CYP (cytochrome P450) 3A29 in pigs could be an important candidate gene responsible for xenobiotic metabolism, similar to CYP3A4 in humans. Accordingly, the tissue expression of CYP3A29 mRNA in domestic pigs has been determined by a real-time PCR. The enzymatic properties of CYP3A29, CYP3A4 and PLM (pig liver microsomes) were compared by kinetic analysis of TST (testosterone) 6β-hydroxylation and NIF (nifedipine) oxidation. CYP3A29 mRNA was highly expressed in the liver and small intestines of domestic pigs. The CYP3A29 enzyme expressed in Sf9 cells had the same TST-metabolizing activity as human CYP3A4 based on their roughly equal in vitro intrinsic clearance values. The affinity of CYP3A29 for NIF was lower than that of CYP3A4 but higher than that of PLM. KET (ketoconazole) was a more potent inhibitor of TST 6β-hydroxylation and NIF oxidation activities of CYP3A29 than TAO (troleandomycin). These findings indicate that pig CYP3A29 is similar to human CYP3A4 in both extent of expression and activity. The results reported in this paper provide a basis for future in vitro toxicity and metabolism studies.

INTRODUCTION

CYP (cytochrome P450) enzymes in mammals play a key toxicological role in the oxidative metabolism and detoxification of various xenobiotics [1]. CYP3A is well known as one of the most important CYP subfamilies because of its extensive set of substrates. Human CYP3A4 is one of the major isoforms expressed in adults and constitutes up to 30% of total hepatic CYP [2]. Besides the metabolic detoxification of common xenobiotics, CYP3A4 is also involved in the metabolic activation of some serious food contaminants (for example, aflatoxin B1) [3]. This process is important since it increases the risk of drug-induced toxicity by facilitating drug elimination.

Pigs are becoming a potential non-rodent model in both comparative pharmacological and toxicological studies because of the high similarity of pig and human anatomy and physiology [4]. The CYP3A activity and proteins have been found in hepatocytes, enterocytes and microsomal proteins from domestic pigs by using specific human CYP3A substrates and human/rat CYP3A antibodies [58]. Their expression can be induced by β-naphthoflavone, phenobarbital, dexamethasone and rifampicin, which are concerned with pregnane X receptor- and constitutive androstane receptor-mediated gene activation [912]. Some frequently used antibiotics, such as KET (ketoconazole) and tiamulin, are able to strongly inhibit pig CYP3A activity [13,14], which would produce metabolic interaction mediated by CYP3A when CYP3A substrates and inhibitors are administrated in combination. These studies highlighted the structural and functional presence of CYP3A isoforms in domestic pigs. However, very little information is available on the individual pig CYP3A enzymes and their metabolic capabilities.

Pig CYP3A29 was considered to be one of the most active contributors to microsomal CYP3A activity because the N-terminal sequence of one of the partially purified CYP3A proteins identified by immunostaining with antibodies against human CYP3A4 was the same as that of CYP3A29 [15,16]. The DNA sequence of CYP3A29 of the domestic pig has been cloned and was found to be composed of an open reading frame of 503 amino acids [17]. The derivative amino acid sequence of porcine CYP3A29 exhibits 76% sequence identity with human CYP3A4. To the best of our knowledge, no further work has been done on this protein. Therefore we undertook a detailed characterization of the expression and enzymatic properties of domestic pig CYP3A29. This work is of importance for drug metabolism and toxicological research.

MATERIALS AND METHODS

Reagents

Grace's cell culture medium, fetal bovine serum and CELLFECTIN reagent were obtained from Invitrogen. TST (testosterone), 6β-OHT (6β-hydroxy testosterone), NIF (nifedipine), ONIF (oxidized NIF), TAO (troleandomycin), glucose 6-phosphate, glucose-6-phosphate dehydrogenase expressed in recombinant Escherichia coli and an anti-human CYP3A4 mAb (monoclonal antibody) were purchased from Sigma. Human recombinant CYP3A4 with hNPR (human NADPH-P450 reductase) and hb5 (human cytochrome b5) (baculovirus-expressed) were obtained from BD Gentest. KET was supplied by the Institute of Veterinary Drug Control of China (Beijing, China). NADP was purchased from Roche. All other chemicals and reagents were of the highest analytical grade.

Isolation of total RNA and synthesis of cDNA

Three independent castrated landrace × large white crossbreed pigs (45±5 kg body weight, aged approx. 3 months) were purchased from the Breeding Swine Testing Center (Wuhan, China). The pigs were fed and killed according to the ethics rules of the Hubei Agricultural Academy (China). Approx. 100 mg each of liver, duodenum, jejunum, ileum, kidney, spleen and lung tissues were collected and then snap-frozen in liquid nitrogen. Total RNA was isolated using a TRIzol® reagent according to the supplier's recommendations (Invitrogen). RNA was treated with DNase I (Promega) and first-strand cDNA synthesis was performed from 2 μg of RNA using M-MLV reverse transcriptase (Takara) and oligo d(T)18.

Real-time PCR assay

The PCR assay was carried out in a 25 μl reaction system consisting of 0.3 μl of cDNA, 80 nM primer pairs (Table 1) for each gene and 12.5 μl of SYBR mix (2×) according to the instructions for the Bio-Rad SYBGreen kit. All PCR reactions were performed using a Bio-Rad IQ5 Multicolor Real-Time PCR Detection System (Bio-Rad). The thermal cycling conditions consisted of an initial denaturation step at 95°C for 5 min and 40 cycles of 95°C for 15 s and 58°C for 40 s respectively. The standard curves were performed with seven 10-fold serially diluted CYP3A29 or GAPDH (glyceraldehyde-3-phosphate dehydrogenase) plasmids. The mRNA expression levels of the target genes in each sample were calculated according to the standard curve and normalized on the basis of its GAPDH content. Each sample was analysed in triplicate.

Table 1
Primer sequences for real-time PCR and cDNA amplification

In the forward (Fwd) primer, the BamHI site is underlined and the start codon is in bold. In the reverse (Rev) primer, the EcoRI site is underlined and the stop codon is in bold.

GeneGenBank® accession numberPrimer sequences (5′→3′)Product size (bp)
CYP3A29* NM_214423.1 Fwd: TCCCTCAACAACCCACAAGA 238 
  Rev: GCTGAAGAAGGTCCACTCGG  
GAPDH* U 44832 Fwd: AAGGTCGGAGTGAACGGATTT 158 
  Rev: CCATTTGATGTTGGCGGGAT  
CYP3A29 NM_214423.1 Fwd: CGGGATCCATGGACCTGATCCCAGGCTTT 1525 
  Rev: GGAATTCAGGCTCCACTTACGGTCCCATCT  
pNPR L33893.1 Fwd: CGGGATCCATGGGGGACTCCAACGTGGAT 2051 
  Rev: GGAATTCTAGCTCCACACGTCCAGGGAGT  
pb5 NM_001001770.1 Fwd: CGGGATCCATGGCCGAACAGTCCGACA 420 
  Rev: GAATTCTTAGTTTTCCGATGTGTAGAAGTGA  
GeneGenBank® accession numberPrimer sequences (5′→3′)Product size (bp)
CYP3A29* NM_214423.1 Fwd: TCCCTCAACAACCCACAAGA 238 
  Rev: GCTGAAGAAGGTCCACTCGG  
GAPDH* U 44832 Fwd: AAGGTCGGAGTGAACGGATTT 158 
  Rev: CCATTTGATGTTGGCGGGAT  
CYP3A29 NM_214423.1 Fwd: CGGGATCCATGGACCTGATCCCAGGCTTT 1525 
  Rev: GGAATTCAGGCTCCACTTACGGTCCCATCT  
pNPR L33893.1 Fwd: CGGGATCCATGGGGGACTCCAACGTGGAT 2051 
  Rev: GGAATTCTAGCTCCACACGTCCAGGGAGT  
pb5 NM_001001770.1 Fwd: CGGGATCCATGGCCGAACAGTCCGACA 420 
  Rev: GAATTCTTAGTTTTCCGATGTGTAGAAGTGA  
*

Primer sequences for real-time PCR.

Primer sequences for cDNA amplification.

Immunoblot analysis

Microsomal proteins in tissue samples from pigs were obtained by homogenization and differential speed centrifugation (10000 and 105000 g). The proteins were separated by SDS/PAGE and then electrotransferred to a PVDF membrane. The blots were developed with a primary antibody raised against human CYP3A4 (MAb HL3, dilution 1:1000) followed by a horseradish peroxidase-labelled goat anti-mouse IgG (dilution 1:20000) according to the methods of Guengerich [18]. The individual blots were visualized on an X-film using Luminol chemiluminescent reagent (Millipore). Microsomes (20 μg) containing recombinantly expressed CYP3A29 from infected Sf9 cells were used as a reference.

Construction of recombinant baculoviruses

NADPH-P450 reductase is a diflavin enzyme responsible for electron donation to mammalian CYP enzymes. CYP requires the NADPH-P450 reductase to function as a monooxygenase [19]. In some oxidation reactions catalysed by CYP3As, cytochrome b5 has been known to support the electron transfer from NADPH to CYP3As via the reductase [20,21]. Therefore pig CYP3A29 was co-expressed in Sf9 cells together with pNPR (pig NADPH-P450 reductase) and pb5 (pig cytochrome b5). PCR amplifications of the target cDNAs were conducted using TaKaRa EX Taq DNA polymerase (DR007B; TaKaRa) with the forward and reverse primers containing the restriction enzyme site sequences (underlined) shown in Table 1. The PCR products were digested with BamHI and EcoRI and further purified using a DNA purification kit (Bioteke). The plasmids pFastBac1-CYP3A29, pFastBac1-pNPR and pFastBac1-pb5 were constructed by inserting the complete coding sequences of CYP3A29, pNPR and pb5 into the restriction sites of BamHI and EcoRI in the pFastBac1 vector and then sequenced using an ABI Prism 3730 Genetic Analyzer (Applied Biosystems). These recombinant plasmids were transformed into DH10Bac cells, and the recombinant baculoviruses containing the entire coding region of porcine CYP3A29, pNPR and pb5 were generated using the Bac-to-Bac baculovirus expression system according to the manufacturer's specifications (Invitrogen).

Expression of porcine CYP3A29 with pNPR and pb5 in Sf9 insect cells

To obtain the approximate protein ratio found in CYP3A4 mixtures using the spectral method described earlier [2224], logarithmic-phase Sf9 insect cells were co-infected with a virus encoding CYP3A29, pNPR and pb5 at a ratio of 8:1:1 and at a total multiplicity of infection of 3. At 24 h post-infection, a hemin–albumin complex was added to achieve a concentration of 1 μg/ml hemin [25]. Cells were harvested by centrifugation 72 h after infection. Microsomes were prepared by ultrasonication and differential speed centrifugation (10000 and 105000 g). The total protein concentration was measured using a bicinchoninic acid protein assay (Pierce). The content of P450 was measured using the carbon monoxide-difference spectrum [22], the co-expressed pNPR activity was measured using the cytochrome c reduction assay [23] and the concentration of co-expressed pb5 was estimated according to a method described previously [24]. The expression of recombinant porcine CYP3A29 in microsomes isolated from baculovirus-infected insect cells was analysed by Western blotting. Prestained protein molecular mass standard (10 μg) was used as a reference. Microsomes (20 μg) from uninfected Sf9 insect cells were used as a negative control. Microsomes were stored at −70°C until use.

Assay for CYP3A enzymatic activity

The incubation mixture contained TST (0–200 μM) and NIF (0–80 μM) as the substrate, liver microsomes (500 μg protein/ml; CYP3As was presumed to be at 150 pmol/mg of protein [7,26]) or pig recombinant CYP3A29 or human recombinant CYP3A4 (5 pmol of recombinant P450) and an NADPH-generating system (2 mM NADP, 20 mM glucose 6-phosphate, 2 units/ml glucose-6-phosphate dehydrogenase and 5 mM MgCl2) in 50 mM potassium phosphate buffer (pH 7.4) in a final volume of 200 μl. The final concentration of the organic solvent (methanol and/or DMSO) in the incubation mixture was less than 1% (v/v). All incubations were conducted in triplicate. The reactions were initiated by the addition of the NADPH-generating system after preincubation at 37°C for 5 min. After incubation at 37°C for 10 min, the reaction was terminated by the addition of 40 μl of ice-cold trichloroacetic acid (15%). The incubated mixtures were centrifuged for 20 min at 11000 g to precipitate protein. The supernatants were analysed by HPLC.

Chemical inhibition assay

The inhibitory capacities of KET and TAO were used to compare the activity of pig recombinant CYP3A29, human recombinant CYP3A4 and PLM (pig liver microsomes). The concentration of the substrate chosen was below the Km (K0.5) values of the three enzyme systems for TST 6β-hydroxylation and NIF oxidation. A lower substrate concentration was not chosen because 10–20% metabolism of NIF at 30 μM approached the limit of quantification for ONIF. TST (25 μM) or NIF (30 μM) was co-incubated with a series of concentrations of KET (0–10 μM) using the same enzyme reaction conditions described earlier. For TAO (0–200 μM), a preincubation (20 min) was undertaken in the presence of the NADPH-generation system before the substrates were added. All incubations were conducted in triplicate. Samples were processed and then analysed by HPLC.

HPLC analysis

The HPLC system consisted of a Waters 2695 ternary pump and a Waters 2487 UV detector. An Eclipse XDB-C18 (250 mm × 4.6 mm internal diameter) (Agilent Technology) HPLC column was used for sample separation. The temperature of the HPLC column was set at 30°C. The mobile phase was methanol/water (56:44, v/v). The column was eluted over 25 min at a flow rate of 1 ml/min. The column effluent was monitored by UV absorbance at 254 nm for 6β-OHT and 270 nm for ONIF. The formation rate of ONIF and 6β-OHT in reaction mixtures was determined based on calibration curves constructed from a series of standards containing different known amounts of metabolite standards. The calibration curves were linear over a range of 0.1–10 μM ONIF and 0.05–10 μM 6β-OHT. Intraday (n=5) and interday (n=5) precision did not exceed 10% in any of the assays.

Data analysis

Kinetic parameters [Km(K0.5) and Vmax] for the biotransformation of TST and NIF in the absence of inhibitors were calculated by fitting the data to either the Michaelis–Menten {v=Vmax[S]/(Km+[S])} or Hill {v=Vmax[S]n/(K0.5+[S]n)}, where n is the Hill coefficient) equations, using non-linear regression analysis. Equations were selected by goodness of fit based on R2 values and least residual sum of squares. The IC50 values for KET and TAO were determined through the non-linear regression of relative reaction velocities at a single substrate concentration in the presence of different inhibitor concentrations. The equation is as follows: Vi=V0/[1+I/IC50]a], where V0 is the uninhibited velocity, Vi is the observed velocity, a is the slope factor and I is the inhibitor concentration. The analysis of statistical significance (P<0.05) was performed wherever appropriate using a one-way ANOVA.

RESULTS

Tissue distribution of CYP3A29

Figure 1 shows the mRNA levels of CYP3A29 relative to GAPDH in different tissues of domestic pigs. The relative expression of CYP3A29 mRNA was greatest in the liver (137), followed by expression in the duodenum (22.5) and the jejunum (13.0). Relative expression in the ileum (10.2) and lungs (6.4) was moderate, whereas low expression was detected in the heart (0.23), kidneys (0.66) and spleen (0.08). Consistent results with high abundances of CYP3A29 mRNA in porcine liver and small intestines were seen in Puccinelli et al. [27]. The tissue distribution of CYP3A29 mRNA in domestic pigs was in agreement with that of Bama miniature pigs [28] and was also comparable to the distribution of CYP3A isoforms in humans and other mammals [14,29,30]. In the present study, a gradient expression of CYP3A29 along the small intestine was observed. These findings were consistent with experiments that detected either CYP3A activity or the immunohistochemically stained proteins in humans and pigs [3133]. Four CYP genes belonging to the CYP3A subfamily have been found in pigs [11], and the corresponding CYP3A proteins in PLM were different in molecular mass and electrophoretic mobility [10]. In the present study, the visible immunoreacting bands in the hepatic and small intestinal microsomal preparations exhibited the same electrophoretic mobility as recombinant CYP3A29 (Figure 2), which indicates that the blotted proteins are CYP3A29 proteins rather than other CYP3A members, and furthermore, CYP3A29 is likely to contribute the most to hepatic and intestinal CYP3A proteins. Weakly visible bands were observed for the lung and kidney samples, and no band was visible for the heart and spleen, suggesting that the results of the immunoblot analysis are in agreement with the analysis of mRNA patterns.

Expression levels of CYP3A29 mRNA in tissues of domestic pigs

Figure 1
Expression levels of CYP3A29 mRNA in tissues of domestic pigs

Rings represent the relative expression units of CYP3A29 mRNA from three independent pigs. Histograms represent the mean levels of CYP3A29 mRNA (relative to GAPDH) in different pig tissues. The relative expression of CYP3A29 mRNA is 0.23±0.22 in heart, 137±53 in liver, 0.08±0.07 in spleen, 6.4±4.7 in lung, 0.66±0.37 in kidney, 22.5±7.6 in duodenum, 13.0±10.3 in jejunum and 10.2±6.5 in ileum tissues respectively. Results are the means±S.D. (n=3).

Figure 1
Expression levels of CYP3A29 mRNA in tissues of domestic pigs

Rings represent the relative expression units of CYP3A29 mRNA from three independent pigs. Histograms represent the mean levels of CYP3A29 mRNA (relative to GAPDH) in different pig tissues. The relative expression of CYP3A29 mRNA is 0.23±0.22 in heart, 137±53 in liver, 0.08±0.07 in spleen, 6.4±4.7 in lung, 0.66±0.37 in kidney, 22.5±7.6 in duodenum, 13.0±10.3 in jejunum and 10.2±6.5 in ileum tissues respectively. Results are the means±S.D. (n=3).

Immunoblot analysis of CYP3A proteins isolated from different swine tissues using an anti-CYP3A4 mAb (MAb HL3)

Figure 2
Immunoblot analysis of CYP3A proteins isolated from different swine tissues using an anti-CYP3A4 mAb (MAb HL3)

Lanes 1–7 were loaded with 20 μg of microsomal proteins from porcine heart, liver, spleen, lung, kidney, small-intestine tissues and Sf9 cells infected with CYP3A29 recombinant baculovirus respectively. Lane 8 was loaded with 10 μg of protein molecular-mass standard. kD, kDa.

Figure 2
Immunoblot analysis of CYP3A proteins isolated from different swine tissues using an anti-CYP3A4 mAb (MAb HL3)

Lanes 1–7 were loaded with 20 μg of microsomal proteins from porcine heart, liver, spleen, lung, kidney, small-intestine tissues and Sf9 cells infected with CYP3A29 recombinant baculovirus respectively. Lane 8 was loaded with 10 μg of protein molecular-mass standard. kD, kDa.

Heterologous expression of CYP3A29 and the partner enzyme genes

The pFastBac1-CYP3A29, pFastBac1-pNPR and pFastBac1-pb5 plasmids were constructed by inserting the complete coding sequences of CYP3A29, pNPR and pb5 into the cloning site of BamHI/EcoRI in the pFastBac1 vector. After sequencing, the 1512 bp fragment was nearly identical with porcine CYP3A29, having differences in only three sites compared with the CYP3A29 cDNA sequence reported previously (GenBank® accession number NM_214423.1) [17]. None of these substitutions resulted in changes in amino acid coding. The 2054 bp and 405 bp fragments were completely in accordance with pNPR (GenBank® accession number L33893.1) and pb5 (GenBank® accession number NM_001001770.1) respectively.

Porcine CYP3A29 was co-expressed with pNPR and pb5 in Sf9 insect cells, and approx. 50 pmol of P450, 200 units of pNPR and 110 pmol of pb5 were detected per 106 cells. The ratio of CYP:pNPR:b5 was close to that of recombinant CYP3A4 mixtures purchased from BD Gentest. The specific spectrograms were observed using whole infected cells (Figures 3A–3C), which indicates that CYP3A29 was functionally expressed as the holoenzyme in Sf9 cells when co-expressed with pNPR and pb5. CYP3A29 expression was also confirmed by immunoblot analysis using an anti-CYP3A4 antibody (Figure 3D).

Spectra of CYP3A29, pNPR and pb5

Figure 3
Spectra of CYP3A29, pNPR and pb5

(A) Fe2+-CO difference spectra of CYP3A29 expressed in infected Sf9 insect cells. (B) 424 nm spectra of pb5 reduced with sodium hydrosulfite. (C) Reductive spectra of cytochrome c by pNPR expressed in infected Sf9 insect cells. (D) Immunoblot analysis of CYP3A29 expression with an anti-CYP3A4 mAb (MAb HL3); lane 1 was loaded with 10 μg of protein molecular mass standard, whereas lanes 3 and 2 were loaded with 20 μg of microsomal proteins from infected Sf9 insect cells and uninfected Sf9 insect cells respectively. kD, kDa.

Figure 3
Spectra of CYP3A29, pNPR and pb5

(A) Fe2+-CO difference spectra of CYP3A29 expressed in infected Sf9 insect cells. (B) 424 nm spectra of pb5 reduced with sodium hydrosulfite. (C) Reductive spectra of cytochrome c by pNPR expressed in infected Sf9 insect cells. (D) Immunoblot analysis of CYP3A29 expression with an anti-CYP3A4 mAb (MAb HL3); lane 1 was loaded with 10 μg of protein molecular mass standard, whereas lanes 3 and 2 were loaded with 20 μg of microsomal proteins from infected Sf9 insect cells and uninfected Sf9 insect cells respectively. kD, kDa.

Enzymatic properties of CYP3A enzymes

Figure 4(A) compares the kinetic data for the 6β-hydroxylation of TST catalysed by pig CYP3A29, human CYP3A4 and PLM. The Vmax value (see Table 2) for the 6β-hydroxylation of TST by CYP3A29 (24.6 nmol·nmol−1 of P450·min−1) was highly similar to that of PLM (22.6 nmol·nmol−1 of P450·min−1) and human recombinant CYP3A4 (23.0 nmol·nmol−1 of P450·min−1). The K0.5 value of CYP3A29 for TST (33.7 μM) was approximately half of that of PLM (64.7 μM) and slightly higher than that of CYP3A4 (28.0 μM). Accordingly, the in vitro intrinsic clearance value, CLint (Vmax/K0.5), of CYP3A29 for TST was 0.73 ml·nmol−1 of P450·min−1, much higher than that of PLM (0.35 ml·nmol−1 of P450·min−1) and roughly equal to that of human CYP3A4 (0.82 ml·nmol−1 of P450·min−1).

Plots for the determination of the apparent K0.5 and Vmax values for TST (A) and NIF (B) metabolism by porcine CYP3A29 (□), PLM (○) and human CYP3A4 (Δ)

Figure 4
Plots for the determination of the apparent K0.5 and Vmax values for TST (A) and NIF (B) metabolism by porcine CYP3A29 (□), PLM (○) and human CYP3A4 (Δ)

Incubations contained 5 pmol of CYP3A enzymes or 500 μg/ml PLM, an NADPH-generating system and TST (0, 2.5, 5, 10, 25, 50, 100, 150 or 200 μM) or NIF (0, 2, 4, 8, 10, 20, 40, 60 or 80 μM) and were incubated for 10 min at 37°C. Values are the means from data obtained from three separate incubations at each substrate concentration. The S.D. of the replicate samples did not exceed 10% of the mean values. The solid lines through the experimental data show the best fits for the non-linear regression analysis using the Hill equation (v=Vmax[S]n/(K0.5+[S]n) for sigmoidal kinetics.

Figure 4
Plots for the determination of the apparent K0.5 and Vmax values for TST (A) and NIF (B) metabolism by porcine CYP3A29 (□), PLM (○) and human CYP3A4 (Δ)

Incubations contained 5 pmol of CYP3A enzymes or 500 μg/ml PLM, an NADPH-generating system and TST (0, 2.5, 5, 10, 25, 50, 100, 150 or 200 μM) or NIF (0, 2, 4, 8, 10, 20, 40, 60 or 80 μM) and were incubated for 10 min at 37°C. Values are the means from data obtained from three separate incubations at each substrate concentration. The S.D. of the replicate samples did not exceed 10% of the mean values. The solid lines through the experimental data show the best fits for the non-linear regression analysis using the Hill equation (v=Vmax[S]n/(K0.5+[S]n) for sigmoidal kinetics.

Table 2
Enzyme kinetic parameters for the 6β-OHT and oxidized NIF by recombinant CYP3A enzymes and PLM respectively

Results are means±S.D. (n=3).

EnzymeSubstrateVmax (nmol·nmol−1 of P450·min−1)K0.5 (μM)CLint (ml·nmol−1 of P450·min−1)n
CYP3A4-hNPR-hb5 TST 23.0±1.2 28.0±3.7 0.82±0.08 1.2±0.1 
CYP3A29-pNPR-pb5  24.6±1.8 33.7±6.6 0.73±0.10 1.1±0.1 
PLM  22.6±2.3 64.7±11.8 0.35±0.09 1.3±0.1 
CYP3A4-hNPR-hb5 NIF 11.0±0.6 5.1±2.1 2.2±0.9 1.3±0.1 
CYP3A29-pNPR-pb5  8.6±0.5 16.3±1.7 0.52±0.08 1.2±0.1 
PLM  10.1±3.4 33.0±20.9 0.31±0.12 1.1±0.1 
EnzymeSubstrateVmax (nmol·nmol−1 of P450·min−1)K0.5 (μM)CLint (ml·nmol−1 of P450·min−1)n
CYP3A4-hNPR-hb5 TST 23.0±1.2 28.0±3.7 0.82±0.08 1.2±0.1 
CYP3A29-pNPR-pb5  24.6±1.8 33.7±6.6 0.73±0.10 1.1±0.1 
PLM  22.6±2.3 64.7±11.8 0.35±0.09 1.3±0.1 
CYP3A4-hNPR-hb5 NIF 11.0±0.6 5.1±2.1 2.2±0.9 1.3±0.1 
CYP3A29-pNPR-pb5  8.6±0.5 16.3±1.7 0.52±0.08 1.2±0.1 
PLM  10.1±3.4 33.0±20.9 0.31±0.12 1.1±0.1 

The kinetic data for the generation of ONIF by recombinant porcine CYP3A29, recombinant human CYP3A4 and PLM with increasing concentrations of NIF (0–80 μM) are displayed in Figure 4(B). The Vmax values for NIF oxidation by the three metabolism systems were relatively similar at 11.0, 8.6 and 10.1 nmol·nmol−1 of P450·min−1 respectively. The K0.5 value of NIF for PLM (33 μM) was roughly twice that of CYP3A29 (16.3 μM), and the latter was 3-fold higher than that of CYP3A4 (K0.5=5.1 μM). The various K0.5 values had a predominant effect on the CLint value (see Table 2). CYP3A4 was 4-fold more active at metabolizing NIF than CYP3A29 and 6-fold more active than PLM based on a CLint value of 2.2 ml·nmol−1 of P450·min−1, compared with values of 0.52 and 0.31 ml·nmol−1 of P450·min−1 respectively.

Inhibitory effect on CYP3A activity

Figure 5 reveals the effects of KET and TAO on the TST 6β-hydroxylation and NIF oxidation activities of recombinant CYP3A29, CYP3A4 and PLM respectively. The IC50 values of KET and TAO towards CYP3A enzymatic activities were calculated and are shown in Table 3. The inhibition of TST 6β hydroxylation and NIF oxidation activities by KET were for CYP3A29 (IC50=0.031 and 0.044 μM respectively) roughly identical with those for CYP3A4 (IC50=0.018 and 0.023 μM respectively) and slightly lower than those for PLM (IC50=0.078 and 0.19 μM respectively). There were no significant differences in the IC50 values between CYP3A29 and PLM and between CYP3A29 and CYP3A4. Apparently higher IC50 values for TAO than KET were observed in the present study. The respective IC50 values for TAO for TST 6β-hydroxylation and NIF oxidation were 17.8 and 4.7 μM for pig CYP3A29, 9.8 and 1.3 μM for human CYP3A4 and 69.5 and 25.5 μM for PLM.

Chemical inhibition of the 6β-hydroxylation of TST and oxidation of NIF catalysed by recombinant CYP3A29 (□), CYP3A4 (○) and PLM (Δ) in the presence of a series of concentrations of KET (0–10 μM) (A and B) and TAO (0–200 μM) (C and D)

Figure 5
Chemical inhibition of the 6β-hydroxylation of TST and oxidation of NIF catalysed by recombinant CYP3A29 (□), CYP3A4 (○) and PLM (Δ) in the presence of a series of concentrations of KET (0–10 μM) (A and B) and TAO (0–200 μM) (C and D)

The substrate concentrations used were 25 μM for TST and 30 μM for NIF. Results are calculated as percentage inhibition of 6β-OHT or ONIF formation as a function of increasing concentration of KET or TAO. Curves are plotted with the mean values from three incubations, and the values for duplicate incubations were within 10% of each other in all cases.

Figure 5
Chemical inhibition of the 6β-hydroxylation of TST and oxidation of NIF catalysed by recombinant CYP3A29 (□), CYP3A4 (○) and PLM (Δ) in the presence of a series of concentrations of KET (0–10 μM) (A and B) and TAO (0–200 μM) (C and D)

The substrate concentrations used were 25 μM for TST and 30 μM for NIF. Results are calculated as percentage inhibition of 6β-OHT or ONIF formation as a function of increasing concentration of KET or TAO. Curves are plotted with the mean values from three incubations, and the values for duplicate incubations were within 10% of each other in all cases.

Table 3
IC50 values for KET and TAO towards 25 μM TST and 30 μM NIF respectively

Results are means±S.D. (n=3). *P<0.05 compared with CYP3A29.

IC50 values (μM)
Enzymes systemKET towards TSTKET towards NIFTAO towards TSTTAO towards NIF
CYP3A4-hNPR-hb5 0.018±0.004 0.023±0.015 9.8±1.3* 1.3±0.7* 
CYP3A29-pNPR-pb5 0.031±0.015 0.044±0.010 17.8±2.0 4.7±0.9 
PLM 0.078±0.015 0.19±0.11 69.5±12.1 25.5±4.4 
IC50 values (μM)
Enzymes systemKET towards TSTKET towards NIFTAO towards TSTTAO towards NIF
CYP3A4-hNPR-hb5 0.018±0.004 0.023±0.015 9.8±1.3* 1.3±0.7* 
CYP3A29-pNPR-pb5 0.031±0.015 0.044±0.010 17.8±2.0 4.7±0.9 
PLM 0.078±0.015 0.19±0.11 69.5±12.1 25.5±4.4 

DISCUSSION

Pigs are increasingly used as an animal model for the development of medicines [13,31,32,34]. Many reports have even raised interest in pigs as the best animal for supplying hepatocyte-based bioartificial liver or extracorporeal liver perfusion for the treatment of patients with liver failure [35,36]. Based on studies utilizing PLM and isoform-selective substrates of CYP3A, it has been suggested that a member of the CYP3A family present in pig liver may be capable of metabolizing substrates similar to those of CYP3A4. However, little is known about the enzymatic properties and other details of the CYP3A enzyme isoforms. CYP3A subfamily enzymes tend to lose catalytic activity during purification, and many of their reactions require special conditions for reconstitution of optimal activity. Furthermore, CYP3A proteins purified from liver microsomes are always contaminated by small amount of other CYP isoenzymes. The only definitive way to determine precisely which enzyme is responsible for the metabolism of a given drug and which metabolites a specific enzyme produces is to construct a recombinant enzyme. To that end, in the present study, CYP3A29 was confirmed to be a highly expressed CYP3A isoform in domestic pigs, and CYP3A29 cDNA was cloned and expressed in insect cells in order to characterize its enzymatic activity and compare it with PLM and its human counterpart CYP3A4.

The 6β-hydroxylation of TST, the most commonly used reaction for estimating the activity of CYP3A, has been employed to assess the activities of CYP3A29, CYP3A4 and PLM. Previous studies have demonstrated that CYP3A enzymes in PLM and hepatocytes are capable of oxidizing TST; however, the results were presented only with a mean reaction velocity at a fixed concentration of substrate [8,37]. The kinetic properties of individual CYP3A isoforms in domestic pigs for these activities have received very limited attention. This study reveals that pig CYP3A29 and human CYP3A4 possessed similar metabolic capacity and affinity for TST. Human CYP3A4 displayed a highly concordant result with the report of Carr et al. [38] (K0.5=24.1 μM), but domestic pig CYP3A29 exhibited a notably higher apparent affinity for TST than purified minipig CYP3A29 (K0.5 > 70 μM [39]). These results strongly suggest that domestic pig CYP3A29 could be more similar to human CYP3A4 than minipig CYP3A29 with regard to the metabolism of TST.

For TST 6β-hydoxylation, PLM displayed a relatively higher K0.5 value, which is also consistent with an earlier observation (K0.5=83.6 μM [39]). Currently, the higher K0.5 and lower CLint values for PLM than for CYP3A29 probably indicate that pig CYPs are either inefficient at metabolizing TST or that pigs might produce metabolites other than the 6β-hydoxy product. TST 15β-, 7α-, 6β-, 16α-, 6β-, 2α- and 2β-hydroxylase activities also have been found to be present predominantly in PLM and cultured hepatocytes from domestic pigs [5], which indicates that other CYP isoforms in pigs could be involved in TST metabolism. An additional LC (liquid chromatography)-MS analysis revealed one additional product in PLM incubations. Based on a signal at m/z of 287 for the dehydrogenated metabolite (see Supplementary Figures S1 and S2 available at http://www.bioscirep.org/bsr/031/bsr0310211add.htm) and assuming that the ionization efficiencies were similar to 6β-OHT, we found that the formation of this dehydrogenated product in PLM occurred at a higher rate compared with the rate of formation of the 6β-hydroxylation product. These findings suggest that, besides 6β-OHT, dehydrogenated TST could also be a major product of TST metabolism in PLM. Moreover, the dehydrogenated TST could also be produced by the other CYP isoforms in PLM due to its existence in CYP3A29 incubations at a lower level than in PLM. Therefore the present findings support the need to fully characterize other CYP enzymes in domestic pigs.

NIF, a frequently employed substrate probe used to characterize CYP3A in various model animals, has been shown to be oxidized by CYP3A29 enzymes. CYP3A29 displayed a similar metabolic capacity to CYP3A4 and PLM for NIF oxidation. However, CYP3A29 was proven to have a relatively lower NIF oxidase activity than CYP3A4 for a much lower CLint value. In addition, CYP3A29 demonstrated an apparent lower K0.5 value and much higher CLint value for NIF oxidization compared with PLM, indicating low NIF oxidase activity in PLM. Besides the involvement of multi-enzymes in PLM, the different kinetic parameters for NIF oxidation between CYP3A29 and PLM could also be the result of probable different levels of pNPR and pb5 in the two metabolism systems. However, when compared with TST, NIF should be used as a selective probe drug for pig CYP3A enzyme activity in vitro due to its lower K0.5 values both in CYP3A29 and PLM.

For the oxidation of NIF and 6β-hydroxylation of TST, CYP3A29, CYP3A4 and PLM all displayed sigmoidal or autoactivation kinetic behaviours with Hill coefficients of n>1 (Table 2). Consistent results were previously reported for several other CYP3A enzymes [38]. Sigmoidal kinetics can be interpreted by the allosteric effect hypothesis. CYP3A proteins usually undergo dramatic conformational changes upon ligand binding with an increase in the active site volume, which could increase the adaptability of enzyme to ligands [40,41].

Inhibitors that are capable of selectively inhibiting a particular enzymatic reaction are extremely useful for characterizing the metabolic pathway or the fate of a new drug. KET inhibition of both TST 6β-hydroxylation and NIF oxidation in the three metabolism systems was stronger than that of TAO, and the results are in agreement with earlier results from micropigs [14]. Furthermore, in PLM, KET inhibition of CYP3A activities is very similar to KET inhibition of CYP3A29 and CYP3A4 activity, with IC50 values ranging from 0.02 to 0.2 μM (P > 0.05), which are also highly comparable to those of the corresponding individual isoforms in other mammals (in the 0.1 μM range) [38]. These results confirmed that KET could be a uniformly powerful inhibitor for targeting CYP3A activities in pigs and humans and support the notion that CYP3A29 contributes the major CYP3A activity in PLM. TAO had significantly higher IC50 values towards CYP3A activity in CYP3A29 compared with its effects on CYP3A4 (P<0.05), and similar results were found in minipig and human liver microsomes [42]. In addition, the IC50 values of TAO and KET towards CYP3A activities in PLM were 2–5-fold different than those of CYP3A29 respectively, although the differences did not reach a significant level (P > 0.05), which again suggests that other P450 enzymes were involved in the metabolism of TST and NIF.

CYP3A29 has been shown to metabolize TST and NIF; furthermore, this can be inhibited by TAO and KET, specific inhibitors of human CYP3A4. Accordingly, it is considered that the functional similarities of pig CYP3A29 and human CYP3A4 are due to the high identity of amino acid residues. The amino acid sequence of pig CYP3A29 is 76% similar to that of human CYP3A4. Consequently, CYP3A29 probably shares an overlapping set of substrates with CYP3A4. However, the CYP3A29 and CYP3A4 proteins have been shown to possess different enzymatic properties for NIF, including inhibitory susceptibility to TAO, indicating the likely differences in their protein structures. When compared, the amino acid sequences of the two enzymes with respect to substrate recognition region, the most distinct differences observed were located in the helices F–G region (see Supplementary Figure S3 available at http://www.bioscirep.org/bsr/031/bsr0310211add.htm). Helices F–G were considered as an important region for determining the substrate specificities of CYP3A enzymes [43] due to their function in initial substrate recognition [41,44]. This region contains a number of residues that have been shown by site-directed mutagenesis to have a direct or indirect role in CYP3A4 function. For example, Leu210, was implicated in effector binding as well as the stereo- and regio-selectivity profile of CYP3A4 [45]. Leu211 and Asp214 were implicated in co-operativity of CYP3A4 [45,46]. These sequence divergences located in functional regions are likely to be an explanation for the different enzymatic properties of the CYP3A enzymes with respect to ligands.

In conclusion, this work has demonstrated that domestic pigs have a functionally active CYP3A29 gene that is well expressed in the liver and small intestines and has biochemical properties quite similar to those of the corresponding human enzyme; this similarity implies the probable important role of pig CYP3A29 in the metabolism of xenobiotics and contributes to the idea that pigs are a useful human model in toxicological and pharmacological studies. Some differences were observed between recombinant CYP3A29 and PLM with regard to substrate and inhibitor kinetics. Therefore the other pig CYP isoenzymes should also be cloned, heterologously expressed and further tested for substrate and inhibitor specificities before those probe activities can be employed to assess special CYP isoforms. Furthermore, additional studies are necessary to determine the content of CYP proteins in porcine tissues with specific antibodies raised against recombinant swine CYP proteins. However, the expression and functional characterization of CYP3A29 have provided a basis for developing an in vitro assay to facilitate the evaluation of the toxicity and metabolism of new drugs.

Abbreviations

     
  • CYP

    cytochrome P450

  •  
  • GAPDH

    glyceraldehyde-3-phosphate dehydrogenase

  •  
  • hb5

    human cytochrome b5

  •  
  • hNPR

    human NADPH-P450 reductase

  •  
  • KET

    ketoconazole

  •  
  • mAb

    monoclonal antibody

  •  
  • NIF

    nifedipine

  •  
  • ONIF

    oxidized NIF

  •  
  • pb5

    pig cytochrome b5

  •  
  • PLM

    pig liver microsomes

  •  
  • pNPR

    pig NADPH-P450 reductase

  •  
  • TAO

    troleandomycin

  •  
  • TST

    testosterone

  •  
  • 6β-OHT

    6β-hydroxytestosterone

AUTHOR CONTRIBUTION

Zonghui Yuan defined the research theme. Min Yao designed the methods and experiments, carried out the laboratory experiments, analysed the data, interpreted the results and wrote the paper. Menghong Dai co-designed the real-time PCR and immunoblot experiments, and co-worked on the associated data collection and their interpretation. Zhaoying Liu and Lingli Huang co-designed the metabolic kinetics experiments, and co-worked on the associated data collection and their interpretation. Dongmei Chen contributed to the HPLC analysis. Yulian Wang, Dapeng Peng, Xu Wang and Zhenli Liu co-designed the experiments, and discussed the analyses, interpretation and presentation. All authors have contributed to, seen and approved the manuscript.

We thank Professor F. Peter Guengerich (Vanderbilt University Medical Center, Nashville, TN, U.S.A.) for the gift of pCWori+ and for useful suggestions.

FUNDING

This work was supported by State Basic Research Development Program of China through the 973 Program [grant number 2009CB118800].

References

References
1
Guengerich
 
F. P.
 
Comparisons of catalytic selectivity of cytochrome P450 subfamily enzymes from different species
Chem. Biol. Interact.
1997
, vol. 
106
 (pg. 
161
-
182
)
2
Wrighton
 
S. A.
Stevens
 
J. C.
 
The human hepatic cytochromes P450 involved in drug metabolism
Crit. Rev. Toxicol.
1992
, vol. 
22
 (pg. 
1
-
21
)
3
Kamdem
 
L. K.
Meineke
 
I.
Godtel-Armbrust
 
U.
Brockmoller
 
J.
Wojnowski
 
L.
 
Dominant contribution of P450 3A4 to the hepatic carcinogenic activation of aflatoxin B1
Chem. Res. Toxicol.
2006
, vol. 
19
 (pg. 
577
-
586
)
4
Skaanild
 
M. T.
 
Porcine cytochrome P450 and metabolism
Curr. Pharm. Des.
2006
, vol. 
12
 (pg. 
1421
-
1427
)
5
Donato
 
M. T.
Castell
 
J. V.
Gomez-Lechon
 
M. J.
 
Characterization of drug metabolizing activities in pig hepatocytes for use in bioartificial liver devices: comparison with other hepatic cellular models
J. Hepatol.
1999
, vol. 
31
 (pg. 
542
-
549
)
6
Bader
 
A.
Hansen
 
T.
Kirchner
 
G.
Allmeling
 
C.
Haverich
 
A.
Borlak
 
J. T.
 
Primary porcine enterocyte and hepatocyte cultures to study drug oxidation reactions
Brit. J. Pharmacol.
2000
, vol. 
129
 (pg. 
331
-
342
)
7
Nebbia
 
C.
Dacasto
 
M.
Rossetto Giaccherino
 
A.
Giuliano Albo
 
A.
Carletti
 
M.
 
Comparative expression of liver cytochrome P450-dependent monooxygenases in the horse and in other agricultural and laboratory species
Vet. J.
2003
, vol. 
165
 (pg. 
53
-
64
)
8
Szotakova
 
B.
Baliharova
 
V.
Lamka
 
J.
Nozinova
 
E.
Wsol
 
V.
Velik
 
J.
Machala
 
M.
Neca
 
J.
Soucek
 
P.
Susova
 
S.
Skalova
 
L.
 
Comparison of in vitro activities of biotransformation enzymes in pig, cattle, goat and sheep
Res. Vet. Sci.
2004
, vol. 
76
 (pg. 
43
-
51
)
9
Myers
 
M. J.
Farrell
 
D. E.
Howard
 
K. D.
Kawalek
 
J. C.
 
Identification of multiple constitutive and inducible hepatic cytochrome P450 enzymes in market weight swine
Drug Metab. Dispos.
2001
, vol. 
29
 (pg. 
908
-
915
)
10
Hosagrahara
 
V. P.
Hansen
 
L. K.
Remmel
 
R. P.
 
Induction of the metabolism of midazolam by rifampin in cultured porcine hepatocytes: preliminary evidence for CYP3A isoforms in pigs
Drug Metab. Dispos.
1999
, vol. 
27
 (pg. 
1512
-
1518
)
11
Nannelli
 
A.
Chirulli
 
V.
Longo
 
V.
Gervasi
 
P. G.
 
Expression and induction by rifampicin of CAR- and PXR-regulated CYP2B and CYP3A in liver, kidney and airways of pig
Toxicology
2008
, vol. 
252
 (pg. 
105
-
112
)
12
Messina
 
A.
Nannelli
 
A.
Fiorio
 
R.
Longo
 
V.
Gervasi
 
P. G.
 
Expression and inducibility of CYP1A1, 1A2, 1B1 by beta-naphthoflavone and CYP2B22, 3A22, 3A29, 3A46 by rifampicin in the respiratory and olfactory mucosa of pig
Toxicology
2009
, vol. 
260
 (pg. 
47
-
52
)
13
Witkamp
 
R. F.
Nijmeijer
 
S. M.
Monshouwer
 
M.
Van Miert
 
A. S.
 
The antibiotic tiamulin is a potent inducer and inhibitor of cytochrome P4503A via the formation of a stable metabolic intermediate complexStudies in primary hepatocyte cultures and liver microsomes of the pig
Drug Metab. Dispos.
1995
, vol. 
23
 (pg. 
542
-
547
)
14
Bogaards
 
J. J.
Bertrand
 
M.
Jackson
 
P.
Oudshoorn
 
M. J.
Weaver
 
R. J.
van Bladeren
 
P. J.
Walther
 
B.
 
Determining the best animal model for human cytochrome P450 activities: a comparison of mouse, rat, rabbit, dog, micropig, monkey and man
Xenobiotica
2000
, vol. 
30
 (pg. 
1131
-
1152
)
15
Zuber
 
R.
Anzenbacherova
 
E.
Anzenbacher
 
P.
 
Cytochromes P450 and experimental models of drug metabolism
J. Cell Mol. Med.
2002
, vol. 
6
 (pg. 
189
-
198
)
16
Soucek
 
P.
Zuber
 
R.
Anzenbacherova
 
E.
Anzenbacher
 
P.
Guengerich
 
F. P.
 
Minipig cytochrome P450 3A, 2A and 2C enzymes have similar properties to human analogs
BMC Pharmacol.
2001
, vol. 
1
 pg. 
11
 
17
Nissen
 
P. H.
Wintero
 
A. K.
Fredholm
 
M.
 
Mapping of porcine genes belonging to two different cytochrome P450 subfamilies
Anim. Genet.
1998
, vol. 
29
 (pg. 
7
-
11
)
18
Guengerich
 
F. P.
Martin
 
M. V.
Guo
 
Z.
Chun
 
Y. J.
 
Purification of functional recombinant P450s from bacteria
Methods Enzymol.
1996
, vol. 
272
 (pg. 
35
-
44
)
19
Gutierrez
 
A.
Grunau
 
A.
Paine
 
M.
Munro
 
A. W.
Wolf
 
C. R.
Roberts
 
G. C.
Scrutton
 
N. S.
 
Electron transfer in human cytochrome P450 reductase
Biochem. Soc. Trans.
2003
, vol. 
31
 (pg. 
497
-
501
)
20
Yamazaki
 
H.
Nakano
 
M.
Imai
 
Y.
Ueng
 
Y. F.
Guengerich
 
F. P.
Shimada
 
T.
 
Roles of cytochrome b5 in the oxidation of testosterone and nifedipine by recombinant cytochrome P450 3A4 and by human liver microsomes
Arch. Biochem. Biophys.
1996
, vol. 
325
 (pg. 
174
-
182
)
21
Yantsevich
 
A. V.
Gilep
 
A. A.
Usanov
 
S. A.
 
Electron transfer properties and catalytic competence of cytochrome b5 in the fusion protein Hmwb5-EGFP in reactions catalyzed by cytochrome P450 3A4
Biochemistry
2009
, vol. 
74
 (pg. 
862
-
873
)
22
Omura
 
T.
Sato
 
R.
 
The carbon monoxide-binding pigment of liver microsomes. Evidence for its hemoprotein nature
J. Biol. Chem.
1964
, vol. 
239
 (pg. 
2370
-
2378
)
23
Strobel
 
H. W.
Dignam
 
J. D.
 
Purification and properties of NADPH-cytochrome P-450 reductase
Methods Enzymol.
1978
, vol. 
52
 (pg. 
89
-
96
)
24
Holmans
 
P. L.
Shet
 
M. S.
Martin-Wixtrom
 
C. A.
Fisher
 
C. W.
Estabrook
 
R. W.
 
The high-level expression in Escherichia coli of the membrane-bound form of human and rat cytochrome b5 and studies on their mechanism of function
Arch. Biochem. Biophys.
1994
, vol. 
312
 (pg. 
554
-
565
)
25
Shou
 
M.
Norcross
 
R.
Sandig
 
G.
Lu
 
P.
Li
 
Y.
Lin
 
Y.
Mei
 
Q.
Rodrigues
 
A. D.
Rushmore
 
T. H.
 
Substrate specificity and kinetic properties of seven heterologously expressed dog cytochromes P450
Drug Metab. Dispos.
2003
, vol. 
31
 (pg. 
1161
-
1169
)
26
Skaanild
 
M. T.
Friis
 
C.
 
Characterization of the P450 system in Gottingen minipigs
Pharmacol. Toxicol.
1997
, vol. 
80
 
Suppl. 2
(pg. 
28
-
33
)
27
Puccinelli
 
E.
Gervasi
 
P. G.
La Marca
 
M.
Beffy
 
P.
Longo
 
V.
 
Expression and inducibility by phenobarbital of CYP2C33, CYP2C42, CYP2C49, CYP2B22, and CYP3As in porcine liver, kidney, small intestine, and nasal tissues
Xenobiotica
2010
, vol. 
40
 (pg. 
525
-
535
)
28
Shang
 
H.
Yang
 
J.
Liu
 
Y.
Wei
 
H.
 
Tissue distribution of CYP3A29 mRNA expression in Bama miniature pig by quantitative reverse transcriptase-polymerase chain reaction (RT-PCR)
Xenobiotica
2009
, vol. 
39
 (pg. 
423
-
429
)
29
Mealey
 
K. L.
Jabbes
 
M.
Spencer
 
E.
Akey
 
J. M.
 
Differential expression of CYP3A12 and CYP3A26 mRNAs in canine liver and intestine
Xenobiotica
2008
, vol. 
38
 (pg. 
1305
-
1312
)
30
Bieche
 
I.
Narjoz
 
C.
Asselah
 
T.
Vacher
 
S.
Marcellin
 
P.
Lidereau
 
R.
Beaune
 
P.
de Waziers
 
I.
 
Reverse transcriptase-PCR quantification of mRNA levels from cytochrome (CYP)1, CYP2 and CYP3 families in 22 different human tissues
Pharmacogenet. Genom.
2007
, vol. 
17
 (pg. 
731
-
742
)
31
Lampen
 
A.
Christians
 
U.
Gonschior
 
A. K.
Bader
 
A.
Hackbarth
 
I.
von Engelhardt
 
W.
Sewing
 
K. F.
 
Metabolism of the macrolide immunosuppressant, tacrolimus, by the pig gut mucosa in the Ussing chamber
Br. J. Pharmacol.
1996
, vol. 
117
 (pg. 
1730
-
1734
)
32
Nishi
 
K.
Ishii
 
T.
Wada
 
M.
Amae
 
S.
Sano
 
N.
Nio
 
M.
Hayashi
 
Y.
 
The expression of intestinal CYP3A4 in the piglet model
Transplant. Proc.
2004
, vol. 
36
 (pg. 
361
-
363
)
33
Paine
 
M. F.
Khalighi
 
M.
Fisher
 
J. M.
Shen
 
D. D.
Kunze
 
K. L.
Marsh
 
C. L.
Perkins
 
J. D.
Thummel
 
K. E.
 
Characterization of interintestinal and intraintestinal variations in human CYP3A-dependent metabolism
J. Pharmacol. Exp. Ther.
1997
, vol. 
283
 (pg. 
1552
-
1562
)
34
Olsen
 
A. K.
Hansen
 
K. T.
Friis
 
C.
 
Pig hepatocytes as an in vitro model to study the regulation of human CYP3A4: prediction of drug–drug interactions with 17 alpha-ethynylestradiol
Chem-Biol. Interact.
1997
, vol. 
107
 (pg. 
93
-
108
)
35
Chari
 
R. S.
Collins
 
B. H.
Magee
 
J. C.
DiMaio
 
J. M.
Kirk
 
A. D.
Harland
 
R. C.
McCann
 
R. L.
Platt
 
J. L.
Meyers
 
W. C.
 
Brief report: treatment of hepatic failure with ex vivo pig-liver perfusion followed by liver transplantation
New Engl. J. Med.
1994
, vol. 
331
 (pg. 
234
-
237
)
36
Gerlach
 
J. C.
 
Development of a hybrid liver support system: a review
Int. J. Artif. Organs
1996
, vol. 
19
 (pg. 
645
-
654
)
37
Skaanild
 
M. T.
Friis
 
C.
 
Cytochrome P450 sex differences in minipigs and conventional pigs
Pharmacol. Toxicol.
1999
, vol. 
85
 (pg. 
174
-
180
)
38
Carr
 
B.
Norcross
 
R.
Fang
 
Y.
Lu
 
P.
Rodrigues
 
A. D.
Shou
 
M.
Rushmore
 
T.
Booth-Genthe
 
C.
 
Characterization of the rhesus monkey CYP3A64 enzyme: species comparisons of CYP3A substrate specificity and kinetics using baculovirus-expressed recombinant enzymes
Drug Metab. Dispos.
2006
, vol. 
34
 (pg. 
1703
-
1712
)
39
Anzenbacherova
 
E.
Baranova
 
J.
Zuber
 
R.
Pechova
 
A.
Anzenbacher
 
P.
Soucek
 
P.
Martinkova
 
J.
 
Model systems based on experimental animals for studies on drug metabolism in man: (mini)pig cytochromes P450 3A29 and 2E1
Basic Clin. Pharmacol. Toxicol.
2005
, vol. 
96
 (pg. 
244
-
245
)
40
Ueng
 
Y. F.
Kuwabara
 
T.
Chun
 
Y. J.
Guengerich
 
F. P.
 
Cooperativity in oxidations catalyzed by cytochrome P450 3A4
Biochemistry
1997
, vol. 
36
 (pg. 
370
-
381
)
41
Ekroos
 
M.
Sjogren
 
T.
 
Structural basis for ligand promiscuity in cytochrome P450 3A4
Proc. Natl. Acad. Sci. U.S.A.
2006
, vol. 
103
 (pg. 
13682
-
13687
)
42
Anzenbacher
 
P.
Soucek
 
P.
Anzenbacherova
 
E.
Gut
 
I.
Hruby
 
K.
Svoboda
 
Z.
Kvetina
 
J.
 
Presence and activity of cytochrome P450 isoforms in minipig liver microsomes. Comparison with human liver samples
Drug Metab. Dispos.
1998
, vol. 
26
 (pg. 
56
-
59
)
43
Torimoto
 
N.
Ishii
 
I.
Toyama
 
K.
Hata
 
M.
Tanaka
 
K.
Shimomura
 
H.
Nakamura
 
H.
Ariyoshi
 
N.
Ohmori
 
S.
Kitada
 
M.
 
Helices F-G are important for the substrate specificities of CYP3A7
Drug Metab Dispos.
2007
, vol. 
35
 (pg. 
484
-
492
)
44
Williams
 
P. A.
Cosme
 
J.
Vinkovic
 
D. M.
Ward
 
A.
Angove
 
H. C.
Day
 
P. J.
Vonrhein
 
C.
Tickle
 
I. J.
Jhoti
 
H.
 
Crystal structures of human cytochrome P450 3A4 bound to metyrapone and progesterone
Science
2004
, vol. 
305
 (pg. 
683
-
686
)
45
Harlow
 
G. R.
Halpert
 
J. R.
 
Alanine-scanning mutagenesis of a putative substrate recognition site in human cytochrome P450 3A4. Role of residues 210 and 211 in flavonoid activation and substrate specificity
J. Biol. Chem.
1997
, vol. 
272
 (pg. 
5396
-
5402
)
46
Wang
 
H.
Dick
 
R.
Yin
 
H.
Licad-Coles
 
E.
Kroetz
 
D. L.
Szklarz
 
G.
Harlow
 
G.
Halpert
 
J. R.
Correia
 
M. A.
 
Structure-function relationships of human liver cytochromes P450 3A: aflatoxin B1 metabolism as a probe
Biochemistry
1998
, vol. 
37
 (pg. 
12536
-
12545
)

Supplementary data