Previous studies have suggested an important role of ERs (oestrogen receptors) in the pathogenesis of leukaemias. However, there is no information so far about the epigenetic characteristics of ERα isoforms and ERβ in leukaemias. In the present study, the mRNA expression and promoter CpG methylation of ERα isoforms (i.e. ERα-A, -B and -C) and ERβ in leukaemia cell lines were evaluated using RT–PCR (reverse transcription–PCR) and MSP (methylation-specific PCR) respectively. The methylation of ERs was further analysed in acute leukaemia patients by MSP and direct DNA sequencing. Although all ERα isoforms and ERβ were methylated in all leukaemia cell lines, except for ERα-C, which was unmethylated in HL-60 and K562 cell lines, only the expression of ERα-A was deficient in all cell lines and its expression could be reactivated by DNA demethylation reagents. With regard to the methylation characteristics in acute leukaemia patients, only ERα-A was inactivated and specifically methylated (95%; 38/40) in almost all patients and unmethylated in all healthy controls, whereas ERα-B, -C and ERβ were methylated in both patients and healthy controls. This result suggested that the methylated status of ERα-A might serve as an epigenetic biomarker of leukaemias. The present study is the first report that demonstrates selective inactivation of ERα isoforms through the promoter CpG methylation pathway in leukaemias.

INTRODUCTION

Among various epigenetic events associated with human cancers, it is well documented that the aberrant promoter methylation plays a significant role in the epigenetic tumorigenesis of various human cancers [1]. To date, aberrant methylation of multiple gene promoters has been described in various leukaemias, such as ALL (acute lymphocytic leukaemia) and AML (acute myeloid leukaemia), and the results suggested a potential role of promoter methylation profiles in the diagnosis, prognosis or treatment prediction of acute leukaemias [24].

ERs (oestrogen receptors) are members of the nuclear steroid–thyroid hormone receptor superfamily. Two forms of ER, i.e. ERα and ERβ, have been identified [5]. Aberrant methylation of the ER promoter and associated epigenetic silencing of ER expression have been reported in various human cancers, such as breast cancer and colorectal carcinomas [5,6]. In human acute leukaemias, it has been reported that the aberrant methylation of ERα promoter was correlated with its epigenetic silencing, and can serve as epigenetic biomarkers in the diagnosis, prognosis and treatment prediction of leukaemias [46]. Three promoters, i.e. A, B and C, have been identified for the human ERα gene [7]. These promoters regulate the synthesis of specific transcripts corresponding to ERα-A, -B and -C isoforms [7]. Previous studies have shown that the expression of the above ERα isoforms could be regulated by promoter CpG methylation in human cancers, such as endometrial cancer [8]. We were interested in determining whether there is epigenetic regulation of ERα isoform expression by promoter CpG islands in human leukaemia. Moreover, studies have suggested a potential role of ERβ in leukomogenesis because the inactivation of ERβ in mice leads to a leukaemia-like syndrome [9]. In the present study, analysis was performed on the expression profile of ERα isoforms (i.e. ERα-A, -B and -C) and ERβ and their methylation status in acute leukaemias. This question is critical in understanding the complexity of ER gene expression and regulation in leukaemia cells.

MATERIALS AND METHODS

Cell culture and treatment with demethylation reagent

Jurkat, HL-60, K562, U937, THP-1 and MOLT-4 cells were maintained in RPMI 1640 medium containing 10% (v/v) fetal bovine serum. The cells were treated with a freshly prepared solution of 5-aza-dC (5-aza-2′-deoxycytidine; Sigma, St. Louis, MO, U.S.A.) according to published protocols [8,10]. On day 1, a final concentration of 2 mg/ml 5-aza-dC in PBS was added to the flask. On the following day, the medium was changed. On days 3 and 5, the cells were treated twice more as on day 1. On day 6, the cells were harvested.

Clinical blood samples of acute leukaemia patients

The present study was approved by local institutional review boards or ethics committees. The whole blood samples were collected from 40 cases of acute leukaemia patients having no record of any previous treatments in the Southwest Hospital (Chongqing, China) in 2006–2007. Ten samples of whole blood were collected from healthy volunteers. The histopathological types of leukaemia patients were identified by a pathologist having no connection with the present study. All patients were ethnic Chinese, and written informed consent had been obtained from all of them or their family members.

RNA isolation and RT–PCR (reverse transcription–PCR)

Cells were washed and lysed with guanidine isothiocyanate solution. Total RNA was extracted using an RNA Extraction kit for culture cells (TaKaRa, Dialian, China) by following the manufacturer's instructions. Three forward primers, i.e. RT-A, RT-B and RT-C, were respectively combined with a common reverse primer, i.e. RT-r, to specifically amplify transcript isoforms from promoters A, B and C respectively. A set of primers (RT-Common-f and RT-Common-r) was used to amplify transcripts common to these promoters. A set of primers (RT-ERβ-f and RT-ERβ-r) was used to specifically amplify transcripts of ERβ. Primers for β-actin were chosen specifically to amplify one intron in the β-actin gene. In the presence of contaminating genomic DNA, additional larger bands would be amplified; the lack of amplification of the larger band was used as a control to rule out contamination with any genomic DNA. The sequences and PCR cycling conditions were listed in Table 1.

Table 1
Summary of the primer sets and PCR conditions of ERs
Primer*Sequence (5′→3′)DenaturingAnnealingExtensionCycleFinal incubationReference
ERα-A-Uf GGATATGGTTTGTATTTTGTTTGT 94°C, 30 s 46°C, 30 s 72°C, 60 s 40 72°C, 8 min [8
ERα-A-Ur ACAAACAATTCAAAAACTCCAACT      [8
ERα-A-Mf GATACGGTTTGTATTTTGTTCGC 94°C, 30 s 49°C, 45 s 72°C, 60 s 40 72°C, 8 min [8
ERα-A-Mr CGAACGATTCAAAAACTCCAACT      [8
ERα-B-Uf TTTATTGTTATTTATTTAGT 94°C, 30 s 45°C, 30 s 72°C, 60 s 40 72°C, 8 min [8
ERα-B-Ur AAAAATATACTCACATATACA      [8
ERα-B-Mf TTTATTGTTATTTATTTAGC 94°C, 30 s 51°C, 45 s 72°C, 60 s 40 72°C, 8 min [8
ERα-B-Mr AAAAATATACTCGCATATACG      [8
ERα-C-Uf TTTTATATTTTTTGGGATTGT 94°C, 30 s 46°C, 30 s 72°C, 60 s 40 72°C, 8 min  
ERα-C-Ur AAAAACTCAAAAACCAACA       
ERα-C-Mf TTTTATATTTTTCGGGATTGC 94°C, 30 s 49°C, 45 s 72°C, 60 s 40 72°C, 8 min  
ERα-C-Mr AAAAACTCAAAAACCGGCG       
ERβ-Wf CTTGGAAGGTGGGCCTGGTC 94°C, 30 s 59°C, 30 s 72°C, 60 s 40 72°C, 8 min  
ERβ-Wr CGCATACAGATGTGATAACTGGCG      [8
ERβ-Uf TTTGGAAGGTGGGTTTGGTT 94°C, 30 s 46°C, 30 s 72°C, 60 s 40 72°C, 8 min [8
ERβ-Ur CACATACAAATATAATAACTAACA      [8
ERβ-Mf TTTGGAAGGTGGGTTTGGTC 94°C, 30 s 49°C, 45 s 72°C, 60 s 40 72°C, 8 min [8
ERβ-Mr CGCATACAAATATAATAACTAACG      [8
RT-Cf GCACAGCACTTCTTGAAAAAGG 94°C, 30 s 59°C, 45 s 72°C, 60 s 40 72°C, 8 min [8
RT-Bf CACATGCGAGCACATTCCTTCC 94°C, 30 s 61°C, 45 s 72°C, 60 s 40 72°C, 8 min [8
RT-Af CCTCGGGCTGTGCTCTTTTTCC 94°C, 30 s 62°C, 45 s 72°C, 60 s 40 72°C, 8 min [8
RT-ABCr AGGGTCATGGTCATGGTCCG      [8
RT-Common-f ACGACTATATGTCCAGCC 94°C, 30 s 62°C, 45 s 72°C, 60 s 40 72°C, 8 min  
RT-Common-r AGGTTGGCAGCTCTCATGTCTCC       
RT-ERβ-f CTTGGAAGGTGGGCCTGGTC 94°C, 30 s 59°C, 30 s 72°C, 60 s 40 72°C, 8 min [8
RT-ERβ-r CGCATACAGATGTGATAACTGGCG      [8
β-Actin-f AAGGCCAACCGCGAGAAGAT 94°C, 30 s 52°C, 30 s 72°C, 60 s 40 72°C, 8 min  
β-Actin-r TCGGTGAGGATCTTCATGAG       
Primer*Sequence (5′→3′)DenaturingAnnealingExtensionCycleFinal incubationReference
ERα-A-Uf GGATATGGTTTGTATTTTGTTTGT 94°C, 30 s 46°C, 30 s 72°C, 60 s 40 72°C, 8 min [8
ERα-A-Ur ACAAACAATTCAAAAACTCCAACT      [8
ERα-A-Mf GATACGGTTTGTATTTTGTTCGC 94°C, 30 s 49°C, 45 s 72°C, 60 s 40 72°C, 8 min [8
ERα-A-Mr CGAACGATTCAAAAACTCCAACT      [8
ERα-B-Uf TTTATTGTTATTTATTTAGT 94°C, 30 s 45°C, 30 s 72°C, 60 s 40 72°C, 8 min [8
ERα-B-Ur AAAAATATACTCACATATACA      [8
ERα-B-Mf TTTATTGTTATTTATTTAGC 94°C, 30 s 51°C, 45 s 72°C, 60 s 40 72°C, 8 min [8
ERα-B-Mr AAAAATATACTCGCATATACG      [8
ERα-C-Uf TTTTATATTTTTTGGGATTGT 94°C, 30 s 46°C, 30 s 72°C, 60 s 40 72°C, 8 min  
ERα-C-Ur AAAAACTCAAAAACCAACA       
ERα-C-Mf TTTTATATTTTTCGGGATTGC 94°C, 30 s 49°C, 45 s 72°C, 60 s 40 72°C, 8 min  
ERα-C-Mr AAAAACTCAAAAACCGGCG       
ERβ-Wf CTTGGAAGGTGGGCCTGGTC 94°C, 30 s 59°C, 30 s 72°C, 60 s 40 72°C, 8 min  
ERβ-Wr CGCATACAGATGTGATAACTGGCG      [8
ERβ-Uf TTTGGAAGGTGGGTTTGGTT 94°C, 30 s 46°C, 30 s 72°C, 60 s 40 72°C, 8 min [8
ERβ-Ur CACATACAAATATAATAACTAACA      [8
ERβ-Mf TTTGGAAGGTGGGTTTGGTC 94°C, 30 s 49°C, 45 s 72°C, 60 s 40 72°C, 8 min [8
ERβ-Mr CGCATACAAATATAATAACTAACG      [8
RT-Cf GCACAGCACTTCTTGAAAAAGG 94°C, 30 s 59°C, 45 s 72°C, 60 s 40 72°C, 8 min [8
RT-Bf CACATGCGAGCACATTCCTTCC 94°C, 30 s 61°C, 45 s 72°C, 60 s 40 72°C, 8 min [8
RT-Af CCTCGGGCTGTGCTCTTTTTCC 94°C, 30 s 62°C, 45 s 72°C, 60 s 40 72°C, 8 min [8
RT-ABCr AGGGTCATGGTCATGGTCCG      [8
RT-Common-f ACGACTATATGTCCAGCC 94°C, 30 s 62°C, 45 s 72°C, 60 s 40 72°C, 8 min  
RT-Common-r AGGTTGGCAGCTCTCATGTCTCC       
RT-ERβ-f CTTGGAAGGTGGGCCTGGTC 94°C, 30 s 59°C, 30 s 72°C, 60 s 40 72°C, 8 min [8
RT-ERβ-r CGCATACAGATGTGATAACTGGCG      [8
β-Actin-f AAGGCCAACCGCGAGAAGAT 94°C, 30 s 52°C, 30 s 72°C, 60 s 40 72°C, 8 min  
β-Actin-r TCGGTGAGGATCTTCATGAG       
*

In the customized name of each primer, the f and r refer to the forward and reverse primers of a certain set of primer respectively; the M and U refer to primers annealed to methylated and unmethylated genomic DNA respectively W, wild-type (used as a positive control).

DNA extraction and sodium bisulfite treatment

Genomic DNA was extracted from leukaemia cell lines and the whole blood of leukaemia patients and healthy volunteers with the QIAamp DNA Blood Mini kit (Qiagen, Valencia, CA, U.S.A.) by following the manufacturer's instructions. Sodium bisulfite modification of genomic DNA was performed with an EZ DNA Methylation kit (Zymo Research) by following the manufacturer's instructions, in which 2 μg of original genomic DNA was eluted with 20 μl of M-elution buffer.

MSP (methylation-specific PCR) and DNA sequencing

The bisulfite-converted genomic DNA was amplified by MSP using the primer sets listed in Table 1 to analyse the promoter CpG methylation of ERα-A, -B and -C and ERβ. MSP was performed in a volume of 25 μl containing 5 pmol of a primer set, 1.0 μl of bisulfite-converted DNA solution in M-elution buffer and the contents of an ExTaq HS DNA polymerase kit (TaKaRa) at the suggested concentrations [including 0.625 unit of ExTaq HS DNA polymerase per 25 μl of reaction mixture, 1×ExTaq Buffer (Mg2+ plus) and 250 μM each dNTP]. The primers and their MSP cycling conditions are summarized in Table 1, in which one primer set (U) will anneal to unmethylated DNA, and a second primer set (M) will anneal to methylated DNA.

RESULTS

Expression profile and methylation status of ER in leukaemia cell lines

MSP and RT–PCR were performed to analyse the methylation status and mRNA expression respectively of three ERα isoforms (i.e. ERα-A, -B and -C) and ERβ on the leukaemia cell lines with or without 5-aza-dC demethylation treatment (Table 2 and Figures 1 and 2).

Table 2
Expression profiles of ER in cell lines treated with or without 5-aza-dC

FM, full methylation in which the positive bands could only be seen in the primers targeting methylated genomic DNA; FU, full unmethylation in which positive bands could only be seen in primers targeting unmethylated genomic DNA; SM, semi-methylation in which the positive bands could be seen in both primers targeting methylated and unmethylated genomic DNA. The + and – signs indicate positive or negative mRNA expression, in which the expression of β-actin served as the positive control.

CellERα-AERα-BERα-CERβ
LineMethylationExpressionMethylationExpressionMethylationExpressionMethylationExpressionβ-Actin
Before treatment          
 Jurkat SM – FM SM FM 
 HL-60 SM – FM FU FM 
 K562 FM – FM FU FM 
 THP-1 FM – FM SM SM 
 MOLT-4 FM – FM SM SM 
 U937 FM – FM SM FM 
After treatment          
 Jurkat FU FU FU FU 
 HL-60 FU FU FU FU 
 K562 FU FU FU FU 
 THP-1 FU FU FU FU 
 MOLT-4 FU FU FU FU 
 U937 FU FU FU FU 
CellERα-AERα-BERα-CERβ
LineMethylationExpressionMethylationExpressionMethylationExpressionMethylationExpressionβ-Actin
Before treatment          
 Jurkat SM – FM SM FM 
 HL-60 SM – FM FU FM 
 K562 FM – FM FU FM 
 THP-1 FM – FM SM SM 
 MOLT-4 FM – FM SM SM 
 U937 FM – FM SM FM 
After treatment          
 Jurkat FU FU FU FU 
 HL-60 FU FU FU FU 
 K562 FU FU FU FU 
 THP-1 FU FU FU FU 
 MOLT-4 FU FU FU FU 
 U937 FU FU FU FU 

Promoter CpG methylation of ERs in leukaemia cell lines with or without 5-aza-dC treatment

Figure 1
Promoter CpG methylation of ERs in leukaemia cell lines with or without 5-aza-dC treatment

Lanes M and U refer to methylated and unmethylated bands of MSP respectively. The names of cell lines are indicated. The methylated bands of ERα-A, -B and -C and ERβ were 119, 187, 167 and 110 bp respectively, and the unmethylated bands were 119, 187, 167 and 110 bp respectively.

Figure 1
Promoter CpG methylation of ERs in leukaemia cell lines with or without 5-aza-dC treatment

Lanes M and U refer to methylated and unmethylated bands of MSP respectively. The names of cell lines are indicated. The methylated bands of ERα-A, -B and -C and ERβ were 119, 187, 167 and 110 bp respectively, and the unmethylated bands were 119, 187, 167 and 110 bp respectively.

Examples of ER mRNA expression in leukaemia cell lines with or without 5-aza-dC treatment

Figure 2
Examples of ER mRNA expression in leukaemia cell lines with or without 5-aza-dC treatment

Lane M, 100 bp DNA ladders (TaKaRa) with a band size of 100, 200, 300, 400, 500, 600, 700, 800, 900, 1000 and 1500 bp. The gel images show mRNA expression of ERs in Jurkat cell lines with (B) or without (A) treatment with 5-aza-dC. Lanes 1–3, the expression of ERα-A (110 bp), -B (187 bp) and -C (167 bp) respectively identified by primers targeted to specific isoforms; lane 4, the total expression of all three isoforms of ERα identified by primers targeted to transcripts that were common to all three isoforms of ERα; lane 5, the expression of ERβ (100 bp); lane 7, the expression of β-actin (876 bp), which served as a positive control; lane B, the water blank control.

Figure 2
Examples of ER mRNA expression in leukaemia cell lines with or without 5-aza-dC treatment

Lane M, 100 bp DNA ladders (TaKaRa) with a band size of 100, 200, 300, 400, 500, 600, 700, 800, 900, 1000 and 1500 bp. The gel images show mRNA expression of ERs in Jurkat cell lines with (B) or without (A) treatment with 5-aza-dC. Lanes 1–3, the expression of ERα-A (110 bp), -B (187 bp) and -C (167 bp) respectively identified by primers targeted to specific isoforms; lane 4, the total expression of all three isoforms of ERα identified by primers targeted to transcripts that were common to all three isoforms of ERα; lane 5, the expression of ERβ (100 bp); lane 7, the expression of β-actin (876 bp), which served as a positive control; lane B, the water blank control.

Without treatment with 5-aza-dC, the promoters of ERα-A, -B and -C and ERβ were fully methylated or semi-methylated in all leukaemia cell lines, including Jurkat, HL-60, K562, U937, THP-1 and MOLT-4, except for ERα-C, which was fully methylated in HL-60 and K562. However, only the expression of ERα-A was deficient in the above six leukaemia cell lines. With the DNA demethylation treatment with 5-aza-dC, the expression of ERα-A was restored in all cell lines, and there were no changes in the expression of ERα-B, and -C and ERβ.

Expression profile and methylation status of ERs in clinical patients with acute leukaemia

To further evaluate the methylation status and expression activity of ER promoter in leukaemia, RT–PCR and MSP were performed to analyse the promoter expression and CpG methylation of ERα isoforms (i.e. ERα-A, -B and -C) and ERβ in 40 cases of leukaemia patients that consisted of 12 cases of ALL, 21 cases of AML and seven cases of an unknown type of acute leukaemia (Table 3 and Figure 3). Compared with full unmethylation in all healthy controls (100%; 10/10), ERα-A promoter was semi-methylated and its expression was inactivated in almost all of the leukaemia patients (95%; 38/40), including 92% (11/12) in ALL, 95% (20/21) in AML and 100% (7/7) in an unknown type of acute leukaemia. Compared with full methylation of ERα-A promoter, the other two isoforms of ERα, i.e. ERα-B and -C, showed full and semi-methylation in healthy controls respectively. There were no apparent methylation patterns of both ERα-B and -C in leukaemia patients except when both of them were methylated. ERβ was found to be fully methylated in all patients (100%; 40/40) and healthy controls.

Table 3
Promoter expression and CpG methylation of ERs in 40 cases of acute leukaemia patients

FM, full methylation in which the positive bands could only be seen in the primers targeting methylated genomic DNA; FU, full unmethylation in which positive bands could only be seen in primers targeting unmethylated genomic DNA; SM, semi-methylation in which the positive bands could be seen in both primers targeting methylated and unmethylated genomic DNA.

ALL (n=12)AML (n=21)Unknown (n=7)Control (n=10)
FUFMSMExpressionFUFMSMExpressionFUFMSMExpressionFUFMSMExpression
ERα-A 11 20 10 
ERα-B 12 12 21 21 10 10 
ERα-C 12 15 21 10 10 
ERβ 12 12 21 21 10 10 
ALL (n=12)AML (n=21)Unknown (n=7)Control (n=10)
FUFMSMExpressionFUFMSMExpressionFUFMSMExpressionFUFMSMExpression
ERα-A 11 20 10 
ERα-B 12 12 21 21 10 10 
ERα-C 12 15 21 10 10 
ERβ 12 12 21 21 10 10 

Promoter CpG methylation of ERα-A in clinical patients with acute leukaemia

Figure 3
Promoter CpG methylation of ERα-A in clinical patients with acute leukaemia

Lane L, 100 bp DNA ladder. Lanes M and U refer to methylated and unmethylated bands of MSP respectively. The gel images showed the promoter CpG methylation of ERα-A promoter in ten healthy controls (A) and acute leukaemia patients (B), in which the ID of each sample is indicated in the top line. The blank refers to the water blank control in MSP.

Figure 3
Promoter CpG methylation of ERα-A in clinical patients with acute leukaemia

Lane L, 100 bp DNA ladder. Lanes M and U refer to methylated and unmethylated bands of MSP respectively. The gel images showed the promoter CpG methylation of ERα-A promoter in ten healthy controls (A) and acute leukaemia patients (B), in which the ID of each sample is indicated in the top line. The blank refers to the water blank control in MSP.

DISCUSSION

The ERs are members of a closely related subgroup of nuclear receptors that includes the androgen, mineralcorticoid and glucocorticoid receptors. Previous studies have revealed that the expression of ERs including both ERα and ERβ could be controlled by both genetic and epigenetic mechanisms in various human cancers [5,7], and the promoter CpG methylation of ERα plays an important role in the leukomogenesis and could serve as an epigenetic biomarker of leukaemias [11,12]. To date, three promoters have been identified to control the expression of ERα isoforms including ERα-A, -B and -C [13]. Previous studies have indicated that there is a selective use of ERα isoforms in various human cancers [7,8,14], and the promoter CpG methylation plays an important role in the control of its isoform expression [8]. For example, one study indicated that only ERα-C was specifically methylated in an endometrial cell line and tumour tissues, and the expression of ERα-C could be reactivated by demethylation of its promoter CpG dinucleotides [8]. However, it is still not clear whether there is a selective use of ERα isoforms that is controlled by promoter CpG methylation in human leukaemia. Moreover, leukaemia-like diseases induced by inactivation of ERβ in the mouse model also suggested a role of ERβ in leukomogenesis [9].

In the present study, we investigated the expression of three isoforms of ERα (i.e. ERα-A, -B and -C) and ERβ in leukaemia cell lines and patients with acute leukaemia. We found that only the transcript from the proximal promoter, i.e. ERα-A, was inactivated in almost all of the leukaemia cell line (95%; 38/40) in patients with acute leukaemia, whereas both transcripts of ERα-B and ERα-C were present (Table 2). We also investigated mechanisms of inactivation of the ERα-A gene through the analysis of promoter CpG methylation using MSP. Although the three isoforms of ERα (i.e. ERα-A, -B and -C) and ERβ were methylated (i.e. semi-methylated or fully methylated) in all of the leukaemia cell lines, except for ERα-C, which was unmethylated in HL-60 and K562 cell lines, only ERα-A was fully unmethylated in healthy controls (Table 3). The expression of ERα-A could be reactivated by DNA demethylation with 5-aza-dC. The results suggested that the selective deficient expression of ERα-A was controlled by its promoter CpG methylation.

To further understand the methylation characteristics of ER gene families in leukaemias, we also investigated the expression activity and methylation status of various ERs in whole blood from clinical leukaemia patients (Table 3). Compared with ERα-B, -C and ERβ, which were methylated (i.e. semi-methylated or fully methylated) in both leukaemia patients and healthy controls, only ERα-A was inactivated in expression and specifically and highly methylated (95%; 38/40) in almost all leukaemia patients and was fully unmethylated in all healthy controls. This result suggested that the methylated status of ERα-A might serve as an epigenetic biomarker of leukaemias. Combined with the epigenetic reactivation of ERα-A in leukaemia cell lines, we concluded that the ERα-A plays an important role in the leukomogenesis.

In conclusion, this is the first report on extensive studies of ERα isoforms (i.e. ERα-A, -B and -C) and ERβ in leukaemia. Inactivation of the ERα-A gene through promoter CpG methylation may be important in the pathogenesis of leukaemia.

Abbreviations

     
  • ALL

    acute lymphocytic leukaemia

  •  
  • AML

    acute myeloid leukaemia

  •  
  • 5-aza-dC

    5-aza-2′-deoxycytidine

  •  
  • ER

    oestrogen receptor

  •  
  • MSP

    methylation-specific PCR

  •  
  • RT–PCR

    reverse transcription–PCR

FUNDING

This work was supported by the National Nature Scientific Foundation of China [grant number 30600264].

References

References
Feinberg
 
A. P.
Ohlsson
 
R.
Henikoff
 
S.
 
The epigenetic progenitor origin of human cancer
Nat. Rev. Genet.
2006
, vol. 
7
 (pg. 
21
-
33
)
Garcia-Manero
 
G.
Jeha
 
S.
Daniel
 
J.
Williamson
 
J.
Albitar
 
M.
Kantarjian
 
H. M.
Issa
 
J. P.
 
Aberrant DNA methylation in pediatric patients with acute lymphocytic leukemia
Cancer
2003
, vol. 
97
 (pg. 
695
-
702
)
Garcia-Manero
 
G.
Bueso-Ramos
 
C.
Daniel
 
J.
Williamson
 
J.
Kantarjian
 
H. M.
Issa
 
J. P.
 
DNA methylation patterns at relapse in adult acute lymphocytic leukemia
Clin. Cancer Res.
2002
, vol. 
8
 (pg. 
1897
-
1903
)
Toyota
 
M.
Kopecky
 
K. J.
Toyota
 
M. O.
Jair
 
K. W.
Willman
 
C. L.
Issa
 
J. P.
 
Methylation profiling in acute myeloid leukemia
Blood
2001
, vol. 
97
 (pg. 
2823
-
2829
)
Zhao
 
C.
Dahlman-Wright
 
K.
Gustafsson
 
J. A.
 
Estrogen receptor beta: an overview and update
Nucl. Recept. Signal
2008
, vol. 
6
 pg. 
e003
 
Melki
 
J. R.
Vincent
 
P. C.
Clark
 
S. J.
 
Concurrent DNA hypermethylation of multiple genes in acute myeloid leukemia
Cancer Res.
1999
, vol. 
59
 (pg. 
3730
-
3740
)
Pinzone
 
J. J.
Stevenson
 
H.
Strobl
 
J. S.
Berg
 
P. E.
 
Molecular and cellular determinants of estrogen receptor alpha expression
Mol. Cell. Biol.
2004
, vol. 
24
 (pg. 
4605
-
4612
)
Sasaki
 
M.
Kotcherguina
 
L.
Dharia
 
A.
Fujimoto
 
S.
Dahiya
 
R.
 
Cytosine-phosphoguanine methylation of estrogen receptors in endometrial cancer
Cancer Res.
2001
, vol. 
61
 (pg. 
3262
-
3266
)
Shim
 
G. J.
Wang
 
L.
Andersson
 
S.
Nagy
 
N.
Kis
 
L. L.
Zhang
 
Q.
Mäkelä
 
S.
Warner
 
M.
Gustafsson
 
J. A.
 
Disruption of the estrogen receptor beta gene in mice causes myeloproliferative disease resembling chronic myeloid leukemia with lymphoid blast crisis
Proc. Natl. Acad. Sci. U.S.A.
2003
, vol. 
100
 (pg. 
6694
-
6699
)
Sasaki
 
M.
Oh
 
B. R.
Dharia
 
A.
Fujimoto
 
S.
Dahiya
 
R.
 
Inactivation of the human androgen receptor gene is associated with CpG hypermethylation in uterine endometrial cancer
Mol. Carcinog.
2000
, vol. 
29
 (pg. 
59
-
66
)
Li
 
Q.
Kopecky
 
K. J.
Mohan
 
A.
Willman
 
C. L.
Appelbaum
 
F. R.
Weick
 
J. K.
Issa
 
J. P.
 
Estrogen receptor methylation is associated with improved survival in adult acute myeloid leukemia
Clin. Cancer Res.
1999
, vol. 
5
 (pg. 
1077
-
1084
)
Issa
 
J. P.
Zehnbauer
 
B. A.
Civin
 
C. I.
Collector
 
M. I.
Sharkis
 
S. J.
Davidson
 
N. E.
Kaufmann
 
S. H.
Baylin
 
S. B.
 
The estrogen receptor CpG island is methylated in most hematopoietic neoplasms
Cancer Res.
1996
, vol. 
56
 (pg. 
973
-
977
)
Giacinti
 
L.
Claudio
 
P. P.
Lopez
 
M.
Giordano
 
A.
 
Epigenetic information and estrogen receptor alpha expression in breast cancer
Oncologist
2006
, vol. 
11
 (pg. 
1
-
8
)
Hayashi
 
S.
Imai
 
K.
Suga
 
K.
Kurihara
 
T.
Higashi
 
Y.
Nakachi
 
K.
 
Two promoters in expression of estrogen receptor messenger RNA in human breast cancer
Carcinogenesis
1997
, vol. 
18
 (pg. 
459
-
464
)

Author notes

1

These authors contributed equally to this work.