The brine shrimp, Artemia, reproduces either oviparously, producing encysted embryos (diapause cysts), or ovoviviparously, producing free-swimming nauplii. Environmental factors, such as photoperiod, have been applied to control the reproduction mode of Artemia, but when the determination of a reproductive mode occurs remains unknown. We analysed the differential gene expression between oocytes from oviparous and ovoviviparous Artemia reared under different photoperiods. A total of 692 qualified cDNA clones were obtained by subtractive hybridization, 327 of which matched GenBank® Nucleotide Sequence Database entries. Gene expressions of 44 cDNAs (representing 56 clones) were analysed in oocytes using real-time PCR. Among these genes, 11 (21 clones) were significantly (P<0.05) up-regulated and 7 (9 clones) down-regulated in Artemia oocytes that subsequently enter diapause. Remarkably, known diapause-related proteins such as ArHsp22 (Artemia heat-shock protein 22) and chitin-binding proteins are found to be already differentially expressed. Furthermore, RNAi (RNA interference) knockdown of a differentially expressed gene, polo-like kinase 1, in oocyte of ovoviviparous Artemia led to the production of white embryos rather than free-swimming nauplii. In summary, our results provide evidence at the molecular level that the reproductive mode of Artemia is already determined at the oocyte stage of their life cycle.

INTRODUCTION

Artemia, a branchiopod crustacean commonly known as the brine shrimp, can withstand the widest salinity range of any known metazoan. The genus Artemia contains quite a number of bisexual and asexual (parthenogenetic) species. Development of embryos of both bisexual and asexual Artemia follows two reproductive modes: oviparity with production of diapause cysts and ovoviviparity with release of free-swimming nauplii [1].

The cysts, which are arrested at the late gastrula stage, are capable of resisting a wide variety of extraordinary environmental stresses, including natural cycles of hydration/desiccation, extreme heat or cold treatment (as reviewed in [2]), and years of continuous anoxia [3]. Several factors or molecules are reported to be characteristic of diapause cysts and are critical for their stress tolerance, including the chitinous shell, the disaccharide trehalose [3], the sHSPs (small heat-shock proteins) p26, ArHsp21 (Artemia heat-shock protein 21) and ArHsp22 [46], and the ferritin homologue artemin [7,8]. Among them, expressions of the sHSPs and artemin increase only in diapause-destined embryos and decrease during post-diapause development [5,6,8,9]. In addition, a previous study of embryos at 2 days post-fertilization revealed a transcription cofactor, p8, which is also specifically enriched in diapause-destined embryos [4]. However, the transcriptional regulation of these genes has not been elucidated [10].

Another important question is: when does the determination of reproductive mode occur? The mode of reproduction was found to be greatly affected by photoperiod, with oviparity dominating during shorter days [11]. It has been suggested that the reproductive mode of Artemia franciscana may be determined early in oocytes before fertilization, when the shell glands are already morphologically different [1]. However, no molecular evidence has been reported for the determination of reproductive mode at such an early stage. Gene expression analysis early in this developmental process is therefore a high priority for further analysis of this issue.

To investigate whether the reproductive mode is determined at the oocyte stage and to study the molecular mechanism that determines reproductive mode, we cultured Artemia parthenogenetica (Gahai Lake, China) under different LD (light/dark cycles), which allowed them to reproduce differently. Oocytes from Artemia cultured under different photoperiods were isolated and the differentially expressed genes were cloned by a novel subtractive hybridization method called DNSH [DSN (duplex-specific nuclease)-mediated normalization and subtractive hybridization]. Many genes, including several known diapause-specific genes (e.g. ArHsp22 and chitin-binding proteins), were found to be differentially expressed at the oocyte stage. The results suggest that development modes of Artemia embryos may be predestined in oocytes.

MATERIALS AND METHODS

Artemia culture and manipulation

A. parthenogenetica from Gahai Lake, China, were a gift from Liu Fengqi (College of Life Sciences, Nankai University, Tianjin, China). Specimens were maintained at room temperature (25°C) in 50–80 g/l artificial sea water prepared by Blue Starfish (Zhejiang Blue Starfish Salt Products, Hangzhou, China) and fed once every 2 days with Chlorella powder. For sample collection and manipulation, Artemia were cultured in LD 4:20 and LD 16:8 at 25°C with an illumination intensity of approx. 2000 lx to allow most of them to reproduce oviparously and ovoviviparously (L. Fengqi, personal communication) respectively. The morphology of Artemia shell glands was used to differentiate oviparity and ovoviviparity as described by Liang and MacRae [1]. Oocytes tended to burst in fresh water, PBS or artificial sea water; to avoid this problem, adult females with oocyte-filled lateral pouches were fixed in 75% (v/v) ethanol in PBS for approx. 4 h at 4°C and then stored at –20°C until dissection. The lateral pouches from Artemia were dissected by needles under a microscope and oocytes were collected using a 200 μl pipette. After draining the excess ethanol, oocytes were stored at –80°C until RNA extraction. Total RNA was isolated by TRIzol® (Invitrogen).

The DNSH method

The schematic procedure of the DNSH is presented in Figure 1. The first-strand cDNA was synthesized by a modified template-switching method [12]. In brief, 2 μg of total RNA was mixed with 4 μl of MMLV (Moloney-murine-leukaemia virus) reverse transcriptase 5× reaction buffer (Promega), 2 μl of 10 mM dNTPs containing 20 mM MgCl2 and 20 mM MnCl2, 2 μl of TsOligo-p (Table 1), 2 μl of Tspa (Table 1), 4 μl of betaine (2.5 M) and trehalose (1 M) solution, 0.5 μl of RNase inhibitor (40 units/μl; TaKaRa) and 2 μl of MMLV reverse transcriptase (H-) point mutation (200 units/μl; Promega) in a total volume of 20 μl. The mixture was incubated at 42°C for 1 h, followed by 45°C for 0.5 h. The enzyme was inactivated by adding 1.5 μl of 100 mM EDTA and incubation at 70°C for 15 min. The first-strand cDNA was then purified using the AxyPrep PCR Clean-up kit (Axygen) and eluted using 80 μl of elution buffer provided by the kit.

Strategy of DNSH

Figure 1
Strategy of DNSH

Starting with a small amount of total RNA, samples were amplified by a template-switching cDNA synthesis and the step-out PCR method [12,15]. SP6 and T7 RNA polymerases are then used to generate sufficient tester and driver RNA respectively. After a secondary reverse transcription, tester RNA–cDNA complexes are mixed with excess driver RNA and subjected to denaturation and re-association. When cDNAs in duplex form are cut by a phage, only normalized single-stranded cDNAs can be exponentially amplified by PCR.

Figure 1
Strategy of DNSH

Starting with a small amount of total RNA, samples were amplified by a template-switching cDNA synthesis and the step-out PCR method [12,15]. SP6 and T7 RNA polymerases are then used to generate sufficient tester and driver RNA respectively. After a secondary reverse transcription, tester RNA–cDNA complexes are mixed with excess driver RNA and subjected to denaturation and re-association. When cDNAs in duplex form are cut by a phage, only normalized single-stranded cDNAs can be exponentially amplified by PCR.

Table 1
Oligonucleotides (10 μM)

The sequence of T7 promoter is shown in boldface.

OligonucleotideSequence (5′–3′)
TsOligo-p GTAATACGACTCACTATAGGGGG-p 
T7oligodT GTAATACGACTCACTATAGGGGG(T)15VN 
SOI CTGCAGCGAACCAATCCTCTGTAATACGACTCACTATAGGG 
PI CTGCAGCGAACCAATCCTCTG 
T7P GTAATACGACTCACTATAGGG 
SalT7P GATCGTCGACGTAATACGACTCACTATAGGG 
SP6T7 CATTTAGGTGACACTATAGAGTAATACGACTCACTATAGGG 
Tspa TGGTTGGACTCGGTTTGGACGCCATAGAATTGG(T)15VN 
3′ap TGGTTGGACTCGGTTTGGACG 
OligonucleotideSequence (5′–3′)
TsOligo-p GTAATACGACTCACTATAGGGGG-p 
T7oligodT GTAATACGACTCACTATAGGGGG(T)15VN 
SOI CTGCAGCGAACCAATCCTCTGTAATACGACTCACTATAGGG 
PI CTGCAGCGAACCAATCCTCTG 
T7P GTAATACGACTCACTATAGGG 
SalT7P GATCGTCGACGTAATACGACTCACTATAGGG 
SP6T7 CATTTAGGTGACACTATAGAGTAATACGACTCACTATAGGG 
Tspa TGGTTGGACTCGGTTTGGACGCCATAGAATTGG(T)15VN 
3′ap TGGTTGGACTCGGTTTGGACG 

The double-stranded cDNA from each sample was synthesized by PCR in a total volume of 3×100 μl. Each 100 μl PCR mixture consisted of 10 μl of 10× TLA buffer [500 mM Tris (pH 9.2), 200 mM (NH4)2SO4 and 7.5 mM MgCl2], 4 μl of 5 mM dNTPs (containing 20 mM MgCl2), 2 μl of primers SP6T7 and 3′ap (Table 1), 4 μl of purified first-strand cDNA and 4 units of Taq+Pfu DNA polymerase (Sangon; Taq was mixed with Pfu in a ratio of 100:3). The PCR programme was 94°C for 1 min, 24 cycles at 94°C for 30 s, 60°C for 30 s, 68°C for 6 min and finally 68°C for 10 min. The PCR products were purified using the AxyPrep PCR Clean-up kit.

Double-stranded cDNA from diapause-destined oocytes was subjected to transcription by SP6 RNA polymerase (Promega). To generate sufficient RNA driver, double-stranded cDNA from nauplii-destined oocytes was subjected to transcription by the RiboMAX™ Large Scale RNA Production System-T7 (Promega). Briefly, each 0.5 μg of double-stranded cDNA was used for in vitro transcription in a total volume of 10 μl for 4 h, followed by treatment with 0.5 unit of DNase I for 20 min. After acid phenol/chloroform extraction and ethanol precipitation, the RNA pellet was dissolved in 10 μl of DEPC (diethyl pyrocarbonate)-treated water. To generate the tester RNA–DNA complexes, 0.5 μg of SP6 transcribed RNA was mixed with 2 μl of MMLV reverse transcriptase 5× reaction buffer (Promega), 1 μl of 10 mM dNTPs, 1 μl of T7oligodT (Table 1), 2 μl of betaine (2.5 M) and trehalose (1 M) solution, 0.25 μl of RNase inhibitor (TaKaRa), and 0.75 μl of MMLV reverse transcriptase (H-) point mutation (Promega) in a total volume of 10 μl. The reaction was conducted at 42°C for 1 h and 45°C for 0.5 h. The enzyme was heat-inactivated at 70°C for 15 min after adding 1 μl of 100 mM EDTA.

For DSN-mediated normalization [13] and subtractive hybridization (DNSH), 2 μl of tester RNA–DNA complex was mixed with 1 μl of 10× hyb buffer (0.25 M Tris, 5 M NaCl and 0.1 mM EDTA, pH 8.0), 2 μl of DMSO, 1 μl of 2 M trehalose and 4 μl of driver RNA (approx. 150 times excess). The hybridization was conducted at 55°C overnight (>16 h) after denaturizing at 88°C for 1.5 min. The hybridization mixture was then transferred to a tube containing 2 μl of 10× DSN buffer (0.5 M Tris, 70 mM MgCl2 and 10 mM dithiothreitol, pH 8.0), 2 μl of 2 M trehalose, and 0.2 unit of DSN (Evrogen) in a total volume of 10 μl that was preheated to 65°C. The mixture was incubated at 65°C for 30 min to allow the cDNA in the DNA–RNA hybrids to be cut, as DSN specifically digests the duplex form DNA [13,14]. Finally, 1.5 μl of 100 mM EDTA and 20 μl of water were added to the mixture to stop the reaction at 68°C for 10 min.

Three rounds of PCR were used to amplify the subtracted cDNA. The PCR-suppression effect [12] was used throughout the procedures to overcome the short-molecule biased amplification. The PCR conditions were similar to those of the double-stranded cDNA synthesis. A total volume of 100 μl was used for each PCR: (a) the primary PCR ran for 30 cycles using 2 μl of subtracted product as the template and 1 μl of SOI and 2 μl of PI (Table 1) as primers (step-out PCR [15]); (b) the secondary PCR ran for 30 cycles using 0.4 μl of the primary PCR product as the template and 4 μl of PI as the primer; and (c) the tertiary PCR ran for 25 cycles using 0.4 μl of the secondary PCR product as the template and 1.6 μl of SalT7P (Table 1) as the primer. After purification using the AxyPrep PCR Clean-up kit, 1 μg of the tertiary PCR products was digested with SalI (TaKaRa). Fragments >500 bp were purified using the AxyPrep DNA Gel Extraction kit (Axygen), ligated with SalI and CIAP (calf intestinal alkaline phosphatase; TaKaRa)-treated PUC19 plasmid and transformed into TSS-treated [16,17] TOP10 Escherichia coli (Invitrogen).

Identification of differentially expressed genes from oocytes in oviducts of Artemia

Transformed bacteria were plated together with 20 μl of 20 mg/ml X-Gal (5-bromo-4-chloroindol-3-yl β-D-galactopyranoside) on LB (Luria–Bertani) agar containing 100 μg/ml ampicillin. In all, 768 white colonies were inoculated into 96-well PCR plates filled with 100 μl of LB+ampicillin. After being shaken overnight at moderate speed at 37°C, 50 μl of 50% (v/v) glycerol in LB was added to each well and the plate was stored at –80°C. The insert cDNAs were sequenced by vector primer M13F at ZEHENGBIO (Shanghai, China). After removal of adaptor and vector sequences, the sequence data were imported into SeqMan of Lasergene software (DNASTAR) and assembled into contiguous sequences. Blastn (megablast) and Blastx were performed against the database of the nucleotide collection (nr/nt) and non-redundant protein sequences (nr) of GenBank® respectively. Sequences matching the GenBank® database (e-value <0.0001) were categorized using COGs (clusters of orthologous groups of proteins) at http://www.ncbi.nlm.nih.gov/COG/.

Quantitative real-time RT–PCR (reverse transcription–PCR) was used to further test the expression levels of 44 selected genes. Total RNAs from oocytes of diapause- and nauplius-destined Artemia were treated with 1 unit of DNase I (Promega) at 37°C for 15 min to remove trace amounts of genomic DNA. Followed by standard phenol/chloroform extraction and ethanol precipitation, 5 μg of total RNA was reverse transcribed in a total volume of 40 μl using the oligo-dT primer from the PrimeScript™ 1st Strand cDNA Synthesis kit (TaKaRa). The first-strand cDNA was diluted by adding 360 μl of sterile water. Real-time PCR was performed with Miniopticon PTC-0148 (Bio-Rad) using a programme of 95°C for 15 s, followed by 40 cycles of 95°C for 10 s, 56°C for 10 s, 72°C for 10 s plus plate read and 78°C for 3 s plus plate read. The 20 μl of reaction mixture contained 1 μl of the diluted cDNA or inserts containing plasmids as the template, 0.4 μM of each primer (see Supplementary Table S1 at http://www.bioscirep.org/bsr/031/bsr0310017add.htm) and 10 μl of SYBR® Premix Ex Taq™ II (TaKaRa). After normalization by α-tubulin, the expression levels of each gene were subjected to Student’s t test analysis.

RNAi (RNA interference)

Because cDNAs were flanked by T7 promoter sequences during the DNSH procedures, dsRNA (double-stranded RNA) could be easily produced for the RNAi assay. For this purpose, plasmids containing genes of interest were isolated and transformed into competent E. coli HT115 (DE3). Transformed HT115 (DE3) was inoculated into LB broth with 50 μg/ml ampicillin and 10 μg/ml tetracycline and incubated at 37°C. When the culture reached D600 (attenuance at 600 nm) 0.4, IPTG was added to a final concentration of 0.4 mM to induce dsRNA production for >4 h. The cells were collected by centrifugation and total RNA was extracted by TRIzol® (Invitrogen). Total RNA was dissolved in RNase buffer (10 mM Tris/HCl, 0.5 M NaCl and 10 mM MgCl2, pH 8.0), heated at 80°C for 5 min, cooled slowly to 37°C and treated with 0.1 mg/ml RNase A and 10 units/ml DNase I for 30 min to remove single-stranded RNA and trace amounts of DNA. The dsRNA was then purified by standard phenol/chloroform extraction and ethanol precipitation. Control dsRNA was isolated from HT115 (DE3) with the plasmid PETT7 [18] as described above. RNAi was performed by microinjection of 100 ng of dsRNA into Artemia at the instar XII stage using the UltraMicroPump II equipped with the Micro4™ MicroSyringe pump controller.

RESULTS AND DISCUSSION

Artemia has attracted much attention because of its ability to switch from producing free-swimming nauplii to producing encysted embryos when subjected to harsh environmental conditions. Recently, Qiu et al. [4] analysed the gene expression of A. franciscana embryos at 2 days post-fertilization and found that many genes were differentially expressed between diapause- and nauplii-destined embryos [4]. A model involving multiple factors for initiating and maintaining diapause of Artemia embryos was proposed in [4]. However, when the reproductive mode of Artemia was determined remains unknown. Identification of differentially expressed genes at an earlier stage, such as in oocytes, would improve the understanding of the molecular changes that characterize diapause development in Artemia. In our present study of A. parthenogenetica, we found that many genes with different functions were differentially expressed between oocytes from oviparous and ovoviviparous Artemia. Moreover, knockdown of the expression of a PLK1 (polo-like kinase 1) led the ovoviviparous Artemia to produce eggs rather than nauplii.

Oviparous and ovoviviparous development of A. parthenogenetica

Embryos of A. parthenogenetica undergo either oviparous or ovoviviparous development (Figure 2) in a manner similar to that of A. franciscana [1]. The reproductive mode that is followed by oocytes can be identified microscopically, initially by the morphology of shell glands (Figures 2a–2c and 2a′–2c′) and later by the morphology of embryos (Figures 2d–2e and 2d′–2e′). Brown shell glands indicate oviparous development (Figures 2a–2c), whereas white or colourless shell glands indicate ovoviviparous development (Figures 2a′–2c′).

Oviparous and ovoviviparous reproduction in A. parthenogenetica

Figure 2
Oviparous and ovoviviparous reproduction in A. parthenogenetica

Samples were fixed in paraformaldehyde and photographed under a dissecting microscope. Oocytes released from ovaries (a and a′) were temporarily stored in oviducts for approx. 3 h (b and b′), then entered into the uterus (c and c′) and developed into either cysts (d–f) or nauplii (d′–f′). E, embryo; O, oocyte; OVI, oviduct; SH, shell gland.

Figure 2
Oviparous and ovoviviparous reproduction in A. parthenogenetica

Samples were fixed in paraformaldehyde and photographed under a dissecting microscope. Oocytes released from ovaries (a and a′) were temporarily stored in oviducts for approx. 3 h (b and b′), then entered into the uterus (c and c′) and developed into either cysts (d–f) or nauplii (d′–f′). E, embryo; O, oocyte; OVI, oviduct; SH, shell gland.

The DNSH method

Although the classical two-step hybridization method called suppression subtractive hybridization [19] and its derivatives such as DSN-mediated transcriptome subtraction [20], and full-length normalization subtractive hybridization [21] are efficient in enrichment of highly abundant target cDNA, they are suspected to result in low representation of rare target cDNA [22]. To investigate the differential gene expression at the oocyte stage of Artemia following different reproductive modes, we established a novel method called DNSH (Figure 1). DSN exhibits maximal activity at 65°C and specifically cleaves DNA in duplex form (either DNA—DNA or DNA–RNA), but not RNA or single-stranded DNA [13,14,23,24]. To avoid loss of transcripts due to the formation of secondary structure, we added betaine, trehalose and DMSO into the hybridization and DSN reaction mixture. These materials decreased the ‘melting’ temperature of double-stranded nucleic acids [25,26] (also see Supplementary Table S2 at http://www.bioscirep.org/bsr/031/bsr0310017add.htm). Moreover, betaine and trehalose thermostabilize DSN, although betaine partially inhibits the activity of DSN at high concentrations (see Supplementary Figures S1 and S2 at http://www.bioscirep.org/bsr/031/bsr0310017add.htm. Differentially expressed transcripts that comprise only approx. 0.0001% of total transcripts can be efficiently enriched using the DNSH method (see Supplementary Figure S3 at http://www.bioscirep.org/bsr/031/bsr0310017add.htm). This indicated that cDNA of low-abundant differentially expressed genes can be efficiently obtained by DNSH.

Identification of cDNAs obtained from diapause-destined Artemia oocytes

Using the DSNH method, 768 colonies were randomly chosen and subjected to sequencing. Among them, 42 were of poor quality and 34 contained vector alone or small inserts (<50 bp) and thus were excluded. The cDNAs from the remaining 692 colonies (GenBank® accession numbers GH635209–GH635900) were assembled into 600 contigs, most of which were singletons (529) and duplicates (57) (see Supplementary Figure S4 at http://www.bioscirep.org/bsr/031/bsr0310017add.htm), indicating the high efficiency of normalization and subtraction of DNSH. Due to the limitations of the knowledge of the Artemia and any other crustacean genome and expressed sequence tags, Blastn searches of the 692 cDNAs identified only 47 cDNAs including 1 snRNA, and Blastx searches identified 327 cDNAs. The 327 protein-encoding cDNAs were then divided into the following four functional categories: metabolism, information storage and processing, cellular processes and signalling, and poorly characterized protein (see Supplementary Table S3 at http://www.bioscirep.org/bsr/031/bsr0310017add.htm and Table 2) using COGs. More detailed information about the 327 cDNAs is listed in Supplementary Table S3.

Table 2
Categorization of protein-encoding cDNAs
CategoryNumber of cDNAs
Metabolism  
 Energy production and conversion 
 Carbohydrate transport and metabolism 15 
 Amino acid transport and metabolism 
 Nucleotide transport and metabolism 
 Coenzyme transport and metabolism 
 Lipid transport and metabolism 
 Inorganic ion transport and metabolism 
 Secondary metabolites biosynthesis, transport and catabolism 
Information storage and processing  
 Translation, ribosomal structure and biogenesis 18 
 RNA processing and modification 
 Transcription 
 Replication, recombination and repair 25 
Cellular processes and signalling  
 Cell cycle control, cell division, chromosome partitioning 10 
 Defence mechanisms 
 Signal transduction mechanisms 36 
 Cell wall/membrane/envelope biogenesis 13 
 Cytoskeleton 12 
 Extracellular structures 18 
 Intracellular trafficking, secretion, and vesicular transport 16 
 Post-translational modification, protein turnover, chaperones 10 
Poorly characterized  
 General function prediction only 42 
 Function unknown 51 
CategoryNumber of cDNAs
Metabolism  
 Energy production and conversion 
 Carbohydrate transport and metabolism 15 
 Amino acid transport and metabolism 
 Nucleotide transport and metabolism 
 Coenzyme transport and metabolism 
 Lipid transport and metabolism 
 Inorganic ion transport and metabolism 
 Secondary metabolites biosynthesis, transport and catabolism 
Information storage and processing  
 Translation, ribosomal structure and biogenesis 18 
 RNA processing and modification 
 Transcription 
 Replication, recombination and repair 25 
Cellular processes and signalling  
 Cell cycle control, cell division, chromosome partitioning 10 
 Defence mechanisms 
 Signal transduction mechanisms 36 
 Cell wall/membrane/envelope biogenesis 13 
 Cytoskeleton 12 
 Extracellular structures 18 
 Intracellular trafficking, secretion, and vesicular transport 16 
 Post-translational modification, protein turnover, chaperones 10 
Poorly characterized  
 General function prediction only 42 
 Function unknown 51 

As the diapause cysts of Artemia have the characteristics of stress resistance and cell cycle arrest, genes that may contribute to the characteristics of diapause cysts and several other genes were selected and subjected to quantitative real-time RT–PCR analysis. Among the 44 individual tested genes (representing 56 clones), 11 genes (21 clones) were significantly up-regulated (P<0.05) and 7 genes (9 clones) were down-regulated (P<0.05) in diapause-destined Artemia oocytes (Table 3 and Supplementary Table S3). The mRNA levels of these genes were quite different. The chitin-binding protein (clone 1E4) was most abundantly expressed compared with the other tested genes, and its expression level was approx. 15 000 times that of nonsense-mediated mRNA decay protein 1 (clone 4H8). Most of the 44 genes were tested to be expressed in low abundance (Table 3). The result that 18 of them were confirmed to be differentially expressed between the diapause- and nauplius-destined oocytes demonstrated that our DNSH method is highly efficient.

Table 3
Expression analysis of selected protein-encoding cDNAs
Clone IDAccession numberClone numberBlastx top-match in GenBank®: species/accession numberProtein name and/or proposed functione-ValueOviparous oocytesaOvoviviparous oocytesaP-valueb
Metabolism         
 Carbohydrate  transport and  metabolism         
  1A10 GH635218 Marinobacter sp. ELB17/ZP_01739187.1 Sugar efflux permease, MFS-like protein 2e-64 71181 (44315) 29818 (1133) 0.091 
  7A8 GH635737 Bombyx mori/NP_001108344 Trehalose transporter 7e-38 138055 (37082) 321412 (46276) 0.003 
Information storage and processing         
 Translation, ribosomal  structure and  biogenesis         
  4C2 GH635491 Drosophila pseudoobscura/XP_001355286.2 Histidine acid phosphatase domain containing protein 9e-14 1402309 (526214) 755688 (119044) 0.053 
  4H8 GH635552 Acyrthosiphon pisum/XP_001948916.1 Similar to nonsense-mediated mrna decay protein 1 (rent1) 1e-41 9164 (4831) 12383 (2559) 0.183 
 RNA processing and  modification         
  4D12 GH635512 Danio rerio/NP_001038397.1 Integrator complex subunit 3, Mediator of Small Nuclear RNA Processing 8e-39 3807917 (613021) 4014392 (1186986) 0.401 
  7B11 GH635748 Apis mellifera/XP_624382 Cleavage and polyadenylation specific factor 1 2e-54 1735556 (389168) 1752062 (560431) 0.484 
 Transcription         
  1F3 GH635264 Marinobacter algicola DG893/ZP_01892922.1 Transcriptional regulator, GntR family 1e-51 14258 (3647) 10337 (3185) 0.117 
  2B2 GH635305 Alteromonas macleodii ‘Deep ecotype’/YP_002126057.1 Transcription elongation factor NusA 3e-74 42324 (7032) 79551 (17515) 0.013 
  6D2 GH635677 Anopheles gambiae str. PEST/XP_315936.4 Mediator of RNA polymerase II transcription subunit 24 7e-08 45714263 (3304319) 50490809 (3252923) 0.074 
  6E6 GH635693 Danio rerio/XP_688865.3 Regulatory factor X domain containing 2 3e-32 8558054 (1209490) 8470238 (1118504) 0.465 
  7E6 GH635775 Cupiennius salei/CAD57739 Homothorax 1, regulate the subcellular localization of the homeotic protein cofactor Extradenticle (EXD) 1e-07 1287413 (242433) 1187251 (204058) 0.307 
  8F1 GH635867 Xenopus laevis/AAA49904.1 MYB-related protein 2, DNA binding 1e-46 11400752 (1392857) 8441788 (268634) 0.011 
  8H1 GH635890 Pichia stipitis CBS 6054/XP_001385384.2 HAP2, transcriptional activator, CCAAT-binding factor, subunit B 2e-17 48080 (14107) NOc 0.002 
 Replication,  recombination  and repair         
 1A2 GH635210 Xenopus laevis/P55861 DNA replication licensing factor mcm2 (minichromosome maintenance protein 2). Acts as a factor that allows the DNA to undergo a single round of replication per cell cycle 3e-79 4795326 (1035578) 4739264 (398060) 0.467 
 2A12 GH635303 Danio rerio/XP_699524.3 Single-strand selective monofunctional uracil DNA glycosylase 1e-40 523156 (118359) 739844 (45331) 0.021 
 2E4 GH635339 Portunus pelagicus/CAP20051.1 Transposase 4e-28 151766 (4574) 189350 (26361) 0.036 
 3C6 GH635405 Bombyx mori/AAQ57129.1 Endonuclease and reverse transcriptase-like protein 8e-27 2471521 (394559) 4483323 (674743) 0.006 
 5B6 GH635573 Schistosoma mansoni/CAJ00236.1 Endonuclease-reverse transcriptase 3e-36 43492 (21921) 34889 (10208) 0.286 
Cellular processes  and signaling         
 Cell cycle control,   cell division,   chromosome   partitioning         
  1E5 GH635257 Mus musculus/CAM13330.1 Dedicator of cytokinesis 7, activate some small GTPases by exchanging bound GDP for free GTP 9e-42 1429111 (132200) 1060023 (88038) 0.008 
  3D6 GH635417 Bombyx mori/NP_001106734.1 Chromodomain-helicase-DNA-binding protein, Chd1 4e-55 646212 (139984) 668356 (51233) 0.405 
  3E8 GH635430 Danio rerio/3D5W_A Polo-like kinase 1, key regulator of mitosis 5e-14 683725 (297302) 1654236 (729577) 0.050 
  3H4 GH635459 Aedes aegypti/XP_001650044.1 Brain tumour protein, brat, plays conserved roles in regulating asymmetric cell division 2e-110 432105 (58073) 418845 (66371) 0.404 
  4H1 GH635546 Dictyostelium discoideum AX4/XP_636910.1 Cell division cycle protein 48, ATPase activity 2e-70 151011 (130802) 48588 (7636) 0.124 
  5H7 GH635638 Culex quinquefasciatus/XP_001851276.1 Maintenance of ploidy protein mob1, spindle pole body duplication and mitotic checkpoint regulation 7e-81 3326932 (355978) 3331466 (579226) 0.496 
  6F11 GH635710 Marinobacter aquaeolei VT8/YP_959599.1 Septum site-determining protein MinD, cell division inhibitor, membrane ATPase, activates MinC 1e-96 203325 (31950) 167603 (39060) 0.144 
  6G4 GH635715 Tribolium castaneum/XP_967278.1 Glucose inhibited division protein a 2e-58 9179540 (1800825) 9412445 (974140) 0.427 
  8F2 GH635868 Culex quinquefasciatus/XP_001868862.1 Septin, GTP-binding proteins associated with diverse processes in dividing and non-dividing cells 9e-90 NOc NOc NOc 
 Signal transduction  mechanisms         
  1C2 GH635234 Caenorhabditis elegans/NP_001122601.1 Multiple PDZ domain protein family member (mpz-1). PDZ domains bind C-terminal polypeptides 1e-25 384951 (372239) 124457 (98006) 0.153 
  1F10 GH635269 Aedes aegypti/XP_001661429.1 Serine/threonine protein phosphatase 2c 2e-50 781458 (138552) 594286 (118186) 0.075 
  5D2 GH635592 Aedes aegypti/XP_001655129.1 Juvenile hormone-inducible protein. Phosphotransferases of the serine or threonine-specific kinase subfamily 1e-12 814885 (210772) 791626 (166497) 0.444 
  6F2 GH635701 Aedes aegypti/XP_001653183.1 kek1, transmembrane protein Kekkon1, functions during oogenesis in a negative feedback loop to directly attenuate EGFR activity 1e-65 4874429 (1035110) 2643792 (381283) 0.012 
  8D1 GH635844 Dictyostelium discoideum AX4/XP_637704.1 Extracellular-signal-regulated protein kinase 5e-60 4674108 (773778) 3717952 (667592) 0.090 
 Extracellular  structures         
  1E4 GH635256 Tribolium castaneum/NP_001073566.1 Chitin binding 3e-38 145004903 (17496865) 83435 (10291) 6.9e-5 
  5E3 GH635605 Tribolium castaneum/NP_001073566.1 Chitin binding 2e-41 15137020 (2722017) 186539 (59612) 3.4e-4 
 Intracellular  trafficking, secretion,  and vesicular  transport         
  1F2 GH635263 Rattus norvegicus/NP_114010.1 Nuclear receptor co-activator 2, ligand-dependent nuclear receptor transcription co-activator activity 6e-33 36555843 (2154518) 32220981 (2602268) 0.045 
  6D8 GH635683 Aedes aegypti/XP_001654070.1 RAN binding protein 8e-11 15956226 (7616989) 11118037 (1423072) 0.170 
 Post-translational  modification, protein  turnover, chaperones         
  1A9 GH635217 Artemia urmiana/ABY86224.1 Artemin, molecular chaperone activity 2e-49 39974 (3652) 68263 (13714) 0.013 
  2G6 GH635363 Artemia franciscana/ABD19713.1 Small heat shock protein ArHsp22 2e-47 38109728 (4870733) 916717 (117775) 9.5e-5 
  5A3 GH635558 Bombyx mori/NP_001036958.1 p23-like protein, p23 binds heat shock protein hsp90 and participates in the folding of a number of proteins 2e-15 13667141 (2894748) 22587321 (6983461) 0.055 
  5A11 GH635566 Dictyostelium discoideum AX4/XP_635173.1 Chaperonin containing TCP1 eta subunit, folding of proteins, ATPase 5e-91 92113 (61186) NOc 0.030 
  8E1 GH635855 Culex quinquefasciatus/XP_001845910.1 Ubiquitin-conjugating enzyme morgue, ubiquitin-mediated protein degradation pathway 6e-08 38807882 (8838408) 40987126 (2925164) 0.353 
Poorly characterized         
 General function  prediction only         
  2E11 GH635346 Acyrthosiphon pisum/XP_001950343.1 Similar to NFX1-type zinc finger-containing protein 2e-7 1684927 (273135) 1661413 (471297) 0.472 
  5B2 GH635569 Caenorhabditis elegans/NP_001023145.1 Dauer up-regulated family member (dur-1) 2e-15 951530 (50601) 73024 (20448) 4.9e-6 
No significant  similarity         
 1A5 GH635213 No Unknown No hit 207217 (18509) 128331 (23683) 0.005 
Internal control         
 α-tubulin   21386652 (1501833) 21393767 (502529) 0.497    
Clone IDAccession numberClone numberBlastx top-match in GenBank®: species/accession numberProtein name and/or proposed functione-ValueOviparous oocytesaOvoviviparous oocytesaP-valueb
Metabolism         
 Carbohydrate  transport and  metabolism         
  1A10 GH635218 Marinobacter sp. ELB17/ZP_01739187.1 Sugar efflux permease, MFS-like protein 2e-64 71181 (44315) 29818 (1133) 0.091 
  7A8 GH635737 Bombyx mori/NP_001108344 Trehalose transporter 7e-38 138055 (37082) 321412 (46276) 0.003 
Information storage and processing         
 Translation, ribosomal  structure and  biogenesis         
  4C2 GH635491 Drosophila pseudoobscura/XP_001355286.2 Histidine acid phosphatase domain containing protein 9e-14 1402309 (526214) 755688 (119044) 0.053 
  4H8 GH635552 Acyrthosiphon pisum/XP_001948916.1 Similar to nonsense-mediated mrna decay protein 1 (rent1) 1e-41 9164 (4831) 12383 (2559) 0.183 
 RNA processing and  modification         
  4D12 GH635512 Danio rerio/NP_001038397.1 Integrator complex subunit 3, Mediator of Small Nuclear RNA Processing 8e-39 3807917 (613021) 4014392 (1186986) 0.401 
  7B11 GH635748 Apis mellifera/XP_624382 Cleavage and polyadenylation specific factor 1 2e-54 1735556 (389168) 1752062 (560431) 0.484 
 Transcription         
  1F3 GH635264 Marinobacter algicola DG893/ZP_01892922.1 Transcriptional regulator, GntR family 1e-51 14258 (3647) 10337 (3185) 0.117 
  2B2 GH635305 Alteromonas macleodii ‘Deep ecotype’/YP_002126057.1 Transcription elongation factor NusA 3e-74 42324 (7032) 79551 (17515) 0.013 
  6D2 GH635677 Anopheles gambiae str. PEST/XP_315936.4 Mediator of RNA polymerase II transcription subunit 24 7e-08 45714263 (3304319) 50490809 (3252923) 0.074 
  6E6 GH635693 Danio rerio/XP_688865.3 Regulatory factor X domain containing 2 3e-32 8558054 (1209490) 8470238 (1118504) 0.465 
  7E6 GH635775 Cupiennius salei/CAD57739 Homothorax 1, regulate the subcellular localization of the homeotic protein cofactor Extradenticle (EXD) 1e-07 1287413 (242433) 1187251 (204058) 0.307 
  8F1 GH635867 Xenopus laevis/AAA49904.1 MYB-related protein 2, DNA binding 1e-46 11400752 (1392857) 8441788 (268634) 0.011 
  8H1 GH635890 Pichia stipitis CBS 6054/XP_001385384.2 HAP2, transcriptional activator, CCAAT-binding factor, subunit B 2e-17 48080 (14107) NOc 0.002 
 Replication,  recombination  and repair         
 1A2 GH635210 Xenopus laevis/P55861 DNA replication licensing factor mcm2 (minichromosome maintenance protein 2). Acts as a factor that allows the DNA to undergo a single round of replication per cell cycle 3e-79 4795326 (1035578) 4739264 (398060) 0.467 
 2A12 GH635303 Danio rerio/XP_699524.3 Single-strand selective monofunctional uracil DNA glycosylase 1e-40 523156 (118359) 739844 (45331) 0.021 
 2E4 GH635339 Portunus pelagicus/CAP20051.1 Transposase 4e-28 151766 (4574) 189350 (26361) 0.036 
 3C6 GH635405 Bombyx mori/AAQ57129.1 Endonuclease and reverse transcriptase-like protein 8e-27 2471521 (394559) 4483323 (674743) 0.006 
 5B6 GH635573 Schistosoma mansoni/CAJ00236.1 Endonuclease-reverse transcriptase 3e-36 43492 (21921) 34889 (10208) 0.286 
Cellular processes  and signaling         
 Cell cycle control,   cell division,   chromosome   partitioning         
  1E5 GH635257 Mus musculus/CAM13330.1 Dedicator of cytokinesis 7, activate some small GTPases by exchanging bound GDP for free GTP 9e-42 1429111 (132200) 1060023 (88038) 0.008 
  3D6 GH635417 Bombyx mori/NP_001106734.1 Chromodomain-helicase-DNA-binding protein, Chd1 4e-55 646212 (139984) 668356 (51233) 0.405 
  3E8 GH635430 Danio rerio/3D5W_A Polo-like kinase 1, key regulator of mitosis 5e-14 683725 (297302) 1654236 (729577) 0.050 
  3H4 GH635459 Aedes aegypti/XP_001650044.1 Brain tumour protein, brat, plays conserved roles in regulating asymmetric cell division 2e-110 432105 (58073) 418845 (66371) 0.404 
  4H1 GH635546 Dictyostelium discoideum AX4/XP_636910.1 Cell division cycle protein 48, ATPase activity 2e-70 151011 (130802) 48588 (7636) 0.124 
  5H7 GH635638 Culex quinquefasciatus/XP_001851276.1 Maintenance of ploidy protein mob1, spindle pole body duplication and mitotic checkpoint regulation 7e-81 3326932 (355978) 3331466 (579226) 0.496 
  6F11 GH635710 Marinobacter aquaeolei VT8/YP_959599.1 Septum site-determining protein MinD, cell division inhibitor, membrane ATPase, activates MinC 1e-96 203325 (31950) 167603 (39060) 0.144 
  6G4 GH635715 Tribolium castaneum/XP_967278.1 Glucose inhibited division protein a 2e-58 9179540 (1800825) 9412445 (974140) 0.427 
  8F2 GH635868 Culex quinquefasciatus/XP_001868862.1 Septin, GTP-binding proteins associated with diverse processes in dividing and non-dividing cells 9e-90 NOc NOc NOc 
 Signal transduction  mechanisms         
  1C2 GH635234 Caenorhabditis elegans/NP_001122601.1 Multiple PDZ domain protein family member (mpz-1). PDZ domains bind C-terminal polypeptides 1e-25 384951 (372239) 124457 (98006) 0.153 
  1F10 GH635269 Aedes aegypti/XP_001661429.1 Serine/threonine protein phosphatase 2c 2e-50 781458 (138552) 594286 (118186) 0.075 
  5D2 GH635592 Aedes aegypti/XP_001655129.1 Juvenile hormone-inducible protein. Phosphotransferases of the serine or threonine-specific kinase subfamily 1e-12 814885 (210772) 791626 (166497) 0.444 
  6F2 GH635701 Aedes aegypti/XP_001653183.1 kek1, transmembrane protein Kekkon1, functions during oogenesis in a negative feedback loop to directly attenuate EGFR activity 1e-65 4874429 (1035110) 2643792 (381283) 0.012 
  8D1 GH635844 Dictyostelium discoideum AX4/XP_637704.1 Extracellular-signal-regulated protein kinase 5e-60 4674108 (773778) 3717952 (667592) 0.090 
 Extracellular  structures         
  1E4 GH635256 Tribolium castaneum/NP_001073566.1 Chitin binding 3e-38 145004903 (17496865) 83435 (10291) 6.9e-5 
  5E3 GH635605 Tribolium castaneum/NP_001073566.1 Chitin binding 2e-41 15137020 (2722017) 186539 (59612) 3.4e-4 
 Intracellular  trafficking, secretion,  and vesicular  transport         
  1F2 GH635263 Rattus norvegicus/NP_114010.1 Nuclear receptor co-activator 2, ligand-dependent nuclear receptor transcription co-activator activity 6e-33 36555843 (2154518) 32220981 (2602268) 0.045 
  6D8 GH635683 Aedes aegypti/XP_001654070.1 RAN binding protein 8e-11 15956226 (7616989) 11118037 (1423072) 0.170 
 Post-translational  modification, protein  turnover, chaperones         
  1A9 GH635217 Artemia urmiana/ABY86224.1 Artemin, molecular chaperone activity 2e-49 39974 (3652) 68263 (13714) 0.013 
  2G6 GH635363 Artemia franciscana/ABD19713.1 Small heat shock protein ArHsp22 2e-47 38109728 (4870733) 916717 (117775) 9.5e-5 
  5A3 GH635558 Bombyx mori/NP_001036958.1 p23-like protein, p23 binds heat shock protein hsp90 and participates in the folding of a number of proteins 2e-15 13667141 (2894748) 22587321 (6983461) 0.055 
  5A11 GH635566 Dictyostelium discoideum AX4/XP_635173.1 Chaperonin containing TCP1 eta subunit, folding of proteins, ATPase 5e-91 92113 (61186) NOc 0.030 
  8E1 GH635855 Culex quinquefasciatus/XP_001845910.1 Ubiquitin-conjugating enzyme morgue, ubiquitin-mediated protein degradation pathway 6e-08 38807882 (8838408) 40987126 (2925164) 0.353 
Poorly characterized         
 General function  prediction only         
  2E11 GH635346 Acyrthosiphon pisum/XP_001950343.1 Similar to NFX1-type zinc finger-containing protein 2e-7 1684927 (273135) 1661413 (471297) 0.472 
  5B2 GH635569 Caenorhabditis elegans/NP_001023145.1 Dauer up-regulated family member (dur-1) 2e-15 951530 (50601) 73024 (20448) 4.9e-6 
No significant  similarity         
 1A5 GH635213 No Unknown No hit 207217 (18509) 128331 (23683) 0.005 
Internal control         
 α-tubulin   21386652 (1501833) 21393767 (502529) 0.497    
a

Levels of mRNA expression: results are means (S.D.) (copies/μg of total RNA) of three replicates and normalized by tubulin.

b

The P-values were calculated by the Student’s t test. The P-values of significantly up-regulated genes are shown in boldface and italicized, while those of significantly down-regulated genes are shown in boldface.

c

Not detected by the 40 cycles of real-time PCR. Expression level was set to zero to calculate the P-value.

Reproductive mode-regulated gene expression in Artemia oocytes

We used DNSH to study the differential transcript profiles in A. parthenogenetica diapause-destined oocytes relative to nauplii-destined oocytes at the filled oviduct stage. We found that many genes whose products commonly regulate metabolism, growth, transcription and stress tolerance were already differentially expressed between diapause- and nauplii-destined oocytes. Some of these genes are discussed below; more information is listed in Table 3 and Supplementary Figure S5 (at http://www.bioscirep.org/bsr/031/bsr0310017add.htm).

Chitin-binding proteins

Chitin-binding proteins play an important role in the formation of the chitinous shell of diapause cysts. The chitinous shell, which is tough and impermeable to non-volatile solutes, protects the cysts from harsh conditions [27]. Five chitin-binding protein encoding cDNAs (representing 14 clones) were isolated in our subtracted library. cDNA clone 1E4 isolated in the present study is identical with a chitin-binding protein (GenBank® accession no. DW678201) isolated from A. franciscana embryos at 2 days post-fertilization [4], whereas clones 6G10 and 8D4 are more similar to another chitin-binding protein (GenBank® accession no. DW678180). Two tested cDNAs (clones 1E4 and 5E3) were up-regulated in diapause-destined oocytes. Our results provide evidence that those genes have already been up-regulated in diapause-destined oocytes, indicating that those proteins are critical for diapause cyst formation. However, why so many types of chitin-binding proteins are transcribed at such an early oocyte stage and how they are involved in the formation of the chitinous shell of Artemia cysts remain unknown. Additional work is required to elucidate how the diapause embryos are encysted.

Major facilitator families

Two metabolic genes, sugar efflux permease (clone 1A10) and trehalose transporter (clone 7A8), were tested. The former was not significantly up-regulated, whereas the latter was significantly down-regulated (P=0.003) in diapause-destined oocytes (Table 3). Trehalose, which constitutes approx. 15% of the dry weight of cysts [3], can either alone or synergistically with p26 stabilize cells during dehydration and rehydration [2830]. It was showed that trehalose transporter from the insect, Polypedilum vanderplanki, can transport trehalose across the cell membrane bidirectionally to balance the trehalose concentration [31]. Taking into account that trehalose plays an important role in the survival of diapause embryos of Artemia, the down-regulated expression of trehalose transporter indicates that trehalose is unlikely to be transported from females to her egg. Thus the accumulation of trehalose in cysts must be made by the egg itself. This premise is supported by the discovery that trehalose synthesis begins in diapause-destined embryos but not in nauplii-destined embryos of A. franciscana at approx. 2 days after fertilization (reviewed in [2]).

Molecular chaperones

Expressions of p26, ArHsp21, ArHsp22 and artemin were previously reported to increase at 2 days post-fertilization in A. franciscana [1,5,6,8]. Although we did not obtain a p26 clone from our subtracted library, we have identified the ArHsp22 and artemin encoding cDNAs therein. In contrast with the expression pattern in A. franciscana [6], ArHsp22 was highly expressed in diapause-destined oocytes of A. parthenogenetica (Table 3). This suggests that ArHsp22 may not only enhance the cysts’ stress resistance, but also function in oocyte or embryo development. The mRNA level of artemin in diapause-destined oocytes of A. parthenogenetica was very low, although it was up-regulated in nauplii-destined oocytes for unknown reasons.

Cell cycle control proteins

Proteins that play important roles in regulation of cell growth, such as dedicator of cytokinesis (clone 1E5), kekkon1 (clone 6F2) and PLK1 (clone 3E8), are significantly differentially expressed in Artemia (Table 3). The former two were up-regulated in diapause-destined oocytes, while the latter one was down-regulated. Dedicator of cytokinesis family proteins regulates migration, morphology, adhesion and growth of cells, whereas deficiency of dedicator of cytokinesis may lead to carcinogenesis [32]. Expression of the transmembrane protein kekkon1, which functions during oogenesis in a negative feedback loop to directly attenuate EGFR (epidermal growth factor receptor) activity, suppresses the growth of mouse mammary tumour cells derived from aberrant ErbB receptors [33]. The PLK1 is critical for regulation of cell division. It has been shown that the expression of PLK1 is inhibited by the tumour suppressor protein p53; in contrast, overexpression of PLK1 inactivated p53 (reviewed in [34]). The up-regulation of dedicator of cytokinesis and kekkon1 and the down-regulation of PLK1 in diapause-destined oocytes of Artemia may contribute to the cell-cycle arrest of diapause embryos.

Transcription factor

The transcription factor, HAP2 (haem-activated protein 2; clone 8H1), was significantly up-regulated in diapause-destined oocytes of Artemia (P=0.002). HAP2 is a subunit of the heterotrimeric CCAAT-binding complex. The CCAAT-binding complex is conserved in eukaryotic organisms such as fungi, plants and animals [35]. It is essential to mitochondrial functions, and its activity was decreased under anoxia in yeast [36]. The CCAAT-binding transcription factor has been shown to rescue yeast and human cells from a cytochrome c oxidase defect [37]. In addition to the sHSPs and trehalose, the up-regulation of HAP2 in diapause-destined oocytes may also contribute to the survival of diapause cysts under years of anoxia.

RNAi knockdown of PLK1

To further understand the functions of these differentially expressed genes in Artemia, RNAi was used to knock down the expression of genes such as ArHsp22, dur-1 (dauer up-regulated family member 1) and PLK1. No significant morphological changes were observed in the diapause cysts of Artemia when the expression of ArHsp22 and dur-1 was knocked down (results not shown). However, knockdown of the expression of PLK1 (approx. 63% knockdown) in oocytes of ovoviviparous Artemia led to the production of white embryos rather than free-swimming nauplii (Figure 3). This finding further supports the premise that down-regulated expression of PLK1 in diapause-destined oocytes of Artemia may contribute to the developmental arrest of diapause embryos.

RNAi of PLK in Artemia

Figure 3
RNAi of PLK in Artemia

In vivo knockdown of PLK1 by RNAi in Artemia leads to production of embryos (RNAi) instead of free-swimming nauplii (control).

Figure 3
RNAi of PLK in Artemia

In vivo knockdown of PLK1 by RNAi in Artemia leads to production of embryos (RNAi) instead of free-swimming nauplii (control).

In summary, we used a novel subtractive hybridization approach, DNSH, to study the differential transcript profiles in A. parthenogenetica diapause-destined oocytes relative to nauplii-destined oocytes at the filled oviduct stage. Many genes, including several known diapause-specific genes (e.g. ArHsp22 and chitin-binding proteins), were found to be differentially expressed between diapause- and nauplii-destined oocytes. Our results suggest that the development modes of A. parthenogenetica embryos may be predestined in oocytes.

Abbreviations

     
  • ArHsp

    Artemia heat-shock protein

  •  
  • COGs

    clusters of orthologous groups of proteins

  •  
  • DSN

    duplex-specific nuclease

  •  
  • DNSH

    DSN-mediated normalization and subtractive hybridization

  •  
  • dsRNA

    double-stranded RNA

  •  
  • HAP2

    haem-activated protein 2

  •  
  • LB

    Luria–Bertani

  •  
  • LD

    light/dark cycles

  •  
  • MMLV

    Moloney-murine-leukaemia virus

  •  
  • PLK1

    polo-like kinase 1

  •  
  • RNAi

    RNA interference

  •  
  • RT–PCR

    reverse transcription–PCR

  •  
  • sHSP

    small heat-shock protein

We thank Mr Chris Wood of the College of Life Sciences, Zhejiang University, for a critical reading of this paper. E. coli HT115 (DE3) was provided by the Caenorhabditis Genetics Center, which is funded by the NIH (National Institutes of Health) NCRR (National Center for Research Resources).

FUNDING

This work was supported by the National Natural Science Foundation of China [grant numbers 40730212, 40876069]; the ‘863’ Program of China [grant number 2007AA09Z426]; the Postdoctoral Scientific Foundation of China [grant number 20090461373]; and the Scientific Research Fund of Zhejiang Provincial Education Department [grant number Y200909613].

References

References
1
Liang
 
P.
MacRae
 
T. H.
 
The synthesis of a small heat shock/alpha-crystallin protein in Artemia and its relationship to stress tolerance during development
Dev. Biol.
1999
, vol. 
207
 (pg. 
445
-
456
)
2
Clegg
 
J. S.
Trotman
 
C. N. A.
 
Abatzopoulos
 
T. J.
Beardmore
 
J. A.
Clegg
 
J. S.
Sorgeloos
 
P.
 
Physiological and biochemical aspects of Artemia ecology
Artemia: Basic and Applied Biology
2002
Dordrecht
Kluwer Academic Publishers
(pg. 
129
-
170
)
3
Clegg
 
J.
 
Embryos of Artemia franciscana survive four years of continuous anoxia: the case for complete metabolic rate depression
J. Exp. Biol.
1997
, vol. 
200
 (pg. 
467
-
475
)
4
Qiu
 
Z.
Tsoi
 
S. C.
MacRae
 
T. H.
 
Gene expression in diapause-destined embryos of the crustacean, Artemia franciscana
Mech. Dev.
2007
, vol. 
124
 (pg. 
856
-
867
)
5
Qiu
 
Z.
Macrae
 
T. H.
 
ArHsp21, a developmentally regulated small heat-shock protein synthesized in diapausing embryos of Artemia franciscana
Biochem. J.
2008
, vol. 
411
 (pg. 
605
-
611
)
6
Qiu
 
Z.
MacRae
 
T. H.
 
ArHsp22, a developmentally regulated small heat shock protein produced in diapause-destined Artemia embryos, is stress inducible in adults
FEBS J.
2008
, vol. 
275
 (pg. 
3556
-
3566
)
7
Warner
 
A. H.
Brunet
 
R. T.
MacRae
 
T. H.
Clegg
 
J. S.
 
Artemin is an RNA-binding protein with high thermal stability and potential RNA chaperone activity
Arch. Biochem. Biophys.
2004
, vol. 
424
 (pg. 
189
-
200
)
8
Chen
 
T.
Villeneuve
 
T. S.
Garant
 
K. A.
Amons
 
R.
MacRae
 
T. H.
 
Functional characterization of artemin, a ferritin homolog synthesized in Artemia embryos during encystment and diapause
FEBS J.
2007
, vol. 
274
 (pg. 
1093
-
1101
)
9
Liang
 
P.
Amons
 
R.
Macrae
 
T. H.
Clegg
 
J. S.
 
Purification, structure and in vitro molecular-chaperone activity of Artemia p26, a small heat-shock/alpha-crystallin protein
Eur. J. Biochem.
1997
, vol. 
243
 (pg. 
225
-
232
)
10
Qiu
 
Z.
MacRae
 
T. H.
 
Developmentally regulated synthesis of p8, a stress-associated transcription cofactor, in diapause-destined embryos of Artemia franciscana
Cell Stress Chaperones
2007
, vol. 
12
 (pg. 
255
-
264
)
11
Nambu
 
Z.
Tanaka
 
S.
Nambu
 
F.
 
Influence of photoperiod and temperature on reproductive mode in the brine shrimp, Artemia franciscana
J. Exp. Zoolog. A Comp. Exp. Biol.
2004
, vol. 
301
 (pg. 
542
-
546
)
12
Dai
 
Z. M.
Zhu
 
X. J.
Chen
 
Q.
Yang
 
W. J.
 
PCR-suppression effect: kinetic analysis and application to representative or long-molecule biased PCR-based amplification of complex samples
J. Biotechnol.
2007
, vol. 
128
 (pg. 
435
-
443
)
13
Zhulidov
 
P. A.
Bogdanova
 
E. A.
Shcheglov
 
A. S.
Vagner
 
L. L.
Khaspekov
 
G. L.
Kozhemyako
 
V. B.
Matz
 
M. V.
Meleshkevitch
 
E.
Moroz
 
L. L.
Lukyanov
 
S. A.
Shagin
 
D. A.
 
Simple cDNA normalization using kamchatka crab duplex-specific nuclease
Nucleic Acids Res.
2004
, vol. 
32
 pg. 
e37
 
14
Shagin
 
D. A.
Rebrikov
 
D. V.
Kozhemyako
 
V. B.
Altshuler
 
I. M.
Shcheglov
 
A. S.
Zhulidov
 
P. A.
Bogdanova
 
E. A.
Staroverov
 
D. B.
 
A novel method for SNP detection using a new duplex-specific nuclease from crab hepatopancreas
Genome Res.
2002
, vol. 
12
 (pg. 
1935
-
1942
)
15
Matz
 
M.
Shagin
 
D.
Bogdanova
 
E.
Britanova
 
O.
Lukyanov
 
S.
Diatchenko
 
L.
Chenchik
 
A.
 
Amplification of cDNA ends based on template-switching effect and step-out PCR
Nucleic Acids Res.
1999
, vol. 
27
 (pg. 
1558
-
1560
)
16
Chung
 
C. T.
Niemela
 
S. L.
Miller
 
R. H.
 
One-step preparation of competent Escherichia coli: transformation and storage of bacterial cells in the same solution
Proc. Natl. Acad. Sci. U.S.A.
1989
, vol. 
86
 (pg. 
2172
-
2175
)
17
Nishimura
 
A.
Morita
 
M.
Nishimura
 
Y.
Sugino
 
Y.
 
A rapid and highly efficient method for preparation of competent Escherichia coli cells
Nucleic Acids Res.
1990
, vol. 
18
 pg. 
6169
 
18
Dai
 
J. Q.
Zhu
 
X. J.
Liu
 
F. Q.
Xiang
 
J. H.
Nagasawa
 
H.
Yang
 
W. J.
 
Involvement of p90 ribosomal S6 kinase in termination of cell cycle arrest during development of Artemia-encysted embryos
J. Biol. Chem.
2008
, vol. 
283
 (pg. 
1705
-
1712
)
19
Diatchenko
 
L.
Lau
 
Y. F.
Campbell
 
A. P.
Chenchik
 
A.
Moqadam
 
F.
Huang
 
B.
Lukyanov
 
S.
Lukyanov
 
K.
Gurskaya
 
N.
Sverdlov
 
E. D.
Siebert
 
P. D.
 
Suppression subtractive hybridization: a method for generating differentially regulated or tissue-specific cDNA probes and libraries
Proc. Natl. Acad. Sci. U.S.A.
1996
, vol. 
93
 (pg. 
6025
-
6030
)
20
Peng
 
R. H.
Xiong
 
A. S.
Xue
 
Y.
Li
 
X.
Liu
 
J. G.
Cai
 
B.
Yao
 
Q. H.
 
Kamchatka crab duplex-specific nuclease-mediated transcriptome subtraction method for identifying long cDNAs of differentially expressed genes
Anal. Biochem.
2008
, vol. 
372
 (pg. 
148
-
155
)
21
Dai
 
Z. M.
Zhu
 
X. J.
Yang
 
W. J.
 
Full-length normalization subtractive hybridization: a novel method for generating differentially expressed cDNAs
Mol. Biotechnol.
2009
, vol. 
43
 (pg. 
257
-
263
)
22
Ji
 
W.
Wright
 
M. B.
Cai
 
L.
Flament
 
A.
Lindpaintner
 
K.
 
Efficacy of SSH PCR in isolating differentially expressed genes
BMC Genomics
2002
, vol. 
3
 pg. 
12
 
23
Anisimova
 
V. E.
Rebrikov
 
D. V.
Zhulidov
 
P. A.
Staroverov
 
D. B.
Lukyanov
 
S. A.
Shcheglov
 
A. S.
 
Renaturation, activation, and practical use of recombinant duplex-specific nuclease from Kamchatka crab
Biochemistry (Moscow)
2006
, vol. 
71
 (pg. 
513
-
519
)
24
Anisimova
 
V. E.
Rebrikov
 
D. V.
Shagin
 
D. A.
Kozhemyako
 
V. B.
Menzorova
 
N. I.
Staroverov
 
D. B.
Ziganshin
 
R.
Vagner
 
L. L.
Rasskazov
 
V. A.
Lukyanov
 
S. A.
Shcheglov
 
A. S.
 
Isolation, characterization and molecular cloning of duplex-specific nuclease from the hepatopancreas of the Kamchatka crab
BMC Biochem.
2008
, vol. 
9
 pg. 
14
 
25
Rees
 
W. A.
Yager
 
T. D.
Korte
 
J.
von Hippel
 
P. H.
 
Betaine can eliminate the base pair composition dependence of DNA melting
Biochemistry
1993
, vol. 
32
 (pg. 
137
-
144
)
26
Spiess
 
A. N.
Mueller
 
N.
Ivell
 
R.
 
Trehalose is a potent PCR enhancer: lowering of DNA melting temperature and thermal stabilization of Taq polymerase by the disaccharide trehalose
Clin. Chem.
2004
, vol. 
50
 (pg. 
1256
-
1259
)
27
Drinkwater
 
L. E.
Clegg
 
J. S.
 
Browne
 
R. A.
Sorgeloos
 
P.
Trotman
 
C. N. A.
 
Experimental biology of cyst diapause
Artemia Biology
1991
Boston, MA
CRC Press
(pg. 
93
-
117
)
28
Wolkers
 
W. F.
Tablin
 
F.
Crowe
 
J. H.
 
From anhydrobiosis to freeze-drying of eukaryotic cells
Comp. Biochem. Physiol. A. Mol. Integr. Physiol.
2002
, vol. 
131
 (pg. 
535
-
543
)
29
Ma
 
X.
Jamil
 
K.
Macrae
 
T. H.
Clegg
 
J. S.
Russell
 
J. M.
Villeneuve
 
T. S.
Euloth
 
M.
Sun
 
Y.
Crowe
 
J. H.
Tablin
 
F.
Oliver
 
A. E.
 
A small stress protein acts synergistically with trehalose to confer desiccation tolerance on mammalian cells
Cryobiology
2005
, vol. 
51
 (pg. 
15
-
28
)
30
Crowe
 
J. H.
Crowe
 
L. M.
Wolkers
 
W. F.
Oliver
 
A. E.
Ma
 
X.
Auh
 
J.-H.
Tang
 
M.
Zhu
 
S.
Norris
 
J.
Tablin
 
F.
 
Stabilization of dry mammalian cells: lessons from nature
Integr. Comp. Biol.
2005
, vol. 
45
 (pg. 
810
-
820
)
31
Kikawada
 
T.
Saito
 
A.
Kanamori
 
Y.
Nakahara
 
Y.
Iwata
 
K.
Tanaka
 
D.
Watanabe
 
M.
Okuda
 
T.
 
Trehalose transporter 1, a facilitated and high-capacity trehalose transporter, allows exogenous trehalose uptake into cells
Proc. Natl. Acad. Sci. U.S.A.
2007
, vol. 
104
 (pg. 
11585
-
11590
)
32
Takahashi
 
K.
Kohno
 
T.
Ajima
 
R.
Sasaki
 
H.
Minna
 
J. D.
Fujiwara
 
T.
Tanaka
 
N.
Yokota
 
J.
 
Homozygous deletion and reduced expression of the DOCK8 gene in human lung cancer
Int. J. Oncol.
2006
, vol. 
28
 (pg. 
321
-
328
)
33
Ghiglione
 
C.
Amundadottir
 
L.
Andresdottir
 
M.
Bilder
 
D.
Diamonti
 
J. A.
Noselli
 
S.
Perrimon
 
N.
Carraway
 
I. K.
 
Mechanism of inhibition of the Drosophila and mammalian EGF receptors by the transmembrane protein Kekkon 1
Development
2003
, vol. 
130
 (pg. 
4483
-
4493
)
34
Martin
 
B. T.
Strebhardt
 
K.
 
Polo-like kinase 1: target and regulator of transcriptional control
Cell Cycle
2006
, vol. 
5
 (pg. 
2881
-
2885
)
35
Tuncher
 
A.
Sprote
 
P.
Gehrke
 
A.
Brakhage
 
A. A.
 
The CCAAT-binding complex of eukaryotes: evolution of a second NLS in the HapB subunit of the filamentous fungus Aspergillus nidulans despite functional conservation at the molecular level between yeast, A. nidulans and human
J. Mol. Biol.
2005
, vol. 
352
 (pg. 
517
-
533
)
36
Lai
 
L. C.
Kosorukoff
 
A. L.
Burke
 
P. V.
Kwast
 
K. E.
 
Metabolic-state-dependent remodeling of the transcriptome in response to anoxia and subsequent reoxygenation in Saccharomyces cerevisiae
Eukaryot. Cell
2006
, vol. 
5
 (pg. 
1468
-
1489
)
37
Fontanesi
 
F.
Jin
 
C.
Tzagoloff
 
A.
Barrientos
 
A.
 
Transcriptional activators HAP/NF-Y rescue a cytochrome c oxidase defect in yeast and human cells
Hum. Mol. Genet.
2008
, vol. 
17
 (pg. 
775
-
788
)

Supplementary data