In the present study, two antioxidant micromolecular components (L2f-2 and L2f-3) and an antioxidant macromolecular component LB2 were extracted from lotus (Nelumbo nucifera Gaertn.) rhizomes. MS, FTIR (Fourier-transform IR) spectroscopy and NMR were used to identify these compounds. L2f-2 was (+/−)-gallocatechin, L2f-3 was (−)-catechin and LB2 was a polysaccharide–protein complex with a molecular mass of 18.8 kDa. LB2 was identified as a polysaccharide sulfate containing α/β-pyranose and α-furanose according to its FTIR spectrogram. It was composed of mannose, rhamnose, glucose, galactose and xylose with a molar ratio 2:8:7:8:1. The antioxidant components L2f-2, L2f-3 and LB2 strongly inhibited HIV-1 RT (reverse transcriptase) and IN (integrase). LB2 inhibited RT with an IC50 value of 33.7 μM. It also exhibited the highest HIV-1 3′-processing inhibitory activity with an IC50 value of 5.28 μM. Both L2f-2 and L2f-3 up-regulated the expression of IL-2 (interleukin-2) and down-regulated IL-10, while LB2 exhibited positive regulation on IL-2, IL-4 and IL-10. Moreover, L2f-3 and LB2 might inhibit HIV-1 directly by down-regulating TNFα (tumour necrosis factor α). These natural antioxidant components with antiviral and immunoregulatory activities could be potentially important for anti HIV-1 drug development and application to HIV-1 therapy.

INTRODUCTION

Nelumbo nucifera Gaertn is an aquatic deciduous perennial plant native to Asia, New Guinea, Queensland and the Northern Territory. It has been used in the Orient as food and a medicinal herb for over 1500 years. It has astringent, cardiotonic, febrifuge, hypotensive, tonic and vasodilating properties [1]. Previous studies focused on the seeds [2], leaves [3] and rhizome knots [4] of N. nucifera. Studies on rhizomes, the main edible part of lotus, were rare [5]. Lotus rhizome is one of the daily vegetables for many people all over the world. It is worth investigating active components in lotus rhizomes.

AIDS caused by HIV is still one of the lethal diseases. From the latest report of the WHO (World Health Organization) (December 2009), 33.4 million people were newly infected with HIV-1 in 2008 and there were 2.0 million AIDS-related deaths (http://www.unaids.org). There is still no cure for AIDS.

There is evidence that free radical damage contributes to many chronic health problems such as cardiovascular disease, cancer, inflammatory diseases and AIDS [6]. Inflammation occurring in these diseases is believed to be accompanied by the production of free radicals [7]. Oxidative stress plays a significant role in the pathogenesis of HIV-1/AIDS by promoting lymphocyte cell death [8]. Cytokines are critical regulatory factors and play important roles in the immune system. One theory of immune regulation involves homoeostasis between Th1 (T-helper 1) and Th2 activity. The capacity of the immune system to trigger primary Th1 or Th2 CD4+ T-cell responses depends on both the differential patterns of cytokines. Th1 cells drive the type-1 pathway (‘cellular immunity’) to fight viruses and other intracellular pathogens, and to eliminate cancerous cells. Th2 cells drive the type-2 pathway (‘humoral immunity’) and up-regulate antibody production to fight extracellular organisms [9]. Secretion of IFNγ (interferon γ) and IL-2 (interleukin-2) by CD4+ Th1 lymphocytes [as well as by CD8+ T-cells and NK (natural killer) cells] triggers macrophage activation and a potent response against intracellular pathogens, whereas Th2 cells typically produce IL-4, IL-6 and IL-10 driving humoral immunity such as Ig production and isotype switch from IgG to IgE in cells [10]. Many reports indicate an immune pathway shift from Th1 to Th2 after infection by HIV-1 [11]. All these studies indicate a close relationship among oxidative damage, immune imbalance and AIDS which suggest that antioxidants might play an important role in the treatment of AIDS.

Natural products constitute an important source of drugs. Polyphenols, especially phenolic acids, flavanols and flavonols, have been considered as active components in the prevention of cardiovascular diseases, cancers, neurodegenerative diseases or diabetes [12]. Epidemiological and in vitro studies strongly suggest that foods containing phytochemical antioxidants have potentially protective effects against many diseases, including cancer, diabetes and cardiovascular diseases [13]. Natural antioxidant products with complex effects may help reduce oxidative damage and maintain immunological balance in AIDS-infected people. Some catechin derivatives have been known to be inhibitors of HIV-1 RT (reverse transcriptase) for over 20 years [14]. Some investigations indicate that catechin derivatives can inhibit HIV-1 replication with multiple mechanisms of action including inhibiting HIV-1 entry into target cells by blocking HIV-1 envelope glycoprotein-mediated membrane fusion [15]. However, few studies have been focused on the effects of catechins on HIV-1 PR (protease) and IN (integrase).

The aim of this study was to isolate potential natural antioxidant components from lotus rhizomes. Their effects on HIV-1 key enzymes and the regulation of main cytokines were studied.

MATERIALS AND METHODS

Reagents

BHA (butylated hydroxyanisole), TBA (thiobarbituric acid), L-ascorbic acid, Folin–Ciocalteau reagent, AZT-TP (azidothymidine triphosphate) and pepstatin A were obtained from Sigma. AAPH [2′,2-azobis-(2-amidinopropane) dihydrochloride] was purchased from Wako. Raltegravir and salicyl hydrazide were gifts from Professor Qiao (Center for AIDS Research, Nankai University, Tianjin, People's Republic of China). The macroporous adsorption resin NKA was purchased from the Chemical Plant of Nankai University, Tianjin, People's Republic of China. Sephadex LH-20 was purchased from Hui De Yi. The TRIzol® kit and RT–PCR kit were purchased from Dingguo Biotechnology Development Center. 2×SYBR Green Realtime PCR Master Mix was from Toyobo. All other chemicals were of the highest quality available.

Animals

Male BALB/c mice, 4–6 weeks of age and with a body mass of 20±2 g, were purchased from a local registered animal supplier. The mice were housed under normal laboratory conditions (25±2°C, 12 h light/12 h dark) with free access to standard rodent chow and water. The animal experiments were performed in compliance with guidelines for animal research laid down by Nankai University.

Sample preparation

Lotus (N. nucifera Gaertn.) rhizomes called ‘Piaohua’ which were produced in Tianjin, China were bought from a local market in October. The lotus rhizomes were cleaned thoroughly with water to remove residual compost, cut into small pieces and crushed. The juice was decanted and centrifuged at 2000 g/min for 10 min to remove the precipitate. The supernatant was condensed and freeze-dried to form the crude extract named L.

The macroporous resin named NKA was used for chromatography of the crude extract L. NKA is composed of cross-linked polystyrene. It has no polarity. The bead size ranges from 0.3 to 1.0 mm, the surface area is 570–590 m2/g and the average pore diameter is 200–220 Å (1 Å≡0.1 nm). L was dissolved (500 mg/ml) in distilled water. The solution was chromatographed on a column of macroporous resin (2.5 cm×35 cm). The inactive fraction named L1 was eluted with distilled water. The resin was then eluted with 30% (v/v) ethanol, and the resulting fraction was name L2. Finally, the resin was regenerated with 90% (v/v) ethanol. L2 was chromatographed on a column of Sephadex LH-20 that was eluted with distilled water. The fractions collected were named L2a, L2b and L2c. The gel was then eluted with 30% (v/v) ethanol. The resulting fraction was named L2d. Then, the gel was eluted with 60% (v/v) ethanol and the collected fractions were named L2e, L2f and L2g. Finally, 50% (v/v) acetone was added to regenerate the gel. The fraction L2f was purified in a LabAlliance HPLC system, including two Series III pumps, a 500 absorbance detector set at 280 nm, and connected to a Cs420x Hardware integrator. A reversed-phase Merck C18 ODS column (250 mm×10 mm, 12 μm) was used. The column temperature was set at 30°C. Elution was carried out with 30% methanol at a flow rate of 3 ml/min.

Then 100 g of crude extract L was dissolved in 200 ml of distilled water. The solution was kept at 4°C for 12 h after adding 200 ml of ethanol. The supernatant was transferred to another clean beaker and then 200 ml of ethanol was added. The resulting solution was kept at 4°C for 12 h. The precipitate named LB was collected. LB was chromatographed on a column of Sephadex G-75 to yield two peaks named LB1 and LB2. LB2 was analysed by HPLC and FTIR (Fourier-transform IR).

Assay for inhibition of erythrocyte haemolysis

Erythrocyte haemolysis was mediated by peroxyl radicals in the assay system [16]. The percentage of haemolysis was calculated using the equation (1−A/B)×100%. L-Ascorbic acid was used as a positive control.

Assay of lipid peroxidantion using kidney homogenates

BHA was used as a positive control. The inhibition ratio was calculated using the following equation: inhibition ratio (%)=(AA1)/A×100%, where A is the absorbance of the control, and A1 is the absorbance of the test sample [17].

Assay of HIV-1 RT inhibitory activity

Samples were tested for RT inhibitory activity against a purified recombinant HIV-1 RT (Merck) using the cell-free RT colorimetric kit (Roche Diagnostics). The screening assay for inhibitors was performed as described in the protocol included with the kit [18]. The standard RT inhibitor AZT-TP was used as a positive control.

 
formula

where A0 is the absorbance of the system with RT but without any sample; As is the absorbance of the system with RT and sample; Ab is the absorbance of the system without RT and sample.

Assay of HIV-1 PR inhibitory activity

Recombinant HIV-1 PR of Escherichia coli origin was used [19] in this assay. Pepstatin A exhibited higher PR inhibition and stability than IDV (indinavir) and RTV (ritonavir) in our previous studies. It was also a positive control in many studies that focused on PR inhibitor screening [20,21]. In this assay, the blank was the culture without IPTG (isopropyl β-D-thiogalactoside), the positive control was pepstatin A and the negative control was the culture with IPTG but without any samples.

The growth curves are shown as y=k×lnx+b

where is A490 and x is the incubation time.

 
formula

where K0 is the slope of the growth curve of bacteria with IPTG but without sample, Ks is the slope of the growth curve of bacteria with IPTG and sample and Kb is the slope of the growth curve of bacteria without IPTG and sample.

Assay for HIV-1 IN inhibitory activity

Two site-directed mutageneses F185K/C280S were induced into the full-length IN to increase its solubility by overlapping PCR [22]. The upstream fragment of IN was amplified by Primer 1 and Primer 4, whereas the downstream fragment was amplified by Primer 2 and Primer 3. The full-length IN was amplified by Primer 1 and Primer 2 with upstream and downstream fragments: P1: 5′-CAGCATATG(Nde I)TTTTTAGATGGAATAGATAAGGCCCAAGATGAAC-3′; P2: 5′-ATAGGATCC(EcoR I)TTACTAATCCTCATCCTGTCTACTTGCCACAGA(C280S)ATCATCACCTGCC-3′; P3: 5′-CCACAATAAA(F185K)AAAAGAAAAGGGGGGATTGGG-3′; P4: 5′-CCCAATCCCCCCTTTTCTTTTTTT(F185K)ATTGTG G-3′.

The full-length IN1–288 (F185K/C280S) was ligated into pET-28a (Novagen) and then transformed into E. coli BL21 (DE3). Recombinant His-tag HIV-1 IN was purified by Ni-NTA (Ni2+-nitrilotriacetate), then freeze-dried and stored at −70°C.

The LTR (long terminal repeat) sequence was cloned into pUC19 to make the substrate plasmid pLTR. pLTR was amplified in DH5α and the plasmids were purified by using EasyPure Plasmid MiniPrep Kit. The reaction system contained 20 mM Tris/HCl (pH 8.0), 2 mM MnCl2, 5 mM 2-mercaptoethanol, 10 pmol of HIV-1 IN and 200 ng pLTR. The mixture was incubated at 37°C for 30 min and tested by using electrophoresis. The results were analysed by Labworks Image Acquisition and Analysis software Version 4.5.00.0.

LTR-P1: 5′-CAGTGGATCC(EcoR I)GACTG(3′-process site)TGGAAGGGCTAATTTGGTC-3′; LTR-P2: 5′-CGACGAATTC(Bam H I)GACTG(3′-process site)CTAGAGATTTCCAC-3′.

The positive control was Raltegravir. The negative control was Tris/HCl. The blank was the mixture without enzyme:

 
formula

where Is is the IOD (inhibition of delay) of (ccDNA+lDNA+ocDNA)/lDNA with sample, I0 is the IOD of (ccDNA+lDNA+ocDNA)/lDNA with enzyme but without any sample and Ib is the IOD of (ccDNA+lDNA+ocDNA)/lDNA without enzyme and sample.

Reltegravir, a diketoacid derivative, is the unique anti-HIV-1 IN drug approved by the U.S. FDA (Food and Drug Administration). Diketoacid derivatives also exhibit some 3′-process activity besides strand transfer inhibitory activity, and have been used as positive controls in many 3′-process assays [23,24]. In the present study, a standard 3′-process inhibitor, salicylhydrazide, was also used as a positive control to confirm the feasibility of this model [25].

Real-time PCR

A total of 20 mice were divided randomly into four groups. Control mice (group A) were treated with 0.9% (w/w) NaCl by injection. L2f-2 mice (group B) were treated with L2f-2 (50 mg/kg of body weight). L2f-3 mice (group C) were treated with L2f-3 (50 mg/kg). LB2 mice (group D) were treated with LB2 (50 mg/ml). All mice were injected once a day for 7 days. On the eighth day, all mice received an intraperitoneal injection of purified LPS (lipopolysaccharide; derived from E. coli O55:B5; Sigma) at a dose of 3 mg/kg of body weight. All mice were killed 12 h later and the total splenic RNA was isolated by using the TRIzol® kit. Ascitic macrophages of mice in group D were collected and the total RNA was isolated by using the TRIzol® kit.

For reverse transcription, 1 μg of total RNA was heated at 65°C for 5 min. Reverse transcription was conducted at 37°C for 30 min. The reaction mixture was composed of 1–5 μg of total RNA, 0.5 mM dNTPs, 50 ng of oligo (dT)16 primer, reverse transcription buffer and 3 units of RT. RT was inactivated by heating at 95°C for 5 min.

The 25 μl Real-time PCR system contained 1 μl of upstream primer (500 pmol), 1 μl of downstream primer (500 pmol), 1 μl of cDNA, 7 μl of double-distilled water and 10 μl of 2×SYBR Green Realtime PCR Master Mix. The following thermocycler programme was used for real-time PCR: 1 min preincubation at 95°C, followed by 40 cycles of incubation at 94°C for 15 s, 55°C for 15 s, 72°C for 45 s. After amplification, melt curves were tested in these reactions every 0.5°C. The primers of IL-2, IL-4, IL-6, IL-10, IFNγ, TNFα (tumour necrosis factor α) and GAPDH (glyceraldehyde-3-phosphate dehydrogenase) are shown in Table 1.

Table 1
Primers used for real-time PCR
GeneSequenceProductLength (bp)
IL-2 Upstream 5′-TGAACTTGGACCTCTGCG-3′ 220 
 Downstream 5′-AGGGCTTGTTGAGATGATGC-3′  
IL-4 Upstream 5′-TCCTGCTCTTCTTTCTCG-3′ 537 
 Downstream 5′-ATGCTCTTTAGGCTTTCC-3′  
IL-6 Upstream 5′-TTCTTGGGACTGATGCTG-3′ 380 
 Downstream 5′-CTGGCTTTGTCTTTCTTGTT-3′  
IL-10 Upstream 5′-ACCAAAGCCACAAAGCAG-3′ 249 
 Downstream 5′-GGAGTCGGTTAGCAGTATG-3′  
IFNγ Upstream 5′-TGAGACAATGAACGCTAC-3′ 142 
 Downstream 5′-TTCCACATCTATGCCACT-3′  
TNFα Upstream 5′-CTGTGAAGGGAATGGGTGTT-3′ 384 
 Downstream 5′-CAGGGAAGAATCTGGAAAGGTC-3′  
GAPDH Upstream 5′-TCAACGGCACAGTCAAGG-3′ 470 
 Downstream 5′-ACCAGTGGATGCAGGGAT-3′  
GeneSequenceProductLength (bp)
IL-2 Upstream 5′-TGAACTTGGACCTCTGCG-3′ 220 
 Downstream 5′-AGGGCTTGTTGAGATGATGC-3′  
IL-4 Upstream 5′-TCCTGCTCTTCTTTCTCG-3′ 537 
 Downstream 5′-ATGCTCTTTAGGCTTTCC-3′  
IL-6 Upstream 5′-TTCTTGGGACTGATGCTG-3′ 380 
 Downstream 5′-CTGGCTTTGTCTTTCTTGTT-3′  
IL-10 Upstream 5′-ACCAAAGCCACAAAGCAG-3′ 249 
 Downstream 5′-GGAGTCGGTTAGCAGTATG-3′  
IFNγ Upstream 5′-TGAGACAATGAACGCTAC-3′ 142 
 Downstream 5′-TTCCACATCTATGCCACT-3′  
TNFα Upstream 5′-CTGTGAAGGGAATGGGTGTT-3′ 384 
 Downstream 5′-CAGGGAAGAATCTGGAAAGGTC-3′  
GAPDH Upstream 5′-TCAACGGCACAGTCAAGG-3′ 470 
 Downstream 5′-ACCAGTGGATGCAGGGAT-3′  

The 2−ΔΔCt method [26] was used to analyse the results. GAPDH was the internal control. For the ΔΔCt calculation to be valid, the amplification efficiencies of the target and reference must be approximately the same. Amplification of cDNA synthesized from different amounts of RNA. The efficiency of amplification of the target gene (IL-2, IL-4, IL-6, IL-10, IFNγ and TNFα) and internal control (GAPDH) was examined using real-time PCR. ΔCt (Ct target geneCt.GAPDH) was calculated for each cDNA dilution. The results were fit using least-squares linear regression analysis (n=3). If the absolute value of the slope is close to zero, the efficiencies of the target and reference genes are similar, and the ΔΔCt calculation for the relative quantification of target may be used.

Statistical analysis of data

All experiments were run in triplicate. The average value and S.D. were calculated. To determine whether there were any differences between the activities of samples, one-way ANOVA was applied to the results followed by the Tukey test. P<0.05 was considered to represent a statistically significant difference.

RESULTS

Isolation of L2f-2, L2f-3 and LB2 from lotus rhizomes

L2f-2 and L2f-3 were well separated on HPLC. MS analyses showed that the m/z [M–H]- of L2f-2 was 305.1 when tested with EI-MS (electron ionization MS). From the results it can be concluded that its molecular mass was 306.1 Da with a molecular formula of C15H14O7. According to its 1H NMR spectrum, it can be concluded that L2f-2 was gallocatechin (Figure 1a). L2f-3 was identified as catechin based on the results of HPLC, LC-ESI–MS/MS (liquid chromatography electrospray ionization tandem MS) and IR spectroscopy (Figure 1b) [27,28]. The yields of L2f-2, L2f-3 and LB2 were 0.65%, 0.39% and 2.20% respectively from crude extract L.

Structures of L2f-2 (a) and L2f-3 (b)

Figure 1
Structures of L2f-2 (a) and L2f-3 (b)
Figure 1
Structures of L2f-2 (a) and L2f-3 (b)

L2f-2 (gallocatechin): trans-2-(3,5,7-trihydroxyphenyl)-3,4-dihydro-1[2H]-benzopyran-3,5,7-triol freeze-dried powder (20 mg). HPLC Rt 5.4 min. 1H-NMR (600 MHz, DMSO-d6) δ2.34 (dd, 1H, J=7.8, 7.8 Hz), 2.59 (dd, 1H, J=4.8, 4.2 Hz), 3.77 (dd, 1H, J=7.2, 7.2 Hz), 4.42 (d, 1H, J=7.2 Hz), 5.69 (s, 1H), 5.88 (s, 1H), 6.24 (s, 3H); LRMS (EI) 306 [M+].L2f-3 (catechin): trans-2-[3,4-dihydroxyphenyl]-3,4-dihydro-1 [2H]-benzopyran-3,5,7-triol freeze-dried powder (10 mg). HPLC Rt 12.1 min. [α]22D-42.0 (c 0.1, acetone). 1H-NMR (600 MHz, DMSO-d6) δ2.34 (dd, 1H, J=8.4, 7.8 Hz), 2.64 (dd, 1H, J=4.8, 5.4 Hz), 3.80 (dd, 1H, J=7.2, 7.2 Hz), 4.47 (d, 1H, J=7.8 Hz), 5.69 (s, 1H), 5.88 (s, 1H), 6.58–6.71 (m, 3H); FTIR (potassium bromide) 1032, 1147, 1468, 1522, 1627 and 3397 cm−1.

LB2 was a polysaccharide–protein complex with a molecular mass of 18.8 kDa. It was composed of mannose, rhamnose, glucose, galactose and xylose with a molar ratio 2:8:7:8:1. LB2 was identified as a polysaccharide sulfate containing α/β-pyranoid and α-furanoid monose by FTIR (Figure 2a). The wide peak at 3384 cm−1 represented the vibrations of O–H, while peaks at 2900 and 1398 cm−1 represented the stretching and angular vibrations of C–H which indicated that LB2 was a polysaccharide. The vibrations at 1680 and 1633 cm−1 were due to C=C and C=O bonds. Peaks from 990 to 1200 cm−1 and at 835 cm−1 were vibrations of α/β-pyranose, while peak at 802 cm−1 was the vibration of α-furanose. The vibrations at 618 cm−1 indicated that there were sulfuric acid ester linkages in this polysaccharide. The peak at 518 cm−1 represented the vibrations of C-(CH2)n (n≥4).

FTIR spectrum (a) and anti-HIV-1 RT activity (b) of LB2

Figure 2
FTIR spectrum (a) and anti-HIV-1 RT activity (b) of LB2
Figure 2
FTIR spectrum (a) and anti-HIV-1 RT activity (b) of LB2

Antioxidant activities of components from lotus rhizomes

The antioxidant activities of the extraction increased along with the purification. L2f-2, L2f-3 and LB2 showed strong antioxidant potencies (Table 2).

Table 2
Inhibitory activities of samples on erythrocyte haemolysis and lipid peroxidation

Values are means±S.D. (n=3). Different superscripts indicate statistically significant difference (P<0.05) in inhibitory rate between fractions at the same concentration when the results were analysed by ANOVA followed by the Tukey test.

Concentration (μg/ml)SampleInhibition of erythrocyte haemolysis (%)Inhibition of lipid peroxidation (%)
250 65.62±1.05 52.62±2.87b 
 LB 21.27±2.10 27.22±2.92a 
 LB2 72.26±0.81 83.25±1.61c 
50 25.12±1.85 15.97±1.78a 
 L2 61.78±3.55 93.77±0.61c 
 L2f 70.47±2.11 80.21±1.52b 
 L2f-2 82.35±1.27 94.20±0.58c 
 L2f-3 91.69±0.69 96.38±0.67c 
50 Positive control 90.53±1.47 84.40±0.72b 
– Negative control 13.40±1.98 – 
Concentration (μg/ml)SampleInhibition of erythrocyte haemolysis (%)Inhibition of lipid peroxidation (%)
250 65.62±1.05 52.62±2.87b 
 LB 21.27±2.10 27.22±2.92a 
 LB2 72.26±0.81 83.25±1.61c 
50 25.12±1.85 15.97±1.78a 
 L2 61.78±3.55 93.77±0.61c 
 L2f 70.47±2.11 80.21±1.52b 
 L2f-2 82.35±1.27 94.20±0.58c 
 L2f-3 91.69±0.69 96.38±0.67c 
50 Positive control 90.53±1.47 84.40±0.72b 
– Negative control 13.40±1.98 – 

HIV-1 RT inhibitory activity

L2f-2 and L2f-3 inhibited RT efficiently with the IC50 values of 10.41 and 9.58 μM (results not shown), while the IC50 value of the standard RT inhibitor AZT-TP was 0.082 μM. LB2 showed RT inhibitory activity with the IC50 value as 33.70 μM (Figure 2b). The inhibitory rate of LB2 was concentration-dependent.

HIV-1 PR inhibitory activity

L2f-2 and L2f-3 showed higher PR inhibitory rates than pepstatin A. LB2 did not exhibit any inhibitory activity on PR in this assay (Table 3).

Table 3
Inhibitory effects of L2f-2, L2f-3, LB and pepstatin A on HIV-1 PR

Values are means±S.D. (n=3). Different superscripts indicate statistically significant differences (P<0.05) in inhibitory rate between fractions when the results are analysed by ANOVA followed by the Tukey test.

Inhibition of HIV-1 PR (%)
SampleDose of sample…70 μg/ml140 μg/ml
L2f-2  17.61±1.33e − 
L2f-3  15.67±1.92d − 
LB2  0a 0a 
Pepstatin A  7.36±1.28b 11.46±2.01c 
Inhibition of HIV-1 PR (%)
SampleDose of sample…70 μg/ml140 μg/ml
L2f-2  17.61±1.33e − 
L2f-3  15.67±1.92d − 
LB2  0a 0a 
Pepstatin A  7.36±1.28b 11.46±2.01c 

HIV-1 IN inhibitory activity

IN exhibited 3′-processing activity on pLTR through cutting ccDNA into lDNA. IN showed processing activity at 3 pmol and plasmid degraded after dealing with 300 pmol of IN. So 30 pmol was chosen as the most appropriate IN concentration (Figure 3a).

HIV-1 IN assay

Figure 3
HIV-1 IN assay

(a) 3′-Processing activity of HIV-1 IN on substrate plasmid pLTR (1, 30 of pmol IN; 2, 0 of pmol IN; 3, 300 of pmol IN; 4, 3 of pmol IN). (b) The effect of different concentrations of LB2 on the 3′-processing activity of HIV-1 IN (1, blank/without IN; 2, negative control/without LB2; 3, 312.5 nM LB2; 4, 625 nM LB2; 5, 1.25 μM LB2; 6, 2.5 μM LB2; 7, 5 μM LB2; 8, 10 μM LB2; 9, 20 μM LB2). (c) Inhibitory rate (%) of raltegravir and salicylhydrazide on HIV-1 IN.

Figure 3
HIV-1 IN assay

(a) 3′-Processing activity of HIV-1 IN on substrate plasmid pLTR (1, 30 of pmol IN; 2, 0 of pmol IN; 3, 300 of pmol IN; 4, 3 of pmol IN). (b) The effect of different concentrations of LB2 on the 3′-processing activity of HIV-1 IN (1, blank/without IN; 2, negative control/without LB2; 3, 312.5 nM LB2; 4, 625 nM LB2; 5, 1.25 μM LB2; 6, 2.5 μM LB2; 7, 5 μM LB2; 8, 10 μM LB2; 9, 20 μM LB2). (c) Inhibitory rate (%) of raltegravir and salicylhydrazide on HIV-1 IN.

LB2 showed the highest IN inhibitory activity with an IC50 value of 5.28 μM and its inhibitory rate was concentration-dependent (Figure 3b). The IC50 values of L2f-2 and L2f-3 were 412.45 and 432.40 μM (results not shown), while the IC50 values of standard IN inhibitors Reltegravir and salicyl hydrazide were 686.17 and 145.86 μM respectively (Figure 3c).

Immunoregulation of HIV-1-related cytokines

The absolute values of the slopes for IL-2, IL-6 and IL-10 (Figure 4a) were 0.072, 0.062 and 0.020 respectively, while the absolute values of the slopes for IL-4, TNFα and IFNγ (Figure 4b) were 0.065, 0.060 and 0.093 respectively. For all the genes analysed, the absolute values of the slopes were close to 0, which indicated that the amplification efficiency of the target genes were in accordance with GAPDH, and the ΔΔCt calculation for the relative quantification of target could be used.

Feasibility of target genes analysed with GAPDH using the ΔΔCt method

Figure 4
Feasibility of target genes analysed with GAPDH using the ΔΔCt method

(a) IL-2, IL-6 and IL-10; (b) IL-4, TNFα and IFNγ. Results represent means±S.D. (n=3).

Figure 4
Feasibility of target genes analysed with GAPDH using the ΔΔCt method

(a) IL-2, IL-6 and IL-10; (b) IL-4, TNFα and IFNγ. Results represent means±S.D. (n=3).

Both L2f-2 and L2f-3 up-regulated the transcription of IL-2 and IL-6 but down-regulated the expression of IL-10. The effect of L2f-2 on TNFα was different from that of L2f-3. L2f-2 up-regulated the expression of TNFα, while L2f-3 exhibited the opposite effect. LB2 increased mRNA levels of IL-2, IL-4 and IL-10 but decreased that of TNFα (Table 4).

Table 4
Effects of L2f-2, L2f-3 and LB2 on the expression of target genes (n=5)
SampleGeneΔCt*ΔΔCt2−ΔΔCt
L2f-2 IL-2 2.37±0.07 −2.11 4.317 
 IL-4 6.66±0.99 −0.08 1.059 
 IL-6 2.33±0.03 −1.52 2.868 
 IL-10 9.75±1.58 1.17 0.444 
 IFNγ 6.59±0.99 0.23 0.853 
 TNFα 3.99±1.07 −0.99 1.986 
L2f-3 IL-2 2.81±0.08 −1.67 3.182 
 IL-4 6.73±1.89 −0.01 1.007 
 IL-6 2.80±0.17 −1.05 2.071 
 IL-10 9.65±0.14 1.07 0.476 
 IFNγ 6.01±0.65 −0.35 1.272 
 TNFα 5.79±0.19 0.55 0.574 
LB2 IL-2 6.15±0.21 −0.67 1.591 
 IL-4 10.85±2.20 −1.22 2.329 
 IL-6 4.53±0.87 0.07 0.953 
 IL-10 5.23±0.77 −0.79 1.729 
 IFNγ 9.16±2.05 0.47 0.720 
 TNFα 6.20±1.52 0.65 0.637 
SampleGeneΔCt*ΔΔCt2−ΔΔCt
L2f-2 IL-2 2.37±0.07 −2.11 4.317 
 IL-4 6.66±0.99 −0.08 1.059 
 IL-6 2.33±0.03 −1.52 2.868 
 IL-10 9.75±1.58 1.17 0.444 
 IFNγ 6.59±0.99 0.23 0.853 
 TNFα 3.99±1.07 −0.99 1.986 
L2f-3 IL-2 2.81±0.08 −1.67 3.182 
 IL-4 6.73±1.89 −0.01 1.007 
 IL-6 2.80±0.17 −1.05 2.071 
 IL-10 9.65±0.14 1.07 0.476 
 IFNγ 6.01±0.65 −0.35 1.272 
 TNFα 5.79±0.19 0.55 0.574 
LB2 IL-2 6.15±0.21 −0.67 1.591 
 IL-4 10.85±2.20 −1.22 2.329 
 IL-6 4.53±0.87 0.07 0.953 
 IL-10 5.23±0.77 −0.79 1.729 
 IFNγ 9.16±2.05 0.47 0.720 
 TNFα 6.20±1.52 0.65 0.637 

Ct=Ctarget gene-Ct GAPDH (amplification from the same cDNA).

†ΔΔ

CtCt treat groupCt control group.

DISCUSSION

Purification of the antioxidant components from N. nucifera

In traditional methods, an array of organic agents such as chloroform, ethyl acetate and diethyl ether must be used to purify natural products with a low molecular mass from crude samples [29]. All these solvents are harmful. Recently, natural product extraction focused on ‘water-extraction’ [30]. In the present study, an improved method was developed to purify active compounds using safer solvents such as water and ethanol.

The most extensively used synthetic antioxidants, such as BHA, and BHT (butylated hydroxytoluene), have restricted use in food and have been suspected to cause liver damage and carcinogenesis [31]. The natural products L2f-2, L2f-3 and LB2 exhibited good water-solubility. They could be absorbed easily by the human body that makes them more valuable than chemosynthetic oleophilic antioxidants.

Most researches focused on the antioxidant potency of N. nucifera [4], while few reports studied the antioxidant components purified from the plant [32,33]. In the present study, the antioxidant components catechin and gallocatechin from lotus rhizome were first purified by a quick and simple method. The yields of catechin and gallocatechin in lotus rhizomes extracted in the present study were 0.024% and 0.037%, which were 10-fold higher than those reported by other researchers [34]. Lotus rhizomes could be the main catechin source and the basic anti-aging food for human consumption. The antioxidative activity of green tea-derived polyphenols known as catechins has been extensively studied [35]. In contrast, researches on catechins from lotus rhizome were not intensive. Fewer papers focused on the purification and identification of catechins from lotus rhizomes. Many antioxidant polysaccharides have been found in fungi [36]. These polysaccharides were composed mainly of glucose [37]. A polysaccharide–protein complex named LB2 from lotus rhizomes was composed mainly of galactose and rhamnose in accordance with the results from other reports on lotus [38].

Inhibitory activities torwards key HIV-1 enzymes

Catechin and its derivatives have been studied for their RT inhibition. Epicatechin gallate from Camellia sinensis was reported to show RT inhibitory activity with an IC50 value of 2.3×10−2–4.6×10−2 μM [14]. Geraniin from Phyllanthus amarus could also inhibit RT with an IC50 value of 1.9 μM. Its RT inhibitory activity was 1000 times higher than the standard RT inhibitor named AZT-TP [40]. It has been reported that the hydroxide groups in ring B of flavones contributed to their RT inhibitory activities [41]. These natural catechin-derived compounds could also inhibit the mutant RT (A17) that has a higher potency than most synthetic inhibitors [42]. L2f-2 and L2f-3 were catchins from N. nucifera Gaertn. They potently inhibited RT.

On the contrary, research into the effect of catechin on PR and IN were rare. IN is an ideal target for anti-HIV therapy. But the agents against IN were developed so slowly that there was only one drug against it named Raltegravir approved by FDA in 32 anti-HIV drugs. Proper screening models were important for drug development. In the present study, a novel 3′-process model was established for IN inhibition screening.

Polysaccharide–protein complex LB2 showed very strong inhibitory activities not only on RT but also on IN. LB2 might not be absorbed easily because it is a macromolecular complex. In the present study, the intracellular concentration of LB2 achieved might be too low to inhibit PR. Therefore, developing a new screening model for macromolecular samples will be our next target. It is valuable that anti-HIV potencies of the natural antioxidant components from N. nucifera Gaertn. were investigated for their inhibition of RT, PR and IN.

Immunoregulation of HIV-1 related cytokines

IL-2 is necessary during T-cell development in the thymus for the maturation of a unique subset of T-cells termed regulatory T-cells (T-regs). It facilitates the production of Igs made by B-cells and induces the differentiation and proliferation of NK cells [43]. L2f-2 (gallocatechin) markedly increased the expression level of IL-2 (over 4-fold increase over control group) indicating that it acted as an activator of IL-2 in immunoreaction. L2f-3 (catechin) increased the level of IL-2 3-fold. In terms of host response to a foreign pathogen, IL-6 has been shown, in mice, to be required for resistance against the bacterium Streptococcus pneumoniae [44]. Treatment with L2f-2 brought about a 2.9-fold augmentation in the level of IL-6. L2f-2 (gallocatechin) was more active than L2f-3 (catechin) which effected 2.1-fold elevation. IL-10 down-regulates the expression of Th1 cytokines, MHC class II antigens and co-stimulatory molecules in macrophages. It is capable of inhibiting the synthesis of pro-inflammatory cytokines such as IL-2 made by Type 1 Th cells. IL-10 also displays potent abilities to suppress the antigen presentation capacity of antigen presenting cells. It is released by cytotoxic T-cells to inhibit the actions of NK cells during the immune response to viral infection [45]. TNFα is another affinitive cytokine to HIV-1. The expressive level of TNFα in immunocytes could be up-regulated after HIV-1 infection [46]. L2f-3 and LB2 might inhibit HIV-1 by down-regulating TNFα directly. LB2 exhibited positive regulation on IL-2, IL-4 and IL-10. It could improve the inhibitory state of cytokines in HIV-1 sufferers and balance the immune system.

Co-existence of inhibitory activity towards HIV enzymes and antioxidant activity in lotus rhizome components

Oxidative stress plays a significant role in the pathogenesis of HIV-1/AIDS, by promoting death of lymphocytes [8]. Accentuation of immunodeficiency in HIV-infected individuals with micronutrient deficiency increases the risk for secondary infections as well as accelerates the onset of chronic AIDS. Supplementation with antioxidants offers a safe and economic treatment to slow the progression of HIV infection. [47]. But the direct relationship between antioxidant and anti-HIV-1 activities needs further investigation. In the present study, antioxidant activity was used to screen and select natural compounds from lotus rhizomes. It was found that these antioxidant compounds could inhibit HIV-1 enzymes directly. With the presence of antioxidant activity, these natural compounds from lotus rhizomes may have a better potential for AIDS treatment and adjuvant therapy.

Conclusions

In the present study, natural products from N. nucifera rhizomes were examined for their potencies to counter oxidation, inhibit key HIV-1 enzymes and affect immune regulation. Most chemically synthetic HIV-1 inhibitors could not deal with the mutant virus. Natural products with multiple anti-HIV-1 effects may circumvent this disadvantage. Therefore, the present investigation may be important to anti-HIV-1 drug development and application of natural products in HIV-1 therapy.

Abbreviations

     
  • AZT-TP

    azidothymidine triphosphate

  •  
  • BHA

    butylated hydroxyanisole

  •  
  • FDA

    Food and Drug Administration

  •  
  • FTIR

    Fourier-transform IR

  •  
  • GAPDH

    glyceraldehyde-3-phosphate dehydrogenase

  •  
  • IFNγ

    interferon γ

  •  
  • IL-2

    interleukin-2

  •  
  • IN

    integrase

  •  
  • IOD

    inhibition of delay

  •  
  • IPTG

    isopropyl β-D-thiogalactoside

  •  
  • LTR

    long terminal repeat

  •  
  • NK

    natural killer

  •  
  • PR

    protease

  •  
  • RT

    reverse transcriptase

  •  
  • Th1

    T-helper 1

  •  
  • TNFα

    tumour necrosis factor α

AUTHOR CONTRIBUTION

Yun Jiang and Fang Liua conceived the project and designed the experiments; Ning Li was responsible for compound extraction and identification; Zhaokun Liu and Changrong Wang performed the HIV-1 RT and PR assays; Yun Jiang conducted the other experiments described in this paper; Fang Liua, Tzi Bun Ng and Wentao Qiao supervised the scientific work; Yun Jiang wrote the manuscript and Tzi Bun Ng revised it.

FUNDING

This work was supported by the National Natural Science Foundation [grant number 30970021], Tianjin Natural Science Foundation [grant number 10JCYBJC09800] and Chinese Ministry of Health [grant number 2008ZX10001-002].

References

References
1
Bown
 
D.
 
Encyclopaedia of Herbs and their Uses
1995
London
Dorling Kindersley
2
Chen
 
Y.
Fan
 
G. R.
Wu
 
H. L.
Wu
 
Y. T.
Mitchell
 
A.
 
Separation, identification and rapid determination of liensine, isoliensinine and neferine from embryo of the seed of Nelumbo nucifera Gaertn by liquid chromatography coupled to diode array detector and tandem mass spectrometry
J. Pharm. Biomed. Anal.
2007
, vol. 
43
 (pg. 
99
-
104
)
3
Jung
 
H. A.
Jung
 
Y. J.
Yoon
 
N. Y.
Jeong da
 
M.
Bae
 
H. J.
Kim
 
D. W.
Na
 
D. H.
Choi
 
J. S.
 
Inhibitory effects of Nelumbo nucifera leaves on rat lens aldose reductase, advanced glycation endproducts formation, and oxidative stress
Food Chem. Toxicol.
2008
, vol. 
46
 (pg. 
3818
-
3826
)
4
Hu
 
M.
Skibsted
 
L. H.
 
Antioxidative capacity of rhizome extract and rhizome knot extract of edible lotus (Nelumbo nuficera)
Food Chem.
2002
, vol. 
76
 (pg. 
327
-
333
)
5
Khattak
 
K. F.
Simpson
 
T. J.
Ihasnullah
 
 
Effect of gamma irradiation on the microbial load, nutrient composition and free radical scavenging activity of Nelumbo nucifera rhizome
Radiat. Phys. Chem.
2009
, vol. 
78
 (pg. 
206
-
212
)
6
Yang
 
H. C.
Xing
 
S.
Shan
 
L.
O'Connell
 
K.
Dinoso
 
J.
Shen
 
A.
Zhou
 
Y.
Shrum
 
C. K.
Han
 
Y.
Liu
 
J. O.
, et al 
Small-molecule screening using a human primary cell model of HIV latency identifies compounds that reverse latency without cellular activation
J. Clin. Invest.
2009
, vol. 
119
 (pg. 
3473
-
3486
)
7
Talati
 
M.
Meyrick
 
B.
Peebles
 
R. S.
Davies
 
S. S.
Dworski
 
R.
Mernaugh
 
R.
Mitchell
 
D.
Boothby
 
M.
Roberts
 
L. J.
Sheller
 
J. R.
 
Oxidant stress modulates murine allergic airway responses
Free Radicals Biol. Med.
2006
, vol. 
40
 (pg. 
1210
-
1219
)
8
Jaruga
 
P.
Jaruga
 
B.
Olczak
 
A.
Halota
 
W.
Olinski
 
R.
 
Oxidative DNA base damage in lymphocytes of HIV-infected drug users
Free Radical Res.
1999
, vol. 
31
 (pg. 
197
-
200
)
9
Kidd
 
P.
 
Th1/Th2 balance: the hypothesis, its limitations, and implications for health and disease
Altern. Med. Rev.
2003
, vol. 
8
 (pg. 
223
-
246
)
10
Massimo
 
A.
Guido
 
P.
 
Role of cytokines and chemokines in the regulation of innate immunity and HIV infection
Mol. Immunol.
2005
, vol. 
42
 (pg. 
161
-
182
)
11
Kedzierska
 
K.
Crowe
 
S. M.
 
Cytokines and HIV-1: interactions and clinical implications
Antivir. Chem. Chemother.
2001
, vol. 
12
 (pg. 
133
-
150
)
12
Wu
 
L. Y.
Juan
 
C. C.
Ho
 
L. T.
Hsu
 
Y. P.
Hwang
 
L. S.
 
Effect of green tea supplementation on insulin sensitivity in Sprague–Dawley rats
J. Agric. Food Chem.
2004
, vol. 
52
 (pg. 
643
-
648
)
13
Senevirathne
 
M.
Kim
 
S.
Siriwardhana
 
N.
Ha
 
J.
Lee
 
K.
Jeon
 
Y.
 
Antioxidant potential of Ecklonia cava on reactive oxygen species scavenging metal chelating, reducing power and lipid peroxidation inhibition
Food Sci. Technol. Int.
2006
, vol. 
12
 (pg. 
27
-
38
)
14
Nakane
 
H
Ono
 
K.
 
Differential inhibitory effects of some catechin derivatives on the activities of human immunodeficiency virus reverse transcriptase and cellular deoxyribonucleic and ribonucleic acid polymerases
Biochemistry
1990
, vol. 
29
 (pg. 
2841
-
2845
)
15
Liu
 
S. W.
Lu
 
H.
Zhao
 
Q.
He
 
Y. X.
Niu
 
J. K.
Debnath
 
A. K.
Wu
 
S. G.
Jiang
 
S. B.
 
Theaflavin derivatives in black tea and catechin derivatives in green tea inhibit HIV-1 entry by targeting gp41
Biochim. Biophys. Acta
2005
, vol. 
1723
 (pg. 
270
-
281
)
16
Sugiyama
 
H.
Fung
 
K. P.
Wu
 
T. W.
 
Purpurogallin as an antioxidant protector of human erythrocytes against lysis by peroxyl radicals
Life Sci.
1993
, vol. 
53
 (pg. 
39
-
43
)
17
Jiang
 
Y.
Ng
 
T. B.
Wang
 
C. R.
Li
 
N.
Wen
 
T. Y.
Qiao
 
W. T.
Zhang
 
D.
Cheng
 
Z. H.
Liu
 
F.
 
First isolation of tryptophan from edible lotus (Nelumbo nucifera Gaertn) rhizomes and demonstration of its antioxidant effects
Int. J. Food Sci. Nutr.
2010
, vol. 
61
 (pg. 
346
-
356
)
18
Wong
 
J. H.
Chan
 
H. Y. E.
Ng
 
T. B.
 
A mannose/glucose-specific lectin from Chinese evergreen chinkapin (Castanopsis chinensis)
Biochim. Biophys. Acta
2008
, vol. 
1780
 (pg. 
1017
-
1022
)
19
Larsson
 
L. G.
Luukkonen
 
B. G. M.
Unge
 
T.
Schwartz
 
S.
Utter
 
G.
Strandberg
 
B.
Öberg
 
B.
 
Enhancement of HIV-1 proteinase activity by HIV-1 reverse transcriptase
Virology
1995
, vol. 
206
 (pg. 
387
-
394
)
20
Jiang
 
Y.
Ng
 
T. B.
Fu
 
M.
Wong
 
J. H.
Liu
 
F.
 
Isolation of adenosine, osinensetin and dimethylguanosine with antioxidant and HIV-1 protease inhibiting activities from fruiting bodies of Cordyceps militaris
Phytomedicine
2010
 
in the press, doi: 10.1016/j.phymed.2010.04.010
21
Lam
 
T. L.
Lam
 
M. L.
Au
 
T. K.
Ip
 
D. T.
Ng
 
T. B.
Fong
 
W. P.
Wan
 
D. C.
 
A comparison of human immunodeficiency virus type-1 protease inhibition activities by the aqueous and methanol extracts of Chinese medicinal herbs
Life Sci.
2000
, vol. 
67
 (pg. 
2889
-
2896
)
22
Jenkins
 
T. M.
Engelman
 
A.
Ghirlando
 
R.
Craigie
 
R.
 
A soluble active mutant of HIV-1 integrase
J. Biol. Chem.
1996
, vol. 
271
 (pg. 
7712
-
7718
)
23
Bessong
 
P. O.
Obi
 
C. L.
Andreola
 
M. L.
Rojas
 
L. B.
Pouysegu
 
L.
Igumbor
 
E.
Meyer
 
J. J.
Quideau
 
S.
Litvak
 
S.
 
Evaluation of selected South African medicinal plants for inhibitory properties against human immunodeficiency virus type 1 reverse transcriptase and integrase
J. Ethnopharmacol.
2005
, vol. 
99
 (pg. 
83
-
91
)
24
Grobler
 
J. A.
Stillmock
 
K.
Hu
 
B.
Witmer
 
M.
Felock
 
P.
Espeseth
 
A. S.
Wolfe
 
A.
Egbertson
 
M.
Bourgeois
 
M.
Melamed
 
J.
, et al 
Diketo acid inhibitor mechanism and HIV-1 integrase: implications for metal binding in the active site of phosphotransferase enzymes
Proc. Natl Acad. Sci. U.S.A.
2002
, vol. 
99
 (pg. 
6661
-
6666
)
25
Pommier
 
Y.
Marchand
 
C.
Neamati
 
N.
 
Retroviral integrase inhibitors year 2000: update and perspectives
Antivir. Res.
2000
, vol. 
47
 (pg. 
139
-
148
)
26
Livak
 
K. J.
Schmittgen
 
T. D.
 
Analysis of relative gene expression data using real-time quantitative PCR and the 2-ΔΔCt method
Methods
2001
, vol. 
25
 (pg. 
402
-
408
)
27
Foo
 
L. Y.
Lu
 
Y.
Molan
 
A. L.
Woodfield
 
D. R.
McNabb
 
W. C.
 
The phenols and prodelphinidins of white clover flowers
Phytochemistry
2000
, vol. 
54
 (pg. 
539
-
548
)
28
Jew
 
S. S.
Lim
 
D. Y.
Bae
 
S. Y.
Kim
 
H. A.
Kim
 
J. H.
Lee
 
J.
Park
 
H. G.
 
Enantioselective synthesis of (2R, 3S)-(+)-catechin
Tetrahedron: Asymmetry
2002
, vol. 
13
 (pg. 
715
-
720
)
29
Yang
 
D.
Wang
 
Q.
Ke
 
L.
Jiang
 
J.
Ying
 
T.
 
Antioxidant activities of various extracts of lotus (Nelumbo nuficera Gaertn) rhizome
Asia Pacific J. Clin. Nutr.
2007
, vol. 
16
 (pg. 
158
-
163
)
30
Tang
 
F.
Zhang
 
Q. L.
Nie
 
Z.
Yao
 
S.
Chen
 
B.
 
Sample preparation for analyzing traditional Chinese medicines
Trends Anal. Chem.
2009
, vol. 
28
 (pg. 
1253
-
1262
)
31
Suja
 
K. P.
Jayalekshmy
 
A.
Arumughan
 
C.
 
Antioxidant activity of sesame cake extract
Food Chem.
2005
, vol. 
91
 (pg. 
213
-
219
)
32
Huang
 
B.
Ban
 
X. Q.
He
 
J. S.
Tong
 
J.
Tian
 
J.
Wang
 
Y. W.
 
Hepatoprotective and antioxidant activity of ethanolic extracts of edible lotus (Nelumbo nucifera. Gaertn) leaves
Food Chem.
2010
, vol. 
120
 (pg. 
873
-
878
)
33
Sohn
 
D. H.
Kim
 
Y. C.
Oh
 
S. H.
Park
 
E. J.
Li
 
X.
Lee
 
B. H.
 
Hepatoprotective and free radical scavenging effects of Nelumbo nucifera
Phytomedicine
2003
, vol. 
10
 (pg. 
165
-
169
)
34
Yan
 
S. L.
Wang
 
Q. Z.
Peng
 
G. H.
 
Determination of catechin in lotus rhizomes by high-performance liquid chromatography
Int. J. Food Sci. Nutr.
2009
, vol. 
60
 (pg. 
432
-
438
)
35
Demeule
 
M.
Michaud-Levesque
 
J.
Annabi
 
B.
Gingras
 
D.
Boivin
 
D.
Jodoin
 
J.
Lamy
 
S.
Bertrand
 
Y.
Béliveau
 
R.
 
Green tea catechins as novel antitumor and antiangiogenic compounds
Curr. Med. Chem. Anti-Cancer Agents
2002
, vol. 
2
 (pg. 
441
-
463
)
36
Chen
 
Y.
Xie
 
M. Y.
Nie
 
S. P.
Li
 
C.
Wang
 
Y. X.
 
Purification, composition analysis and antioxidant activity of a polysaccharide from the fruiting bodies of Ganoderma atrum
Food Chem.
2008
, vol. 
107
 (pg. 
231
-
241
)
37
Gao
 
G. S.
Hou
 
B.
Wu
 
S. R.
Liu
 
P.
 
Research progress and thinking in chemical structure and bioactivities of polysaccharides of Tremella aurantialba
Edible Fungi China
2007
, vol. 
26
 (pg. 
8
-
10
)
38
Yan
 
L.
Wang
 
S. M.
Zhang
 
F. H.
Shi
 
B. X.
Li
 
S. Y.
Li
 
Q. H.
 
Extractation and characteristics of polysaccharides from lotus root pomace
Food Sci.
2007
, vol. 
28
 (pg. 
226
-
230
)
39
Reference deleted
40
Notka
 
F.
Meier
 
G. R.
Wagner
 
R.
 
Inhibition of wild-type human immunodeficiency virus and reverse transcriptase inhibitor-resistant variants by Phyllanthus amarus
Antivir. Res.
2003
, vol. 
58
 (pg. 
175
-
186
)
41
Tillekeratne
 
L. M.
Sherette
 
A.
Fulmer
 
J. A.
Hupe
 
L.
Hupe
 
D.
Gabbara
 
S.
Peliska
 
J. A.
Hudson
 
R. A.
 
Differential inhibition of polymerase and strand-transfer activities of HIV-1 reverse transcriptase
Bioorg. Med. Chem. Lett.
2002
, vol. 
12
 (pg. 
525
-
528
)
42
Tillekeratne
 
L. M.
Sherette
 
A.
Grossman
 
P.
Hupe
 
L.
Hupe
 
D.
Hudson
 
R. A.
 
Simplified catechin-gallate inhibitors of HIV-1 reverse transcriptase
Bioorg. Med. Chem. Lett.
2001
, vol. 
11
 (pg. 
2763
-
2767
)
43
Waldmann
 
T. A.
 
The biology of interleukin-2 and interleukin-15: implications for cancer therapy and vaccine design
Nat. Rev. Immunol.
2006
, vol. 
6
 (pg. 
595
-
601
)
44
van der Poll
 
T.
Keogh
 
C. V.
Guirao
 
X.
Buurman
 
W. A.
Kopf
 
M.
Lowry
 
S. F.
 
Interleukin-6 gene-deficient mice show impaired defense against pneumococcal pneumonia
J. Infect. Dis.
1997
, vol. 
176
 (pg. 
439
-
444
)
45
Groux
 
H.
Cottrez
 
F.
 
The complex role of interleukin-10 in autoimmunity
J. Autoimmun.
2004
, vol. 
20
 (pg. 
281
-
285
)
46
Collins
 
K. R.
Quinones-Mateu
 
M. E.
Toossi
 
Z.
Arts
 
E. J.
 
Impact of tuberculosis on HIV-1 replication, diversity, and disease progression
AIDS Rev.
2002
, vol. 
4
 (pg. 
165
-
176
)
47
Sepulveda
 
R. T.
Watson
 
R. R.
 
Treatment of antioxidant deficiencies in AIDS patients
Nutr. Res.
2002
, vol. 
22
 (pg. 
27
-
37
)