The existence of PDLSCs [PDL (periodontal ligament) stem cells] in PDL has been identified and such cells may function in periodontal reconstruction, including bone formation. Oestrogens/ERs (oestrogen receptors; ERα and ERβ) exert important effects in bone formation, however, the relationship between ERs and PDLSCs has not been established. In the present study, PDLSCs were isolated and assays for detecting stem-cell biomarkers and multipotential differentiation potential confirmed the validity of human PDLSCs. The results of RT–PCR (reverse transcription–PCR) and Western blotting showed that ERα and ERβ were expressed at higher levels in PDLSCs as compared with PDLCs (PDL cells), and 17β-oestradiol obviously induced the osteogenic differentiation of PDLSCs in vitro. Furthermore, a pan-ER inhibitor or lentivirus-mediated siRNA (small interfering RNA) targeting ERα or ERβ blocked the oestrogen-induced osteogenic differentiation of PDLSCs. The results indicate that both ERα and ERβ were involved in the process of osteogenic differentiation of PDLSCs.

INTRODUCTION

The PDL (periodontal ligament) is a complex tissue containing several subpopulations of heterogeneous cells, including cementum-forming cells (cementoblasts) and bone-forming cells (osteoblasts). These cells contribute to tooth nutrition, homoeostasis and repair of damaged tissue [13]. The differentiated functional cells in the PDL are suspected to derive from clonogenic cells maintaining the properties of stem-like cells [4]. PDLSCs (PDL stem cells) have been investigated for a long time [46]. Previously, Seo et al. reported that PDL contains stem-like cells that have the potential to form cementum/PDL-like tissue in vivo [7]. Furthermore, they concluded that PDLSCs may be promising candidates for periodontal regenerative therapy because they have the capacity to self-renew and differentiate into many types of cells, integrating into complex tissue [8]. It is possible to obtain PDLCs (PDL cells) from clinical patients and to manipulate standard protocols to isolate and amplify the source of PDLSCs. However, the molecular mechanism of the specific differentiation of PDLSCs has not been investigated thoroughly.

Previous studies demonstrated that exogenous oestrogens can prevent postmenopausal bone loss by enhancing the osteoblastic activity and formation of bone tissue. It has been widely accepted that the ER (oestrogen receptor)-mediated signalling pathway is the most critical step in the turnover of bone tissue. Like most hormones, oestrogen exerts its influence by binding to specific receptors, specifically two ER subtypes, ERα and ERβ [912]. Both receptors belong to the nuclear hormone receptor superfamily and mediate a variety of physiological signals [1315]. However, there are still many discrepancies in the study of the function and mechanism of ERs in the formation of bone tissue. James et al. [16] found that only ERα was involved in oestrogen-induced posterofrontal cranial suture fusion, whereas in a transgenic mouse model, it was demonstrated that both ERs play important roles in bone metabolism [17]. Recently, it was reported that both ERα and ERβ are expressed in human PDLCs and the up-regulation of ERβ expression was detected during osteogenic differentiation of PDLCs [18]. But the expression pattern and biological function of ERs in PDLSCs have not been elucidated.

Our previous study showed the expression pattern of ERα in rat marrow mesenchymal stem cells and its correlation with osteogenic differentiation in vitro [19]. This suggested that ERs could be functional molecules in the osteogenic differentiation of stem-like cells, including PDLSCs. Indeed, ERα and ERβ have been detected in PDLCs, and oestrogen has been shown to stimulate the bone formation capacity of cultured PDLCs by increasing ALP (alkaline phosphatase) activity, osteocalcin distribution and the formation of mineralized nodules [2023]. Therefore we hypothesized that oestrogens/ERs may stimulate osteogenic differentiation in PDLSCs and contribute to their capacity for periodontal tissue regeneration.

In the present study, we isolated a single colony of stem-like cells from human PDLCs and identified their surface markers, metabolic rate and multipotential differentiation potential. In the functional analysis of the relationship between PDLSCs and ERs, pharmacological intervention and genetic manipulation were performed to evaluate the influence of ERα and ERβ expression on the osteogenic differentiation of PDLSCs in vitro.

MATERIALS AND METHODS

Cell isolation and culture

Normal, partially impacted third molars (n=6) were collected from three female individuals aged 18, 19 and 22. The collection followed the guidelines for informed consent established by the Ethics Committee of the School of Stomatology, Fourth Military Medical University (Xi'an, China). PDLCs were obtained as previously described [14]. Briefly, PDLs were gently separated from the surface of the mid-root and cut into small pieces. Next, they were dispersed into a 6-well plate with coverslips and cultured in α-MEM (α-modified Eagle's medium) supplemented with 10% FCS (foetal calf serum; Gibco), 2 mmol/l glutamine, 100 units/ml penicillin and 100 μg/ml streptomycin (Sigma, St. Louis, MO, U.S.A.). The samples were incubated at 37°C in 5% CO2, and the culture medium was exchanged every other day. When the cells surrounding the tissue explants emerged, the coverslips and deciduous tissue explants were removed. All the experiments were performed after PDLCs were cultured for more than five passages and the phenotype of the cells were stable.

To obtain homogeneous populations of PDLSCs, subconfluent primary cultures of PDLCs were obtained using a limiting dilution technique. Cells were diluted into DMEM (Dulbecco's modified Eagle's medium) containing 10% FCS in 96-well culture plates (Corning) at a concentration of 10 cells/ml (100 μl per well). Each chamber was then assessed for the presence or absence of a single cell with an inverted microscope (Olympus, Tokyo, Japan). Wells containing only one cell were marked for further analysis. After 2–3 weeks of original culture, the single-cell-derived clones were then harvested and further expanded in the growth medium. After human PDLSCs were cultured for more than three passages, the various experiments were performed. The isolated cells were expanded with the α-MEM containing 10% FCS and incubated at 37°C in 5% CO2.

Clonogenic assay

Cells were seeded on to 96-well plates at a density of 10 cells/ml in a volume of 100 μl. Cultures were fixed with 10% formalin on day 10, stained with 0.1% Toluidine Blue (Sigma) and observed with an inverted microscope. Aggregates of 50 cells or more were scored as colonies, and the results were recorded.

MTT assay

Cells were subjected to an MTT [3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyl-2H-tetrazolium bromide] assay (Sigma) for evaluating the metabolic rate of cells as previously described [19]. After 24 h of seeding (1×103 per well), 20 μl (5 mg/ml) of MTT was added to each well of a 96-well plate for incubation for 4 h at 37°C. Then the supernatant was removed and 150 μl of DMSO was added after 10 min of oscillation. The attenuance (D) was determined with an ELISA detector at a wavelength of 490 nm.

Flow cytometry analysis

PDLSCs and PDLCs were collected and washed with PBS and then resuspended in PBS containing 2% BSA and 0.1% sodium azide. Cell aliquots (3×103 cells/100 μl) were incubated on ice with FITC-coupled antibodies against CD45, CD44, CD146 and STRO-1 (Beckman Coulter, Fullerton, CA, U.S.A.) or FITC-coupled non-specific mouse IgG (isotype control) for 30 min. The cells were then washed with PBS and resuspended in 1 ml of PBS for FACS analysis. The data were analysed, and positive expression was defined as a level of fluorescence greater than 99% of the corresponding isotype-matched control antibodies.

Analysis of the multipotential differentiation potential of PDLSCs

PDLSCs were plated at 5×103/cm2 in 6-well plates and cultured in α-MEM supplemented with 10% FCS. For adipogenic induction, the medium was changed 24 h later to an adipogenic inducing medium containing α-MEM supplemented with 0.5 mM IBMX (isobutylmethylxanthine; Sigma), 10−8 M insulin (Sigma), 10−7 M dexamethasone (Sigma) and 10% FCS. The medium was changed every 3 days. At 21 days post-induction, cultures were fixed with 10% formalin and stained with Oil Red O (Sigma). For osteogenic induction, the medium was changed to an osteogenic inducing medium containing α-MEM supplemented with 10 mM 2-glycerophosphate (Sigma), 0.1 μM dexamethasone (Sigma), 0.05 mM ascorbic acid (Sigma) and 10% FCS. Medium was changed every other day. After 21 days, the cells were assayed for calcium deposits using Alizarin Red S staining.

Immunocytochemical analysis

PDLSCs were seeded on to coverslips at a density of 2×105 cells/ml and maintained in α-MEM supplemented with 10% FCS for an additional 2 days before fixing with 4% polyoxymethylene. Polyclonal rabbit anti-human ERα and ERβ antibodies were obtained from Santa Cruz Biotechnology (Santa Cruz, CA, U.S.A.). The immunocytochemical analyses were performed using the SABC (streptavidin–biotin complex) method according to the manufacturer-recommended protocol. All samples were counter-stained with haematoxylin and eosin and examined with an Olympus compound microscope (Olympus Optical Co.) and a Nikon digital camera.

RT–PCR (reverse transcription–PCR) and antibodies for Western-blot analysis

Total RNA was extracted from cells using TRIzol® reagent (Invitrogen, Carlsbad, CA, U.S.A.). First-strand cDNA was synthesized using a first-strand cDNA synthesis kit (Invitrogen). The following primers were incorporated: ER1 (ESRα; GenBank® Nucleotide Sequence Database accession no. NM_000125.3|), ER2 (ESRβ; GenBank® accession no. NM_001437.2|), PPARγ (peroxisome-proliferator-activated receptor γ; GenBank® accession no. AY157024), LPL (lipoprotein lipase; GenBank® accession no. NM_000237) and GAPDH (glyceraldehyde-3-phosphate dehydrogenase; GenBank® accession no. M33197). Primer sequences were as follows: ERα forward primer 5′-CACAGACACTTTGATCCACC-3′, reverse primer 5′-AATGCGATGAAGTAGAGCCC-3′; ERβ: forward primer 5′- CATAAGACTATATTGTCCAGCC -3′, reverse primer 5′- AACCGAGATGATGTAGCCAGCAGC -3′; PPARγ2: forward primer 5′-CTCCTATTGACCCAGAAAGC-3′, reverse primer 5′-GTAGAGCTGAGTCTTCTCAG-3′; LPL: forward primer 5′-ATGGAGAGCAAAGCCCTGCTC-3′, reverse primer 5′-GTTAGGTCCAGCTGGATCGAG-3′; and GAPDH: forward primer 5′-AAGAAGGTGGTGAAGCAGGC-3′, reverse primer 5′-TCCACCACCCTGTTGCTGTA-3′. The PCRs were pre-incubated in a PCR Mastercycler gradient (Eppendorf, Hamburg, Germany) at 95°C for 3 min and then cycled 33 times at 95°C/30 s, 55°C/45 s and 72°C/60 s, followed by a final 10 min extension at 72°C. The products were separated by electrophoresis on a 1% agarose gel and visualized by UV-induced fluorescence.

For Western blotting, cell extracts containing 30 μg total protein were directly subjected to SDS/PAGE and transferred. The membranes were blocked and probed with primary antibodies that recognize ERα, ERβ, MEPE (matrix extracellular phosphoglycoprotein), OCN (osteocalcin), TGF-β (transforming growth factor-β)-RI, GAPDH, β-actin (Santa Cruz Biotechnology) and BSP (bone sialoprotein; Abcom). Secondary antibodies were chosen according to the species of origin of the primary antibodies and detected by enhanced chemiluminescence (Pierce).

Construction and infection of ERα and ERβ siRNA (small interfering RNA) expression lentivirus

To generate lentiviruses expressing RNAi (RNA interference) specific for ERα and ERβ, the RNAi was designed based on two conservative cDNA fragments within the coding region of the human ERα and ERβ gene. The target sequence for ERα was CCAGTGCACCATTGATAAA, and the target sequence for ERβ was TATCTCTGTGTCAAGGCCA. The annealed DNA sequences were cloned into the HpaI and XhoI sites of pGCL-GFP (GENECHEM, Shanghai, China) to generate pGCL-GFP-ERα and pGCL-GFP-ERβ. A control vector, pGCL-GFP-Ctr, was supplied by GENECHEM. Subsequently, the plasmid, together with pHelper 1.0 and pHelper 2.0 plasmids that contained the imperative elements for virus packaging, were co-transfected into HEK-293T cells [HEK-293 cells (human embryonic kidney cells) expressing the large T-antigen of SV40 (simian virus 40)] with Lipofectamine™ 2000, according to the manufacturer's instructions (Invitrogen) for the generation of lentivirus-siRNA-ERα, lentivirus-siRNA-ERβ or lentivirus-siRNA-Ctr. The culture supernatants containing the lentivirus were harvested and ultracentrifuged.

For cell infection, cells were grown to 70–80% confluence and infected with lentivirus-siRNA-ERα, lentivirus-siRNA-ERβ or lentivirus-siRNA-Ctr at a MOI (multiplicity of infection) of 30. Cells were harvested 48 h after infection and analysed by FACS to sort and collect GFP (green fluorescent protein)-positive cells.

ALP activity and OCN production assay

The standard protocol was manipulated as previously described [24]. Briefly, cells were plated at a density of 1×104 cells per well in 96-well plates. Fresh medium (Phenol Red-free α-MEM supplemented with 10% charcoal stripped and heat-inactivated FCS, 2 mmol/l glutamine, 100 units/ml penicillin and 100 μg/ml streptomycin) and experimental agents were added every other day. At the indicated time points, the ALP activity of cells was determined using an ALP assay kit (JianCheng Co., Nanjing, China) according to the manufacturer's instructions. The D was determined with an ELISA detector at a wavelength of 490 nm.

Cells were treated with 17β-oestradiol (10−7 M) for 10 days. The culture medium was then collected and Osteocalcin ELISA kits (Takara Bio, Shiga, Japan) were used to detect OCN levels. Briefly, samples were placed in 96-well microtitre plates coated with monoclonal detective antibodies and incubated for 2 h at room temperature (25 °C). After removing unbound material with washing buffer (50 mM Tris, 200 mM NaCl and 0.2% Tween 20, pH 7.5), horseradish peroxidase-conjugated streptavidin was added to bind to the antibodies. Horseradish peroxidase catalysed the conversion of a chromogenic substrate (tetramethylbenzidine) into a coloured solution, with colour intensity proportional to the amount of protein present in the sample. The attenuance of each well was measured at 450 nm by a plate reader (Versa Max, Molecular Devices).

Statistic analysis

All experiments were repeated at least three times to ensure reproducibility. The results are reported as means±S.D. The results were analysed by one-way ANOVA followed by Dunnett's test for significance. P<0.05 was considered statistically significant.

RESULTS

Isolation and characterization of PDLSCs from human PDLCs

Recent studies have highlighted the existence of stem cells in PDL tissue, and the findings have provided evidence that PDLSCs have the capacity for multipotential differentiation. Using the limiting dilution technique, we isolated stem-like cells from a PDLC population. To characterize stem cell phenotypic markers of single-colony derived PDLSCs, the expressions of CD44, CD45, CD146 and STRO-1 were analysed by flow cytometry. We observed that a high percentage of PDLSCs expressed CD44, STRO-1 and CD146 (Figure 1A). In contrast, only few PDLSCs expressed CD45 (Figure 1A). This result showed that we obtained the enriched PDLSCs from human PDLCs.

Identification and characteristics of human PDLSCs from PDLC cultures

Figure 1
Identification and characteristics of human PDLSCs from PDLC cultures

(A) Flow cytometric analysis of PDLSC and PDLC biomarkers. A representative diagram is given for CD44, STRO-1, CD146 and CD45 expression in PDLSCs and PDLCs. The FITC-conjugated isotype-matching immunoglobulins were used to determine non-specific staining. Detection of each marker was repeated three times (mean±S.D.). (B) Adipogenic and osteogenic differentiation of PDLSCs. The upper panel shows the Oil Red O staining of PDLSCs that were cultured in adipogenic medium for 3 weeks. RT–PCR analysis shows PPARγ and LPL mRNA expression in cells with adipogenic induction for 3 weeks. GAPDH was used as an internal control. The lower panel shows Alizarin Red staining of PDLSCs that were cultured in osteogenic medium for 3 weeks. Western-blot analysis confirmed the expression of the osteoblastic markers, including BSP, OCN, TGF-β-RI and MEPE, under osteogenic induction for 3 weeks. GAPDH was used as an internal control. (C) Colony formation assay for detecting the colony numbers of cell clusters derived from PDLSCs and PDLCs. The results shown are the means ± S.D. for more than three independent experiments (*P<0.05). (D) MTT assay for measuring the metabolic rate of PDLSCs and PDLCs. The results shown are the means±S.D. with culture time (P<0.05).

Figure 1
Identification and characteristics of human PDLSCs from PDLC cultures

(A) Flow cytometric analysis of PDLSC and PDLC biomarkers. A representative diagram is given for CD44, STRO-1, CD146 and CD45 expression in PDLSCs and PDLCs. The FITC-conjugated isotype-matching immunoglobulins were used to determine non-specific staining. Detection of each marker was repeated three times (mean±S.D.). (B) Adipogenic and osteogenic differentiation of PDLSCs. The upper panel shows the Oil Red O staining of PDLSCs that were cultured in adipogenic medium for 3 weeks. RT–PCR analysis shows PPARγ and LPL mRNA expression in cells with adipogenic induction for 3 weeks. GAPDH was used as an internal control. The lower panel shows Alizarin Red staining of PDLSCs that were cultured in osteogenic medium for 3 weeks. Western-blot analysis confirmed the expression of the osteoblastic markers, including BSP, OCN, TGF-β-RI and MEPE, under osteogenic induction for 3 weeks. GAPDH was used as an internal control. (C) Colony formation assay for detecting the colony numbers of cell clusters derived from PDLSCs and PDLCs. The results shown are the means ± S.D. for more than three independent experiments (*P<0.05). (D) MTT assay for measuring the metabolic rate of PDLSCs and PDLCs. The results shown are the means±S.D. with culture time (P<0.05).

To determine the multipotential differentiation capacity of PDLSCs, we performed adipogenic and osteogenic induction by adding special agents into the culture media. After adipogenic induction, PDLSCs developed into Oil Red O-positive lipid-laden fat cells by day 21 (Figure 1B), as well as small round Alizarin Red-positive nodules in the osteogenic induction cultures by 3 weeks, indicating the multipotential differentiation potential of the isolated PDLSCs (Figure 1B). The specific differentiation of PDLSCs was further confirmed by semi-quantitative RT–PCR. Increased expression of PPARγ and LPL was detected in the adipogenic induction group and the expression of ALP was induced in the osteogenic induction group. These results were consistent with previous studies [7,25,26] and suggested that our isolated PDLSCs were suitable for further analysis.

As observed from the colony formation assay, PDLSCs showed the ability to form more colonies (Figure 1C) compared with those in PDLC cultures. These results indicate that PDLSCs have the ability to form multicell clusters. Additionally, the results of the MTT assay showed that the metabolic rate of the PDLSCs was slower as compared with PDLCs, and this finding is consistent with the properties of stem cells reported previously [27].

Oestrogen-induced osteogenic differentiation of PDLSCs

To confirm the effect of oestrogens on the osteogenic differentiation of PDLSCs in vitro, we measured the ALP activity and OCN level of PDLSCs in the presence of oestrogens. ALP and OCN are markers for calcification and differentiation of osteo-inductive cells. We found that the ALP activity was much higher in the oestrogen-treated PDLSCs than in the control group (Figure 2). Furthermore, in the oestrogen-treated groups, the ALP activity was stimulated in a dose-dependent manner (Figure 2). These results suggest that oestrogens may influence the osteogenic differentiation of PDLSCs in vitro.

Oestradiol-induced ALP activity in PDLSCs

Figure 2
Oestradiol-induced ALP activity in PDLSCs

PDLSCs were divided into the following four groups: untreated cells and cells treated with 10−7, 10−8 and 10−9 M 17-β oestradiol. At the indicated time points, the ALP activity of PDLSCs was detected according to the protocol described in the Materials and methods section (*P<0.05 compared with the control group respectively). OD, D.

Figure 2
Oestradiol-induced ALP activity in PDLSCs

PDLSCs were divided into the following four groups: untreated cells and cells treated with 10−7, 10−8 and 10−9 M 17-β oestradiol. At the indicated time points, the ALP activity of PDLSCs was detected according to the protocol described in the Materials and methods section (*P<0.05 compared with the control group respectively). OD, D.

The expression patterns of ERs on PDLSCs

Although PDLSCs have been identified as a therapeutic source for periodontal tissue repair [2], few studies have focused on the function of their ERs. To investigate the expression patterns of ERα and ERβ in PDLSCs, immunocytochemistry was performed. We detected positive ER signals in the nuclei of PDLSCs (Figure 3A), indicating their possible biological function as transcriptional factors. We further found that both ERα and ERβ gene expression and protein distribution were higher in PDLSCs than those in PDLCs, as confirmed by RT–PCR and Western-blot analysis respectively (Figures 3B and 3C). The higher expression of ERα and ERβ in PDLSCs as compared with PDLCs indicates a potential involvement of ERα and ERβ in the process of oestrogen-induced osteogenic differentiation of PDLSCs.

Expression of ERα and ERβ in PDLSCs

Figure 3
Expression of ERα and ERβ in PDLSCs

(A) Immunocytochemical analysis of ERs and immunostaining of PDLSCs using antibodies against ERα and ERβ. The isotype IgG was used as a negative control. Scale bar, 50 μm. (B) Semi-RT–PCR analysis of ERs in PDLSCs and PDLCs. GAPDH was used as an internal control. (C) Western-blot analysis of ERs in PDLSCs and PDLCs. β-actin was used as an internal control.

Figure 3
Expression of ERα and ERβ in PDLSCs

(A) Immunocytochemical analysis of ERs and immunostaining of PDLSCs using antibodies against ERα and ERβ. The isotype IgG was used as a negative control. Scale bar, 50 μm. (B) Semi-RT–PCR analysis of ERs in PDLSCs and PDLCs. GAPDH was used as an internal control. (C) Western-blot analysis of ERs in PDLSCs and PDLCs. β-actin was used as an internal control.

Pharmacological intervention and genetic manipulation to abrogate the activation of ERα and ERβ and their effects on the oestrogen-induced osteogenic differentiation of PDLSCs

To determine the biological effect of ERs in the process of oestrogen-induced osteogenic differentiation of PDLSCs, we used a pan-ER inhibitor ICI 182780 to block the function of both ERα and ERβ. When this antagonist was added into the culture media, 17-β oestradiol-treated PDLSCs showed lower activity of ALP and lower OCN levels as compared with those of the control group (Figure 4A). The results suggest that ERα and ERβ could act as key factors in the osteogenic differentiation of PDLSCs.

Oestradiol-induced ALP activity and OCN level in PDLSCs after treatment by pharmacological or genetic manipulation resulting in decreased ER biological function

Figure 4
Oestradiol-induced ALP activity and OCN level in PDLSCs after treatment by pharmacological or genetic manipulation resulting in decreased ER biological function

(A) Oestradiol-induced ALP activity and OCN level in PDLSCs under treatment with the pan-ER inhibitor, ICI 182789. Cells were divided into three groups: the control group, oestrogen-treated group (10−7 M 17-β oestradiol) and ER antagonist group (10−7 M ICI 182780 supplemented with 10−7 M 17-β oestradiol). At 3 and 10 days after treatment, ALP activity and OCN level were measured respectively. The results shown are the means±S.D. for five samples (*P<0.05 compared with the control group). (B) Western-blot analysis of lentivirus-mediated down-regulation of ERα and ERβ in PDLSCs. In the group of pLenti-ERα-infected cells, ERβ was used to show the specific silencing effect of ERα shRNA and in the group of pLenti- ERβ-infected cells, ERα was used to show the specific silencing effect of ERβ shRNA. (C) Lentivirus-infected PDLSCs were treated with 10−7 M 17-β oestradiol and were cultured for 3 and 10 days. Subsequently, the ALP activity and OCN level of PDLSCs were determined and compared with the control group respectively. Results are expressed as means±S.D. for three independent experiments (*P<0.05 compared with the control group).

Figure 4
Oestradiol-induced ALP activity and OCN level in PDLSCs after treatment by pharmacological or genetic manipulation resulting in decreased ER biological function

(A) Oestradiol-induced ALP activity and OCN level in PDLSCs under treatment with the pan-ER inhibitor, ICI 182789. Cells were divided into three groups: the control group, oestrogen-treated group (10−7 M 17-β oestradiol) and ER antagonist group (10−7 M ICI 182780 supplemented with 10−7 M 17-β oestradiol). At 3 and 10 days after treatment, ALP activity and OCN level were measured respectively. The results shown are the means±S.D. for five samples (*P<0.05 compared with the control group). (B) Western-blot analysis of lentivirus-mediated down-regulation of ERα and ERβ in PDLSCs. In the group of pLenti-ERα-infected cells, ERβ was used to show the specific silencing effect of ERα shRNA and in the group of pLenti- ERβ-infected cells, ERα was used to show the specific silencing effect of ERβ shRNA. (C) Lentivirus-infected PDLSCs were treated with 10−7 M 17-β oestradiol and were cultured for 3 and 10 days. Subsequently, the ALP activity and OCN level of PDLSCs were determined and compared with the control group respectively. Results are expressed as means±S.D. for three independent experiments (*P<0.05 compared with the control group).

To further analyse the biological function of ERα and ERβ, lentivirus-mediated specific gene shRNAs (small-hairpin RNAs) were applied to down-regulate the expression of ERα and ERβ. The GFP reporter in the lentivirus vector helped us to detect the transfection efficiency of our delivery system, and the gene silencing effect was confirmed by Western-blot analysis (Figure 4B). To determine whether ERα and ERβ function in the oestrogen-induced osteogenic differentiation of PDLSCs, ALP activity and OCN level were observed. The results showed that, with the down-regulation of either ERα or ERβ, oestrogen-induced ALP activity and OCN level were attenuated compared with the control group, suggesting that both ERα and ERβ play important roles in oestrogen-induced osteogenic differentiation of PDLSCs (Figure 4C).

DISCUSSION

The existence of PDLSCs in a population of PDLCs has been identified and such cells may function in the regeneration of periodontal tissue, including bone formation. Oestrogens/ERs (ERα and ERβ) exert important effects in bone formation; however, the relationship between ERs and PDLSCs has not been established. In the present study, we isolated PDLSCs from human PDLCs by using the limiting dilution technique. Assays for detecting stem-cell biomarkers and multipotential differentiation potential characterized the human PDLSCs. In a previous study, STRO-1 was identified as a specific biomarker of PDLSCs and STRO-1-positive PDLCs were sorted and enriched by FACS to detect its differentiation capacity [28]. On the one hand, we manipulated the similar protocol to isolate and enrich the PDLSCs, and, on the other hand, we used the limited dilution technique to do this. When we performed the FACS to detect the expression patterns of CD44 and CD146, two biomarkers on the fibroblast-derived stem-like cells, we found that the expression level of these two biomarkers was much higher in cells isolated by using the latter method than in cells isolated by using the former method (results not shown). Therefore we think that the limited dilution technique could be a more feasible method to obtain single colony-derived PDLSCs that maintained the homogenic stem-like cells.

Many factors are involved in the progression of periodontal disease [29,30]. Oestrogen deficiency, which is regarded as a key factor in periodontal disease, often occurs in postmenopausal osteoporotic women [31]. Clinicians have found that HRT (hormone replacement therapy) can improve the clinical outcome of periodontal disease and may serve as an effective, adjunct treatment for preserving periodontal bone mass [32]. We observed the obviously osteogenic differentiation of PDLSCs with treatment with 17β-oestradiol. This suggested that a combination of PDLSCs and HRT may be a potential strategy for the treatment of oestrogen-deficiency-associated osteoporosis.

In the present study, we detected increased expression of both ERα and ERβ. This phenomenon is discrepant with previous reports that oestrogens increase the mRNA and protein expression of ERα, while decreasing those of ERβ in mesenchymal stem cells [33]. However, Stossi et al. [34] demonstrated that both ERα and ERβ transcriptionally up-regulated BMP-6 (bone morphogenetic protein-6), a key factor in bone formation, supporting the findings of the present study that both ERα and ERβ may function in the osteogenic differentiation of PDLSCs [34]. This difference may be explained by the fact that in the different types of cells, the different expression patterns of ERα and ERβ are under the control of specific mechanisms.

It has been reported that, as transcriptional factors, ERα and ERβ have distinct and common target genes in different biological processes [34]. Because ICI 182780 is a pan-antagonist of ERs, the different biological functions of ERα and ERβ cannot be analysed independently by using this antagonist. To further confirm the discovery of our study that both ERs may be involved in the process of oestrogen-induced osteogenic differentiation of PDLSCs, we applied the lentivirus-mediated siRNA to down-regulate the expression of ERα and ERβ, respectively, and analysed their effects on this process. Taken together, the results of both pharmacological intervention and genetic manipulation to abrogate the activation of ERα and ERβ demonstrated that both ERs are involved in the oestrogen-induced osteogenic differentiation of PDLSCs

To our knowledge, this is the first study to detect the expression patterns of ERα and ERβ in PDLSCs. Our results also establish a relationship between ERs and PDLSCs, suggesting that both ERα and ERβ are involved in oestrogen-induced osteogenic differentiation of PDLSCs. These findings emphasize the importance of the ER-mediated signalling pathway in the osteogenic differentiation of PDLSCs. Our future studies will be focused on the common target genes transcriptionally regulated by both ERs to further explore the signalling pathways that control the osteogenic differentiation of PDLSCs.

Abbreviations

     
  • ALP

    alkaline phosphatase

  •  
  • BSP

    bone sialoprotein

  •  
  • ER

    oestrogen receptor

  •  
  • FCS

    foetal calf serum

  •  
  • GAPDH

    glyceraldehyde-3-phosphate dehydrogenase

  •  
  • GFP

    green fluorescent protein

  •  
  • HRT

    hormone replacement therapy

  •  
  • LPL

    lipoprotein lipase

  •  
  • α-MEM

    α-modified Eagle's medium

  •  
  • MEPE

    matrix extracellular phosphoglycoprotein

  •  
  • MTT

    3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyl-2H-tetrazolium bromide

  •  
  • OCN

    osteocalcin

  •  
  • PDL

    periodontal ligament

  •  
  • PDLC

    PDL cell

  •  
  • PDLSC

    PDL stem cell

  •  
  • PPARγ

    peroxisomeproliferator-activated receptor γ

  •  
  • RNAi

    RNA interference

  •  
  • RT–PCR

    reverse transcription–PCR

  •  
  • shRNA

    small-hairpin RNA

  •  
  • siRNA

    small interfering RNA

  •  
  • TGF-β-RI

    transforming growth factor-β receptor type 1

AUTHOR CONTRIBUTION

Yin Ding and Feng Pan conceived and designed the study. Feng Pan and Rui Zhang collected, analysed and interpreted the data, and wrote the paper. Guang Wang carried out the statistical analyses. Yin Ding gave final approval and took overall responsibility for the paper.

FUNDING

This work was supported by the Natural Science Foundation of China [grant number 30572069].

References

References
1
McCulloch
 
C. A.
Bordin
 
S.
 
Role of fibroblast subpopulations in periodontal physiology and pathology
J. Periodontal Res.
1991
, vol. 
26
 (pg. 
144
-
154
)
2
Pitaru
 
S.
McCulloch
 
C. A.
Narayanan
 
S. A.
 
Cellular origin and differentiation control mechanisms during periodontal development and wound healing
J. Periodontal Res.
1994
, vol. 
19
 (pg. 
81
-
94
)
3
Gottlow
 
J.
Nyman
 
S.
Karring
 
T.
Linde
 
J.
 
New attachment formation as the result of controlled tissue regeneration
J. Clin. Periodontol.
1984
, vol. 
11
 (pg. 
494
-
503
)
4
Ivanovski
 
S.
Gronthos
 
S.
Shi
 
S.
Bartold
 
P. M.
 
Stem cells in the periodontal ligament
Oral Dis.
2006
, vol. 
12
 (pg. 
358
-
363
)
5
Melcher
 
A. H.
 
Cells of periodontium: their role in the healing of wounds
Ann. R. Coll. Surg. Engl.
1985
, vol. 
67
 (pg. 
130
-
131
)
6
McCulloch
 
C. A.
 
Progenitor cell populations in the periodontal ligament of mice
Anat. Rec.
1985
, vol. 
211
 (pg. 
258
-
262
)
7
Seo
 
B. M.
Miura
 
M.
Gronthos
 
S.
Bartold
 
P. M.
Batouli
 
S.
Brahim
 
J.
Young
 
M.
Robey
 
P. G.
Wang
 
C. Y.
Shi
 
S.
 
Investigation of multipotential postnatal stem cells from human periodontal ligament
Lancet
2004
, vol. 
364
 (pg. 
149
-
155
)
8
Bartold
 
P. M.
Shi
 
S.
Gronthos
 
S.
 
Stem cells and periodontal regeneration
Periodontol. 2000
2006
, vol. 
40
 (pg. 
164
-
172
)
9
Green
 
S.
Walter
 
P.
Kumar
 
V.
Krust
 
A.
Bornert
 
J. M.
Argos
 
P.
Chambon
 
P.
 
Human oestrogen receptor cDNA: sequence, expression and homology to v-erb-A
Nature
1986
, vol. 
320
 (pg. 
134
-
139
)
10
Greene
 
G. L.
Gilna
 
P.
Waterfield
 
M.
Baker
 
A.
Hort
 
Y.
Shine
 
J.
 
Sequence and expression of human estrogen receptor complementary DNA
Science
1986
, vol. 
231
 (pg. 
1150
-
1154
)
11
Kuiper
 
G. G.
Enmark
 
E.
Pelto-Huikko
 
M.
Nilsson
 
S.
Gustafsson
 
J. A.
 
Cloning of a novel estrogen receptor expressed in rat prostate and ovary
Proc. Natl. Acad. Sci. U.S.A.
1996
, vol. 
93
 (pg. 
5925
-
5930
)
12
Smith
 
E. P.
Specker
 
B.
Korach
 
K. S.
 
Recent experimental and clinical findings in the skeleton associated with loss of estrogen hormone or estrogen receptor activity
J. Steroid Biochem. Mol. Biol.
2010
, vol. 
118
 (pg. 
264
-
272
)
13
Hall
 
J. M.
Couse
 
J. F.
Korach
 
K. S.
 
The multifaceted mechanisms of estradiol and estrogen receptor signaling
J. Biol. Chem.
2001
, vol. 
276
 (pg. 
36869
-
36872
)
14
Somerman
 
M. J.
Young
 
M. F.
Foster
 
R. A.
Moehring
 
J. M.
Imm
 
G.
Sauk
 
J. J.
 
Characteristics of human periodontal ligament cells in vitro
Arch. Oral. Biol.
1990
, vol. 
35
 (pg. 
241
-
247
)
15
Imai
 
Y.
Kondoh
 
S.
Kouzmenko
 
A.
Kato
 
S.
 
Regulation of bone metabolism by nuclear receptors
Mol. Cell. Endocrinol.
2009
, vol. 
310
 (pg. 
3
-
10
)
16
James
 
A. W.
Theologis
 
A. A.
Brugmann
 
S. A.
Xu
 
Y.
Carre
 
A. L.
Leucht
 
P.
Hamilton
 
K.
Korach
 
K. S.
Longaker
 
M. T.
 
Estrogen/estrogen receptor alpha signaling in mouse posterofrontal cranial suture fusion
PLoS One
2009
, vol. 
4
 pg. 
e7120
 
17
Sniekers
 
Y. H.
van Osch
 
G. J.
Ederveen
 
A. G.
Inzunza
 
J.
Gustafsson
 
J. A.
van Leeuwen
 
J. P.
Weinans
 
H.
 
Development of osteoarthritic features in estrogen receptor knockout mice
Osteoarthritis Cartilage
2009
, vol. 
17
 (pg. 
1356
-
1361
)
18
Tang
 
X.
Meng
 
H.
Han
 
J.
Zhang
 
L.
Hou
 
J.
Zhang
 
F.
 
Up-regulation of estrogen receptor-beta expression during osteogenic differentiation of human periodontal ligament cells
J. Periodontal Res.
2008
, vol. 
43
 (pg. 
311
-
321
)
19
Wang
 
Q.
Yu
 
J. H.
Zhai
 
H. H.
Zhao
 
Q. T.
Chen
 
J. W.
Shu
 
L.
Li
 
D. Q.
Liu
 
D. Y.
Dong
 
C.
Ding
 
Y.
 
Temporal expression of estrogen receptor alpha in rat bone marrow mesenchymal stem cells
Biochem. Biophys. Res. Commun.
2006
, vol. 
347
 (pg. 
117
-
123
)
20
Jönsson
 
D.
Andersson
 
G.
Ekblad
 
E.
Liang
 
M.
Bratthall
 
G.
Nilsson
 
B. O.
 
Immunocytochemical demonstration of estrogen receptor β in human periodontal ligament cells
Arch. Oral Biol.
2004
, vol. 
49
 (pg. 
85
-
88
)
21
Cao
 
M.
Shu
 
L.
Li
 
J.
Su
 
J.
Zhang
 
W.
Wang
 
Q.
Guo
 
T.
Ding
 
Y.
 
The expression of estrogen receptors and the effects of estrogen on human periodontal ligament cells
Methods Find. Exp. Clin. Pharmacol.
2007
, vol. 
29
 (pg. 
329
-
335
)
22
Morishita
 
M.
Yamamura
 
T.
Bachchu
 
M. A.
Shimazu
 
A.
Iwamoto
 
Y.
 
The effects of estrogen on osteocalcin production by human periodontal ligament cells
Arch. Oral Biol.
1998
, vol. 
43
 (pg. 
329
-
333
)
23
Morishita
 
M.
Yamamura
 
T.
Shimazu
 
A.
Bachchu
 
A. H.
Iwamoto
 
Y.
 
Estradiol enhances the production of mineralized nodules by human periodontal ligament cells
J. Clin. Periodontol.
1999
, vol. 
26
 (pg. 
748
-
751
)
24
Hong
 
L.
Sultana
 
H.
Paulius
 
K.
Zhang
 
G.
 
Steroid regulation of proliferation and osteogenic differentiation of bone marrow stromal cells: a gender difference
J. Steroid Biochem. Mol. Biol.
2009
, vol. 
114
 (pg. 
180
-
185
)
25
Jo
 
Y. Y.
Lee
 
H. J.
Kook
 
S. Y.
Choung
 
H. W.
Park
 
J. Y.
Chung
 
J. H.
Choung
 
Y. H.
Kim
 
E. S.
Yang
 
H. C.
Choung
 
P. H.
 
Isolation and characterization of postnatal stem cells from human dental tissues
Tissue Eng.
2007
, vol. 
13
 (pg. 
767
-
773
)
26
Nagatomo
 
K.
Komaki
 
M.
Sekiya
 
I.
Sakaguchi
 
Y.
Noguchi
 
K.
Oda
 
S.
Muneta
 
T.
Ishikawa
 
I.
 
Stem cell properties of human periodontal ligament cells
J. Periodont. Res.
2006
, vol. 
41
 (pg. 
303
-
310
)
27
Beyer Nardi
 
N.
da Silva Meirelles
 
L.
 
Mesenchymal stem cells: isolation, in vitro expansion and characterization
Handb. Exp. Pharmacol.
2006
, vol. 
174
 (pg. 
249
-
282
)
28
Gay
 
I. C.
Chen
 
S.
MacDougall
 
M.
 
Isolation and characterization of multipotential human periodontal ligament stem cells
Orthod. Craniofac. Res.
2007
, vol. 
10
 (pg. 
149
-
160
)
29
Offenbacher
 
S.
Barros
 
S. P.
Beck
 
J. D.
 
Rethinking periodontal inflammation
J. Periodontol.
2008
, vol. 
79
 (pg. 
1577
-
1584
)
30
Gunji
 
T.
Onouchi
 
Y.
Nagasawa
 
T.
Katagiri
 
S.
Watanabe
 
H.
Kobayashi
 
H.
Arakawa
 
S.
Noguchi
 
K.
Hata
 
A.
Izumi
 
Y.
Ishikawa
 
I.
 
Functional polymorphisms of the FPR1 gene and aggressive periodontitis in Japanese
Biochem. Biophys. Res. Commun.
2007
, vol. 
364
 (pg. 
7
-
13
)
31
Lerner
 
U. H.
 
Inflammation-induced bone remodeling in periodontal disease and the influence of post-menopausal osteoporosis
J. Dent. Res.
2006
, vol. 
85
 (pg. 
596
-
607
)
32
Inagaki
 
K.
Kurosu
 
Y.
Sakano
 
M.
Yamamoto
 
G.
Kikuchi
 
T.
Noguchi
 
T.
Yano
 
H.
Izawa
 
H.
Hachiya
 
Y.
 
Oral osteoporosis: a review and its dental implications
Clin. Calcium
2007
, vol. 
17
 (pg. 
157
-
163
)
33
Zhou
 
S.
Zilberman
 
Y.
Wassermann
 
K.
Bain
 
S. D.
Sadovsky
 
Y.
Gazit
 
D.
 
Estrogen modulates estrogen receptor alpha and beta expression, osteogenic activity, and apoptosis in mesenchymal stem cells (MSCs) of osteoporotic mice
J. Cell. Biochem. Suppl.
2001
, vol. 
36
 (pg. 
144
-
155
)
34
Stossi
 
F.
Barnett
 
D. H.
Frasor
 
J.
Komm
 
B.
Lyttle
 
C. R.
Katzenellenbogen
 
B. S.
 
Transcriptional profiling of estrogen-regulated gene expression via estrogen receptor (ER) alpha or ERbeta in human osteosarcoma cells: distinct and common target genes for these receptors
Endocrinology
2004
, vol. 
145
 (pg. 
3473
-
3486
)

Author notes

1

These authors contributed equally to this work.