The purpose of the study is to investigate the correlation between the expression of C-reactive protein (CRP) and autophagy-related 9B (ATG9B) and pathological features of clear cell renal cell carcinoma (CCRCC) patients. We also intended to explore the effects of manipulated expression of CRP and ATG9B on the apoptosis and cell cycle progression of CCRCC cell line. ATG9B expression in CCRCC tissues and adjacent renal tissues was analyzed by immunohistochemistry (IHC). Gene expression was determined at transcription and translational levels using real-time quantitative PCR (RT-qPCR) and Western blot. The association between CRP/ATG9B expression and clinical-pathological parameters including age, gender, pathological grades, TNM stage and distant metastasis of the patients was assessed by correlation analysis. siRNA and overexpression plasmids construction were used to manipulate the expression of CRP in human CCRCC cell line 786-O. Cell apoptosis and cell cycle progression were determined using flow cytometry (FCM) and Hoechst 33258 staining. CRP expression correlates with ATG9B expression. The expression of CRP and ATG9B are significantly correlated with TNM staging, distant metastasis, and survival time of CCRCC patients. A high-level of CRP indicates a poor overall survival (OS). In addition, CRP expression influences cell cycle and apoptosis of CCRCC cells. The study reveals that CRP might be a CCRCC development promoter. In addition, there is a close relationship between CRP and ATG9B in CCRCC carcinogenesis.

Introduction

Renal cell carcinoma (RCC) is the most common substantial lesion within kidney [1], constituting 2–3% of adult malignancies [2] and 85% of primary renal tumors [3]. It commonly spreads to lungs, liver, bones, brain, adrenals, and lymph nodes, but seldom to skin, thyroid, and pancreas [4]. Clear cell renal cell carcinoma (CCRCC), as a subtype of RCC, accounts for ~75% of RCC [5]. Forty percent of CCRCC patients would eventually die of carcinoma development [6]. CCRCC shows the highest fatality rate amongst the common urologic malignancies [7]. Over 10000 patients die from kidney cancer each year, however, systemic treatment of RCC has improved vastly in the last two decades [8]. The pathogenesis of the most common type of RCC, CCRCC has been better understood. Therapies with high rates of response, longer progression-free survival such as anti-angiogenic drugs targetting vascular endothelial growth factor (VEGF) and its receptors, and mechanistic target of rapamycin (mTOR) inhibitors have been used [9].

The C-reactive protein (CRP) is located on chromosome 1q23.2 and encodes protein that belongs to the pentaxin family. CRP is a plasma protein mainly generated in liver and activated by interleukin 6 (IL-6) [10]. It is a prognostic factor for survival and recurrence of different types of cancers including mammary, prostatic, colonic, hepatocellular, bone, and upper aerodigestive tract (UADT) tumors [1114]. Additionally, a previous meta-analysis has shown that high serum level of CRP (>1.0 mg/dl) is correlated with increased hazard of lung cancer and possibly breast, prostate, and colorectal cancers [15]. Furthermore, recent studies have revealed that CRP expression is significantly associated with overall survival (OS) time of patients with RCC [1619]. However, whether abnormal CRP expression is associated with CCRCC pathogenesis, metastasis, and OS remains to be clarified.

The autophagy-related 9B (ATG9B), located on chromosome 7q36.1, belongs to the ATG family. A previous study has shown that ATG9B expression is tissue specific, that is ATG9B is abundant in organs such as placenta and ovary but minimum in lung, testis, liver, muscle, brain, and pancreas [20]. The methylation of ATG9B promoter may interrupt the autophagy signal pathway and influence the invasive ductal carcinoma (IDC) development [21]. Similarly, Kang et al. [22] discovered that the mutation of ATG9B is common in human gastric and colorectal cancers and it can be closely related to stomach and colorectal carcinogenesis, suggesting that ATG9B mutation may promote neoplasm development by deregulating autophagy. Whats more, ATG9B interacted with p38IP and regulated by p38α mitogen-activated protein kinase (MAPK) pathway, which then influenced the trafficking of ATG9B and therefore the autophagy process in a mammalian system [23,24]. Autophagy is closely related to cancer development including CCRCC [25,26]. However, the relationship between ATG9B expression and CCRCC pathogenesis, metastasis, and OS remains to be clarified as well.

Previous studies have shown us the aberrant expression of CRP and ATG9B and their relationship with various human diseases especially cancer development including CCRCC. Yet, the influence of their expression on CCRCC progression remains further elaborated. Our study here aimed to explore the relationship between CRP and ATG9B expression with CCRCC pathogenesis, metastasis, and survival as well as the role they play in CCRCC using in vitro experiments.

Materials and methods

Tissue specimens

One hundred and eighty five CCRCC tissues and normal adjacent tissues were collected from CCRCC patients in the Urology Center of Liaocheng People’s Hospital between 2013 and 2016. All tissues were frozen in liquid nitrogen immediately and were stored at −80°C. No patients had received any adjuvant treatments, such as radiotherapy or chemotherapy before surgery. Written informed consents were obtained from all the participants. The study had been approved by the Ethics Committee of Liaocheng People’s Hospital.

Cell culture and siRNA transfection

CCRCC cell line (786-O) was purchased from American Type Culture Collection (ATCC; Manassas, VA, U.S.A.). All cells were placed in Dulbecco’s modified Eagle’s medium (DMEM; Gibco, Life Technologies, Darmstadt, Germany) which contains 10% FBS (HyClone, Logan, UT), penicillin (100 U/ml), and streptomycin (100 mg/ml). All were stored at 37°C in a humidified atmosphere containing 5% CO2. SiRNA-1 and siRNA-2 were synthesized by Suzhou GenePharma Co., Ltd. (Suzhou, China). Twenty-four hours before transfection, the 786-O cells were seeded in the DMEM medium with 10% FBS without antibiotics so the cells grew to 90% confluence. siRNA–Lipofectamine 2000 complexes were prepared. Briefly, siRNA-1 and siRNA-2 were resuspended in 1× siRNA buffer to reach a final concentration of 1 μM. One microliter of siRNA solution was added to 100 μl of serum-free medium to mix. Lipofectamine 2000 reagent (0.5 μl) was added to 25 μl serum-free medium. siRNA medium and diluted Lipofectamine 2000 reagent were incubated together for 20 min at room temperature to allow complex formation. The old medium was removed after 4–6 h. The complexes were added to each well. Cells were then harvested 24 h after transfection. The siRNA sequences were provided in Supplementary Table S1. SiRNA-1 and siRNA-2 were both used to knockdown CRP, yet they had different sequences.

ELISA

CRP human ELISA Kit (ab99995, Abcam, Boston, MA, U.S.A.) was purchased for conducting ELISA. All materials were prepared at room temperature prior to use. One hundred microliters of standards and tissue samples were added to wells. The wells were covered and incubated for 2.5 h. The solution was discarded and the wells were washed three times by adding 300 μl 1× wash solution into each well. Any remaining liquid was removed completely. One hundred microliters of 1× biotinylated anti-human CRP detector antibody was added to each well. The antibody was incubated for 1 h. Then the solution was discarded and the wells were washed three times by adding 300 μl of 1× wash solution into each well. One hundred microliters of 1× HRP-streptavidin solution to each well and incubated for 45 min. The solution was removed completely. One hundred microliters of TMB One-Step substrate reagent was added to each well and incubated for 30 min in the dark. Last, 50 μl of stop solution was added to each well. The optimal density was read at 450 nm immediately.

RNA extraction and real-time quantitative PCR

Total mRNAs of stored human CCRCC tissues and cells were extracted using TRIzol reagent (Invitrogen, Carlsbad, CA, U.S.A.) following the manufacturer’s instructions. Reverse-transcribed cDNA synthesis was performed with PrimeScript RT Reagent Kit (TaKaRa, Dalian, China). Real-time quantitative PCR (RT-qPCR) was conducted using miSYBR-Green PCR kit (TransGen Biotech, China) according to manufacturer’s protocols. Data were evaluated using SDS 2.2 software. GAPDH acted as the internal control. The expressions of CRP and ATG9B were quantitated using 2−ΔΔCt method. The primer sequences are listed in Table 1.

Table 1
RT-qPCR primer sequences
Gene namePrimers (5′–3′)
CRP F: TGTGAGCCAGAAAAACAAGCAAA 
 R: GGTATGGGGGTGGGGTCTAA 
ATG9B F: TGTGAGCCAGAAAAACAAGCAAA 
 R: GGTATGGGGGTGGGGTCTAA 
GAPDH F: TGTGAGCCAGAAAAACAAGCAAA 
 R: GGTATGGGGGTGGGGTCTAA 
Gene namePrimers (5′–3′)
CRP F: TGTGAGCCAGAAAAACAAGCAAA 
 R: GGTATGGGGGTGGGGTCTAA 
ATG9B F: TGTGAGCCAGAAAAACAAGCAAA 
 R: GGTATGGGGGTGGGGTCTAA 
GAPDH F: TGTGAGCCAGAAAAACAAGCAAA 
 R: GGTATGGGGGTGGGGTCTAA 

Immunohistochemical staining

Three micrometers thick paraffin-embedded histotomy was soaked in xylene to dewax twice for 20 min, hydrated in gradient ethanol (100, 90, 80, and 70%) for 7 min. The specimens were then rinsed in the tap water three times, 3 min each time. The tissue sections were boiled with sodium citrate buffer for 5 min. The sections were then cultured in 3% H2O2 for 10 min to prevent endogenous peroxidase activities. The slices were then rinsed using PBS three times (5 min each time) and sealed in 10% serum for 10 min at room temperature to avoid non-specific binding. The tissue sections were subsequently incubated with primary antibodies anti-CRP antibody (ab31156, 5 µg/ml, Abcam, Boston, MA, U.S.A.) and anti-ATG9B antibody (ab117591, 5 µg/ml, Abcam, Boston, MA, U.S.A.). After incubation at 4°C overnight with Galectin-3, the serum was discarded and the sections were mixed with biotinylated secondary antibodies for 10 min after being washed in PBS three times (5 min each time). Afterwards, the tissue sections were cultured with streptavidin-horseradish peroxidase (SA-HRP) for another 10 min and rinsed with PBS for 5 min, three times. Finally, after diluting with 3,3′-diaminobenzidine (DAB), the sections were blended with Mayer’s Hematoxylin (Merck, Darmstadt, Germany), gradient ethanol (95, 85, and 75%) for 3 min, respectively as well as absolute ethanol for 10 min and dehydrated in xylene twice, each time 5 min. The criteria immunohistochemical (IHC) staining records showed were: no expression (0 represents without staining), low expression (1 represents more than 30% of cells weakly stained), or high expression (2 represents more than 30% of cells strongly stained).

Western blot

Cells were washed with PBS, scraped from the dishes and centrifuged at 12000 r.p.m. at 4°C for 15 min. Cell lysates were prepared with radioimmunoprecipitation assay (RIPA) buffer. The supernatants were collected and protein concentration was determined using the BCA assay (Beyotime, Shanghai, China). Proteins were separated by SDS/PAGE (Bio–Rad, Hercules, CA, U.S.A.), transferred on to PVDF membranes (Invitrogen, Gaithersburg, MD, U.S.A) for Western blot analysis following the manufacturer’s guidelines. PVDF membranes were sealed using 5% skim milk for 1 h at room temperature, and then incubated with primary antibodies anti-CRP (ab31156, 5 µg/ml, Abcam, Boston, MA, U.S.A.) and anti-ATG9B (ab117591, 2 µg/ml, Abcam, Boston, MA, U.S.A.). After culturing with primary antibodies overnight at 4°C, secondary antibodies (1:1000) were added for another 1-h incubation at room temperature. The membranes were washed three times with TBS-Tween (TBST). The immunoreactive protein bands were visualized using G: Box XR5 and the membranes were subsequently exposed.

Hoechst 33258 staining

786-O cells were seeded on cover slips in 24-well plates. After transfection for 48 h, cells were mixed with 4% paraformaldehyde at room temperature for 5 min. The cells were then permeabilized using 0.2% Triton X-100 solution with PBS for another 5 min, and rinsed with PBS. Then, 5% BSA was used to block the cells at room temperature for 2 h, after which they were rinsed with PBS three times (5 min each time). The cells were then stained with 0.5 ml Hoechst 33258 in dark for 5 min and rinsed in PBS. Finally, they were coverslipped with aqueous mounting medium (Dako Faramount, Shanghai, China) for later observation.

Apoptosis assay

Flow cytometry (FCM) was employed to analyze the apoptosis in CCRCC cells. Cells were collected in logarithmic growth phase, placed in a 96-well plate and preincubated for 24 h in a CO2 incubator. Single-cell suspensions were fixed with 70% alcohol and then rinsed twice with PBS and binding buffer was employed to resuspend cells. For Annexin V staining, 5 μl Annexin V-PE, 5 μl 7-AAD staining and binding buffer of 10 mM HEPES/NaOH (pH 7.4), 140 mM NaCl, and 2.5 mM CaCl2 were added to samples, which were incubated for 15 min at room temperature in dark and analyzed by a flow cytometer (FACSCanto II, BD Biosciences). The data were analyzed using FlowJo software (LLC, Ashland, OR, U.S.A.). Three experiments were performed in triplicate. Apoptotic cells that were positive of Annexin V-PE but not 7-AAD were early apoptotic, whereas those were Annexin V-PE and 7-AAD positive were late apoptotic or necrotic.

Statistical analysis

SPSS 22 (Chicago, Illinois, U.S.A.) was used for statistical analyses and data were presented as mean ± S.D. Correlations between expressions of CRP and ATG9B and the clinical-pathological characteristics were analyzed using two-sided Fisher’s exact test. The correlation between the protein expressions of CRP and ATG9B was assessed using Spearman’s rank correlation coefficient test. The Kaplan–Meier method was applied to draw OS curves and the expression comparisons distinction between groups was evaluated using the log-rank test. P<0.05 was considered statistically significant.

Results

The expression of CRP and ATG9B in serum and tissues

The concentration of CRP in human serum was evaluated using ELISA method. The results showed that the expression of CRP in CCRCC group was significantly higher than that in control group (<10 mg/l, Figure 1A). Meanwhile, amongst 185 CCRCC serum samples, there were high expressions of serum CRP in 159 cases (>30 mg/l), moderate expression of CRP in 18 cases (11–30 mg/l), and low expression of CRP in 8 cases (<10 mg/l).

CRP and ATG9B expression in tissues and the relationship between CRP expression and OS rate of patients

Figure 1
CRP and ATG9B expression in tissues and the relationship between CRP expression and OS rate of patients

(A) Serum CRP protein was lowly expressed in patients of the normal group, but highly expressed (>30 mg/l) in 159 CCRCC cases, medium expressed in 18 CCRCC cases (11–30 mg/l) and lowly expressed (<10 mg/l) in 8 CCRCC cases. (B) ATG9B expression in all normal kidney and tumor tissues was positive, with 82 lowly expressed and 103 highly expressed in CCRCC patients group. The positive signal is in the cancer cell cytoplasm. (C) Patients with high CRP expression level had worse survival outcomes compared with low expression group. *P<0.05 compared with control group.

Figure 1
CRP and ATG9B expression in tissues and the relationship between CRP expression and OS rate of patients

(A) Serum CRP protein was lowly expressed in patients of the normal group, but highly expressed (>30 mg/l) in 159 CCRCC cases, medium expressed in 18 CCRCC cases (11–30 mg/l) and lowly expressed (<10 mg/l) in 8 CCRCC cases. (B) ATG9B expression in all normal kidney and tumor tissues was positive, with 82 lowly expressed and 103 highly expressed in CCRCC patients group. The positive signal is in the cancer cell cytoplasm. (C) Patients with high CRP expression level had worse survival outcomes compared with low expression group. *P<0.05 compared with control group.

The IHC staining results showed that compared with adjacent tissues, CCRCC tissues demonstrated more positive expression of ATG9B. In CCRCC tissues, low expression of ATG9B was detected in 82 patients and highly expressed ATG9B was observed in 103 patients (Figure 1B). The positive signal was in the cytoplasm of cancer cells.

The correlation between gene expression and the pathological characteristics of CCRCC patients

The relationship between CRP and ATG9B expression levels and CCRCC patients’ characteristics were analyzed using two-sided Fisher’s exact test. As was shown in Table 2, high expression of CRP or ATG9B was positively related to advanced TNM stage and distant metastases. In addition, there was also a positive correlation between CRP expression and ATG9B expression (Table 3).

Table 2
Associations between expressions of CRP and ATG9B and clinicopathologic characteristics in CCRCC patients
CharacteristicsVolume (%)CRP expression (n=185)PATG9B expression (n=185)P
Low (n=97) (%)High (n=88) (%)Low (n=82) (%)High (n=88) (%)
Age (years)        
  ≤52 73 (39.46) 36 (49) 37 (51) 0.548 38 (52) 35 (48) 0.097 
  >52 112 (60.54) 61 (55) 51 (45)  44 (39) 68 (61)  
Gender        
  Male 105 (56.76) 52 (49) 53 (51) 0.377 51 (49) 54 (51) 0.232 
  Female 80 (43.24) 45 (56) 35 (44)  31 (39) 49 (61)  
Histologic grade        
  Grade 1–2 77 (41.62) 39 (51) 38 (49) 0.765 37 (48) 40 (52) 0.453 
  Grade 3–4 108 (58.38) 58 (54) 50 (46)  45 (42) 63 (58)  
TNM stage        
  I–II 98 (52.97) 60 (61) 38 (39) 0.013 32 (33) 66 (67) 0.001 
  III–IV 87 (47.03) 37 (43) 50 (57)  50 (57) 37 (43)  
Distant metastasis        
  Absent 127 (68.65) 75 (59) 52 (41) 0.011 63 (49) 64 (51) 0.038 
  Present 58 (31.35) 22 (38) 36 (62)  19 (33) 39 (67)  
CharacteristicsVolume (%)CRP expression (n=185)PATG9B expression (n=185)P
Low (n=97) (%)High (n=88) (%)Low (n=82) (%)High (n=88) (%)
Age (years)        
  ≤52 73 (39.46) 36 (49) 37 (51) 0.548 38 (52) 35 (48) 0.097 
  >52 112 (60.54) 61 (55) 51 (45)  44 (39) 68 (61)  
Gender        
  Male 105 (56.76) 52 (49) 53 (51) 0.377 51 (49) 54 (51) 0.232 
  Female 80 (43.24) 45 (56) 35 (44)  31 (39) 49 (61)  
Histologic grade        
  Grade 1–2 77 (41.62) 39 (51) 38 (49) 0.765 37 (48) 40 (52) 0.453 
  Grade 3–4 108 (58.38) 58 (54) 50 (46)  45 (42) 63 (58)  
TNM stage        
  I–II 98 (52.97) 60 (61) 38 (39) 0.013 32 (33) 66 (67) 0.001 
  III–IV 87 (47.03) 37 (43) 50 (57)  50 (57) 37 (43)  
Distant metastasis        
  Absent 127 (68.65) 75 (59) 52 (41) 0.011 63 (49) 64 (51) 0.038 
  Present 58 (31.35) 22 (38) 36 (62)  19 (33) 39 (67)  

P; Bold values mean significant results

Table 3
Correlations between CRP and ATG9B
Spearman’s rhoCRPATG9B
CRP Correlation coefficient 1.000 0.850 
 Sig. (two-tailed) 0.000 0.000 
ATG9B Correlation coefficient 0.850 1.000 
 Sig. (two-tailed) 0.000 0.000 
Spearman’s rhoCRPATG9B
CRP Correlation coefficient 1.000 0.850 
 Sig. (two-tailed) 0.000 0.000 
ATG9B Correlation coefficient 0.850 1.000 
 Sig. (two-tailed) 0.000 0.000 

The correlation between CRP expression and patients’ prognosis

Survival curves were generated by means of the Kaplan–Meier method and the distinctions amongst groups with different expressions were detected using the log-rank test. The correlation between CRP expression level and OS of CCRCC patients was shown in Figure 1C. The results indicated that patients with high CRP expression level had a lower OS and poorer prognostic result than those who with low CRP expression level.

The correlation between CRP expression and ATG9B expression

The effect of siRNA transfection on the expression of CRP was confirmed by RT-qPCR (Figure 2A). Compared with the negative control group, siRNAs (siRNA-1 and siRNA-2) could significantly inhibit CRP mRNA expression. ATG9B expression dramatically decreased after the transfection of siRNAs. In addition, the expression level of ATG9B decreased more quickly than that of CRP (Figure 2B). According to Western blot results, the expression levels of CRP and ATG9B proteins were remarkably down-regulated.

CRP silences effects and its correlation with ATG9B expression

Figure 2
CRP silences effects and its correlation with ATG9B expression

(A) siRNAs could significantly down-regulate mRNA expressions of CRP and ATG9B protein. mRNA levels of CRP and ATG9B were both significantly lower in siRNA-1 and siRNA-2 groups than in control group. (B) CRP protein level as well as ATG9B protein level in siRNA-1 and siRNA-2 groups was much lower than in control group. *P<0.05, #P<0.05 compared with control group.

Figure 2
CRP silences effects and its correlation with ATG9B expression

(A) siRNAs could significantly down-regulate mRNA expressions of CRP and ATG9B protein. mRNA levels of CRP and ATG9B were both significantly lower in siRNA-1 and siRNA-2 groups than in control group. (B) CRP protein level as well as ATG9B protein level in siRNA-1 and siRNA-2 groups was much lower than in control group. *P<0.05, #P<0.05 compared with control group.

The inhibitive effects of CRP on the apoptosis of 786-O cells

The results of Hoechst 33258 staining of the tumor cell cytoplasm showed that the transfection of siRNAs significantly promoted the apoptosis in 786-O cells (Figure 3A). Annexin-V and 7-AAD dual-staining FCM results demonstrated that the apoptosis rate of cells in siRNA-1 or siRNA-2 group was much higher than that in the control group (Figure 3B). This also indicated that the apoptosis of 786-O cells could be induced through silencing CRP expression. On the other hand, cell cycle assay also demonstrated that cells were arrested in G1-phase in the two siRNA groups (Figure 3C).

Inhibition of CRP expression induces cell cycle arrest and the apoptosis in 786-O cells

Figure 3
Inhibition of CRP expression induces cell cycle arrest and the apoptosis in 786-O cells

(A) The apoptosis of 786-O cells increased by either siRNA by ~2.5 times. Scale bar: 30 μm. (B) Dual-staining FCM test results showed that apoptotic cells transfected with siRNAs were much more than those in the control group. * means P<0.05 compared with the control group. (C) The cell cycle was significantly arrested in G0/G1-phase in siRNA groups. *P<0.05 compared with control group.

Figure 3
Inhibition of CRP expression induces cell cycle arrest and the apoptosis in 786-O cells

(A) The apoptosis of 786-O cells increased by either siRNA by ~2.5 times. Scale bar: 30 μm. (B) Dual-staining FCM test results showed that apoptotic cells transfected with siRNAs were much more than those in the control group. * means P<0.05 compared with the control group. (C) The cell cycle was significantly arrested in G0/G1-phase in siRNA groups. *P<0.05 compared with control group.

The synchronous expression of CRP expression and ATG9B expression

As shown in Figure 4, mRNA expression levels of CRP and ATG9B in overexpressed group was up-regulated by more than twice in comparison with the control group. Western blot results revealed that overexpression of CRP could significantly up-regulate the expression of ATG9B.

The effects of CRP overexpression and its correlation with ATG9B expression

Figure 4
The effects of CRP overexpression and its correlation with ATG9B expression

(A) CRP mRNA expression increased by ~2.5 times, while ATG9B expression increased by ~2.2 times significantly in CRP overexpression group than in Scr group. (B) CRP level increased significantly because of its overexpression, which also improved ATG9B level. *P<0.05, #P<0.05 compared with Scr group.

Figure 4
The effects of CRP overexpression and its correlation with ATG9B expression

(A) CRP mRNA expression increased by ~2.5 times, while ATG9B expression increased by ~2.2 times significantly in CRP overexpression group than in Scr group. (B) CRP level increased significantly because of its overexpression, which also improved ATG9B level. *P<0.05, #P<0.05 compared with Scr group.

The inhibitive effects of CRP expression on the apoptosis in 786-O cells

The apoptotic rate of the overexpression group presented a drastic decline in comparison with negative control group, which also suggested that CRP overexpression could inhibit apoptosis (Figure 5A). Moreover, CRP expression group displayed much fewer apoptotic cells than the negative control group, shown by Annexin-V and 7-AAD dual-staining FCM test results. CRP overexpression could suppress cell apoptosis (Figure 5B). S- and G2/M-phases increased in 786-O cells of overexpression group compared with the negative control group (Figure 5C). This showed that CRP expression level could exert influence on the cell cycle of 786-O cells.

CRP overexpression promotes the apoptosis of 786-O cells and reduces the cell cycle

Figure 5
CRP overexpression promotes the apoptosis of 786-O cells and reduces the cell cycle

(A) 786-O cell apoptosis decreased by approximately two-fold. Scale bar: 30 μm. (B) the number of apoptotic cells was much less in CRP overexpression group than that in Scr group. (C) The percentage of cells that were arrested in G0/G1-phase in CRP overexpression group was reduced significantly compared with Scr group. *P<0.05 compared with Scr group.

Figure 5
CRP overexpression promotes the apoptosis of 786-O cells and reduces the cell cycle

(A) 786-O cell apoptosis decreased by approximately two-fold. Scale bar: 30 μm. (B) the number of apoptotic cells was much less in CRP overexpression group than that in Scr group. (C) The percentage of cells that were arrested in G0/G1-phase in CRP overexpression group was reduced significantly compared with Scr group. *P<0.05 compared with Scr group.

Discussion

In the present study, we have discovered that the expression of CRP and ATG9B is significantly correlated with CCRCC TNM staging, metastasis, and OS. A higher level of CRP indicates a poorer OS of CCRCC patient. The inhibition of CRP expression significantly increased the apoptosis and cell cycle arrest of CCRCC cell line 786-O. CRP expression is positively correlated with ATG9B, and its overexpression leads to less apoptosis and less cell cycle arrest of 786-O cells. CCRCC is the most common kind of RCC with poor prognosis with a 5-year survival rate of 0–10% [27]. To understand the relationship of CRP and ATG9B expression and CCRCC are significant to the development of CCRCC prognosis and treatment.

In our study, we found that CRP expression was associated with ATG9B expression. The inhibition of CRP expression was accompanied by a decreased expression of ATG9B and the overexpression of CRP was accompanied with an increased expression of ATG9B. Serum CRP protein was lowly expressed in normal patients. Amongst CCRCC patients, 159 were found with high-level CRP (>30 mg/l), 18 medium-level (11-30 mg/l), and 8 low-level (<10 mg/l). On the other hand, ATG9B was found overexpressed in most of CCRCC patients. CRP was found significantly associated with OS of CCRCC patients. Based on the above results, we speculated that the expression of CRP and ATG9B was positively correlated with CCRCC and it may indicate a poorer status of CCRCC. Our results are consistent with previous studies, in which identical findings were demonstrated in regards of RCC OS and aberrant CRP expression [17,2830]. Thus, we speculated that the aberrant overexpression of CRP and ATG9B could possibly promote CCRCC development.

The in vivo experiment results support our hypothesis that the aberrant overexpression of CRP and ATG9B could promote CCRCC development, possibly by influencing the cell cycle and apoptosis. The inhibition of CRP expression promoted whereas the promotion of CRP expression inhibited 786-O cell cycle arrest and apoptosis. As a stable downstream inflammation marker, it can be stimulated by IL-1 and tumor necrosis factors (TNFs) [31]. Chronic inflammation can be predictor of cancer initiation, progression, metastasis, and survival. CRP-level measurements can be clinically significant for RCC prognosis [32,33]. Hence, we inferred that CRP could be involved in CCRCC development via some inflammation pathway that involves ILs and TNFs and affect CCRCC cell proliferation and apoptosis.

On the other hand, CRP overexpression was found to be accompanied/associated with ATG9B overexpression. ATG9B is involved in autophagy process that delivers cytoplasmic constituents degraded by autophagosomes to lysosomes for digestion [34], which is a common scene during carcinogenesis [26]. Autophagy can play a protective role in tumor cell survival, and can also contribute to cancer progression by preventing tumor cell from programming death [35]. Zhang et al. [21] found aberrant promoter methylation of ATG9B in sporadic breast carcinoma. Oncogenic autophagy in CCRCC was reported to be regulated by some molecules, which could contribute to the CCRCC progression [25]. ATG genes as well as ATG-interacting genes have been reported to be related to the development of diverse carcinomas such as lung cancer and CCRCC etc. [36]. Based on the previous findings as well as ours, we speculated that aberrant ATG9B expression might contribute to the aberrant autophagy of CCRCC cells, which then induced CCRCC progression.

Certain limitations exist in the present study. First of all, in vivo studies need to be done to elaborate the role of CRP and ATG9B expression during CCRCC development. Second, ATG9B-related autophagy pathway can be further studied for a better comprehension of the ATG9B-related mechanism of CCRCC pathogenesis. Third, the influence between CRP-related inflammation pathways and CCRCC need to be further explored. Fourth, in vivo experiments need to be further studied to verify the in vitro discoveries. Last, detailed correlation between ATG9B and CCRCC pathogenesis need further investigation as well.

In conclusion, our study showed that CRP and ATG9B were both aberrantly overexpressed in CCRCC tissues and cells, and they were closely correlated with CCRCC TNM staging, metastasis, and OS. The suppression of CRP expression led to the cancer cell cycle arrest and apoptosis. The results indicate that CRP and ATG9B could be significant predictors of CCRCC and can be a valuable target for CCRCC therapy.

Ethics approval and consent to participate

All procedures in this research were in accordance with the Declaration of Helsinki and approved by the Ethics Committee of Liaocheng People’s Hospital. All participating patients had given consent for the present study.

Competing interests

The authors declare that there are no competing interests associated with the manuscript.

Author contribution

Z.M. and Z.Q. conceptualized the research and design. J.L. and J.Y. were responsible for the data analysis and interpretation. Z.M. and Z.Q. drafted the manuscript. Z.X. and Z.S. critically revised the manuscript. All the authors approved the final manuscript.

Funding

The authors declare that there are no sources of funding to be acknowledged.

Abbreviations

     
  • ATG9B

    autophagy-related 9B

  •  
  • CCRCC

    clear cell renal cell carcinoma

  •  
  • CRP

    C-reactive protein

  •  
  • DMEM

    Dulbecco’s modified Eagle’s medium

  •  
  • FCM

    flow cytometry

  •  
  • IHC

    immunohistochemistry

  •  
  • OS

    overall survival

  •  
  • RCC

    renal cell carcinoma

  •  
  • RT-qPCR

    real-time quantitative PCR

  •  
  • TNF

    tumor necrosis factor

References

1
Ozturk
H.
(
2015
)
Bilateral synchronous adrenal metastases of renal cell carcinoma: a case report and review of the literature
.
Oncol. Lett.
9
,
1897
1901
2
Flum
A.S.
,
Hamoui
N.
,
Said
M.A.
,
Yang
X.J.
,
Casalino
D.D.
,
McGuire
B.B.
et al
(
2016
)
Update on the diagnosis and management of renal angiomyolipoma
.
J. Urol.
195
,
834
846
3
Bokhari
A.
and
Tiscornia-Wasserman
P.G.
(
2017
)
Cytology diagnosis of metastatic clear cell renal cell carcinoma, synchronous to pancreas, and metachronous to thyroid and contralateral adrenal: Report of a case and literature review
.
Diagn. Cytopathol.
45
,
161
167
4
Wolf
S.
,
Obolonczyk
L.
,
Sworczak
K.
,
Czapiewski
P.
and
Sledzinski
Z.
(
2015
)
Renal cell carcinoma metastases to the pancreas and the thyroid gland 19 years after the primary tumour
.
Prz. Gastroenterol.
10
,
185
189
5
Feng
C.
,
Xiong
Z.
,
Jiang
H.
,
Ding
Q.
,
Fang
Z.
and
Hui
W.
(
2016
)
Genetic alteration in notch pathway is associated with better prognosis in renal cell carcinoma
.
Biofactors
42
,
41
48
6
Wendel
C.
,
Campitiello
M.
,
Plastino
F.
,
Eid
N.
,
Hennequin
L.
,
Quetin
P.
et al
(
2017
)
Pituitary metastasis from renal cell carcinoma: description of a case report
.
Am. J. Case Rep.
18
,
7
11
7
Xu
Z.Q.
,
Zhang
L.
,
Gao
B.S.
,
Wan
Y.G.
,
Zhang
X.H.
,
Chen
B.
et al
(
2015
)
EZH2 promotes tumor progression by increasing VEGF expression in clear cell renal cell carcinoma
.
Clin. Transl. Oncol.
17
,
41
49
8
Ouyang
A.M.
,
Wei
Z.L.
,
Su
X.Y.
,
Li
K.
,
Zhao
D.
,
Yu
D.X.
et al
(
2017
)
Relative computed tomography (CT) enhancement value for the assessment of microvascular architecture in renal cell carcinoma
.
Med. Sci. Monit.
23
,
3706
3714
9
Choueiri
T.K.
and
Motzer
R.J.
(
2017
)
Systemic therapy for metastatic renal-cell carcinoma
.
N. Engl. J. Med.
376
,
354
366
10
Bereta
J.
,
Kurdowska
A.
,
Koj
A.
,
Hirano
T.
,
Kishimoto
T.
,
Content
J.
et al
(
1989
)
Different preparations of natural and recombinant human interleukin-6 (IFN-beta 2, BSF-2) similarly stimulate acute phase protein synthesis and uptake of alpha-aminoisobutyric acid by cultured rat hepatocytes
.
Int. J. Biochem.
21
,
361
366
11
Nakamura
T.
,
Grimer
R.J.
,
Gaston
C.L.
,
Watanuki
M.
,
Sudo
A.
and
Jeys
L.
(
2013
)
The prognostic value of the serum level of C-reactive protein for the survival of patients with a primary sarcoma of bone
.
Bone Joint J.
95-B
,
411
418
12
Nakamura
T.
,
Grimer
R.
,
Gaston
C.
,
Francis
M.
,
Charman
J.
,
Graunt
P.
et al
(
2013
)
The value of C-reactive protein and comorbidity in predicting survival of patients with high grade soft tissue sarcoma
.
Eur. J. Cancer
49
,
377
385
13
Funovics
P.T.
,
Edelhauser
G.
,
Funovics
M.A.
,
Laux
C.
,
Berzaczy
D.
,
Kubista
B.
et al
(
2011
)
Pre-operative serum C-reactive protein as independent prognostic factor for survival but not infection in patients with high-grade osteosarcoma
.
Int. Orthop.
35
,
1529
1536
14
Nakanishi
H.
,
Araki
N.
,
Kudawara
I.
,
Kuratsu
S.
,
Matsumine
A.
,
Mano
M.
et al
(
2002
)
Clinical implications of serum C-reactive protein levels in malignant fibrous histiocytoma
.
Int. J. Cancer
99
,
167
170
15
Guo
Y.Z.
,
Pan
L.
,
Du
C.J.
,
Ren
D.Q.
and
Xie
X.M.
(
2013
)
Association between C-reactive protein and risk of cancer: a meta-analysis of prospective cohort studies
.
Asian Pac. J. Cancer Prev.
14
,
243
248
16
Guo
S.
,
He
X.
,
Chen
Q.
,
Yang
G.
,
Yao
K.
,
Dong
P.
et al
(
2017
)
The C-reactive protein/albumin ratio, a validated prognostic score, predicts outcome of surgical renal cell carcinoma patients
.
BMC Cancer
17
,
171
17
Dalpiaz
O.
,
Luef
T.
,
Seles
M.
,
Stotz
M.
,
Stojakovic
T.
,
Pummer
K.
et al
(
2017
)
Critical evaluation of the potential prognostic value of the pretreatment-derived neutrophil-lymphocyte ratio under consideration of C-reactive protein levels in clear cell renal cell carcinoma
.
Br. J. Cancer
116
,
85
90
18
Fujita
T.
,
Nishi
M.
,
Tabata
K.
,
Matsumoto
K.
,
Yoshida
K.
and
Iwamura
M.
(
2016
)
Overall prognostic impact of C-reactive protein level in patients with metastatic renal cell carcinoma treated with sorafenib
.
Anticancer Drugs
27
,
1028
1032
19
Hu
H.
,
Yao
X.
,
Xie
X.
,
Wu
X.
,
Zheng
C.
,
Xia
W.
et al
(
2017
)
Prognostic value of preoperative NLR, dNLR, PLR and CRP in surgical renal cell carcinoma patients
.
World J. Urol.
35
,
261
270
20
Kusama
Y.
,
Sato
K.
,
Kimura
N.
,
Mitamura
J.
,
Ohdaira
H.
and
Yoshida
K.
(
2009
)
Comprehensive analysis of expression pattern and promoter regulation of human autophagy-related genes
.
Apoptosis
14
,
1165
1175
21
Zhang
X.
,
Li
C.
,
Wang
D.
,
Chen
Q.
,
Li
C.L.
and
Li
H.J.
(
2016
)
Aberrant methylation of ATG2B, ATG4D, ATG9A and ATG9B CpG island promoter is associated with decreased mRNA expression in sporadic breast carcinoma
.
Gene
590
,
285
292
22
Kang
M.R.
,
Kim
M.S.
,
Oh
J.E.
,
Kim
Y.R.
,
Song
S.Y.
,
Kim
S.S.
et al
(
2009
)
Frameshift mutations of autophagy-related genes ATG2B, ATG5, ATG9B and ATG12 in gastric and colorectal cancers with microsatellite instability
.
J. Pathol.
217
,
702
706
23
Webber
J.L.
and
Tooze
S.A.
(
2010
)
New insights into the function of Atg9
.
FEBS Lett.
584
,
1319
1326
24
Webber
J.L.
and
Tooze
S.A.
(
2010
)
Coordinated regulation of autophagy by p38alpha MAPK through mAtg9 and p38IP
.
EMBO J.
29
,
27
40
25
Hall
D.P.
,
Cost
N.G.
,
Hegde
S.
,
Kellner
E.
,
Mikhaylova
O.
,
Stratton
Y.
et al
(
2014
)
TRPM3 and miR-204 establish a regulatory circuit that controls oncogenic autophagy in clear cell renal cell carcinoma
.
Cancer Cell
26
,
738
753
26
Cecconi
F.
and
Jaattela
M.
(
2014
)
Targeting ions-induced autophagy in cancer
.
Cancer Cell
26
,
599
600
27
Zeng
F.C.
,
Zeng
M.Q.
,
Huang
L.
,
Li
Y.L.
,
Gao
B.M.
,
Chen
J.J.
et al
(
2016
)
Downregulation of VEGFA inhibits proliferation, promotes apoptosis, and suppresses migration and invasion of renal clear cell carcinoma
.
Onco. Targets Ther.
9
,
2131
2141
28
Kuang
H.
,
Liao
L.
,
Chen
H.
,
Kang
Q.
,
Shu
X.
and
Wang
Y.
(
2017
)
Therapeutic effect of sodium glucose co-transporter 2 inhibitor dapagliflozin on renal cell carcinoma
.
Med. Sci. Monit.
23
,
3737
3745
29
Novara
G.
(
2009
)
Editorial comment on: impact of C-reactive protein kinetics on survival of patients with metastatic renal cell carcinoma
.
Eur. Urol.
55
,
1153
1154
30
Yoshida
N.
,
Ikemoto
S.
,
Narita
K.
,
Sugimura
K.
,
Wada
S.
,
Yasumoto
R.
et al
(
2002
)
Interleukin-6, tumour necrosis factor alpha and interleukin-1beta in patients with renal cell carcinoma
.
Br. J. Cancer
86
,
1396
1400
31
Hu
Q.
,
Gou
Y.
,
Sun
C.
,
Ding
W.
,
Xu
K.
,
Gu
B.
et al
(
2014
)
The prognostic value of C-reactive protein in renal cell carcinoma: a systematic review and meta-analysis
.
Urol. Oncol.
32
,
50.e1
e8
32
Shrotriya
S.
,
Walsh
D.
,
Bennani-Baiti
N.
,
Thomas
S.
and
Lorton
C.
(
2015
)
C-reactive protein is an important biomarker for prognosis tumor recurrence and treatment response in adult solid tumors: a systematic review
.
PLoS ONE
10
,
e0143080
33
Hrab
M.
,
Olek-Hrab
K.
,
Antczak
A.
,
Kwias
Z.
and
Milecki
T.
(
2013
)
Interleukin-6 (IL-6) and C-reactive protein (CRP) concentration prior to total nephrectomy are prognostic factors in localized renal cell carcinoma (RCC)
.
Rep. Pract. Oncol. Radiother.
18
,
304
309
34
Zavodszky
E.
,
Vicinanza
M.
and
Rubinsztein
D.C.
(
2013
)
Biology and trafficking of ATG9 and ATG16L1, two proteins that regulate autophagosome formation
.
FEBS Lett.
587
,
1988
1996
35
Mizushima
N.
,
Levine
B.
,
Cuervo
A.M.
and
Klionsky
D.J.
(
2008
)
Autophagy fights disease through cellular self-digestion
.
Nature
451
,
1069
1075
36
Lebovitz
C.B.
,
Robertson
A.G.
,
Goya
R.
,
Jones
S.J.
,
Morin
R.D.
,
Marra
M.A.
et al
(
2015
)
Cross-cancer profiling of molecular alterations within the human autophagy interaction network
.
Autophagy
11
,
1668
1687

Author notes

*

These authors contributed equally to this work.

This is an open access article published by Portland Press Limited on behalf of the Biochemical Society and distributed under the Creative Commons Attribution License 4.0 (CC BY).

Supplementary data