 1 : 250 overall compound dilution and a final DMSO concentration of 0.5%. For initial screening, compounds were tested at the highest 150 μM concentration [24,33,37,38]. For the dose-dependent study of the active compounds, a semi-logarithmic serial dilution (containing ten different concentrations) was prepared at 150 μM top concentration for test compounds and chloroquine (10 nM) and artemisinins (2 μM) for the controls. The known PfMCA-2 inhibitor, Z-FA-FMK (3 μM) was also used as a positive control. Two microliters of the test compounds or controls were added to 96-well plates (Corning, U.S.A.). Parasite culture was added to a final concentration of 1% parasitaemia and 0.5% hematocrit. Plates were incubated for 36 h for asexual stages and 72 h for sexual stages at 37°C incubator with 5% CO2 and 95% humidity [24,34,37]. Blood smears of parasites were prepared after every 6 h for monitoring asexual stage development and growth progression of gametocytes was observed at different time intervals. Slides were stained with Giemsa (Amresco, U.S.A) and parasitaemia was determined by the microscopic analysis. Statistical analysis was done by using 2 tail T-test including IC50 determination and graphical output was performed in GraphPad Prism® 5 using non-linear regression variable slope curve fitting.

Measurement of cell viability

Synchronized schizonts stage parasites were cultured in a 96-well plate with selected compounds for 36 h beginning at the schizonts stage (0.5–1%) followed by the addition of 10 µl of AlamarBlue (Invitrogen). The viability of schizont stage parasites was monitored at different time points (4, 8, 16 h) using AlamarBlue dye. Similarly, 100 µl of the gametocyte (stage II–V) culture were incubated with compounds along with DMSO for 72 h. AlamarBlue was added at different time points after the addition of compounds and fluorescence was measured 24 h later [39]. The dye is a cell-permeable nontoxic non-fluorescent active ingredient (blue) that uses the natural reducing power of viable cells to convert resazurin to the fluorescent molecule, resorufin (very bright red). Metabolically active cells convert resazurin to resorufin, thereby generating a quantitative measure of viability [39]. Wells containing an equivalent number of uninfected RBCs were also tested.

Measurement of Reactive Oxygen Species (ROS)

Intracellular ROS levels were measured in SS-1, -3 and -5 treated schizonts and gametocytes along with untreated parasites. The parasites were washed and resuspended in RPMI followed by incubation with a cell-permeant dye, H2DCFDA (Sigma), for 30 min [8,40]. Fluorometric measurements (excitation at 510 nm and emission at 530 nm) were performed in duplicate, and the results were expressed as the mean fluorescence intensity.

Measurement of mitochondrial transmembrane potential [ΔΨm]

The mitochondrial transmembrane potential was investigated using JC-1 dye. JC-1 accumulates in the mitochondrial matrix under the influence of ΔΨm, where it reversibly forms monomers (green) with characteristic absorption and emission spectra [8,41,42]. In brief, schizonts stage parasites were treated with SS-5 (1.5 µM) for 8–12 h. The cells were then incubated at 37°C incubator with 5% CO2 for 1 h with a final concentration of JC-1 dye at 5 µg/µl. The reactions were then analyzed by fluorescence measurement using a spectrofluorometer at 507 and 530 nm as the excitation and emission wavelengths, respectively (green fluorescence), and at 507 and 590 nm as excitation and emission wavelengths, respectively (red fluorescence). The ratio of the reading at 590 nm to the reading at 530 nm (590 : 530 ratios) was considered to be the relative ΔΨm value. In flow cytometry, the FL-1 channel denotes the mean fluorescence intensity [8,41].

Intracellular Ca2+ measurement

Intracellular calcium (Ca2+) concentration was measured with the fluorescent probe fura-2-acetoxymethyl ester (fura-2AM), as described previously [8,43]. Briefly, SS-5 treated schizonts stage parasites were harvested and washed twice with RPMI media and then incubated with fura-2 AM (6 µM) at 37°C for 30–60 min. Fura-Red is a ratiometric dye with dual excitation (488 nm for free Ca2+ and 405 nm for bound Ca2+) and single emission (640 nm). For Fura-Red, a decrease in fluorescence corresponds to an increase in Ca2+ concentration for excitation at both wavelengths, but the ratio of F405 nm/488 nm raises with an increase in Ca2+ concentration [8,41].

Measurement of cellular ATP level

ATP content was determined by the luciferin/luciferase method, as described previously [8]. The assay is based on the requirement of luciferase for ATP in producing light (emission maximum, 560 nm, at pH-7.8). In brief, schizonts stage parasites were treated with SS-5 at different time point washed with 1× PBS twice, and the cytosolic extract was prepared as described earlier. An aliquot of the lysate was assayed for ATP using the luciferase ATP assay kit (Invitrogen, Inc. Ltd.). The amount of ATP in the experimental samples was calculated from a standard curve prepared with ATP.

Flow cytometry analysis

For flow cytometry analysis, late-stage trophozoites and mature schizonts rich cultures were maintained at 1–2% parasitaemia and incubated with compound SS-1, -3, and -5 for 6–12 h in the 96-well plate. The experiment was performed in triplicates individually for annexin-V labeling and tunnel assay. Flow cytometry analysis was performed by a FACS Calibur flow cytometry and data analyzed by BD FACScan software (BD Biosciences, U.S.A) [7,8,44,47].

TUNEL assay for DNA fragmentation

Terminal deoxynucleotidyltransferase (TdT)-mediated nick end labeling kit was used to performed TUNEL assay according to the manufacturer's guidelines (Clontech Laboratories, India). Briefly, infected RBC cells were washed and fixed with 1% p-formaldehyde/1× PBS on ice for 30 min followed by permeabilization with 0.1% Triton ×-100 in 0.1% sodium citrate for 20 min on ice. The TdT enzyme labeling was done followed by flow cytometry [8,45]. For microscopy, TdT enzyme stained cells were deposited onto slides prior to the AlexaFluor488 treatment and slides were observed under a fluorescence microscope after staining with DAPI. DNase treated, non-treated and unlabeled parasites were used as positive, negative and staining controls, respectively [8,45,46].

Annexin V-FITC assay

For annexin-V staining, ∼1 × 107 parasitized RBC (pRBC) cells along with uninfected RBC treated with 0.05% saponin and were washed with 1× PBS and suspended in 100 µl of 1× annexin--binding buffer and stained with annexin-FITC and propidium iodide (PI) for 15–20 min in dark according to manufacturer's instructions (Annexin V-FITC Assay kit, Cayman, U.S.A.). Annexin-V labeled cells were diluted to 0.5 ml in 1× annexin-binding buffer and analyzed by flow cytometry within 1 h. The pRBCs were analyzed for FITC-annexin-V fluorescence on a FL-1 channel whereas the intensity of PI measured in FL-2 channel. The parasite cultures stained with only PI or annexin V-FITC and uninfected RBC cells were used as staining controls [44,45,47,48].

Cytotoxicity assay

Cytotoxicity of compounds was evaluated in hepatocellular carcinoma (HepG2) cells with the MTT [3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide] (SRL, India) assay. In brief, cells were cultured in Dulbecco's modified Eagle's medium (DMEM) supplemented with 10% fetal bovine serum, penicillin (1 unit/ml), and streptomycin (1 unit/ml), in a humidified chamber of 5% CO2 at 37°C. HepG2 cells were seeded into 96-well plate at a density of 2 × 104 cells per well and were incubated for 48 h with different concentrations of compounds with their respective control. After 48 h, a solution of 0.5 mg/ml MTT was added from the 5 mg/ml stock followed by incubation for 2–3 h. The resulting formazan crystals were resuspended in 50 μl of DMSO/isopropanol and further incubated for 10–15 min. Absorbance at λ590 nm of the cells, with medium alone (control) or different concentrations of compounds, was measured by ELISA plate reader (Techan, Switzerland). Toxicity was determined as percent viable cells, which was calculated according to the following formula: (abssample − absblank)/(abscontrol − absblank) × 100 and graph were plotted % viable cells versus concentration of compounds. Nontoxic samples were those in which no significant inhibition of HepG2 cell growth, relative to controls, was observed [49].

In vivo antimalarial activity assay

Twenty-two BALBc mice weighing between 18 and 20 g of either sex and aged 6–8 weeks were kept in the Animal House of the National Institute of Immunology, New Delhi. The animals were maintained under standard laboratory conditions, as approved by the Experimentation Ethics Committee of the institute. The P. berghei (ANKA) was used to investigate the antimalarial activity of selected compounds SS-1, SS-3 and SS-5 along with their respective controls. The experimental animals were inoculated intraperitoneal (i.p.) with 100–150 µl of frozen RBC infected with the P. berghei ANKA strain [50]. The day of inoculation was defined as day zero (D0). After 2 days of infection, ∼5–8% parasitaemia was observed and infected animals were distributed randomly into six groups of three animals per cage. After the infection was established, 0.1 ml of respective compounds in DMSO was administered intra-peritoneally (i.p) to each mouse at a dose of 25 mg/kg of body weight per day for subsequent 5 days (day 1–5). The course of malaria infection in compounds treated, solvent DMSO and untreated mice were monitored daily by counting the number of parasites in the Giemsa stained smears that were obtained from the tail vein blood, and parasitaemia was determined by counting 1000 erythrocytes [37,50].

Results

Chemical synthesis of compounds

Five new Z-FA-FMK analogs containing different amides of PA were synthesized (Figure 1). The detailed synthesis pathways are depicted in supporting information (Supplementary Figure S1). The PA-Pip (Bzl)-OH was synthesized in solution phase by coupling of PA with Pip (Bzl)-OMe. HCl was used to synthesize 1-ethyl-3-(3-dimethylaminopropyl) carbodiimide hydrochloride (EDC.HCl) and NMM in dry dichlomethane followed by saponification. The PA-Pip (Bzl)-TFEA, PA amide were synthesized by coupling of trifluoroethyl amine with PA-Pip (Bzl)-OH (Supplementary Figure S1). Furthermore, the PA amides were synthesized by coupling of isonipecotic acid (Inp) with trifluoroamine/difluorophenylhydrazine followed by coupling of PA with Boc-Inp-trifluoroethyl/difluorophenyl. The CH2F group at the C-terminus of Z-FA-FMK (Z-Phe-Ala-CH2F) was replaced with trifluoroethyl and difluorophenyl groups, and the Z-group at the N-terminus was replaced with PA. To reduce the length of the dipeptide, the Phe-Ala unit was replaced with β, β-disubstituted-β-amino acid, β3,3-Pip (Bzl) and isonipecotic acid (Inp) (Supplementary Figure S1).

Workflow for the selection of the specific compounds and their chemical structure.

Figure 1.
Workflow for the selection of the specific compounds and their chemical structure.
Figure 1.
Workflow for the selection of the specific compounds and their chemical structure.

Inhibition of protease activity by compound SS 1-5

We assessed the inhibition of PfMCA-2 by our five test compounds, SS1-5. Compounds, SS-5, SS-1 and SS-3 inhibited the PfMCA-2 activity at 10 µM whereas SS-2 and SS-4 had no effect on the enzyme activity up to 50 µm concentration (Figure 2A). Kinetic study of the enzyme with the most effective compound SS-5 was performed based on non-linear Michaelis–Menten regression. The calculated Km (Z-GRR-AMC) and Ki (SS-5) of PfMCA-2 were 5.9 ± 0.5 µM and 3.0 ± 0.86 µM, respectively (Figure 2B). A similar pattern of inhibition with all compounds was observed when studying the activity of whole-cell lysates in the schizont and gametocyte stages of P. falciparum (Figure 2C). To consider the specificity of protease inhibition, we assessed activities against other proteases. The SS-1 and SS-3 (10 µM) inhibited the activity of human cathepsin-B, D, L and caspase-7 (Figure 3A,C). However, the activity of selected P. falciparum proteases (falcipain-2, falcipain-3, vivapain-2 and plasmepsin-II) was not inhibited in the presence of SS-1 and SS-3 (Figure 3B,D). Surprisingly, SS-5 (10 µM) did not inhibit any tested malarial proteases, human cathepsin B, D and L, or caspase-3 or -7 (Figure 3E,F). Therefore, among the test compounds, SS-5 was the most specific inhibitor of PfMCA-2.

Activity and Expression of PfMCA-2 in presence of different compounds.

Figure 2.
Activity and Expression of PfMCA-2 in presence of different compounds.

The activity of PfMCA-2 in the presence of different compounds; All compounds were checked up to 50 µM concentration (A). Kinetic study of PfMCA-2 using a different concentration of the effective compound, SS-5 and its Km and Ki was calculated based on non-linear Michaelis–Menten regression (B). The activity of PfMCA-2 using specific Z-GRR-AMC substrate and selected compounds in schizonts and gametocytes stages cell lysates (C). Graphical representation of PfMCA-2 transcript expression in SS-1, SS-3 and SS-5 treated schizonts and gametocytes compared with untreated; p < 0.05* (significant) (D). The expression level of PfMCA-2 reduced in presence of SS-5 compared with control schizonts and gametocytes cell lysates (refer Supplementary Figure S3 for full image) (E).

Figure 2.
Activity and Expression of PfMCA-2 in presence of different compounds.

The activity of PfMCA-2 in the presence of different compounds; All compounds were checked up to 50 µM concentration (A). Kinetic study of PfMCA-2 using a different concentration of the effective compound, SS-5 and its Km and Ki was calculated based on non-linear Michaelis–Menten regression (B). The activity of PfMCA-2 using specific Z-GRR-AMC substrate and selected compounds in schizonts and gametocytes stages cell lysates (C). Graphical representation of PfMCA-2 transcript expression in SS-1, SS-3 and SS-5 treated schizonts and gametocytes compared with untreated; p < 0.05* (significant) (D). The expression level of PfMCA-2 reduced in presence of SS-5 compared with control schizonts and gametocytes cell lysates (refer Supplementary Figure S3 for full image) (E).

Effect of compound SS-1, SS-3 and SS-5 on the enzymatic activity of different cysteine proteases (FP-2 and 3, VP-2) and an aspartic protease, (PM-II) and human cathepsin B, D and L and caspase-3 and -7.

Figure 3.
Effect of compound SS-1, SS-3 and SS-5 on the enzymatic activity of different cysteine proteases (FP-2 and 3, VP-2) and an aspartic protease, (PM-II) and human cathepsin B, D and L and caspase-3 and -7.

SS-1 and SS-3 inhibited the activity of cathepsin B, D, L and caspase-7 (A,C). SS-5 did not affect the activity of human cathepsin B, D, L, caspase-3 and 7 (E). SS-1, SS-3 and SS-5 had no effect on the activity of well-characterized malaria proteases, FP-2, FP-3, VP-3 and PM-II (B, D and F).

Figure 3.
Effect of compound SS-1, SS-3 and SS-5 on the enzymatic activity of different cysteine proteases (FP-2 and 3, VP-2) and an aspartic protease, (PM-II) and human cathepsin B, D and L and caspase-3 and -7.

SS-1 and SS-3 inhibited the activity of cathepsin B, D, L and caspase-7 (A,C). SS-5 did not affect the activity of human cathepsin B, D, L, caspase-3 and 7 (E). SS-1, SS-3 and SS-5 had no effect on the activity of well-characterized malaria proteases, FP-2, FP-3, VP-3 and PM-II (B, D and F).

SS-5 reduces the expression of PfMCA-2

We assessed PfMCA-2 transcript expression in the presence of SS-5 and related compounds. The expression of PfMCA-2 mRNA was remarkably reduced in schizonts and gametocytes treated with SS-1, SS-3 and SS-5 (Figure 2D). For compound, SS-5, expression was reduced by 6-fold in schizonts and 4-fold in gametocytes. Notably, PfMCA-2 expression was unaffected by SS-2 or SS-4 (data not shown). Considering protein expression, SS-5 inhibited PfMCA-2 expression in schizont and gametocyte cell lysates (Figure 2E). SS-5 did not inhibit mRNA (falcipain-2, falcipain-3 and vivapain-2) or protein (falciapin-2 and falcipain-3) levels for tested Plasmodial proteases (Supplementary Figure S2).

Effect of compounds on the asexual parasite life cycle

To examine stage-specific action, the five Z-FA-FMK analogs were added to cultured P. falciparum schizonts. SS-1, SS-3 and SS-5 treated schizont stage parasites were ruptured and developed into an abnormal/distorted ring stage. Moreover, the stage transition from abnormal ring to further stages was blocked in the treated parasite (Figure 4). The IC50 for growth inhibition by SS-5 was 1.17 µM (Figure 5; Table 1). Compounds SS-2 and SS-4 did not inhibit parasite development.

Effect of SS-1 and SS-3 on asexual cycle of parasite.
Figure 4.
Effect of SS-1 and SS-3 on asexual cycle of parasite.

Giemsa stained bright-field microscope images showing the predominant parasite phenotype at different concentrations of SS-1 and SS-3 after 36 h of incubation. SS-1 and SS-3 treated parasites do not progress normally at its lowest concentration of 3.7 7.5 µM, respectively, and morphologically distorted rings observed (A,C). Bars and solid lines graphs represent growth arrests from rings to schizonts stages in the parasites treated with SS-1and SS-3 (B, D and E). A graph represents the IC50 value of SS-1 and SS-3 for inhibiting 50% parasite growth in vitro (F). (** indicates no parasites).

Figure 4.
Effect of SS-1 and SS-3 on asexual cycle of parasite.

Giemsa stained bright-field microscope images showing the predominant parasite phenotype at different concentrations of SS-1 and SS-3 after 36 h of incubation. SS-1 and SS-3 treated parasites do not progress normally at its lowest concentration of 3.7 7.5 µM, respectively, and morphologically distorted rings observed (A,C). Bars and solid lines graphs represent growth arrests from rings to schizonts stages in the parasites treated with SS-1and SS-3 (B, D and E). A graph represents the IC50 value of SS-1 and SS-3 for inhibiting 50% parasite growth in vitro (F). (** indicates no parasites).

Effect of SS-5 on asexual and sexual cycle of parasite.
Figure 5.
Effect of SS-5 on asexual and sexual cycle of parasite.

Giemsa stained bright-field microscope images showing the predominant parasite phenotype at different concentrations of SS-5 after 36 h of incubation. SS-5 treated parasites do not progress normally at its lowest concentration of 1.5 µM and morphologically distorted rings observed (A). Bars and solid lines graphs represent growth arrests from rings to schizonts stages in the parasites treated with different concentrations of SS-5 (B,C). A graph represents the IC50 value of SS-5 for inhibiting 50% parasite growth in vitro (D). Giemsa stained bright-field microscope images showing the predominant parasite phenotype at 24 and 72 h after the addition of compound SS-5 (E). The total percentage of different sexual stages I–V at 24  and 72 h after each treatment was calculated and plotted as a percentage of parasites along with the DMSO control (F) (* indicates no parasites).

Figure 5.
Effect of SS-5 on asexual and sexual cycle of parasite.

Giemsa stained bright-field microscope images showing the predominant parasite phenotype at different concentrations of SS-5 after 36 h of incubation. SS-5 treated parasites do not progress normally at its lowest concentration of 1.5 µM and morphologically distorted rings observed (A). Bars and solid lines graphs represent growth arrests from rings to schizonts stages in the parasites treated with different concentrations of SS-5 (B,C). A graph represents the IC50 value of SS-5 for inhibiting 50% parasite growth in vitro (D). Giemsa stained bright-field microscope images showing the predominant parasite phenotype at 24 and 72 h after the addition of compound SS-5 (E). The total percentage of different sexual stages I–V at 24  and 72 h after each treatment was calculated and plotted as a percentage of parasites along with the DMSO control (F) (* indicates no parasites).

Table 1.
Inhibitory concentration of tested compounds for blocking asexual parasite growth in vitro
S. noCompoundsIC50 (µM)
C1 14.6 ± 1.1 
C2 12.8 ± 1.3 
C3 16.1 ± 1.6 
SS-1 2.7 ± 0.9 
SS-2 15.2 ± 1.2 
SS-3 4.7 ± 1.1 
SS-4 23.6 ± 2,1 
SS-5 1.1 ± 0.2 
Z-FA-FMK 2.7 ± 0.45 
S. noCompoundsIC50 (µM)
C1 14.6 ± 1.1 
C2 12.8 ± 1.3 
C3 16.1 ± 1.6 
SS-1 2.7 ± 0.9 
SS-2 15.2 ± 1.2 
SS-3 4.7 ± 1.1 
SS-4 23.6 ± 2,1 
SS-5 1.1 ± 0.2 
Z-FA-FMK 2.7 ± 0.45 

Effect of compounds on sexual-stage parasites

Since PfMCA-2 was expressed in gametocyte stages I–IV, we assessed the effects of the Z-FA-FMK analogs, on sexual-stage parasites. After 24 h of incubation, when controls were gametocytes stages II and III, and after 72 h, when controls were stages IV and V, parasites treated with SS-1 (3.7 µM), SS-3 (7.5 µM) and SS-5 (1 µM), were morphologically abnormal (Figure 6A,C; 6B,D; 5E,F, respectively) (Table 2).

Effect of SS-1 and SS-3 on sexual cycle of parasite.

Figure 6.
Effect of SS-1 and SS-3 on sexual cycle of parasite.

Giemsa stained bright-field microscope images showing the predominant parasite phenotype at 24 and 72 h after the addition of compound SS-1 and SS-3 (A,B). The total percentage of different sexual stages I–V at 24 and 72 h after each treatment was calculated and plotted as a percentage of parasites along with the DMSO control (C,D) (** indicates the absence of parasite after the treatment).

Figure 6.
Effect of SS-1 and SS-3 on sexual cycle of parasite.

Giemsa stained bright-field microscope images showing the predominant parasite phenotype at 24 and 72 h after the addition of compound SS-1 and SS-3 (A,B). The total percentage of different sexual stages I–V at 24 and 72 h after each treatment was calculated and plotted as a percentage of parasites along with the DMSO control (C,D) (** indicates the absence of parasite after the treatment).

Table 2.
Inhibitory concentration of tested compounds for blocking sexual parasite growth in vitro
S. noCompoundsIC50 (µM)
SS-1 3.8 ± 0.9 
SS-3 5.2 ± 1.1 
SS-5 0.8 ± 0.1 
Z-FA-FMK 1.8 ± 0.3 
S. noCompoundsIC50 (µM)
SS-1 3.8 ± 0.9 
SS-3 5.2 ± 1.1 
SS-5 0.8 ± 0.1 
Z-FA-FMK 1.8 ± 0.3 

Treatment with SS-5 hampers cell viability and causes the generation of reactive oxygen species

Cellular ROS formation after treatment of schizonts and gametocytes with the compounds was measured fluorometrically overtime as a conversion of CM-H2DCFDA to 2, 7-dichlorofluorescein. Compared with controls, the level of ROS was significantly higher in SS-5 treated schizonts within 2 h of treatment, and the level further increased over 16 h of incubation (Figure 7A). The level of ROS was also increased in SS-5 treated gametocytes (Figure 7C). ROS levels in parasites treated with SS-1 and SS-3 were similar to those of DMSO-treated controls (Figure7A,C). The viability of schizonts and gametocytes stage parasites was measured using AlamarBlue dye. The fluorescent signals from the DMSO-treated cultures constantly increased whereas the signal was declined in the SS-5 treated culture at 16 h (Figure 7B,D). The decline in fluorescence signal indicated that the majority of parasites lost their viability within 16 h of treatment with 1 µM SS-5. In contrast, after incubation with SS-1 and SS-3, the majority of cells were viable and progressed to different developmental stages (Figure 7B,D).

Compound SS-5 affects the cell viability and induced oxidative stress by the generation of reactive oxygen species (ROS).

Figure 7.
Compound SS-5 affects the cell viability and induced oxidative stress by the generation of reactive oxygen species (ROS).

Measurement of ROS level for the schizonts treated with SS-5 (2 µM). After incubation with H2DCFDA, the fluorescence intensity was measured at 530 nm. The values were obtained in triplicates, averaged and plotted against time (A,C). P. falciparum schizonts and gametocytes were cultured in the presence of SS-5, SS-3 and SS-1 for 8 h prior to the addition of AlamarBlue. AlamarBlue was added at 2, 4 or 8 h and after addition, fluorescence was measured at 4, 8 and 16 h, respectively; p < 0.05** (Student's t-test). The viability of cells (schizonts and gametocytes) was calculated using AlamarBlue dye. The values were taken in triplicate and averaged. The fluorescence intensity as a measure of cell viability was plotted against different time points. p < 0.05*(significant); p ≤ 0.01** (highly significant) (B,D).

Figure 7.
Compound SS-5 affects the cell viability and induced oxidative stress by the generation of reactive oxygen species (ROS).

Measurement of ROS level for the schizonts treated with SS-5 (2 µM). After incubation with H2DCFDA, the fluorescence intensity was measured at 530 nm. The values were obtained in triplicates, averaged and plotted against time (A,C). P. falciparum schizonts and gametocytes were cultured in the presence of SS-5, SS-3 and SS-1 for 8 h prior to the addition of AlamarBlue. AlamarBlue was added at 2, 4 or 8 h and after addition, fluorescence was measured at 4, 8 and 16 h, respectively; p < 0.05** (Student's t-test). The viability of cells (schizonts and gametocytes) was calculated using AlamarBlue dye. The values were taken in triplicate and averaged. The fluorescence intensity as a measure of cell viability was plotted against different time points. p < 0.05*(significant); p ≤ 0.01** (highly significant) (B,D).

SS-5 triggers accumulation of intracellular Ca2+, followed by depolarization of mitochondrial membrane potential

The intracellular [Ca2+] level was measured in control and SS-5 treated parasites. Untreated parasites maintained intracellular [Ca2+] at 45 ± 4 nM. Parasites treated with SS-5 (2 µM) exhibited a time dependent increase in cytosolic Ca2+, ∼145 ± 4.2 nM was observed after 6 h of incubation (Figure 8A). Changes in the mitochondrial membrane potential (ΔΨm) were determined using mitosensor dye JC-1. A fall in the mitochondrial membrane potential of SS-5-treated parasites was indicated by increased green fluorescence intensity and loss of red signal (Figure 8B,C).

Measurement of mitochondrial potential and changes in intracellular Ca2+ and ATP level after SS-5 treatment.

Figure 8.
Measurement of mitochondrial potential and changes in intracellular Ca2+ and ATP level after SS-5 treatment.

An increase in Ca2+ level was measured after treatment with SS-5 compared with untreated (A). Fluorescent microscopic images of JC-1-stained representative parasites showing the accumulation of aggregated JC-1(red) in the mitochondria and monomeric JC-1(green) in the cytosol. The parasite nuclei were stained with DAPI (blue) (B). Bar graph showing a reduction in the ratio of JC-1(red)/JC-1(green) in parasite population after treatment with SS-5; a total of one million cells were counted by flow cytometry to calculate JC-1 ratio; p ≤ 0.01**(highly significant) (C). Schizonts stage parasites were treated with 0.2% DMSO and SS-5 for 2, 4, 6 or 8 h, and total cytosolic ATP was measured as described in Materials and methods (D).

Figure 8.
Measurement of mitochondrial potential and changes in intracellular Ca2+ and ATP level after SS-5 treatment.

An increase in Ca2+ level was measured after treatment with SS-5 compared with untreated (A). Fluorescent microscopic images of JC-1-stained representative parasites showing the accumulation of aggregated JC-1(red) in the mitochondria and monomeric JC-1(green) in the cytosol. The parasite nuclei were stained with DAPI (blue) (B). Bar graph showing a reduction in the ratio of JC-1(red)/JC-1(green) in parasite population after treatment with SS-5; a total of one million cells were counted by flow cytometry to calculate JC-1 ratio; p ≤ 0.01**(highly significant) (C). Schizonts stage parasites were treated with 0.2% DMSO and SS-5 for 2, 4, 6 or 8 h, and total cytosolic ATP was measured as described in Materials and methods (D).

SS-5 caused decreased ATP levels

We measured intracellular ATP content in normal and SS-5-treated parasites. When parasites were treated with 2 µM SS-5 for 2 h, ATP levels were the same as those in controls (∼118 nmol/106 cells) (Figure 8D). However, after 8 h there was a dramatic decrease in ATP level (21.6 nmol/106 cells) compared with controls 120 nmol/106 cells (Figure 8D). These results indicate that the generation of ROS followed by depolarization of mitochondrial potential (ΔΨm) inhibited cellular ATP generation.

SS-5 induce cell death in vitro

To study cell death, the percentage of cells undergoing apoptosis/necrosis was determined by flow cytometry after staining with annexin V-FITC and PI. After incubation with SS-1, SS-3 and SS-5, the percentage of apoptotic cells was 25%, 28% and 56%, respectively, compared with 1.2% in controls (Figure 9A,B). Microscopic analysis revealed DNA fragmentation in eight nucleated schizonts 12 h after incubation with SS-5 (2 µM) (Figure 9D). Similar sign of DNA fragmentation was observed in SS-1 and SS-3 treated parasites (Data not shown). Flow cytometry analysis also revealed that the percentages of TUNEL-positive cells were increased with following SS-5 (45%), SS-1 (25%) and SS-3 (16%) treatment compared with control (Figure 9C,E). Notably, ∼50% of SS-5 treated schizonts were positive for TUNEL staining in the presence of terminal deoxynucleotidyl transferase (TdT) and a much smaller proportion was stained in the absence of TdT (Figure 9C). Taken together, our findings indicate that SS-5 induces apoptosis in P. falciparum.

Analysis of cell death in P. falciparum in vitro.

Figure 9.
Analysis of cell death in P. falciparum in vitro.

Dot plots represented the population of dead cells analyzed by flow cytometry using annexin-V and propidium iodide in FL-1 versus FL-2 channels, respectively. The cells in the bottom right quadrant indicate apoptosis, whereas cells in the top left quadrant represent the necrotic population (A). Bar graph showing the percentage of dead cells population treated with different compounds as determined by FACS analysis (B). Bar graph represents the percentage of TUNEL-positive cells after treatment with SS-1, SS-3 and SS-5 (C). Images of P. falciparum schizonts with fragmented DNA marked as TUNEL-positive cells. Positive cells showed a bright red nucleus. DAPI staining was used to check the location of the nucleus (D). Flow cytometry analysis of DNA fragmentation was performed by TdT labeling kit as per the manufacturer's protocol (E).

Figure 9.
Analysis of cell death in P. falciparum in vitro.

Dot plots represented the population of dead cells analyzed by flow cytometry using annexin-V and propidium iodide in FL-1 versus FL-2 channels, respectively. The cells in the bottom right quadrant indicate apoptosis, whereas cells in the top left quadrant represent the necrotic population (A). Bar graph showing the percentage of dead cells population treated with different compounds as determined by FACS analysis (B). Bar graph represents the percentage of TUNEL-positive cells after treatment with SS-1, SS-3 and SS-5 (C). Images of P. falciparum schizonts with fragmented DNA marked as TUNEL-positive cells. Positive cells showed a bright red nucleus. DAPI staining was used to check the location of the nucleus (D). Flow cytometry analysis of DNA fragmentation was performed by TdT labeling kit as per the manufacturer's protocol (E).

Dose-dependent cytotoxicity effect of SS-5, SS-1 and SS-3

To assess the cytotoxicity, hepatocellular carcinoma (HepG2) cell line was studied with the MTT assay. After 48 h incubations with up to 5 mM SS-1, SS-3 and SS-5, the cells had 70–80% viability, indicating a lack of marked toxicity (Figure 10A).

In vivo effect of SS-1, SS-3 and SS-5 on the parasite survival.

Figure 10.
In vivo effect of SS-1, SS-3 and SS-5 on the parasite survival.

The percentage cell viability was assessed in HepG2 cell line in the presence of SS-1, SS-3 and SS-5 and their respective controls (A). Mice in each experimental group were treated with compound SS-1, SS-3 and SS-5 (25 mg/kg). Giemsa stained bright-field microscope images showing the parasite phenotype and parasitaemia on day 1, 6 and 12 after the addition of compound SS-5. Parasitaemia was determined by counting 1000 erythrocytes in a different field (B). The percent parasitaemia on days 0–12 shown in the figure. On day 12, SS-1 and SS-3 treated groups; the mean parasitaemia was determined to be ∼20% whereas in the SS-5 group, the mean parasitaemia was ∼5% (C). Bar graph represents the percentage of parasite suppression after treatment with SS-1, SS-3 and SS-5 over the period of time (D).

Figure 10.
In vivo effect of SS-1, SS-3 and SS-5 on the parasite survival.

The percentage cell viability was assessed in HepG2 cell line in the presence of SS-1, SS-3 and SS-5 and their respective controls (A). Mice in each experimental group were treated with compound SS-1, SS-3 and SS-5 (25 mg/kg). Giemsa stained bright-field microscope images showing the parasite phenotype and parasitaemia on day 1, 6 and 12 after the addition of compound SS-5. Parasitaemia was determined by counting 1000 erythrocytes in a different field (B). The percent parasitaemia on days 0–12 shown in the figure. On day 12, SS-1 and SS-3 treated groups; the mean parasitaemia was determined to be ∼20% whereas in the SS-5 group, the mean parasitaemia was ∼5% (C). Bar graph represents the percentage of parasite suppression after treatment with SS-1, SS-3 and SS-5 over the period of time (D).

Compound SS-5 reduces parasite burden in vivo

We assessed the activities of SS-1, SS-3 and SS-5 against the murine parasite P. berghei. There were prominent morphological deformities in the parasite, (Figure 10B) and parasitaemia was lower in treated, compared with control animals (Figure 10B,C) (Table 3). Compounds SS-1 and SS-3 had modest anti-parasitic effects (Figure 10C,D).

Table 3.
Response to treatment of SS-1, SS-3 and SS-5 in BALBc mice infected with P. berghei on day 8
Dose of compound (25 mg/kg)Parasitaemia ± SEM (%)Parasite suppression ± SEM (%)
SS-1 8.0 ± 1.2 30 ± 6 
SS-3 10.6 ± 1.8 22 ± 2 
SS-5 2.2 ± 0.9 57 ± 11 
Dose of compound (25 mg/kg)Parasitaemia ± SEM (%)Parasite suppression ± SEM (%)
SS-1 8.0 ± 1.2 30 ± 6 
SS-3 10.6 ± 1.8 22 ± 2 
SS-5 2.2 ± 0.9 57 ± 11 

Molecular docking of PfMCA-2 and SS-5

The crystal structure of PfMCA-2 is not known. Therefore, a homology model of the predicted active site region of PfMCA-2 was prepared using Protein Model Server and validated with SAVES server. The best model of PfMCA-2 was selected for the docking study. Docking was carried out using the docking server, PatchDock and docking results were refined with FireDock [51,52]. FireDock server analyses and sorts the refined complex structures based on energy functions such as global energy, atomic contact energy, and contributions of hydrogen bonds and, Van der Waals interactions. It was observed that SS-5 binds to the predicted substrate recognition site of PfMCA-2 with high affinity (global energy; −48.62) compared with Z-FA-FMK (global energy; −29.54) (Figure 11A). The strong interaction of the SS-5 β-amino acid warhead with most of the residues in the substrate recognition site of PfMCA-2 suggests specific interaction of SS-5 with PfMCA-2 compared with Z-FA-FMK (Figure 11B).

Molecular docking of PfMCA-2 with SS-5.

Figure 11.
Molecular docking of PfMCA-2 with SS-5.

Docked complex of PfMCA-2 with most effective SS-5 and effector caspase inhibitor, Z-FA-FMK (A). Interaction map showing key amino acid residues of PfMCA-2 involved in binding to the substrate, Z-GRR-AMC, and inhibitor SS-5 and Z-FA-FMK (B).

Figure 11.
Molecular docking of PfMCA-2 with SS-5.

Docked complex of PfMCA-2 with most effective SS-5 and effector caspase inhibitor, Z-FA-FMK (A). Interaction map showing key amino acid residues of PfMCA-2 involved in binding to the substrate, Z-GRR-AMC, and inhibitor SS-5 and Z-FA-FMK (B).

Discussion

We previously showed that the inhibition of PfMCA-2 by Z-FA-FMK (effector caspases inhibitor) led to the generation of oxidative stress and the occurrence of apoptosis-like cell death in P. falciparum. Therefore, we designed and synthesized five analogs by structural modification in Z-FA-FMK with amides of PA. Interestingly, among the five analogs, SS-5 was specifically inhibited PfMCA-2 and caused further downstream processes of cell death in P. falciparum.

Regulated protein turnover machinery in the cell is crucial for efficient cellular homeostasis; any interference with this system provokes cellular stress and alters the typical functioning of proteins vital for cell survival [41]. In accordance with our previous study where Z-FA-FMK reduced the expression level of PfMCA-2 both at mRNA and protein level and also caused in vitro parasite growth arrest [24]. In the present study, specific compound, SS-5 also reduced the mRNA as well as protein expression of PfMCA-2 at schizonts and gametocytes stages where PfMCA-2 maximally expressed. Furthermore, SS-5 effectively inhibited the parasite growth throughout the asexual and sexual stages of the parasite life cycle. Gene expression changes are a major component of stress responses, along with alterations in metabolism, cell cycle progression, protein homeostasis, cytoskeletal organization, vesicular trafficking and modification of enzymatic activities. It is well illustrated in yeast, mammalian and drosophila that the alteration of gene expression occurs in response to stress [53]. Interestingly, in the presence of SS-5, there was a consistent increase in cytosolic ROS and loss of cell viability. The morphological changes in PCD result from various physiological imbalances that arise inside the parasites. The previous study showed that in Leishmania donovani, oxidative stress causes mitochondrial depolarization by increasing cytosolic Ca2+ levels [8,41]. It was also reported that calcium flux is necessary not only for the activation of different proteases31 but also for the appearance of phosphatidylserine on the outer leaflet of the plasma membrane during apoptosis-like cell death. Considering the importance of the cytosolic Ca2+ level in inducing apoptosis, we measured the intracellular Ca2+ in SS-5 treated parasites at different time intervals. Notably, in the presence of SS-5, the intracellular Ca2+ level was consistently increased throughout the time course whereas the mitochondrial potential was significantly reduced. Together, these results suggest that SS-5-induced cellular stress by altering the calcium homeostasis, which thereby induces a loss of mitochondrial potential (ΔΨm). Therefore, mitochondrial dysfunction may occur due to a change in cation homeostasis caused by high ROS levels. Earlier studies revealed that the maintenance of proper mitochondrial potential (ΔΨm) is essential for the survival of the cell as it drives the synthesis of ATP and maintains oxidative phosphorylation [8]. Interestingly, the present study showed that in the absence of proper functional mitochondria, cells cease to synthesize ATP from their mitochondrial source and causes a rapid decrease in cellular ATP levels up to 50% by 6 h post-treatment with SS-5 (Figure 8D). Our results are consistent with the study reported previously that the ATP level gradually decreases after the loss of ΔΨm during treatment with H2O2 [43]. As literature suggested, ATP is a key molecule for chromatin condensation, nuclear fragmentation and regulation, and the maintenance of ion homeostasis during apoptosis [8,41]. Therefore, depletion of the ATP level enhances apoptosis by creating cellular oxidative stress, followed by externalization of phosphatidylserine and DNA fragmentation. These altogether are responsible for the deregulation of vital cellular functions in parasite; ultimately leading to type I cell death (apoptosis) (Figure 12).

Schematic proposed pathway of SS-5-induced PfMCA-2-dependent apoptotic cell death in P. falciparum.

Figure 12.
Schematic proposed pathway of SS-5-induced PfMCA-2-dependent apoptotic cell death in P. falciparum.
Figure 12.
Schematic proposed pathway of SS-5-induced PfMCA-2-dependent apoptotic cell death in P. falciparum.

These findings add useful information about the PfMCA-2 role in P. falciparum and this could be further utilized for developing a more sensitive inhibitor which inhibits PfMCA-2 in picomolar concentration and could be used as a potent antimalarial. However, this study leaves some important questions to address; detailed mechanism behind the execution of PfMCA-2 dependant parasite cell death was still need to validate. Overall, this study reveals that the PfMCA-2 appears to be an important enzyme for the maintenance of cellular homeostasis and regulation of vital cellular machinery in human malaria parasite P. falciparum. In addition, PfMCA-2 could be one of the important players for regulating stress-dependent programmed cell death in P. falciparum.

Competing Interests

I hereby confirmed that there is no competing interest associated with this study.

Funding

This work has been supported by DBT Ramalingaswami Fellowship (BT/HRD/35/02/2009) and ICMR-NIMR Intramural grant sanctioned to KCP and ICMR-SRF awarded to Vandana.

Author Contributions

Vandana and K.C.P. developed the project, designed and optimized the experiments, interpreted the data, and wrote the manuscript; Vandana and K.M.P. optimized the in vitro parasite culture experiments and data analysis. Vandana and A.P.S., M.K. and inderjeet designed performed and interpreted data of In vivo study; R.R. and S.S. help in designing and synthesis of the chemical compounds. All the authors approved and reviewed the final version of the manuscript.

Acknowledgements

Authors express sincere thanks to Prof. Alo Nag, Dr. Radhakrishan Pillai, for their constant guidance in the study and Dr. Asif Mohammed for providing JC-1 dye. We thank Prof. Philip J Rosenthal and Dr. Akash Ranjan for critically reading the manuscript and provide valuable suggestions. A special thanks to Dr. Yash Gupta for his help in performing a bioinformatics analysis study. Also, we thank Mr. Devesh Mishra for their technical assistance for completing this work. Vandana would like to acknowledge the Indian Council of Medical Research (ICMR) for financial support. The present manuscript was approved by the publication committee (No.43/2018) of the ICMR-National Institute of Malaria Research (ICMR-NIMR), New Delhi.

Abbreviations

     
  • PfMCA-2

    Plasmodium falciparum metacaspase-2

  •  
  • PA

    piperic acid

  •  
  • TFA

    trifluoroacetic acid

  •  
  • DCM

    dichloromethane

  •  
  • NMM

    N-methylmorpholine

  •  
  • pRBC

    parasitized RBC

  •  
  • PI

    propidium iodide

References

References
1
D'Arcy
,
M.S.
(
2019
)
Cell death: a review of the major forms of apoptosis, necrosis and autophagy
.
Cell Biol. Int.
43
,
582
592
2
Uren
,
A.G.
,
O'Rourke
,
K.
,
Aravind
,
L.A.
,
Pisabarro
,
M.T.
,
Seshagiri
,
S.
,
Koonin
,
E.V.
et al (
2000
)
Identification of paracaspases and metacaspases: two ancient families of caspase like proteins, one of which plays a key role in MALT lymphoma
.
Mol. Cell
6
,
961
967
3
Schulz
,
J.B.
,
Weller
,
M.
and
Moskowitz
,
M.A.
(
1999
)
Caspases as treatment targets in stroke and neurodegenerative diseases
.
Ann. Neurol.
45
,
421
429
4
Rohn
,
T.T.
and
Head
,
E.
(
2009
)
Caspases as therapeutic targets in Alzheimer's disease: is it time to “cut” to the chase?
Int. J. Clin. Exp. Pathol.
2
,
108
118
PMID:
[PubMed]
5
Holtzman
,
D.M.
and
Deshmukh
,
M.
(
1997
)
Caspases: a treatment target for neurodegenerative disease?
Nat. Med.
3
,
954
955
6
Meslin
,
B.
,
Zalila
,
H.
,
Fasel
,
N.
,
Picot
,
S.
and
Bienvenu
,
A.L.
(
2011
)
Are protozoan metacaspases potential parasite killers?
Parasit. Vectors
4
,
26
7
Engelbrecht
,
D.
and
Coetzer
,
T.L.
(
2015
)
Sunlight inhibits growth and induces markers of programmed cell death in Plasmodium falciparum in vitro
.
Malar. J.
14
,
378
8
Chowdhury
,
S.
,
Mukherjee
,
T.
,
Chowdhury
,
S.R.
,
Sengupta
,
S.
,
Mukhopadhyay
,
S.
,
Jaisankar
,
P.
et al (
2014
)
Disuccinyl betulin triggers metacaspase-dependent endonucleas mediated cell death in unicellular protozoan parasite Leishmania donovani
.
Antimicrob. Agents Chemother.
58
,
2186
2201
9
McLuskey
,
K.
,
Moss
,
C.X.
and
Mottram
,
J.C.
(
2014
)
Purification, characterization, and crystallization of Trypanosoma metacaspases
.
Methods Mol. Biol. (Clifton, N.J.)
1133
,
203
221
10
Tsiatsiani
,
L.
,
Van Breusegem
,
F.
,
Gallois
,
P.
,
Zavialov
,
A.
,
Lam
,
E.
and
Bozhkov
,
P.V.
(
2011
)
Metacaspases
.
Cell Death Differ.
18
,
1279
1288
11
Mottram
,
J.C.
,
Helms
,
M.J.
,
Coombs
,
G.H.
and
Sajid
,
M.
(
2003
)
Clan CD cysteine peptidases of parasitic protozoa
.
Trends Parasitol.
19
,
182
187
12
Ameisen
,
J.C.
,
Idziorek
,
T.
,
Billaut-Mulot
,
O.
,
Loyens
,
M.
,
Tissier
,
J.P.
,
Potentier
,
A.
et al (
1995
)
Apoptosis in a unicellular eukaryote (Trypanosoma cruzi): implications for the evolutionary origin and role of programmed cell death in the control of cell proliferation, differentiation and survival
.
Cell Death Differ.
2
,
285
300
PMID:
[PubMed]
13
Cornillon
,
S.
,
Foa
,
C.
,
Davoust
,
J.
,
Buonavista
,
N.
,
Gross
,
J.D.
and
Golstein
,
P.
(
1994
)
Programmed cell death in dictyostelium
.
J. Cell Sci.
107
,
2691
2704
PMID:
[PubMed]
14
Davis
,
M.C.
,
Ward
,
J.G.
,
Herrick
,
G.
and
Allis
,
C.D.
(
1992
)
Programmed nuclear death: apoptotic-like degradation of specific nuclei in conjugating Tetrahymena
.
Dev. Biol.
154
,
419
432
15
Vardi
,
A.
,
Eisenstadt
,
D.
,
Murik
,
O.
,
Berman-Frank
,
I.
,
Zohary
,
T.
,
Levine
,
A.
et al (
2007
)
Synchronization of cell death in a dinoflagellate population is mediated by an excreted thiol protease
.
Environ. Microbiol.
9
,
360
369
16
Welburn
,
S.C.
,
Lillico
,
S.
and
Murphy
,
N.B.
(
1999
)
Programmed cell death in procyclic form Trypanosoma brucei rhodesiense: identification of differentially expressed genes during con A induced death
.
Mem. Inst. Oswaldo Cruz.
94
,
229
234
17
Piacenza
,
L.
,
Peluffo
,
G.
and
Radi
,
R.
(
2001
)
L-Arginine-dependent suppression of apoptosis in trypanosoma cruzi: contribution of the nitric oxide and polyamine pathways
.
Proc. Natl. Acad. Sci. U.S.A.
98
,
7301
7306
18
Nguewa
,
P.A.
,
Fuertes
,
M.A.
,
Valladares
,
B.
,
Alonso
,
C.
and
Perez
,
J.M.
(
2004
)
Programmed cell death in trypanosomatids: a way to maximize their biological fitness?
Trends Parasitol.
20
,
375
380
19
Ridgley
,
E.L.
,
Xiong
,
Z.H.
and
Ruben
,
L.
(
1999
)
Reactive oxygen species activate a Ca2+- dependent cell death pathway in the unicellular organism Trypanosoma brucei
.
Biochem. J.
340
,
33
40
20
Khademvatan
,
S.
,
Gharavi
,
M.J.
and
Saki
,
J.
(
2011
)
Miltefosine induces metacaspase and PARP genes expression in Leishmania infantum
.
Braz. J. Infect. Dis.
15
,
442
448
21
Proto
,
W.R.
,
Castanys-Munoz
,
E.
,
Black
,
A.
,
Tetley
,
L.
,
Moss
,
C.X.
,
Juliano
,
L.
et al (
2011
)
Trypanosoma brucei metacaspase 4 is a pseudopeptidase and a virulence factor
.
J. Biol. Chem.
286
,
39914
39925
22
Kosec
,
G.
,
Alvarez
,
V.E.
,
Agüero
,
F.
,
Sánchez
,
D.
,
Dolinar
,
M.
,
Turk
,
B.
et al (
2006
)
Metacaspases of Trypanosoma cruzi: possible candidates for programmed cell death mediators
.
Mol. Biochem. Parasitol.
145
,
18
28
23
Alvarez
,
V.E.
,
Niemirowicz
,
G.T.
and
Cazzulo
,
J.J.
(
2013
)
Metacaspases, autophagins and metallocarboxypeptidases: potential new targets for chemotherapy of the trypanosomiases
.
Curr. Med. Chem.
20
,
3069
3077
24
Vandana
,
Singh
,
A.P.
,
Singh
,
J.
,
Sharma
,
R.
,
Akhter
,
M.
,
Mishra
,
P.K.
et al (
2018
)
Biochemical characterization of unusual cysteine protease of P. falciparum, metacaspase-2 (MCA-2)
.
Mol. Biochem. Parasitol.
220
,
28
41
25
Okwute
,
S.K.
and
Egharevba
,
H.O.
(
2013
)
Piperine-type amides: review of the chemical and biological characteristics
.
Int. J. Chem.
5
,
99
122
26
Posner
,
G.H.
,
Wang
,
D.
,
Cumming
,
J.N.
,
Oh
,
C.H.
,
French
,
A.N.
,
Bodley
,
A.L.
et al (
1995
)
Further evidence supporting the importance of and the restrictions on a carbon-centered radical for high antimalarial activity of 1, 2, 4-trioxanes like artemisinin
.
J. Med. Chem.
38
,
2273
2275
27
Pandey
,
K.C.
,
Wang
,
S.X.
,
Sijwali
,
P.S.
,
Lau
,
A.L.
,
McKerrow
,
J.H.
and
Rosenthal
,
P.J.
(
2005
)
The Plasmodium falciparum cysteine protease falcipain-2 captures its substrate, hemoglobin, via a unique motif
.
Proc. Natl. Acad. Sci. U.S.A.
102
,
9138
9143
28
Pandey
,
K.C.
,
Sijwali
,
P.S.
,
Singh
,
A.
,
Na
,
B.K.
and
Rosenthal
,
P.J.
(
2004
)
Independent intramolecular mediators of folding, activity, and inhibition for the Plasmodium falciparum cysteine protease falcipain-2
.
J. Biol. Chem.
279
,
3484
3491
29
Pandey
,
K.C.
,
Singh
,
N.
,
Arastu-Kapur
,
S.
,
Bogyo
,
M.
and
Rosenthal
,
P.J.
(
2006
)
Falstatin, a cysteine protease inhibitor of Plasmodium falciparum, facilitates erythrocyte invasion
.
PLoS Pathog.
2
,
e117
30
Walsh
,
J.G.
,
Cullen
,
S.P.
,
Sheridan
,
C.
,
Lüthi
,
A.U.
,
Gerner
,
C.
and
Martin
,
S.J.
(
2008
)
Executioner caspase-3 and caspase-7 are functionally distinct proteases
.
Proc. Natl. Acad. Sci. U.S.A.
105
,
12815
12819
31
Roschitzki-Voser
,
H.
,
Schroeder
,
T.
,
Lenherr
,
E.D.
,
Frölich
,
F.
,
Schweizer
,
A.
,
Donepudi
,
M.
et al (
2012
)
Human caspases in vitro: expression, purification and kinetic characterization
.
Protein Expr. Purif.
84
,
236
246
32
Sharma
,
P.
,
Sharma
,
S.
,
Mishra
,
A.K.
,
Thomas
,
T.
,
Das De
,
T.
,
Rohilla
,
S.L.
et al (
2015
)
Unraveling dual feeding associated molecular complexity of salivary glands in the mosquito Anopheles culicifacies
.
Biol. Open
4
,
1002
1015
33
Lambros
,
C.
and
Vanderberg
,
J.P.
(
1979
)
Synchronization of Plasmodium falciparum erythrocytic stages in culture
.
J. Parasitol.
65
,
418
420
34
Ranjan
,
R.
,
Ahmed
,
A.
,
Gourinath
,
S.
and
Sharma
,
P.
(
2009
)
Dissection of mechanisms involved in the regulation of Plasmodium falciparum calcium-dependent protein kinase 4
.
J. Biol. Chem.
284
,
15267
15276
35
Fivelman
,
Q.L.
,
McRobert
,
L.
,
Sharp
,
S.
,
Taylor
,
C.J.
,
Saeed
,
M.
,
Swales
,
C.A.
et al (
2007
)
Improved synchronous production of Plasmodium falciparum gametocytes in vitro
.
Mol. Biochem. Parasitol.
154
,
119
123
36
Miao
,
J.
,
Wang
,
Z.
,
Liu
,
M.
,
Parker
,
D.
,
Li
,
X.
,
Chen
,
X.
et al (
2013
)
Plasmodium falciparum: generation of pure gametocyte culture by heparin treatment
.
Exp. Parasitol.
135
,
541
545
37
Li
,
X.
,
Chen
,
H.
,
Jeong
,
J.J.
and
Chishti
,
A.H.
(
2007
)
BDA-410: a novel synthetic calpain inhibitor active against blood stage malaria
.
Mol. Biochem. Parasitol.
155
,
26
32
38
Czesny
,
B.
,
Goshu
,
S.
,
Cook
,
J.L.
and
Williamson
,
K.C.
(
2009
)
The proteasome inhibitor epoxomicin has potent Plasmodium falciparum gametocytocidal activity
.
Antimicrob. Agents Chemother.
53
,
4080
4085
39
Tanaka
,
T.Q.
and
Williamson
,
K.C.
(
2011
)
A malaria gametocytocidal assay using oxidoreduction indicator
.
Mol. Biochem. Parasitol.
177
,
160
163
40
Dolai
,
S.
,
Pal
,
S.
,
Yadav
,
R.K.
and
Adak
,
S.
(
2011
)
Endoplasmic reticulum stress-induced apoptosis in Leishmania through Ca2+-dependent and caspase-independent mechanism
.
J. Biol. Chem.
286
,
13638
13646
41
Rathore
,
S.
,
Datta
,
G.
,
Kaur
,
I.
,
Malhotra
,
P.
and
Mohmmed
,
A.
(
2015
)
Disruption of cellular homeostasis induces organelle stress and triggers apoptosis like cell-death pathways in malaria parasite
.
Cell Death Dis.
6
,
e1803
42
Sen
,
N.
,
Das
,
B.B.
,
Ganguly
,
A.
,
Mukherjee
,
T.
,
Tripathi
,
G.
,
Bandyopadhyay
,
S.
et al (
2004
)
Camptothecin induced mitochondrial dysfunction leading to programmed cell death in unicellular hemoflagellate Leishmania donovani
.
Cell Death Differ.
11
,
924
936
43
Mukherjee
,
S.B.
,
Das
,
M.
,
Sudhandiran
,
G.
and
Shaha
,
C.
(
2002
)
Increase in cytosolic Ca2+ levels through the activation of non-selective cation channels induced by oxidative stress causes mitochondrial depolarization leading to apoptosis-like death in Leishmania donovani promastigotes
.
J. Biol. Chem.
277
,
24717
24727
44
Reape
,
T.J.
and
McCabe
,
P.F.
(
2010
)
Apoptotic-like regulation of programmed cell death in plants
.
Apoptosis
15
,
249
256
45
Vaid
,
A.
and
Sharma
,
P.
(
2006
)
PfPKB, a protein kinase B-like enzyme from Plasmodium falciparum: II. identification of calcium/calmodulin as its upstream activator and dissection of a novel signaling pathway
.
J. Biol. Chem.
281
,
27126
27133
46
Dixit
,
A.
,
Singh
,
P.K.
,
Sharma
,
G.P.
,
Malhotra
,
P.
and
Sharma
,
P.
(
2010
)
PfSRPK1, a novel splicing-related kinase from Plasmodium falciparum
.
J. Biol. Chem.
285
,
38315
38323
47
Rebelo
,
M.
,
Sousa
,
C.
,
Shapiro
,
H.M.
,
Mota
,
M.M.
,
Grobusch
,
M.P.
and
Hänscheid
,
T.
(
2013
)
A novel flow cytometric hemozoin detection assay for real-time sensitivity testing of Plasmodium falciparum
.
PLoS One
8
,
e61606
48
Mutai
,
B.K.
and
Waitumbi
,
J.N.
(
2010
)
Apoptosis stalks Plasmodium falciparum maintained in continuous culture condition
.
Malar. J.
9
,
S6
49
Stockert
,
J.C.
,
Blázquez-Castro
,
A.
,
Cañete
,
M.
,
Horobin
,
R.W.
and
Villanueva
,
A.
(
2012
)
MTT assay for cell viability: Intracellular localization of the formazan product is in lipid droplets
.
Acta Histochem.
114
,
785
796
50
Bankole
,
A.E.
,
Adekunle
,
A.A.
,
Sowemimo
,
A.A.
,
Umebese
,
C.E.
,
Abiodun
,
O.
and
Gbotosho
,
G.O.
(
2016
)
Phytochemical screening and in vivo antimalarial activity of extracts from three medicinal plants used in malaria treatment in Nigeria
.
Parasitol. Res.
115
,
299
305
51
Schneidman-Duhovny
,
D.
,
Inbar
,
Y.
,
Nussinov
,
R.
and
Wolfson
,
H.J.
(
2005
)
Patchdock and symmDock: servers for rigid and symmetric docking
.
Nucleic Acids Res.
33
,
363
367
52
Mashiach
,
E.
,
Schneidman-Duhovny
,
D.
,
Andrusier
,
N.
,
Nussinov
,
R.
and
Wolfson
,
H.J.
(
2008
)
Firedock: a web server for fast interaction refinement in molecular docking
.
Nucleic Acids Res.
36
,
229
232
53
De Nadal
,
E.
,
Ammerer
,
G.
and
Posas
,
F.
(
2011
)
Controlling gene expression in response to stress
.
Nat. Rev. Genet.
12
,
833

Author notes

*

These authors contributed equally.

Supplementary data