Host genotype may be closely related to the different outcomes of Hepatitis B virus (HBV) infection. To identify the association of variants and HBV infection, we comprehensively investigated the cytokine- and immune-related gene mutations in patients with HBV associated hepatocellular carcinoma (HBV-HCC). Fifty-three HBV-HCC patients, 53 self-healing cases (SH) with HBV infection history and 53 healthy controls (HCs) were recruited, the whole exon region of 404 genes were sequenced at >900× depth. Comprehensive variants and gene levels were compared between HCC and HC, and HCC and SH. Thirty-nine variants (adjusted P<0.0001, Fisher’s exact test) and 11 genes (adjusted P<0.0001, optimal unified approach for rare variant association test (SKAT-O) gene level test) were strongly associated with HBV-HCC. Thirty-four variants were from eight human leukocyte antigen (HLA) genes that were previously reported to be associated with HBV-HCC. The novelties of our study are: five variants (rs579876, rs579877, rs368692979, NM_145007:c.*131_*130delTG, NM_139165:exon5:c.623-2->TT) from three genes (REAT1E, NOD-like receptor (NLR) protein 11 (NLRP11), hydroxy-carboxylic acid receptor 2 (HCAR2)) were found strongly associated with HBV-HCC. We found 39 different variants in 11 genes that were significantly related to HBV-HCC. Five of them were new findings. Our data implied that chronic hepatitis B patients who carry these variants are at a high risk of developing HCC.

Introduction

Hepatitis B virus (HBV) affected more than 248 million individuals worldwide [1] and caused deaths of 500000–1.2 million each year [2]. The HBV infection outcomes including self-healing and persistent infection, are associated with viral factors, environmental factors, and host genetic factors [3]. Host immune responses, such as virus recognition, antigen processing and presentation, as well as immune regulation are associated with pathogen infection and clearance [4]. The innate immunity plays important roles in immunopathology and treatment of HBV infection [5]. Toll-like receptors (TLRs) and innate immune sensors of pathogen serve as immune regulators of both innate and adaptive immune responses [6]. Recent study showed that young mice with TLR4 mutation exhibit rapid HBV clearance [7]. NOD-like receptor (NLR), another immune sensor can sense and react to viral infection through the inflammasomes [8,9]. The adaptive immunity genes such as human leukocyte antigen (HLA), have been widely studied in the HBV infection by genome-wide association study (GWAS) [1014]. Polymorphisms of some cytokine genes are also associated with the outcomes of patients with HBV infection [1518]. With the advances in high-throughput sequencing (HTS), some rare variants have been found and associated with HBV infection. To identify the variants associated with outcomes of patients with HBV infection, we systematically sorted and sequenced 404 genes related to innate and adaptive immunity, cytokine and cytokine receptors, and immune regulator genes in Chinese population infected with/without HBV infection. The identification of variants associated with the outcome of patients with HBV infection helps physicians treat the patients more specifically.

Materials and methods

Study subjects and sample collections

Three groups were included in the present study: hepatocellular carcinoma (HCC) group individuals who had HBV infection history and self-healed (self-healing (SH)) and healthy controls (HCs). The participants were from the First, Second, Third, and Fourth Hospital of Hebei Medical University (Shijiazhuang, China) and the Fifth Hospital of Shijiazhuang (Shijiazhuang, China) between January 2015 and January 2016. HCC diagnosis was according to the guidelines of the America Association for the Study of Liver Diseases (AASLD) [19]. HCC patients were seropositive for HBsAg or had HBV infection history. Self-healing HBV patients had no previous HBV immunization and the liver enzymes were normal, seropositive for HBsAb and HBeAb, and seronegative for HBsAg, HBeAg, and HBV DNA. HCs had normal liver enzymes, seronegative for HBcAb, HBeAb, HBeAg, HBsAb, and HBsAg, no previous HBV immunization, and no endocrine, cardiovascular, and kidney diseases, and other liver diseases history. All participants had written informed consents. The protocol of the present study was in accordance with the Declaration of Helsinki, and was approved by the Human Ethic Committee of the Second Hospital of Hebei Medical University. Five milliliters of whole blood were drawn and stored at −80°C until use. DNA was extracted from whole blood samples using an Invitrogen PureLink Genomic DNA Mini Kit (Thermo Fisher, Foster City, CA, U.S.A.).

Cytokines and immune genes search and gene panel design

The cytokines and cytokine receptors, TLRs, NLRs, HLA family genes, T-cell activation, and co-stimulation genes, natural killer cell target genes, G-protein-coupled receptor genes such as free fatty acid receptor (FFAR), hydroxy-carboxylic acid receptor (HCAR) family genes were sorted according to the HUGO Gene Nomenclature Committee (HGNC) database [20]. TargetSeq™ (iGeneTech, Beijing, China), an RNA probe based liquid phase chips were used to capture the whole exome region of selected genes.

Targetted region sequencing

The concentration of DNA was determined using a Qubit dsDNA BR Assay Kit (Thermo Fisher, Foster City, CA, U.S.A.). Two microliters of sample DNA were used for sequencing. Using an automated SPRIworks System (Beckman Coulter, San Jose, CA, U.S.A.), the 200–500 bp size libraries were constructed with a TruSeq DNA Sample Preparation Kit (Illumina, San Diego, CA, U.S.A.). Then the small (200–500 bp) size libraries were further used for capturing using TargetSeq™ liquid chip capture sequencing kits (iGeneTech, Beijing, China) according to the manufacturer’s instructions. In short, before the hybrid capture, small size libraries were mixed with Hybridization Block (iGeneTech, Beijing, China) to avoid any repeating sequences to form hybrid itself. And then, melting the Hybridization Buffer at room temperature and preheating Hybridization Buffer in 65°C water bath. After the solution completely dissolved, 20 µl Hybridization Buffer was mixed with 20 μl small-size library in a PCR tube, and 5 µl RNase block (Thermo Fisher, Foster City, CA, U.S.A.) was mixed with ssRNA probe to prevent probe degradation. The purpose of liquid phase hybrid was to capture objective DNA fragments by ssRNA probe complementary pairing. The Hybridization capture was performed in ABI 2720 PCR (Thermo Fisher, Foster City, CA, U.S.A.) at 65°C overnight for incubation. After hybridization, the DNA:RNA hybrid was enriched by biotin-labeled magnetic beads (Thermo Fisher, Foster City, CA, U.S.A.). Finally, the targetted sequences were amplified in ABI 2720 PCR. PCR parameters were: 95°C for 4 min, 98°C for 20 s, 65°C for 30 s, 16 cycles, 72°C for 30 s, 72°C for 5 min, and 12°C hold. PCR reagents were KAPA Taq PCR Kits (KAPA Biosystems, Boston, Massachusetts, U.S.A.) and Nextflex primers were synthesized by Invitrogen (Thermo Fisher, Foster City, CA, U.S.A.). The quality of amplified library was determined by using an Agilent 2100 Bioanalyzer (Agilent Technologies, Santa Clara, CA, U.S.A.), and the library DNA concentration was again determined by Qubit dsDNA BR assay kit according to the manufacturer’s instructions. Libraries with good quality and DNA concentration >3 ng/μl were sequenced using an Illumina Hiseq X-ten sequencer (Illumina, San Diego, CA, U.S.A.).

Bioinformatics analyses

Data QC

The adaptor sequences and raw reads with low quality reads were filtered using Trimmomatic software [21]. The adaptor sequences were GATCGGAAGAGCACACGTCT and AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT, the criterion of low-quality sequence was the quality value of no more than Q20 or the accuracy of no more than 99%. The bases length should be longer than 40 bp after removing the base that does not meet the criteria. Finally fastqc software (http://www.bioinformatics.bbsrc.ac.uk/projects/fastqc/) was used to measure data quality to make sure that 95% of the remaining reads or clean reads with quality were more than Q30.

Variants calling

The clean reads were aligned to the reference human genome (February 2009, hg19, GRCh37, downloaded from UCSC) by BWA MEM software [22] to generate BAM files. In order to improve the accuracy, the samtools [23] and picard software (http://broadinstitute.github.io/picard/) were used to remove PCR repetitive sequence. The Genome Analysis Toolkit (GATK) [24] was used to detect the variants such as SNPs and InDels in BAM files. Finally, ANNOVAR software [25] was used to annotate the variants.

Functional effect of variants

Phenolyzer [26] was used to predict the association between the genotype and phenotype of HBV infection.

Association testing

Both single-variant and gene-based tests were performed. For single-variant based test, Fisher’s exact test was used to compare the different variants between HCC/control groups or subgroup, the false discovery rate (FDR) adjusted P-value <0.001 was considered significant. For gene-based tests, optimal unified approach for rare variant association test (SKAT-O) [27], a rare-variant association test used in small-sample case–control genome study, was used to assess excess-risk mutations in HCC/controls and subgroups. Default setting was used and significance were defined at FDR adjusted P-value <0.0001.

Results

Study subjects

A total of 53 HCC patients, 53 SH cases with previous HBV infection and 53 HCs were recruited, the clinical characteristics and statistics of study subjects were listed in Table 1.

Table 1
Demographics
HCCHCSH
Gender, male/female 45/8 26/27 30/23 
Age, M (Q) 56.0 (11.50) 34.0 (16.0) 55.0 (19.0) 
Drinking, no/yes 40/13 46/7 43/10 
Smoking, no/yes 41/12 46/7 41/12 
HBV DNA, M (Q) 3200 (30842) 
HbsAg, (+/−) 41/12 0/53 0/53 
HbeAg, (+/−) 17/36 0/53 0/53 
Anti-Hbe, (+/−) 7/11 
ALT, M (Q) 38.0 (68.8) 
AST, M (Q) 58.0 (72.5) 
AFP, M (Q) 161.2 (1070.0) 
HCCHCSH
Gender, male/female 45/8 26/27 30/23 
Age, M (Q) 56.0 (11.50) 34.0 (16.0) 55.0 (19.0) 
Drinking, no/yes 40/13 46/7 43/10 
Smoking, no/yes 41/12 46/7 41/12 
HBV DNA, M (Q) 3200 (30842) 
HbsAg, (+/−) 41/12 0/53 0/53 
HbeAg, (+/−) 17/36 0/53 0/53 
Anti-Hbe, (+/−) 7/11 
ALT, M (Q) 38.0 (68.8) 
AST, M (Q) 58.0 (72.5) 
AFP, M (Q) 161.2 (1070.0) 

Abbreviations: AFP, α-fetoprotein; ALT, Alanine aminotransferase; Anti-Hbe, antibody to HBeAg; AST, aspartate aminotransferase; HbeAg, HBV E antigen; HbsAg, HBV surface antigen; M, mean; Q, quartile.

Targetted gene investigations

A total of 404 genes or coding region of ~500 kilo (K) bp, were sorted according to HGNC database, including the whole cytokine and receptor family genes, some innate immunity and adaptive immunity related genes which reported as pathogen sensors (Table 2). The cytokine and receptor family genes were: 43 interleukin (IL) family genes, 42 IL receptor genes, 21 interferon (IFN) genes, 5 IFN receptor genes, 45 chemokine ligand (CCL) genes, 24 chemokine receptor genes, 18 tumor necrosis factor genes, and 29 tumor necrosis factor receptor genes. The innate genes included 10 TLR genes, and 22 NLRs family genes. The adaptive immunity genes comprised 27 MHC-related genes, 18 T-cell inhibition and co-inhibition related genes, 28 T-cell activation and co-stimulation genes. Other immune response related genes were: 37 natural killer cell target genes, 54 G-protein-coupled receptor genes, and 16 other genes.

Table 2
Summary of genes investigated in the study
GroupSubgroup and gene numbers
Cytokines and receptors ILs and receptors, n=85; IFNs and receptors, n=26; chemokines and receptors, n=69; tumor necrosis factor and receptors, n=47 
Innate immunity TLRs, n=10; NLRs, n=22 
Adaptive immunity MHCs, n=27; T-cell inhibitors, n=18; T-cell activators, n=28 
Others GPCRs, n=54; natural killer cell targets, n=37, others, n=16; 
GroupSubgroup and gene numbers
Cytokines and receptors ILs and receptors, n=85; IFNs and receptors, n=26; chemokines and receptors, n=69; tumor necrosis factor and receptors, n=47 
Innate immunity TLRs, n=10; NLRs, n=22 
Adaptive immunity MHCs, n=27; T-cell inhibitors, n=18; T-cell activators, n=28 
Others GPCRs, n=54; natural killer cell targets, n=37, others, n=16; 

Abbreviation: GPCR, G-protein-coupled receptor.

Targetted region sequencing performance

TRS yielded 10.84M clean reads (averaged read length was 143.65 bp) or 1577.94M clean bp for each sample, the average base quality was 40.26 and Q30 of call clean reads was 95.64%; the coverage rate of 499.968K region was 99.48%, duplication rate was 39.84%, and align rate was 99.23%; the capture rate was 50.53%. The target average depth was 919.55X, with target 10X rate was 99.31% and target 20X rate was 99.18%.

Variants and genes related to HBV associated with HCC

As shown in flowchart (Figure 1), both HC and self-healing groups were used as controls to identify variants and genes associated with HCC. The results of variant and gene level association test for each subgroup were listed in Table 3.

Flowchart of study design.

Figure 1
Flowchart of study design.

CC, hepatocellular carcinoma with hapatitis B virus infection; FDR, false discovery rate; SH, self-healing cases with previous hepatitis B virus infection; HC, healthy controls; SKAT-O, optimal unified approach for rare variant association test.

Figure 1
Flowchart of study design.

CC, hepatocellular carcinoma with hapatitis B virus infection; FDR, false discovery rate; SH, self-healing cases with previous hepatitis B virus infection; HC, healthy controls; SKAT-O, optimal unified approach for rare variant association test.

Table 3
Association of variants and genes with HBV associated with HCC
Gene symbolAssociated SNVsVariant level ORVariant level P-value (FDR adjusted)Numbers of SNVsSKAT-O gene level P-value (FDR adjusted)
HCC compared with HCHCC compared with SHHCC compared with HCHCC compared with SHHCC compared with HCHCC compared with SH
HLA-B rs2596493 Inf Inf 2.25E-18 3.59E-18 106 1.7232E-16 2.67597E-10 
HLA-B rs1131285 Inf Inf 1.7E-13 1.13E-13 106 1.7232E-16 2.67597E-10 
HLA-B rs1065386 Inf Inf 6.97E-09 6.97E-09 106 1.7232E-16 2.67597E-10 
HLA-B rs1050570 Inf Inf 1.87E-08 1.83E-08 106 1.7232E-16 2.67597E-10 
HLA-B rs1050556 Inf Inf 0.0000019 0.0000019 106 1.7232E-16 2.67597E-10 
HLA-B rs1131215 Inf Inf 0.0000623 0.0000619 106 1.7232E-16 2.67597E-10 
HLA-C rs41556617 Inf Inf 7.92E-12 6.79E-12 108 5.33706E-07 3.14762E-05 
HLA-C rs2308527 Inf Inf 0.000000801 0.00000074 108 5.33706E-07 3.14762E-05 
HLA-DPA1 rs1042174 16.63 28.69 0.000000899 3.15E-08 33 1.4521E-08 4.3979E-07 
HLA-DPA1 rs1126543 Inf Inf 2.9E-09 2.9E-09 33 1.4521E-08 4.3979E-07 
HLA-DPA1 rs2308930 Inf Inf 6.97E-09 6.97E-09 33 1.4521E-08 4.3979E-07 
HLA-DPA1 rs2308929 Inf Inf 6.97E-09 6.97E-09 33 1.4521E-08 4.3979E-07 
HLA-DPA1 rs1126542 Inf Inf 1.87E-08 1.83E-08 33 1.4521E-08 4.3979E-07 
HLA-DQA1 rs9272896 Inf Inf 0.0000116 0.0000113 81 3.33767E-07 1.30562E-05 
HLA-DQB1 rs1049055 36.19 75.53 2.7E-11 6.3E-14 110 9.04603E-10 7.65036E-10 
HLA-DQB1 rs1130430 19.53322682 11.3 0.00000465 0.0000835 110 9.04603E-10 7.65036E-10 
HLA-DQB1 rs1049057 Inf Inf 4.67E-08 4.18E-08 110 9.04603E-10 7.65036E-10 
HLA-DQB1 rs1063345 Inf Inf 0.00000465 0.0000045 110 9.04603E-10 7.65036E-10 
HLA-DQB1 rs1140316 Inf Inf 0.0000623 0.0000619 110 9.04603E-10 7.65036E-10 
HLA-DQB2 rs9276572 Inf Inf 2.05E-15 2.05E-15 21 5.04185E-06 0.000688766 
HLA-DRB1 rs17211105 18.48 18.48 3.21E-08 3.02E-08 126 1.08223E-14 1.74002E-11 
HLA-DRB1 rs9270299 12.56 16.04 0.00000974 0.00000051 126 1.08223E-14 1.74002E-11 
HLA-DRB1 rs17883134 44.09 20.97 1.07E-10 1.83E-08 126 1.08223E-14 1.74002E-11 
HLA-DRB1 rs9270303 20.97 20.97 1.95E-08 1.83E-08 126 1.08223E-14 1.74002E-11 
HLA-DRB1 rs2308759 353.69 214.66 5.04E-20 3.59E-18 126 1.08223E-14 1.74002E-11 
HLA-DRB1 rs17211091 18.04 96.28 0.000000363 1.61E-10 126 1.08223E-14 1.74002E-11 
HLA-DRB1 rs113734598 48.46 15.62 0.00000159 0.0000619 126 1.08223E-14 1.74002E-11 
HLA-DRB1 rs9269693 136.13 Inf 9.53E-13 3.74E-14 126 1.08223E-14 1.74002E-11 
HLA-DRB1 rs1064697 Inf Inf 0.000000124 0.000000107 126 1.08223E-14 1.74002E-11 
HLA-DRB1 rs1071752 Inf Inf 0.0000623 0.0000619 126 1.08223E-14 1.74002E-11 
HLA-DRB5 rs17211043 Inf Inf 0.000000124 0.000000107 83 4.77962E-10 2.52675E-06 
HLA-DRB5 rs77853982 Inf Inf 0.000000801 0.00000074 83 4.77962E-10 2.52675E-06 
HLA-DRB5 rs701884 38.71 Inf 0.0000245 0.0000019 83 4.77962E-10 2.52675E-06 
HLA-DRB5 rs1064587 35.87 Inf 0.000058 0.0000045 83 4.77962E-10 2.52675E-06 
HCAR2 rs579877 Inf Inf 0.0000277 0.000027 11 2.03163E-06 3.36441E-05 
HCAR2 rs579876 Inf Inf 0.0000277 0.000027 11 2.03163E-06 3.36441E-05 
NLRP11 NM_145007: c.*131_*130delTG 9.684525939 14.70656392 2.71228E-05 6.95927E-07 22 6.83802E-07 2.97726E-09 
NLRP11 rs368692979 17.64443693 32.53501457 8.81316E-08 8.54585E-10 22 6.83802E-07 2.97726E-09 
RAET1E NM_139165: exon5:c.623-2- >TT 16.6900097 20.59517629 1.0742E-07 9.68061E-09 21 0.000603407 3.07916E-05 
Gene symbolAssociated SNVsVariant level ORVariant level P-value (FDR adjusted)Numbers of SNVsSKAT-O gene level P-value (FDR adjusted)
HCC compared with HCHCC compared with SHHCC compared with HCHCC compared with SHHCC compared with HCHCC compared with SH
HLA-B rs2596493 Inf Inf 2.25E-18 3.59E-18 106 1.7232E-16 2.67597E-10 
HLA-B rs1131285 Inf Inf 1.7E-13 1.13E-13 106 1.7232E-16 2.67597E-10 
HLA-B rs1065386 Inf Inf 6.97E-09 6.97E-09 106 1.7232E-16 2.67597E-10 
HLA-B rs1050570 Inf Inf 1.87E-08 1.83E-08 106 1.7232E-16 2.67597E-10 
HLA-B rs1050556 Inf Inf 0.0000019 0.0000019 106 1.7232E-16 2.67597E-10 
HLA-B rs1131215 Inf Inf 0.0000623 0.0000619 106 1.7232E-16 2.67597E-10 
HLA-C rs41556617 Inf Inf 7.92E-12 6.79E-12 108 5.33706E-07 3.14762E-05 
HLA-C rs2308527 Inf Inf 0.000000801 0.00000074 108 5.33706E-07 3.14762E-05 
HLA-DPA1 rs1042174 16.63 28.69 0.000000899 3.15E-08 33 1.4521E-08 4.3979E-07 
HLA-DPA1 rs1126543 Inf Inf 2.9E-09 2.9E-09 33 1.4521E-08 4.3979E-07 
HLA-DPA1 rs2308930 Inf Inf 6.97E-09 6.97E-09 33 1.4521E-08 4.3979E-07 
HLA-DPA1 rs2308929 Inf Inf 6.97E-09 6.97E-09 33 1.4521E-08 4.3979E-07 
HLA-DPA1 rs1126542 Inf Inf 1.87E-08 1.83E-08 33 1.4521E-08 4.3979E-07 
HLA-DQA1 rs9272896 Inf Inf 0.0000116 0.0000113 81 3.33767E-07 1.30562E-05 
HLA-DQB1 rs1049055 36.19 75.53 2.7E-11 6.3E-14 110 9.04603E-10 7.65036E-10 
HLA-DQB1 rs1130430 19.53322682 11.3 0.00000465 0.0000835 110 9.04603E-10 7.65036E-10 
HLA-DQB1 rs1049057 Inf Inf 4.67E-08 4.18E-08 110 9.04603E-10 7.65036E-10 
HLA-DQB1 rs1063345 Inf Inf 0.00000465 0.0000045 110 9.04603E-10 7.65036E-10 
HLA-DQB1 rs1140316 Inf Inf 0.0000623 0.0000619 110 9.04603E-10 7.65036E-10 
HLA-DQB2 rs9276572 Inf Inf 2.05E-15 2.05E-15 21 5.04185E-06 0.000688766 
HLA-DRB1 rs17211105 18.48 18.48 3.21E-08 3.02E-08 126 1.08223E-14 1.74002E-11 
HLA-DRB1 rs9270299 12.56 16.04 0.00000974 0.00000051 126 1.08223E-14 1.74002E-11 
HLA-DRB1 rs17883134 44.09 20.97 1.07E-10 1.83E-08 126 1.08223E-14 1.74002E-11 
HLA-DRB1 rs9270303 20.97 20.97 1.95E-08 1.83E-08 126 1.08223E-14 1.74002E-11 
HLA-DRB1 rs2308759 353.69 214.66 5.04E-20 3.59E-18 126 1.08223E-14 1.74002E-11 
HLA-DRB1 rs17211091 18.04 96.28 0.000000363 1.61E-10 126 1.08223E-14 1.74002E-11 
HLA-DRB1 rs113734598 48.46 15.62 0.00000159 0.0000619 126 1.08223E-14 1.74002E-11 
HLA-DRB1 rs9269693 136.13 Inf 9.53E-13 3.74E-14 126 1.08223E-14 1.74002E-11 
HLA-DRB1 rs1064697 Inf Inf 0.000000124 0.000000107 126 1.08223E-14 1.74002E-11 
HLA-DRB1 rs1071752 Inf Inf 0.0000623 0.0000619 126 1.08223E-14 1.74002E-11 
HLA-DRB5 rs17211043 Inf Inf 0.000000124 0.000000107 83 4.77962E-10 2.52675E-06 
HLA-DRB5 rs77853982 Inf Inf 0.000000801 0.00000074 83 4.77962E-10 2.52675E-06 
HLA-DRB5 rs701884 38.71 Inf 0.0000245 0.0000019 83 4.77962E-10 2.52675E-06 
HLA-DRB5 rs1064587 35.87 Inf 0.000058 0.0000045 83 4.77962E-10 2.52675E-06 
HCAR2 rs579877 Inf Inf 0.0000277 0.000027 11 2.03163E-06 3.36441E-05 
HCAR2 rs579876 Inf Inf 0.0000277 0.000027 11 2.03163E-06 3.36441E-05 
NLRP11 NM_145007: c.*131_*130delTG 9.684525939 14.70656392 2.71228E-05 6.95927E-07 22 6.83802E-07 2.97726E-09 
NLRP11 rs368692979 17.64443693 32.53501457 8.81316E-08 8.54585E-10 22 6.83802E-07 2.97726E-09 
RAET1E NM_139165: exon5:c.623-2- >TT 16.6900097 20.59517629 1.0742E-07 9.68061E-09 21 0.000603407 3.07916E-05 

Abbreviations: Inf, infinite; HCAR2, hydroxy-carboxylic acid receptor 2; OR, odds ratio; NLRP11, NLR protein 11; RAET1E, retinoic acid early transcript 1E; SH, self-healing cases with previous HBV infection.

A total of 39 significantly different variants and 11 genes were identified. Thirty four of the variants were from eight HLA genes, including HLA-B, HLA-C, HLA-DPA1, HLA-DQA1, HLA-DQB1, HLA-DQB2, HLA-DRB1, and HLA-DRB5. We also identified five non-HLA variants in retinoic acid early transcript 1E (RAET1E), NLR protein 11 (NLRP11), and HCAR2. NM_139165:exon5:c.623-2->TT was located in RAET1E. The variants identified were significantly enriched in HCC patients, and rare or no variants were found enriched in controls. rs368692979 and NM_145007:c.*131_*130delTG were located in NLRP11, and were two of the top ten most significant variants (P-values were 6.72E-14 and 7.08E-11 in HCC compared with HC and HCC compared with self-healing, respectively). Previous studies showed that NLRP11 was related to inflammation [41]. These variants were also significantly enriched in HCC patients, and rare or no variants were found enriched in controls. rs579876 and rs579877 were located in 3′-UTR of HCAR2.

Discussion

The present study found that 39 variants in 11 genes were strongly associated with HBV associated with HCC (HBV-HCC). Amongst them, 34 variants from eight genes in HLA region were previously described and our data were consistent with previous studies [3035]. The novelties of our study are: five variants (rs579876, rs579877, rs368692979, NM_145007:c.*131_*130delTG, NM_139165:exon5:c.623-2->TT) from three genes (REAT1E, NLRP11, HCAR2) were found to be strongly associated with HBV-HCC. Our study provided fundamental data which needs further study to confirm the roles of these new variants and genes.

HBV infection is a serious public health problem [1]. Patients with HBV infection have different outcomes, such as self-healing, HBV carrier, chronic hepatitis, or HCC [4]. It has been found that the host genotype may be closely related to the different outcomes. Some HCC-related loci have been identified based on GWAS [1014,28]. However, these studies are mainly based on the common variants, and most of the variants are located in the non-gene region. It is difficult to verify the gene function and explore the mechanism of disease. Given that HTS methods such as whole exome sequencing (WES) or whole genome sequencing (WGS) focus on not only common but also rare variants, HTS has been widely used in complex disease genetics studies and shows promising results. WES has been successfully applied in HCC genetics research [29].

Large sample size is necessary for HCC studies. However, WES-based GWAS is very expensive. TRS, which targets the specific gene families or pathway genes, provides relatively cost-effective solution. The present study investigated the cytokines and immune genes associated with HCC. We selected 404 genes that may be associated with HBV infection. These genes are mainly involved in antigen recognition, processing and presentation, immune regulatory cytokines and receptors, as well as those included in innate immune system, such as TLRs and NLRs. We have also studied some genes that are directly related to immune checkpoint.

We included SH cases because we speculated that they may carry less risk mutations or carry more protective mutations. Previous study demonstrated that the performance of gene level associated/burden test is reliable in WES/WGS study even in a small sample size in WES/WGS study [27]. The present study performed a comprehensive variants and gene level association analysis between both HCC compared with HC and HCC compared with SH. We found that 39 variants and 11 genes were strongly associated with HBV-HCC.

Not surprisingly, 34 variants from eight genes in HLA region were found strongly associated with HBV-HCC. Our data were consistent with previous studies [3035]. We found five new variants from three genes that are also strongly related to HBV-HCC.

RAET1E is an MHC class I related gene from the RAET1 family, which functions as a ligand for the NKG2D receptor. NKG2D receptors are expressed on the surface of several types of immune cells and are involved in both innate and adaptive immune responses [36]. Previous studies showed that reduced NKG2D ligand expression in HCC correlates with early recurrence [37], and that the immunoreceptor NKG2D promotes tumor growth in a model of HCC [38]. Consistent with these studies, we found that a splicing variant in RAET1E, NM_139165:exon5:c.623-2->TT, might lead to malfunction of RAET1E, a ligand for the NKG2D receptor. As NKG2D receptor blockade is an attractive target for HCC therapy [39], further research will be necessary to study how RAET1E may be involved in HBV-associated HCC and develop candidate drugs.

NLRP11 is a member of the NLR gene family, which is reported to be closely related to antiviral immunity [40]. Although little is known about whether NLRP11 is involved in HBV infection, another member of the NLR family, NLRP3, is involved in danger signal inflammatory responses [41]. Furthermore, the four variants identified, including rs368692979 and NM_145007:c.*131_*130delTG in NLRP11, together with rs579876 and rs579877 in HCAR2, a gene closely related to immune activation [42], were all from the 3′-UTR region, which suggests that the expression of NLRP11 and HCAR2 might be under the regulation of miRNA.

Conclusion

Our comprehensive investigation of cytokine- and immune-related gene mutations in HBV-HCC patients and controls showed that 39 different variants and 11 genes were significantly related to HBV-HCC. Our data implied that chronic hepatitis B patients who carry these variants need intensive monitoring.

Funding

This work was supported by the National Natural Science Foundation of China [grant number 81402729]; and the Natural Science Foundation of Hebei Province [grant number H2015206152].

Competing interests

The authors declare that there are no competing interests associated with the manuscript.

Author contribution

Fengxue Yu, Xiaolin Zhang and Mingbang Wang conducted the research design; Suzhai Tian, Lianxia Geng, Chaojun Zhang, Lina Guo and Wenting An performed DNA extracting; Weili Xu, Yuan Jia, Xuechen Liu, Junji Ma and Yuan Quan collected the samples; Fengxue Yu, Ning Ma, Xiaolin Zhang, Mingbang Wang and Dianwu Liu analyzed the data.

Abbreviations

     
  • BAM

    Binary Alignment/Map

  •  
  • FDR

    false discovery rate

  •  
  • GWAS

    genome-wide association study

  •  
  • HbsAg

    Hepatitis B surface antigen

  •  
  • HBeAg

    Hepatitis B e antigen

  •  
  • HBcAb

    Hepatitis B core antibody

  •  
  • HBeAb

    Hepatitis B e antibody

  •  
  • HBV

    hepatitis B virus

  •  
  • HBV-HCC

    HBV associated hepatocellular carcinoma

  •  
  • HC

    healthy control

  •  
  • HCAR2

    hydroxy-carboxylic acid receptor 2

  •  
  • HCC

    hepatocellular carcinoma

  •  
  • HGNC

    HUGO Gene Nomenclature Committee

  •  
  • HLA

    human leukocyte antigen

  •  
  • HTS

    high-throughput sequencing

  •  
  • IFN

    interferon

  •  
  • IL

    interleukin

  •  
  • NLR

    NOD-like receptor

  •  
  • NLRP11

    NOD-like receptor protein 11

  •  
  • NOD

    nucleotide-binding oligomerization domain

  •  
  • RAET

    retinoic acid early transcript

  •  
  • RAET1E

    retinoic acid early transcript 1E

  •  
  • SH

    self-healing case

  •  
  • SNV

    Single Nucleotide Variant

  •  
  • TLR

    toll-like receptor

  •  
  • TRS

    target region sequencing

  •  
  • QC

    quality control

  •  
  • WES

    whole exome sequencing

  •  
  • WGS

    whole genome sequencing

References

References
1
Schweitzer
A.
et al
(
2015
)
Estimations of worldwide prevalence of chronic hepatitis B virus infection: a systematic review of data published between 1965 and 2013
.
Lancet
386
,
1546
1555
2
Lavanchy
D.
(
2004
)
Hepatitis B virus epidemiology, disease burden, treatment, and current and emerging prevention and control measures
.
J. Viral Hepat.
11
,
97
107
3
Rehermann
B.
and
Bertoletti
A.
(
2015
)
Immunological aspects of antiviral therapy of chronic hepatitis B virus and hepatitis C virus infections
.
Hepatology
61
,
712
721
4
Rehermann
B.
and
Nascimbeni
M.
(
2005
)
Immunology of hepatitis B virus and hepatitis C virus infection
.
Nat. Rev. Immunol.
5
,
215
229
5
Maini
M.K.
and
Gehring
A.J.
(
2016
)
The role of innate immunity in the immunopathology and treatment of HBV infection
.
J. Hepatol.
64
(
1 Suppl.
),
S60
S70
6
Akira
S.
and
Takeda
K.
(
2004
)
Toll-like receptor signalling
.
Nat. Rev. Immunol.
4
,
499
511
7
Chou
H.H.
et al
(
2015
)
Age-related immune clearance of hepatitis B virus infection requires the establishment of gut microbiota
.
Proc. Natl. Acad. Sci. U.S.A.
112
,
2175
2180
8
Franchi
L.
,
Munoz-Planillo
R.
and
Nunez
G.
(
2012
)
Sensing and reacting to microbes through the inflammasomes
.
Nat. Immunol.
13
,
325
332
9
Kanneganti
T.D.
(
2010
)
Central roles of NLRs and inflammasomes in viral infection
.
Nat. Rev. Immunol.
10
,
688
698
10
Jiang
D.K.
et al
(
2015
)
Genetic variants in five novel loci including CFB and CD40 predispose to chronic hepatitis B
.
Hepatology
62
,
118
128
11
Kim
Y.J.
et al
(
2013
)
A genome-wide association study identified new variants associated with the risk of chronic hepatitis B
.
Hum. Mol. Genet.
22
,
4233
4238
12
Hu
Z.
et al
(
2013
)
New loci associated with chronic hepatitis B virus infection in Han Chinese
.
Nat. Genet.
45
,
1499
1503
13
Mbarek
H.
et al
(
2011
)
A genome-wide association study of chronic hepatitis B identified novel risk locus in a Japanese population
.
Hum. Mol. Genet.
20
,
3884
3892
14
Kamatani
Y.
et al
(
2009
)
A genome-wide association study identifies variants in the HLA-DP locus associated with chronic hepatitis B in Asians
.
Nat. Genet.
41
,
591
595
15
Yucesoy
B.
et al
(
2002
)
IL-1beta gene polymorphisms influence hepatitis B vaccination
.
Vaccine
20
,
3193
3196
16
Hohler
T.
et al
(
2005
)
A functional polymorphism in the IL-10 promoter influences the response after vaccination with HBsAg and hepatitis A
.
Hepatology
42
,
72
76
17
Sodsai
P.
et al
(
2013
)
Association of cytokine and cytokine receptor gene polymorphisms with the risk of chronic hepatitis B
.
Asian Pac. J. Allergy Immunol.
31
,
277
285
18
Gao
Q.J.
et al
(
2009
)
Polymorphisms of some cytokines and chronic hepatitis B and C virus infection
.
World J. Gastroenterol.
15
,
5610
5619
19
Bruix
J.
,
Sherman
M.
and (
2011
)
Management of hepatocellular carcinoma: an update
.
Hepatology
53
,
1020
1022
20
Gray
K.A.
et al
(
2015
)
Genenames.org: the HGNC resources in 2015
.
Nucleic Acids Res.
43
,
D1079
D1085
21
Bolger
A.M.
,
Lohse
M.
and
Usadel
B.
(
2014
)
Trimmomatic: a flexible trimmer for Illumina sequence data
.
Bioinformatics
30
,
2114
2120
22
Li
H.
(
2014
)
Toward better understanding of artifacts in variant calling from high-coverage samples
.
Bioinformatics
30
,
2843
2851
23
Li
H.
et al
(
2009
)
The Sequence Alignment/Map format and SAMtools
.
Bioinformatics
25
,
2078
2079
24
McKenna
A.
et al
(
2010
)
The Genome Analysis Toolkit: a MapReduce framework for analyzing next-generation DNA sequencing data
.
Genome Res.
20
,
1297
1303
25
Wang
K.
,
Li
M.
and
Hakonarson
H.
(
2010
)
ANNOVAR: functional annotation of genetic variants from high-throughput sequencing data
.
Nucleic Acids Res.
38
,
e164
26
Yang
H.
,
Robinson
P.N.
and
Wang
K.
(
2015
)
Phenolyzer: phenotype-based prioritization of candidate genes for human diseases
.
Nat. Methods
12
,
841
843
27
Lee
S.
et al
(
2012
)
Optimal unified approach for rare-variant association testing with application to small-sample case-control whole-exome sequencing studies
.
Am. J. Hum. Genet.
91
,
224
237
28
Li
Y.
et al
(
2016
)
Genome-wide association study identifies 8p21.3 associated with persistent hepatitis B virus infection among Chinese
.
Nat. Commun.
7
,
11664
29
Zhao
Q.
et al
(
2012
)
Rare inborn errors associated with chronic hepatitis B virus infection
.
Hepatology
56
,
1661
1670
30
Mathew
S.
et al
(
2016
)
Host nucleotide polymorphism in hepatitis B virus-associated hepatocellular carcinoma
.
World J. Hepatol.
8
,
485
498
31
Malmassari
S.L.
et al
(
2007
)
Impact of hepatitis B virus basic core promoter mutations on T cell response to an immunodominant HBx-derived epitope
.
Hepatology
45
,
1199
1209
32
Posuwan
N.
et al
(
2014
)
Genetic association of human leukocyte antigens with chronicity or resolution of hepatitis B infection in thai population
.
PLoS ONE
9
,
e86007
33
Liu
X.
et al
(
2016
)
Polymorphisms of HLA-DQB1 predict survival of hepatitis B virus-related hepatocellular carcinoma patients receiving hepatic resection
.
Clin. Res. Hepatol. Gastroenterol.
40
,
739
747
34
Kurokohchi
K.
et al
(
1996
)
Expression of HLA class I molecules and the transporter associated with antigen processing in hepatocellular carcinoma
.
Hepatology
23
,
1181
1188
35
Li
S.
et al
(
2012
)
GWAS identifies novel susceptibility loci on 6p21.32 and 21q21.3 for hepatocellular carcinoma in chronic hepatitis B virus carriers
.
PLoS Genet.
8
,
e1002791
36
Muntasell
A.
et al
(
2017
)
Targeting NK-cell checkpoints for cancer immunotherapy
.
Curr. Opin. Immunol.
45
,
73
81
37
Kamimura
H.
et al
(
2012
)
Reduced NKG2D ligand expression in hepatocellular carcinoma correlates with early recurrence
.
J. Hepatol.
56
,
381
388
38
Sheppard
S.
et al
(
2017
)
The immunoreceptor NKG2D promotes tumour growth in a model of hepatocellular carcinoma
.
Nat. Commun.
8
,
13930
39
Vilarinho
S.
et al
(
2007
)
Blockade of NKG2D on NKT cells prevents hepatitis and the acute immune response to hepatitis B virus
.
Proc. Natl. Acad. Sci. U.S.A.
104
,
18187
18192
40
Lupfer
C.
and
Kanneganti
T.D.
(
2013
)
The expanding role of NLRs in antiviral immunity
.
Immunol. Rev.
255
,
13
24
41
Baroja-Mazo
A.
et al
(
2014
)
The NLRP3 inflammasome is released as a particulate danger signal that amplifies the inflammatory response
.
Nat. Immunol.
15
,
738
748
42
Feingold
K.R.
et al
(
2014
)
Inflammation stimulates niacin receptor (GPR109A/HCA2) expression in adipose tissue and macrophages
.
J. Lipid Res.
55
,
2501
2508

Author notes

*

These authors contributed equally to this work.

This is an open access article published by Portland Press Limited on behalf of the Biochemical Society and distributed under the Creative Commons Attribution License 4.0 (CC BY).