Abstract

Interleukin (IL)-17 have been reported to be associated with the pathogenesis of colorectal cancer (CRC). Few studies investigated the association between IL-17 gene polymorphisms and risk of CRC with inconsistent findings. Thus, we recruited 352 CRC cases and 433 controls in a Chinese population and their genotyping was done using polymerase chain reaction-restriction fragment length polymorphism method. Our data showed that IL-17A rs2275913 polymorphism was associated with the increased risk of CRC, while no association was observed for IL-17F rs763780 polymorphism. Stratified analyses revealed that the significant association was also obtained in the females, smokers, drinkers and age ≥ 60 years groups for rs2275913 polymorphism. Moreover, the CC and/or GC genotype of rs2275913 polymorphism were correlated with TNM stage and lymph node metastasis. No association was shown between IL-17F rs763780 polymorphism and clinical characteristics of CRC. In conclusion, our data indicate that IL-17A rs2275913 polymorphism but not IL-17F rs763780 polymorphism contributes to increased risk for CRC patients in this Chinese population.

Introduction

Colorectal cancer (CRC) is the third most common cancer and the fourth most common cause of cancer death [1]. More than 1.2 million patients are diagnosed with CRC annually and more than 600,000 die from this disorder [2]. It is well known that environmental and inherited genetic factors made great contributions to susceptibility to CRC [3]. Genome-wide association studies (GWAS) and meta-analysis using 1000 Genomes for imputation have identified novel risk variants for CRC patients [4].

Two inflammatory cytokines, Interleukin (IL)-17A and IL-23, produced by myeloid cells and different lymphocyte subsets, have been implicated in the pathogenesis of inflammatory associated cancers such as CRC [5]. The up-regulation of IL-17 ad IL-23 was observed in a mouse model of colorectal tumorigenesis [6]. In CRC, elevated expression of IL-17A was associated with adverse prognostic outcome and rapid progression to metastatic disease [7]. Th17-type cytokines (IL-17A, IL-17F, IL-21, IL-22), IL-6 and tumor necrosis factor-α synergistically activate STAT3 and NF-κB to promote CRC growth [8]. Single-nucleotide polymorphism (SNP) in IL-17 gene may influence genomic stability and increase the production of IL-17, thereby conferring susceptibility to CRC [9].

Many studies have investigated the association between IL-17 gene polymorphisms and risk of CRC [9–15], mainly focusing on two polymorphisms (rs2275913, IL-17A; rs763780, IL-17F). However, their findings were conflicting. Furthermore, there is no study to investigate the association between IL-17A rs2275913 polymorphism and risk of CRC in a Chinese population. In addition, only one study [12] has thrown lights on the rs763780 polymorphism for Chinese population. Therefore, we conducted this hospital-based case–control study to evaluate the effects of IL-17A rs2275913 and IL-17F rs763780 polymorphisms on the risk of CRC.

Patients and methods

Subjects

In the present study, 352 CRC patients with newly histopathologically diagnosed CRC and 433 sex- and age-matched controls were recruited from Zhejiang Cancer Hospital, Taizhou Cancer Hospital, Quzhou Kecheng People’s Hospital and Lanxi People’s Hospital from May 2012 to May 2018. No patients had received radiotherapy or chemotherapy prior to surgery. Approximately 58.2% of CRC patients were rectal cancer and were classified according to the American Joint Committee on cancer (AJCC) classification system. The control groups were selected from individuals receiving health examinations at the same period. The individuals with family history of cancer or digestive diseases were excluded.

Data on demographic and risk factor information for all subjects were obtained using a self-designed questionnaire, including body mass index (BMI), smoking status, alcohol consumption and family history of cancer. The individuals who smoked at least one cigarette per day at least one year was defined as “smoker”. Individuals were defined as drinkers if they drank alcohol at least once a week for more than 1 year. Subjects with at least one first-degree relative or two second-degree relatives having CRC were defined as having family history of cancer. We obtained clinical information about C-reactive protein (CRP); erythrocyte sedimentation rate (ESR); TNM stage, localization of tumor, tumor size, differentiation, lymph node metastasis and histopathological characteristics from the medical record. The study was approved by the Ethics Committee of the above four hospitals and met the standards of Declaration of Helsinki. Written informed consent was obtained from each subject.

Blood sampling and genotyping

Peripheral blood (2 ml) was taken from all subjects and genomic DNA was extracted from peripheral blood using the TIANamp Blood DNA kit (Tiangen Biotech, Beijing, China) according to manufacturer’s instructions. The quality and concentration of extracted DNA was measured in two OD wavelength 260 and 280 nm using NanoDrop (Thermo Scientific, U.S.A.). SNP genotyping was performed using polymerase chain reaction-restriction fragment length polymorphism method. The primers used for the nucleotide extension reaction were AACAAGTAAGAATGAAAAGAGGACATGGT (forward) and CCCCCAATGAGGTCATAGAAGAATC (reverse) for rs2275913 and ACCAAGGCTGCTCTGTTTCT (forward) and GGTAAGGAGTGGCATTTCTA (reverse) for rs763780 polymorphism. For PCR, 25 μl reaction mixture contained as follows: 2.5 μl of 10× reaction buffer (with 1.5 mM MgCl2), 2 μl of deoxynucleotide triphosphate (dNTP; 2.5 mM), 2 μl of each pair primer, 50 ng DNA template, 1 μl of 0.4U Taq polymerase (Applied Biosystems, Evry, France) and 14.5 μl ddH2O. The cycling program involved preliminary denaturation at 94°C for 5 min, followed by 35 cycles of 94°C for 30 s, 57°C for 30 s, and 72°C for 30 s with a final extension at 72°C for 8 min. The digested PCR products were with XagI (Fermentas, Lithuania) for IL-17A rs2275913 polymorphism and NlaIII (BioLabs, England) for IL-17F rs763780 polymorphism overnight at 37°C. The PCR products were analyzed by horizontal electrophoresis on an ethidium bromide-stained agarose gel (2% w/v) and then photographed. About 4% of selected samples were reconfirmed with direct sequencing to ensure the genotyping accuracy.

Statistical analysis

The demographic variables were expressed as means ± standard deviation (continuous variables) and frequencies and percentages (categorical variables) respectively. Differences between means were compared by Student’s t-test or Mann–Whitney U test (where the data were not distributed normally). The chi-square test was used to evaluate the differences in frequency distributions of categorical between cases and controls. The Hardy–Weinberg equilibrium (HWE) was applied to test for deviation between observed and expected frequencies among controls using a goodness-of-fit chi-square test. The SNP-associated disease risk was assessed with logistic regression analysis adjusted for age and sex. P < 0.05 were considered statistically significant. All statistical analyses were conducted using SPSS 22.0 software (SPSS Inc., Chicago, U.S.A.).

Results

Characteristics of the study population

The demographic and medical data of participants are shown in Table 1. The mean age of CRC patients was 62.27 years compared with 62.38 years of control groups, which revealed no statistically difference (P = 0.848). The distribution of sex, smoking, BMI and drinking did not differ significantly. Among the 352 cases, 215 (61.1%) were adenocarcinoma; 123 (34.9%) were squamous cell carcinoma; and 14 (4.0%) were other types of CRC. We have also investigated other clinical information of CRC patients, including histological grade, TNM stage, tumor size and lymph node metastasis.

Table 1
Patient demographics and risk factors in colorectal cancer.
Characteristics Case (N = 352) Control (N = 433) P 
Age, years 62.27 ± 8.10 62.38 ± 7.78 0.848 
Sex   0.629 
  Male 69 (19.6%) 79 (18.2%)  
  Female 283 (80.4%) 354 (81.8%)  
BMI, kg/m2 25.12 ± 4.00 24.84 ± 3.80 0.306 
Smoking   0.361 
  Yes 192 (54.5%) 222 (51.3%)  
  No 160 (45.5%) 211 (48.7%)  
Alcohol   0.774 
  Yes 206 (58.5%) 249 (57.5%)  
  No 146 (41.5%) 184 (42.5%)  
CRP, mg/l 7.73 ± 17.38   
ESR, mm/h 10.85 ± 12.00   
Family history    
  Yes 47 (13.4%)   
  No 305 (86.6%)   
Histological grade    
  Well differentiated 34 (9.7%)   
  Moderately differentiated 275 (78.1%)   
  Poorly differentiated 43 (12.2%)   
TNM stage    
  I+II 192 (54.5%)   
  III+IV 160 (45.5%)   
Tumor size    
  >5 cm 202 (57.4%)   
  ≤5 cm 150 (42.6%)   
Lymph node metastasis    
  No 230 (65.3%)   
  Yes 122 (34.7%)   
Histology    
  Adenocarcinoma 338 (96.0%)   
  Squamous cell carcinoma 10 (2.8%)   
Others 4 (1.2%)   
Characteristics Case (N = 352) Control (N = 433) P 
Age, years 62.27 ± 8.10 62.38 ± 7.78 0.848 
Sex   0.629 
  Male 69 (19.6%) 79 (18.2%)  
  Female 283 (80.4%) 354 (81.8%)  
BMI, kg/m2 25.12 ± 4.00 24.84 ± 3.80 0.306 
Smoking   0.361 
  Yes 192 (54.5%) 222 (51.3%)  
  No 160 (45.5%) 211 (48.7%)  
Alcohol   0.774 
  Yes 206 (58.5%) 249 (57.5%)  
  No 146 (41.5%) 184 (42.5%)  
CRP, mg/l 7.73 ± 17.38   
ESR, mm/h 10.85 ± 12.00   
Family history    
  Yes 47 (13.4%)   
  No 305 (86.6%)   
Histological grade    
  Well differentiated 34 (9.7%)   
  Moderately differentiated 275 (78.1%)   
  Poorly differentiated 43 (12.2%)   
TNM stage    
  I+II 192 (54.5%)   
  III+IV 160 (45.5%)   
Tumor size    
  >5 cm 202 (57.4%)   
  ≤5 cm 150 (42.6%)   
Lymph node metastasis    
  No 230 (65.3%)   
  Yes 122 (34.7%)   
Histology    
  Adenocarcinoma 338 (96.0%)   
  Squamous cell carcinoma 10 (2.8%)   
Others 4 (1.2%)   

BMI, body mass index; CRP, C-reactive protein; ESR, erythrocyte sedimentation rate; TNM, tumor node metastasis.

IL-17 gene polymorphisms analysis

The product lengths (bp) of different genotypes were as following: AA: 102bp, AG: 102 bp + 68bp + 34bp, GG: 68bp + 34bp (IL-17A rs2275913 polymorphism); TT: 63bp + 80bp, CT: 143bp + 80bp + 63bp, CC: 143bp (IL-17F rs763780 polymorphism). Table 2 shows the genotype and allele distributions for IL-17 gene polymorphisms in the CRC patients and controls. The observed genotype frequencies for the two polymorphisms (rs2275913 and rs763780) in the controls did not departure from HWE. For rs2275913 polymorphism, A allele was related to increased risk for CRC (AA vs GG: OR, 1.31; 95% CI, 1.06–1.64; P = 0.014); the AA genotype (not GA genotype) had a significantly elevated risk for CRC compared to GG genotype (AA vs GG: OR, 1.72; 95% CI, 1.02–2.88; P = 0.041). Similarly, AA+GA genotype or A allele was associated with the increased risk for CRC. Further, rs2275913 polymorphism was significant in homozygous, dominant and allelic models after adjusting for sex and age. However, no significant associations with the CRC risk was demonstrated for rs763780 polymorphism before and after adjusting for sex and age.

Table 2
Genotype frequencies of IL-17 gene polymorphisms in cases and controls
Models Genotype Case (n, %) Control (n, %) OR (95% CI) P-value *OR (95% CI) *P-value 
rs2275913 
 GG 160 (45.6%) 231 (53.6%) 1.00 (reference)    
Heterozygous GA 154 (43.9%) 169 (39.2%) 1.31 (0.98–1.76) 0.075 1.32 (0.98–1.77) 0.071 
Homozygous AA 37 (10.5%) 31 (7.2%) 1.72 (1.02–2.88) 0.041 1.73 (1.03–2.91) 0.039 
Dominant GG 160 (45.6%) 231 (53.6%) 1.00 (reference)    
 AA+GA 191 (54.4%) 200 (46.4%) 1.37 (1.04–1.82) 0.028 1.38 (1.04–1.83) 0.026 
Recessive GA+GG 314 (89.5%) 400 (92.8%) 1.00 (reference)    
 AA 37 (10.5%) 31 (7.2%) 1.52 (0.92–2.50) 0.102 1.53 (0.93–2.52) 0.098 
Allele 474 (67.5%) 631 (73.2%) 1.00 (reference)    
 228 (32.5%) 231 (26.8%) 1.31 (1.06–1.64) 0.014   
rs763780 
 TT 241 (68.7%) 284 (65.7%) 1.00 (reference)    
Heterozygous TC 100 (28.5%) 132 (30.6%) 0.89 (0.65–1.22) 0.462 0.89 (0.65–1.21) 0.459 
Homozygous CC 10 (2.8%) 16 (3.7%) 0.73 (0.33–1.65) 0.453 0.72 (0.32–1.63) 0.434 
Dominant TT 241 (68.7%) 284 (65.7%) 1.00 (reference)    
 CC+TC 110 (31.3%) 148 (34.3%) 0.87 (0.65–1.18) 0.375 0.87 (0.65–1.18) 0.369 
Recessive TC+TT 341 (97.2%) 416 (96.3%) 1.00 (reference)    
 CC 10 (2.8%) 16 (3.7%) 0.76 (0.34–1.70) 0.504 0.75 (0.34–1.58) 0.485 
Allele 582 (82.9%) 700 (81.0%) 1.00 (reference)    
 120 (17.1%) 164 (19.0%) 0.88 (0.68–1.14) 0.335   
Models Genotype Case (n, %) Control (n, %) OR (95% CI) P-value *OR (95% CI) *P-value 
rs2275913 
 GG 160 (45.6%) 231 (53.6%) 1.00 (reference)    
Heterozygous GA 154 (43.9%) 169 (39.2%) 1.31 (0.98–1.76) 0.075 1.32 (0.98–1.77) 0.071 
Homozygous AA 37 (10.5%) 31 (7.2%) 1.72 (1.02–2.88) 0.041 1.73 (1.03–2.91) 0.039 
Dominant GG 160 (45.6%) 231 (53.6%) 1.00 (reference)    
 AA+GA 191 (54.4%) 200 (46.4%) 1.37 (1.04–1.82) 0.028 1.38 (1.04–1.83) 0.026 
Recessive GA+GG 314 (89.5%) 400 (92.8%) 1.00 (reference)    
 AA 37 (10.5%) 31 (7.2%) 1.52 (0.92–2.50) 0.102 1.53 (0.93–2.52) 0.098 
Allele 474 (67.5%) 631 (73.2%) 1.00 (reference)    
 228 (32.5%) 231 (26.8%) 1.31 (1.06–1.64) 0.014   
rs763780 
 TT 241 (68.7%) 284 (65.7%) 1.00 (reference)    
Heterozygous TC 100 (28.5%) 132 (30.6%) 0.89 (0.65–1.22) 0.462 0.89 (0.65–1.21) 0.459 
Homozygous CC 10 (2.8%) 16 (3.7%) 0.73 (0.33–1.65) 0.453 0.72 (0.32–1.63) 0.434 
Dominant TT 241 (68.7%) 284 (65.7%) 1.00 (reference)    
 CC+TC 110 (31.3%) 148 (34.3%) 0.87 (0.65–1.18) 0.375 0.87 (0.65–1.18) 0.369 
Recessive TC+TT 341 (97.2%) 416 (96.3%) 1.00 (reference)    
 CC 10 (2.8%) 16 (3.7%) 0.76 (0.34–1.70) 0.504 0.75 (0.34–1.58) 0.485 
Allele 582 (82.9%) 700 (81.0%) 1.00 (reference)    
 120 (17.1%) 164 (19.0%) 0.88 (0.68–1.14) 0.335   

The genotyping was successful in 351 cases and 431 controls for rs2275913; The genotyping was successful in 351 cases and 432 controls for rs763780; Bold values are statistically significant (P < 0.05).

*

Adjust for age and sex.

Stratified analyses were conducted according to sex, age, smoking, alcohol and BMI (Table 3). For rs2275913, a significantly increased CRC risk with the AA genotype was found among smokers (AA vs. GG, OR 2.38; 95% CI, 1.19–4.76; P = 0.014) and non-drinkers (AA vs. GG, OR 4.22; 95% CI, 1.72–9.82; P < 0.001). The increased effect also appeared stronger in the subgroup of age ≥ 60 years (AA vs. GG, OR 2.44; 95% CI, 1.29–4.60; P = 0.006) and females (GA vs. GG, OR 1.42; 95% CI, 1.02–1.98; P = 0.037). No significant findings were obtained in the analysis of rs2275913 polymorphism and BMI. However, stratified analyses by sex, age, smoking and drinking indicated that the allele or genotype frequencies of rs763780 polymorphism did not differ significantly between the cases and controls. Next, we investigated the association between these two SNPs and clinicopathologic features of CRC patients (Table 4). The AA genotype of rs2275913 polymorphism is more frequent in patients with TNM stage III+IV and in patients with lymph node metastasis. This indicated that IL-17 rs2275913 polymorphism was correlated with TNM stage and lymph node metastasis (P = 0.043 and 0.026, respectively). We observed no evidence of association between rs763780 polymorphism and other clinical characteristics such as CRP, ESR, histological grade, TNM stage, tumor size, lymph node metastasis, family history and histology.

Table 3
Stratified analyses between rs2275913 polymorphisms and the risk of colorectal cancer
Variable (Case/Control) Heterozygous model Homozygous model Recessive model Dominant model 
rs2275913 GG GA AA GA vs GG AA vs GG AA vs GG+GA AA+GA vs GG 
Sex        
  Male 38/46 23/30 8/3 0.93 (0.46–1.86); 0.833 3.23 (0.80–13.02); 0.100 3.32 (0.85–13.06); 0.086 1.14 (0.59–2.18); 0.699 
  Female 122/185 131/139 29/28 1.42 (1.02–1.98); 0.037 1.56 (0.89–2.76); 0.124 1.32 (0.77–2.28); 0.315 1.45 (1.05–1.98); 0.022 
Smoking        
  Yes 86/118 79/88 26/15 1.23 (0.82–1.86); 0.321 2.38 (1.19–4.76); 0.014 2.16 (1.11–4.22); 0.023 1.40 (0.95–2.06); 0.091 
  No 74/113 75/81 11/16 1.40 (0.91–2.15); 0.124 1.04 (0.46–2.37); 0.925 0.89 (0.40–1.98); 0.776 1.34 (0.89–2.03); 0.163 
Alcohol        
  Yes 102/126 87/100 16/22 1.07 (0.72–1.57); 0.747 0.89 (0.45–1.79); 0.746 0.87 (0.44–1.70); 0.675 1.04 (0.71–1.50); 0.857 
  No 58/105 67/69 21/9 1.76 (1.11–2.80); 0.017 4.22 (1.72–9.82); <0.001 3.24 (1.44–7.33); 0.005 2.04 (1.31–3.18); 0.002 
Age (years)        
  <60 58/81 66/64 7/13 1.44 (0.89–2.33); 0.138 0.75 (0.28–2.00); 0.568 0.63 (0.24–1.63); 0.340 1.32 (0.83–2.11); 0.237 
  ≥60 102/150 88/105 30/18 1.23 (0.84–1.79); 0.295 2.44 (1.29–4.60); 0.006 2.23 (1.21–4.12); 0.011 1.40 (0.98–2.00); 0.064 
BMI        
  <25 78/126 75/88 17/16 1.37 (0.90–2.08); 0.144 1.70 (0.81–3.57); 0.158 1.48 (0.73–3.02); 0.282 1.42 (0.95–2.11); 0.086 
  ≥25 82/105 79/81 20/15 1.25 (0.82–1.91); 0.304 1.71 (0.82–3.54); 0.150 1.54 (0.76–3.11); 0.228 1.32 (0.88–1.98); 0.176 
Variable (Case/Control) Heterozygous model Homozygous model Recessive model Dominant model 
rs2275913 GG GA AA GA vs GG AA vs GG AA vs GG+GA AA+GA vs GG 
Sex        
  Male 38/46 23/30 8/3 0.93 (0.46–1.86); 0.833 3.23 (0.80–13.02); 0.100 3.32 (0.85–13.06); 0.086 1.14 (0.59–2.18); 0.699 
  Female 122/185 131/139 29/28 1.42 (1.02–1.98); 0.037 1.56 (0.89–2.76); 0.124 1.32 (0.77–2.28); 0.315 1.45 (1.05–1.98); 0.022 
Smoking        
  Yes 86/118 79/88 26/15 1.23 (0.82–1.86); 0.321 2.38 (1.19–4.76); 0.014 2.16 (1.11–4.22); 0.023 1.40 (0.95–2.06); 0.091 
  No 74/113 75/81 11/16 1.40 (0.91–2.15); 0.124 1.04 (0.46–2.37); 0.925 0.89 (0.40–1.98); 0.776 1.34 (0.89–2.03); 0.163 
Alcohol        
  Yes 102/126 87/100 16/22 1.07 (0.72–1.57); 0.747 0.89 (0.45–1.79); 0.746 0.87 (0.44–1.70); 0.675 1.04 (0.71–1.50); 0.857 
  No 58/105 67/69 21/9 1.76 (1.11–2.80); 0.017 4.22 (1.72–9.82); <0.001 3.24 (1.44–7.33); 0.005 2.04 (1.31–3.18); 0.002 
Age (years)        
  <60 58/81 66/64 7/13 1.44 (0.89–2.33); 0.138 0.75 (0.28–2.00); 0.568 0.63 (0.24–1.63); 0.340 1.32 (0.83–2.11); 0.237 
  ≥60 102/150 88/105 30/18 1.23 (0.84–1.79); 0.295 2.44 (1.29–4.60); 0.006 2.23 (1.21–4.12); 0.011 1.40 (0.98–2.00); 0.064 
BMI        
  <25 78/126 75/88 17/16 1.37 (0.90–2.08); 0.144 1.70 (0.81–3.57); 0.158 1.48 (0.73–3.02); 0.282 1.42 (0.95–2.11); 0.086 
  ≥25 82/105 79/81 20/15 1.25 (0.82–1.91); 0.304 1.71 (0.82–3.54); 0.150 1.54 (0.76–3.11); 0.228 1.32 (0.88–1.98); 0.176 
rs763780 TT TC CC TC vs TT CC vs TT CC vs TT+TC CC+TC vs TT 
Sex        
  Male 46/51 20/23 3/5 0.96 (0.47–1.98); 0.921 0.67 (0.15–3.00); 0.591 0.67 (0.16–2.92); 0.597 0.91 (0.46–1.80); 0.788 
  Female 195/233 80/109 7/11 0.87 (0.62–1.23); 0.442 0.76 (0.29–1.99); 0.573 0.79 (0.30–2.06); 0.629 0.86 (0.62–1.21); 0.388 
Smoking        
  Yes 133/144 52/68 7/9 0.83 (0.54–1.27); 0.391 0.84 (0.31–2.33); 0.740 0.89 (0.33–2.44); 0.823 0.83 (0.55–1.25); 0.375 
  No 108/140 48/64 3/7 0.97 (0.62–1.52); 0.878 0.55 (0.14–2.18); 0.397 0.56 (0.14–2.19); 0.403 0.93 (0.596–1.43); 0.726 
Alcohol        
  Yes 133/168 67/74 5/7 1.14 (0.76–1.70); 0.531 0.90 (0.28–2.89); 0.855 0.86 (0.27–2.75); 0.800 1.12 (0.76–1.65); 0.581 
  No 108/116 33/58 5/9 0.61 (0.37–1.01); 0.054 0.72 (0.25–2.08); 0.537 0.82 (0.29–2.37); 0.717 0.63 (0.39–1.01); 0.051 
Age (years)        
  <60 88/100 38/52 5/7 0.83 (0.50–1.38); 0.473 0.81 (0.25–2.65); 0.730 0.86 (0.27–2.78); 0.803 0.83 (0.51–1.35); 0.447 
  ≥60 153/184 62/80 5/9 0.93 (0.62–1.38); 0.707 0.67 (0.22–2.03); 0.472 0.68 (0.22–2.06); 0.494 0.90 (0.61–1.32); 0.591 
BMI        
  <25 114/140 48/80 7/9 0.73 (0.47–1.13); 0.159 0.95 (0.34–2.63); 0.919 1.05 (0.38–2.88); 0.922 0.75 (0.50–1.14); 0.184 
  ≥25 127/144 52/52 3/7 1.13 (0.72–1.78); 0.586 0.49 (0.12–1.92); 0.303 0.47 (0.12–1.84); 0.279 1.06 (0.68–1.64); 0.804 
rs763780 TT TC CC TC vs TT CC vs TT CC vs TT+TC CC+TC vs TT 
Sex        
  Male 46/51 20/23 3/5 0.96 (0.47–1.98); 0.921 0.67 (0.15–3.00); 0.591 0.67 (0.16–2.92); 0.597 0.91 (0.46–1.80); 0.788 
  Female 195/233 80/109 7/11 0.87 (0.62–1.23); 0.442 0.76 (0.29–1.99); 0.573 0.79 (0.30–2.06); 0.629 0.86 (0.62–1.21); 0.388 
Smoking        
  Yes 133/144 52/68 7/9 0.83 (0.54–1.27); 0.391 0.84 (0.31–2.33); 0.740 0.89 (0.33–2.44); 0.823 0.83 (0.55–1.25); 0.375 
  No 108/140 48/64 3/7 0.97 (0.62–1.52); 0.878 0.55 (0.14–2.18); 0.397 0.56 (0.14–2.19); 0.403 0.93 (0.596–1.43); 0.726 
Alcohol        
  Yes 133/168 67/74 5/7 1.14 (0.76–1.70); 0.531 0.90 (0.28–2.89); 0.855 0.86 (0.27–2.75); 0.800 1.12 (0.76–1.65); 0.581 
  No 108/116 33/58 5/9 0.61 (0.37–1.01); 0.054 0.72 (0.25–2.08); 0.537 0.82 (0.29–2.37); 0.717 0.63 (0.39–1.01); 0.051 
Age (years)        
  <60 88/100 38/52 5/7 0.83 (0.50–1.38); 0.473 0.81 (0.25–2.65); 0.730 0.86 (0.27–2.78); 0.803 0.83 (0.51–1.35); 0.447 
  ≥60 153/184 62/80 5/9 0.93 (0.62–1.38); 0.707 0.67 (0.22–2.03); 0.472 0.68 (0.22–2.06); 0.494 0.90 (0.61–1.32); 0.591 
BMI        
  <25 114/140 48/80 7/9 0.73 (0.47–1.13); 0.159 0.95 (0.34–2.63); 0.919 1.05 (0.38–2.88); 0.922 0.75 (0.50–1.14); 0.184 
  ≥25 127/144 52/52 3/7 1.13 (0.72–1.78); 0.586 0.49 (0.12–1.92); 0.303 0.47 (0.12–1.84); 0.279 1.06 (0.68–1.64); 0.804 

BMI, body mass index.

Bold values are statistically significant (P <0.05).

Table 4
The stratified analysis between rs2275913/rs763780 polymorphisms and clinical characteristics of CRC patients
Characteristics Genotype distributions 
rs2275913 GG GA AA GA+AA 
Histological grade     
  MD/WD 130/16 117/15 27/3 144/18 
  OR (95%CI); P-value 1.0 (reference) 0.96 (0.46–2.03); 0.915 1.11 (0.30–4.07); 0.877 0.99 (0.48–2.01); 0.966 
Histological grade     
  PD/WD 14/16 22/15 7/3 29/18 
  OR (95%CI); P-value 1.0 (reference) 1.68 (0.63–4.43); 0.296 2.67 (0.58–12.33); 0.201 1.84 (0.73–4.66); 0.195 
TNM stage     
  III+IV/I+II 70/90 86/68 23/14 109/82 
  OR (95%CI); P-value 1.0 (reference) 1.63 (1.04–2.54); 0.032 2.11 (1.01–4.40); 0.043 1.71 (1.12–2.61); 0.013 
Tumor size     
  >5 cm/≤5 cm 99/61 82/72 21/16 103/88 
  OR (95%CI); P-value 1.0 (reference) 0.70 (0.45–1.10); 0.122 0.81 (0.39–1.67); 0.565 0.72 (0.47–1.11); 0.133 
Lymph node metastasis     
  Yes/No 63/97 80/74 22/15 102/89 
  OR (95%CI); P-value 1.0 (reference) 1.67 (1.06–2.61); 0.025 2.26 (1.09–4.68); 0.026 1.77 (1.15–2.70); 0.009 
Family history     
  Yes/No 24/136 17/137 6/31 23/168 
  OR (95%CI); P-value 1.0 (reference) 0.70 (0.36–1.37); 0.298 1.10 (0.41–2.91); 0.853 0.78 (0.42–1.44); 0.418 
Histology     
  Adenocarcinoma/Not 155/5 149/5 33/4 182/9 
  OR (95%CI); P-value 1.0 (reference) 0.96 (0.27–3.39); 0.951 0.27 (0.07–1.05); 0.058 0.65 (0.21–1.99); 0.452 
ESR     
  ≥10/<10 63/97 68/86 17/20 85/106 
  OR (95%CI); P-value 1.0 (reference) 1.22 (0.78–1.91); 0.391 1.31 (0.64–2.69); 0.464 1.24 (0.81–1.89); 0.333 
CRP     
  ≥25/<25 13/147 9/145 7/30 16/175 
  OR (95%CI); P-value 1.0 (reference) 0.70 (0.29–1.69); 0.431 2.64 (0.97–7.17); 0.057 1.03 (0.48–2.22); 0.932 
Characteristics Genotype distributions 
rs2275913 GG GA AA GA+AA 
Histological grade     
  MD/WD 130/16 117/15 27/3 144/18 
  OR (95%CI); P-value 1.0 (reference) 0.96 (0.46–2.03); 0.915 1.11 (0.30–4.07); 0.877 0.99 (0.48–2.01); 0.966 
Histological grade     
  PD/WD 14/16 22/15 7/3 29/18 
  OR (95%CI); P-value 1.0 (reference) 1.68 (0.63–4.43); 0.296 2.67 (0.58–12.33); 0.201 1.84 (0.73–4.66); 0.195 
TNM stage     
  III+IV/I+II 70/90 86/68 23/14 109/82 
  OR (95%CI); P-value 1.0 (reference) 1.63 (1.04–2.54); 0.032 2.11 (1.01–4.40); 0.043 1.71 (1.12–2.61); 0.013 
Tumor size     
  >5 cm/≤5 cm 99/61 82/72 21/16 103/88 
  OR (95%CI); P-value 1.0 (reference) 0.70 (0.45–1.10); 0.122 0.81 (0.39–1.67); 0.565 0.72 (0.47–1.11); 0.133 
Lymph node metastasis     
  Yes/No 63/97 80/74 22/15 102/89 
  OR (95%CI); P-value 1.0 (reference) 1.67 (1.06–2.61); 0.025 2.26 (1.09–4.68); 0.026 1.77 (1.15–2.70); 0.009 
Family history     
  Yes/No 24/136 17/137 6/31 23/168 
  OR (95%CI); P-value 1.0 (reference) 0.70 (0.36–1.37); 0.298 1.10 (0.41–2.91); 0.853 0.78 (0.42–1.44); 0.418 
Histology     
  Adenocarcinoma/Not 155/5 149/5 33/4 182/9 
  OR (95%CI); P-value 1.0 (reference) 0.96 (0.27–3.39); 0.951 0.27 (0.07–1.05); 0.058 0.65 (0.21–1.99); 0.452 
ESR     
  ≥10/<10 63/97 68/86 17/20 85/106 
  OR (95%CI); P-value 1.0 (reference) 1.22 (0.78–1.91); 0.391 1.31 (0.64–2.69); 0.464 1.24 (0.81–1.89); 0.333 
CRP     
  ≥25/<25 13/147 9/145 7/30 16/175 
  OR (95%CI); P-value 1.0 (reference) 0.70 (0.29–1.69); 0.431 2.64 (0.97–7.17); 0.057 1.03 (0.48–2.22); 0.932 
rs763780 TT TC CC TC+CC 
Histological grade     
  MD/WD 187/23 77/11 9/1 87/11 
  OR (95%CI); P-value 1.0 (reference) 0.86 (0.40–1.85); 0.701 0.49 (0.10–2.46); 0.378 0.97 (0.45–2.09); 0.943 
Histological grade     
  PD/WD 31/23 12/11 0/0 12/11 
  OR (95%CI); P-value 1.0 (reference) 0.81 (0.30–2.16); 0.672 NA 0.81 (0.30–2.16); 0.672 
TNM stage     
  III+IV/I+II 116/125 39/61 5/5 44/66 
  OR (95%CI); P-value 1.0 (reference) 0.69 (0.43–1.11); 0.123 1.08 (0.30–3.82); 0.908 0.72 (0.46–1.14); 0.156 
Tumor size     
  >5 cm/≤5 cm 135/106 60/40 7/3 67/43 
  OR (95%CI); P-value 1.0 (reference) 1.18 (0.73–1.89); 0.499 1.83 (0.46–7.26); 0.382 1.22 (0.77–1.94); 0.390 
Lymph node metastasis     
  Yes/No 86/155 31/69 5/5 36/74 
  OR (95%CI); P-value 1.0 (reference) 0.81 (0.49–1.33); 0.407 1.80 (0.51–6.40); 0.356 0.88 (0.54–1.41); 0.589 
Family history     
  Yes/No 32/209 15/85 1/9 15/95 
  OR (95%CI); P-value 1.0 (reference) 1.15 (0.59–2.24); 0.675 0.73 (0.09–5.92); 0.764 1.03 (0.53–1.99); 0.927 
Histology     
  Adenocarcinoma/Not 231/10 96/4 9/1 105/5 
  OR (95%CI); P-value 1.0 (reference) 1.04 (0.32–3.39); 0.950 0.39 (0.05–3.38); 0.393 0.91 (0.30–2.73); 0.865 
ESR     
  ≥10/<10 100/141 37/63 2/8 39/71 
  OR (95%CI); P-value 1.0 (reference) 0.83 (0.51–1.34); 0.441 0.35 (0.07–1.70); 0.193 0.78 (0.49–1.24); 0.284 
CRP     
  ≥25/<25 12/229 6/94 1/9 7/103 
  OR (95%CI); P-value 1.0 (reference) 1.22 (0.44–3.34); 0.802 2.12 (0.25–18.13); 0.492 1.30 (0.50–3.39); 0.596 
rs763780 TT TC CC TC+CC 
Histological grade     
  MD/WD 187/23 77/11 9/1 87/11 
  OR (95%CI); P-value 1.0 (reference) 0.86 (0.40–1.85); 0.701 0.49 (0.10–2.46); 0.378 0.97 (0.45–2.09); 0.943 
Histological grade     
  PD/WD 31/23 12/11 0/0 12/11 
  OR (95%CI); P-value 1.0 (reference) 0.81 (0.30–2.16); 0.672 NA 0.81 (0.30–2.16); 0.672 
TNM stage     
  III+IV/I+II 116/125 39/61 5/5 44/66 
  OR (95%CI); P-value 1.0 (reference) 0.69 (0.43–1.11); 0.123 1.08 (0.30–3.82); 0.908 0.72 (0.46–1.14); 0.156 
Tumor size     
  >5 cm/≤5 cm 135/106 60/40 7/3 67/43 
  OR (95%CI); P-value 1.0 (reference) 1.18 (0.73–1.89); 0.499 1.83 (0.46–7.26); 0.382 1.22 (0.77–1.94); 0.390 
Lymph node metastasis     
  Yes/No 86/155 31/69 5/5 36/74 
  OR (95%CI); P-value 1.0 (reference) 0.81 (0.49–1.33); 0.407 1.80 (0.51–6.40); 0.356 0.88 (0.54–1.41); 0.589 
Family history     
  Yes/No 32/209 15/85 1/9 15/95 
  OR (95%CI); P-value 1.0 (reference) 1.15 (0.59–2.24); 0.675 0.73 (0.09–5.92); 0.764 1.03 (0.53–1.99); 0.927 
Histology     
  Adenocarcinoma/Not 231/10 96/4 9/1 105/5 
  OR (95%CI); P-value 1.0 (reference) 1.04 (0.32–3.39); 0.950 0.39 (0.05–3.38); 0.393 0.91 (0.30–2.73); 0.865 
ESR     
  ≥10/<10 100/141 37/63 2/8 39/71 
  OR (95%CI); P-value 1.0 (reference) 0.83 (0.51–1.34); 0.441 0.35 (0.07–1.70); 0.193 0.78 (0.49–1.24); 0.284 
CRP     
  ≥25/<25 12/229 6/94 1/9 7/103 
  OR (95%CI); P-value 1.0 (reference) 1.22 (0.44–3.34); 0.802 2.12 (0.25–18.13); 0.492 1.30 (0.50–3.39); 0.596 

Bold values are statistically significant (P < 0.05). PD, poorly differentiation, MD, moderately differentiation, WD, well differentiation; TNM, tumor node metastasis.

Discussion

In the present study, we found that IL-17A rs2275913 polymorphism was associated with the increased risk for CRC in a Chinese population. However, no association was observed for the IL-17F rs763780 polymorphism. Additionally, rs2275913 polymorphism showed significant correlation with TNM stage and lymph node metastasis in CRC patients.

Recently, several studies investigated the association between IL-17A rs2275913 polymorphism and risk of CRC [9,11,13–15]. Omrane et al. firstly conducted a population-based study to explore the association of rs2275913 polymorphism with CRC risk in a Tunisian population involving 102 CRC patients and 139 controls [11]. They found that IL-17A rs2275913 polymorphism conferred susceptibility to CRC and was associated with tumor location and tumor differentiation [11]. However, no significant association with CRC risk was observed for rs2275913 polymorphism in another Tunisian study conducted by Bedoui et al. [15]. Additionally, two Caucasian studies also investigated the effect of this SNP on the risk of CRC [9,13]. Nemati et al. revealed that AG genotype showed a significantly elevated risk for CRC compared to GG genotype in the Iranian population [13]. This significant association was also observed in the Saudi population [9]. However, no study has explored this SNP in the Chinese population. In this study, we observed that IL-17A rs2275913 polymorphism increased the risk of CRC under the additive, dominant and allelic models. The significant association observed in the whole population was also shown in the female, smoker, drinker and individuals with age ≥ 60 years groups. According to the dbSNP database, rs2275913 polymorphism was located in the promoter region of IL-17A gene. We hypothesized that IL-17A rs2275913 polymorphism conferred susceptibility to CRC by altering the IL-17 expression. In addition, IL-17A rs2275913 polymorphism was related to TNM stage III+IV and lymph node metastasis.

IL-17F rs763780 polymorphism was also investigated in several studies [9,10,12–14]. Three studies failed to find allele or genotype association with CRC susceptibility [9,10,14]. However, Ma et al. found that CC genotype or C allele was associated with the increased risk of CRC in a Chinese population [12]. Significant associations with the CRC risk were also demonstrated in an Iranian population [13]. In the present study, there was no significant association for this SNP in the overall analysis and in the stratified analyses of sex, age and smoking. Obviously, the findings of this study were consistent with most previous studies [9,10,14]. The rs763780 polymorphism is a missense mutation (His > Arg) when the nucleotide changes from T to C. Key amino acid changes may affect the three-dimensional structure of the protein, which in turn leads to changes in protein function. DbSNP database indicated that this mutation was benign. This may be the reason why we failed to obtain the positive results.

Several limitations of the present study need to be addressed. First, the sample size was not large, thus we could not rule out the possibility of false-positive results. Second, environmental factors might have affected the final results, including occupation and educational level. Third, we did not follow up on CRC patients, limiting our further analysis. Fourth, the controls from the hospital may not fully represent the entire population.

In conclusion, IL-17A rs2275913 polymorphism is associated with increased risk for CRC in a Chinese population. Furthermore, this SNP was associated with higher TNM stage and regional lymph node metastasis. However, no positive findings were obtained for IL-17F rs763780 polymorphism. Further studies in other studies with larger sample sizes, as well as functional evaluation of studied SNPs, are warranted to further validate these findings.

Author Contribution

H.X.J. conceived the entire study; H.Y.F. and R.B.Y. analyzed the data; H.Y.F., T.J.C. and H.L.C. performed statistical analysis; H.Y.F. and H.X.J. wrote the paper. All authors read and agreed with the final version of this manuscript.

Funding

This work was supported by grants from Traditional Chinese Medical science and technology plan of Zhejiang Province [grant number 2019ZA019]; and the Zhejiang Provincial Medicine Health Science and Technology Program [grant number 2019KY336].

Competing Interests

The authors declare that there are no competing interests associated with the manuscript.

Abbreviations

     
  • CRC

    colorectal cancer

  •  
  • CRP

    C-reactive protein

  •  
  • IL

    interleukin

  •  
  • SNP

    single-nucleotide polymorphism

References

References
1.
Rabeneck
L.
,
Horton
S.
,
Zauber
A.G.
and
Earle
C.
(
2015
)
Colorectal Cancer
. In
Cancer: Disease Control Priorities, (Volume 3)
Third edn(
Gelband
H.
,
Jha
P.
,
Sankaranarayanan
R.
and
Horton
S.
, eds),
Washington (DC)
2.
Brenner
H.
,
Kloor
M.
and
Pox
C.P.
(
2014
)
Colorectal cancer
.
Lancet
383
,
1490
1502
[PubMed]
3.
Lichtenstein
P.
,
Holm
N.V.
,
Verkasalo
P.K.
,
Iliadou
A.
,
Kaprio
J.
,
Koskenvuo
M.
et al.
(
2000
)
Environmental and heritable factors in the causation of cancer–analyses of cohorts of twins from Sweden, Denmark, and Finland
.
N. Engl. J. Med.
343
,
78
85
[PubMed]
4.
Al-Tassan
N.A.
,
Whiffin
N.
,
Hosking
F.J.
,
Palles
C.
,
Farrington
S.M.
,
Dobbins
S.E.
et al.
(
2015
)
A new GWAS and meta-analysis with 1000Genomes imputation identifies novel risk variants for colorectal cancer
.
Sci. Rep.
5
,
10442
[PubMed]
5.
Blake
S.J.
and
Teng
M.W.
(
2014
)
Role of IL-17 and IL-22 in autoimmunity and cancer
.
Actas. Dermosifiliogr.
105
,
41
50
[PubMed]
6.
Grivennikov
S.I.
,
Wang
K.
,
Mucida
D.
,
Stewart
C.A.
,
Schnabl
B.
,
Jauch
D.
et al.
(
2012
)
Adenoma-linked barrier defects and microbial products drive IL-23/IL-17-mediated tumour growth
.
Nature
491
,
254
258
[PubMed]
7.
Wang
K.
and
Karin
M.
(
2015
)
The IL-23 to IL-17 cascade inflammation-related cancers
.
Clin. Exp. Rheumatol.
33
,
S87
90
[PubMed]
8.
De Simone
V.
,
Franze
E.
,
Ronchetti
G.
,
Colantoni
A.
,
Fantini
M.C.
,
Di Fusco
D.
et al.
(
2015
)
Th17-type cytokines, IL-6 and TNF-alpha synergistically activate STAT3 and NF-kB to promote colorectal cancer cell growth
.
Oncogene
34
,
3493
3503
[PubMed]
9.
Obeed
Al
,
A.
O.
,
Vaali-Mohamed
M.A.
,
Alkhayal
K.A.
,
Bin Traiki
T.A.
,
Zubaidi
A.M.
et al.
(
2018
)
IL-17 and colorectal cancer risk in the Middle East: gene polymorphisms and expression
.
Cancer Manag. Res
10
,
2653
2661
[PubMed]
10.
Omrane
I.
,
Baroudi
O.
,
Bougatef
K.
,
Mezlini
A.
,
Abidi
A.
,
Medimegh
I.
et al.
(
2014
)
Significant association between IL23R and IL17F polymorphisms and clinical features of colorectal cancer
.
Immunol. Lett.
158
,
189
194
[PubMed]
11.
Omrane
I.
,
Marrakchi
R.
,
Baroudi
O.
,
Mezlini
A.
,
Ayari
H.
,
Medimegh
I.
et al.
(
2014
)
Significant association between interleukin-17A polymorphism and colorectal cancer
.
Tumour Biol.
35
,
6627
6632
[PubMed]
12.
Ma
M.
,
Jin
G.J.
,
Yun
K.
,
Mu
R.Q.
,
Zhao
M.
,
Yu
X.O.
et al.
(
2015
)
Correlation of IL-1F genetic polymorphisms with the risk of colorectal cancer among Chinese populations
.
Tumour Biol.
36
,
807
814
[PubMed]
13.
Nemati
K.
,
Golmoghaddam
H.
,
Hosseini
S.V.
,
Ghaderi
A.
and
Doroudchi
M.
(
2015
)
Interleukin-17FT7488 allele is associated with a decreased risk of colorectal cancer and tumor progression
.
Gene
561
,
88
94
[PubMed]
14.
Omrane
I.
,
Medimegh
I.
,
Baroudi
O.
,
Ayari
H.
,
Bedhiafi
W.
,
Stambouli
N.
et al.
(
2015
)
Involvement of IL17A, IL17F and IL23R Polymorphisms in Colorectal Cancer Therapy
.
PLoS One
10
,
e0128911
[PubMed]
15.
Bedoui
S.A.
,
Barbirou
M.
,
Stayoussef
M.
,
Dallel
M.
,
Mokrani
A.
,
Makni
L.
et al.
(
2018
)
Association of interleukin-17A polymorphisms with the risk of colorectal cancer: A case-control study
.
Cytokine
110
,
18
23
[PubMed]

Author notes

*

These authors contributed equally to this study.

This is an open access article published by Portland Press Limited on behalf of the Biochemical Society and distributed under the Creative Commons Attribution License 4.0 (CC BY).