Fingerprint analyses of two potato spindle tuber viroid (PSTV) isolates causing severe and mild symptoms~ respectively, in tomato exhibited defined differences in the RNase T1 and RNase A fingerprints. The complete sequencing of the mild isolate and the comparison of its primary structure with the previously established one of the pathogenic type strain revealed that oligonucleotides CAAAAAAG, CUUUUUCUCUAUCUUACUUG, and AAAAAAGGAC in the ‘severe’ strain are replaced by CAAUAAG, CUUUUUCUCUAUCUUUCUUUG, AAU, and AAGGAC in the 'mild' strain. Thus, three nucleotide exchanges at different sites of the molecule may change a pathogenic viroid to a practically non-pathogenic isolate. The possible correlation between the secondary structure in a defined region of the PSTV molecule and its pathogenicity for tomato is discussed.
Skip Nav Destination
Article navigation
Research Article|
March 01 1981
A severe and a mild potato spindle tuber viroid isolate differ in three nucleotide exchanges only
Hans J. Gross;
Hans J. Gross
*Max-Planck-Institut für Biochemie, D-8033, Martinsried bei München
§Institut für Biochemie der Universität Würzburg, D-8700 Würzburg, F.R.G.
Search for other works by this author on:
Ursula Liebl;
Ursula Liebl
*Max-Planck-Institut für Biochemie, D-8033, Martinsried bei München
Search for other works by this author on:
Heidemarie Alberty;
Heidemarie Alberty
*Max-Planck-Institut für Biochemie, D-8033, Martinsried bei München
Search for other works by this author on:
Guido Krupp;
Guido Krupp
*Max-Planck-Institut für Biochemie, D-8033, Martinsried bei München
§Institut für Biochemie der Universität Würzburg, D-8700 Würzburg, F.R.G.
Search for other works by this author on:
Horst Domdey;
Horst Domdey
*Max-Planck-Institut für Biochemie, D-8033, Martinsried bei München
Search for other works by this author on:
Karla Ramm;
Karla Ramm
†Arbeitsgruppe Pflanzenvirologie, Justus-Liebig-Universität, D-6300, Giessen
§Institut für Biochemie der Universität Würzburg, D-8700 Würzburg, F.R.G.
Search for other works by this author on:
Heinz L. Sänger
Heinz L. Sänger
†Arbeitsgruppe Pflanzenvirologie, Justus-Liebig-Universität, D-6300, Giessen
§Institut für Biochemie der Universität Würzburg, D-8700 Würzburg, F.R.G.
Search for other works by this author on:
Publisher: Portland Press Ltd
Received:
February 18 1981
Online ISSN: 1573-4935
Print ISSN: 0144-8463
© 1981 The Biochemical Society
1981
Biosci Rep (1981) 1 (3): 235–241.
Article history
Received:
February 18 1981
Citation
Hans J. Gross, Ursula Liebl, Heidemarie Alberty, Guido Krupp, Horst Domdey, Karla Ramm, Heinz L. Sänger; A severe and a mild potato spindle tuber viroid isolate differ in three nucleotide exchanges only. Biosci Rep 1 March 1981; 1 (3): 235–241. doi: https://doi.org/10.1007/BF01114910
Download citation file:
Sign in
Don't already have an account? Register
Sign in to your personal account
You could not be signed in. Please check your email address / username and password and try again.
Could not validate captcha. Please try again.
Biochemical Society Member Sign in
Sign InSign in via your Institution
Sign in via your InstitutionGet Access To This Article
Open Access for all
We offer compliant routes for all authors from 2025. With library support, there will be no author nor reader charges in 5 journals. Check here |
![]() |