Abstract
The heterotrimeric eIF2 complex consists of a core eIF2γ subunit to which binds eIF2α and eIF2β subunits and plays an important role in delivering the Met-tRNAiMet to the 40S ribosome and start codon selection. The intricacies of eIF2β-γ interaction in promoting Met-tRNAiMet binding are not clearly understood. Previously, the zinc-binding domain (ZBD) eIF2βS264Y mutation was reported to cause Met-tRNAiMet binding defect due to the intrinsic GTPase activity. We showed that the eIF2βS264Y mutation has eIF2β-γ interaction defect. Consistently, the eIF2βT238A intragenic suppressor mutation restored the eIF2β-γ and Met-tRNAiMet binding. The eIF2β-ZBD residues Asn252Asp and Arg253Ala mutation caused Met-tRNAiMet binding defect that was partially rescued by the eIF2βT238A mutation, suggesting the eIF2β-ZBD modulates Met-tRNAiMet binding. The suppressor mutation rescued the translation initiation fidelity defect of the eIF2γN135D SW-I mutation and eIF2βF217A/Q221A double mutation in the HTH domain. The eIF2βT238A suppressor mutation could not rescue the eIF2β binding defect of the eIF2γV281K mutation; however, combining the eIF2βS264Y mutation with the eIF2γV281K mutation was lethal. In addition to the previously known interaction of eIF2β with the eIF2γ subunit via its α1-helix, the eIF2β-ZBD also interacts with the eIF2γ subunit via guanine nucleotide-binding interface; thus, the eIF2β-γ interacts via two distinct binding sites.
Introduction
In the three domains of life, translation initiation is a critical phase in which the AUG start codon is selected to establish an open reading frame (ORF) for protein biosynthesis. The archaea and eukaryotes use heterotrimeric a/eIF2 consisting of the GTPase core a/eIF2γ subunit to which binds a/eIF2α and a/eIF2β subunit, and along with the GTP and Met-tRNAiMet forms a ternary complex (TC), which delivers the Met-tRNAiMet to the P-site of the 40S ribosome [1,2]. The eIF2γ subunit is made of G-domain (residues 1-309), domain II (residues 310-412), and domain III (residues 413-529). The eIF2γ G-domain has characteristic motifs for the guanine nucleotide binding and switch-I (SW-I) and switch-II (SW-II) regions for the GTP hydrolysis. The G-domain and domain II are packed together to form a Met-tRNAiMet binding pocket [3,4]. The eIF2α subunit is made of an N-terminal domain (residues 1-90), middle domain (residues 91-174), and the C-terminal domain (residues 182-265) and shows multiple contacts with the Met-tRNAiMet and plays an important regulatory role in translation initiation control (integrated stress response in the higher eukaryotes) via phosphorylation of its Ser51 residue [5–7]. The eIF2β subunit has a long unstructured N-terminal tail (residues 1-126), followed by α1-helix (residues 128-143), a helix turn helix (HTH) domain (residues 155-234), and at the C-terminal end, a zinc-binding domain (ZBD) (resides 235-270) which is made of three distinct loops [5]. For simplicity, we are referring to the eIF2β-ZBD loop region from amino acids 235-244 containing residue T238 as a T-loop, the region from 245-256 containing residue R253 as a R-loop, and the loop region from 257-270 containing residue S264 as an S-loop (Figure 1A). The eIF2β subunit is reported to show guanine nucleotide dissociation inhibitor (GDI) activity and also interacts with the GTPase-activating protein (GAP) eIF5 subunit by the N-terminal lysine (K) -boxes [8,9].
eIF2βS264Y zinc-binding domain mutation causes eIF2γ binding defect
(A,B) Schematic representation, sequence homology, and structure of eIF2β. (A) The eIF2β is divided into an N-terminal tail (NTT) containing three K-boxes, the middle region consisting of α1-helix, the C-terminal region consisting of helix-turn-helix, and a zinc-binding domain. Different mutations in the eIF2β subunit are indicated. Multiple sequence alignment of eIF2β-ZBD from the indicated organisms belonging to archaea, yeast, and higher eukaryotes was done using the Clustal-omega algorithm. The position of the four conserved cystines, Thr238 and Ser264 residues, are shown at the bottom. The T-loop, R-loop, and S-loop indicate different regions of the eIF2β-ZBD. (B) The cryoEM structure of partial yeast 48S PIC (6FYX) [5] viewed using PYMOL software [10] showing eIF2β (blue), Met-tRNAi (grey), eIF2γ switch-I region (SW-I; cyan), Zn2+ ion (sphere; grey) and a GCP molecule. The eIF2β-ZBD’s T-loop, R-loop, and S-loop are indicated. Residues that were mutated in this study are shown in red color sticks. Polar interactions of Ser264 and Thr238 residues with the guanine nucleotide are shown with a dotted line. The polar interaction of eIF2γ Arg127 residue with the eIF2β Thr265 and α-PO4 of guanine nucleotide is indicated by a dotted line. (C) Growth analysis. Yeast strain YP896 (his4Δ, sui3Δ) carrying single copy eIF2βWT (A1451) or eIF2βS264Y (A1446) plasmids were grown overnight, serially diluted, and spotted on SD media plate supplemented with uracil, tryptophane and histidine and incubated at 30°C for 2–3 days. (D) Analysis of eIF2β-eIF2γ interaction by yeast two-hybrid. The eIF2γWT protein was fused with the Activating domain (AD) (A1242), and the eIF2βWT (A1237) or eIF2βS264Y (A1238) mutant proteins were fused with the DNA binding domain (DBD) and transformed into the yeast strain (YP930) along with the empty vector (EV) (A643) and (A1236), serially diluted and spotted on SCD adenine plate supplemented with uracil or SCD supplemented with uracil and 250 μM 3-amino triazole (3-AT). (E) Co-Immunoprecipitation assay. Yeast strain YP912 (gcd11Δ, sui3Δ) carrying GCD11 gene encoding N-terminal 3xHA eIF2γ transformed with either a single copy eIF2βWT (A1451) or eIF2βS264Y (A1446) plasmids were grown overnight and harvested at OD600 ∼ 0.8. The WCE (300 μg) was incubated with anti-HA antibody agarose beads, and the eIF2γ protein was co-immunoprecipitated. One-fifth of the beads were analysed by Western blot using anti-HA, anti-RPS20, anti-β-actin and anti-eIF2β antibodies. The input lanes contain 2.5% of the WCE. The densitometric quantitation of the blot is shown on the right. Statistical differences were determined by one-way ANOVA analysis. The error bar shows the standard deviation obtained from at least three biological replicates.
(A,B) Schematic representation, sequence homology, and structure of eIF2β. (A) The eIF2β is divided into an N-terminal tail (NTT) containing three K-boxes, the middle region consisting of α1-helix, the C-terminal region consisting of helix-turn-helix, and a zinc-binding domain. Different mutations in the eIF2β subunit are indicated. Multiple sequence alignment of eIF2β-ZBD from the indicated organisms belonging to archaea, yeast, and higher eukaryotes was done using the Clustal-omega algorithm. The position of the four conserved cystines, Thr238 and Ser264 residues, are shown at the bottom. The T-loop, R-loop, and S-loop indicate different regions of the eIF2β-ZBD. (B) The cryoEM structure of partial yeast 48S PIC (6FYX) [5] viewed using PYMOL software [10] showing eIF2β (blue), Met-tRNAi (grey), eIF2γ switch-I region (SW-I; cyan), Zn2+ ion (sphere; grey) and a GCP molecule. The eIF2β-ZBD’s T-loop, R-loop, and S-loop are indicated. Residues that were mutated in this study are shown in red color sticks. Polar interactions of Ser264 and Thr238 residues with the guanine nucleotide are shown with a dotted line. The polar interaction of eIF2γ Arg127 residue with the eIF2β Thr265 and α-PO4 of guanine nucleotide is indicated by a dotted line. (C) Growth analysis. Yeast strain YP896 (his4Δ, sui3Δ) carrying single copy eIF2βWT (A1451) or eIF2βS264Y (A1446) plasmids were grown overnight, serially diluted, and spotted on SD media plate supplemented with uracil, tryptophane and histidine and incubated at 30°C for 2–3 days. (D) Analysis of eIF2β-eIF2γ interaction by yeast two-hybrid. The eIF2γWT protein was fused with the Activating domain (AD) (A1242), and the eIF2βWT (A1237) or eIF2βS264Y (A1238) mutant proteins were fused with the DNA binding domain (DBD) and transformed into the yeast strain (YP930) along with the empty vector (EV) (A643) and (A1236), serially diluted and spotted on SCD adenine plate supplemented with uracil or SCD supplemented with uracil and 250 μM 3-amino triazole (3-AT). (E) Co-Immunoprecipitation assay. Yeast strain YP912 (gcd11Δ, sui3Δ) carrying GCD11 gene encoding N-terminal 3xHA eIF2γ transformed with either a single copy eIF2βWT (A1451) or eIF2βS264Y (A1446) plasmids were grown overnight and harvested at OD600 ∼ 0.8. The WCE (300 μg) was incubated with anti-HA antibody agarose beads, and the eIF2γ protein was co-immunoprecipitated. One-fifth of the beads were analysed by Western blot using anti-HA, anti-RPS20, anti-β-actin and anti-eIF2β antibodies. The input lanes contain 2.5% of the WCE. The densitometric quantitation of the blot is shown on the right. Statistical differences were determined by one-way ANOVA analysis. The error bar shows the standard deviation obtained from at least three biological replicates.
In the eukaryotic translation initiation process, translation initiation factor eIF1 binds near the P-site, eIF1A binds at the A-site, and the eIF3 is assembled on the solvent side of the 40S ribosome. The TC and eIF5 are recruited to this complex to form a 43S pre-initiation complex (PIC). The 43S PIC then binds to the activated mRNA-eIF4F complex to form a 48S complex and scans the mRNA from the 5′ to 3′ direction in search of the AUG start codon [11]. During the scanning process, the eIF5 Arg15 residue is proposed to interact with the eIF2γ G-domain to hydrolyse the GTP molecule to GDP + Pi; however, the Pi release is blocked by the eIF1 [12–14]. When the AUG start codon enters the 40S ribosomal P-site, the codon:anti-codon interaction causes significant structural rearrangement in the 48S scanning complex. The eIF1 is released from the 40S ribosomal P-site and an attendant Pi release from the eIF2γ subunit, the 40S ribosomal head rotates from the ‘Open’ conformation to ‘Closed’ state, and the Met-tRNAiMet conformation changes from the POUT to PIN state [15]. Mutations in the translation initiation factors that disrupt these processes and prematurely insert the Met-tRNAiMet in the PIN state even in the absence of the AUG start codon at the P-site often relax the stringency of start codon recognition (suppressor of initiation codon; Sui¯ phenotype). For example, the eIF2γN135D/A382V and eIF2βS264Y mutations show defects in Met-tRNAiMet binding and enhance translation initiation from the UUG codon of the His4UUG allele [15–18]. It is important to emphasize that the Sui¯ phenotype is caused by the delivery of Met-tRNAiMet in an altered conformation (PIN) and the attendant premature dissociation of the eIF1 from the scanning 48S ribosomal complex rather than the premature dissociation of Met-tRNAiMet [15,17,18]. The defect in the fidelity of start codon selection can have a pleiotropic effect on the cellular proteome and adversely affect cellular physiology [19].
The a/eIF2γ subunit is structurally and functionally homologous to the bacterial elongation factor EF-Tu and the a/eEF-1A, which binds to the charged elongator tRNAs and delivers them to the A-site of the 70S/80S ribosome in the elongation phase of protein synthesis without the additional support of any other proteins [20]. Interestingly, the eIF2αβγ orthologs are absent in the eubacteria, where a single polypeptide initiation factor IF2 is responsible for binding Met-tRNAiMet to the 30S ribosome [21]. In the absence of the eIF2γ ortholog in eubacteria, it could be possible that in archaea or eukaryotes, the a/eIF2γ might have evolved from the EF-Tu/aEF-1A. Whereas in the EF-Tu/aEF-1A, the G-domain, domain II, and domain III are packed together to form an elongator tRNA (tRNAe) binding pocket, in the case of eIF2γ subunit, the Met-tRNAiMet is rotated 165° to interact with the G-domain and domain II interface [3,22]. In this orientation, the Met-tRNAiMet contacts with the eIF2γ subunit are far less (∼32%) compared with the elongator tRNAe (100%) bound to the EF-Tu/EF-1A [3,23]. The eIF2α and eIF2β subunits contribute the rest of the contacts with the Met-tRNAiMet. The eIF2α and eIF2β subunit may have evolved to associate with the eIF2γ subunit and provide additional contact sites by sandwiching the Met-tRNAiMet between them and stabilizing the Met-tRNAiMet in the TC. In the present study, we have explored the intricacies of eIF2β-γ interaction, especially the role of eIF2β-ZBD in binding with the core eIF2γ subunit and how it promotes the Met-tRNAiMet binding. Our study revealed that the Ser264Tyr substitution in the ZBD S-loop led to the eIF2β binding defect. Next, we screened for the intragenic suppressor mutation that could rescue the growth defect of the eIF2βS264Y mutation. Interestingly, the eIF2βT238A suppressor mutation isolated in the T-loop rescues the eIF2β-γ binding defect; it partially rescues the Met-tRNAiMet binding defect and the Sui¯ phenotype of the eIF2βS264Y mutant. In addition to the previously known interaction of eIF2β with the eIF2γ subunit via its α1-helix, we showed that the eIF2β-ZBD also interacts with the eIF2γ subunit via guanine nucleotide-binding interface and promotes Met-tRNAiMet binding to the TC.
Results
The eIF2βS264Y zinc-binding domain mutation causes eIF2γ binding defect
The eIF2βS264Y mutation was extensively used to study the eIF2 function [3,5,18,24–33]. However, mechanistic insight into the working of eIF2βS264Y mutation is not clearly understood. The eIF2βS264Y mutation was proposed to cause eIF5-independent intrinsic GTPase activity in the ternary complex to release the Met-tRNAiMet prematurely [24]. It could be possible that the eIF2βS264Y mutation may have other defects that interfere with the Met-tRNAiMet binding. Structural data of the TC suggest that the eIF2β subunit binds to the eIF2γ subunit via α1-helix. The eIF2β-ZBD residues Thr238 and Ser264 also show polar interaction with the ribose sugar moiety (2′OH and 3′OH) of GDP/GTP bound to the eIF2γ subunit (Figure 1B) [5]. However, the importance of this interaction was never tested. The eIF2βS264 residue is relatively conserved in the yeast and higher eukaryotes (Figure 1A). We predicted that the eIF2βS264Y mutation may alter the ZBD conformation and affect eIF2β-γ interaction. Consistently, the eIF2βS264Y mutation showed a severe slow-growth (Slg¯) phenotype when the eIF2βWT was evicted (Figure 1C). We used the yeast two-hybrid assay to test whether the eIF2βS264Y mutation shows an in vivo binding defect with the eIF2γ subunit (see Materials and Methods). The eIF2γWT and eIF2βS264Y mutant pair showed a slow growth phenotype on the SCD supplemented with uracil and 250 μM 3-AT plate (Figure 1D, row 3), indicating eIF2γWT-eIF2βS264Y interaction defect. To confirm that the eIF2βS264Y mutation has an interaction defect with the eIF2γ protein, we conducted an in vivo co-immunoprecipitation experiment. We added a 3xHA-tag to the N-terminal end of the eIF2γ protein, and using anti-HA antibody agarose beads the eIF2γ protein was pulled down from the whole-cell extract (WCE) of the wild-type and eIF2βS264Y mutant yeast strains and analysed by the Western blot using anti-HA and anti-eIF2β antibodies. Consistent with the yeast two-hybrid data, the eIF2βS264Y mutant showed a 30% binding defect with the eIF2γ subunit (Figure 1E). These data suggest that in addition to the eIF2β subunit binding to the eIF2γ-G domain via its α1-helix, the eIF2β-ZBD is also critically contributing to the interaction via the guanine nucleotide-binding interface.
Isolation and characterization of eIF2βS264Y intragenic suppressor mutation
To gain further insights into the function of eIF2β-ZBD and its involvement in the TC complex formation, we screened for intragenic suppressors of the eIF2βS264Y mutation (see Supplementary Data). We focused our work on the suppressor mutation that converts eIF2β-Thr238 to Ala in the ZBD (T-loop) (Figure 2A, row 3 and Figure 1B). The eIF2βT238 residue is relatively conserved in yeast and higher eukaryotes, except in plants, where Thr is replaced with Gly (Figure 1A). The eIF2βS264Y mutation shows the Sui¯ phenotype [34,35]. To test if the eIF2βS264Y/T238A suppressor mutation suppresses the Sui¯ phenotype of eIF2βS264Y mutation, we used YP896 yeast strain (his4Δ, sui3Δ) containing a plasmid-borne copy of either eIF2βWT, eIF2βS264Y, eIF2βS264Y/T238A or eIF2βT238A genes and transformed with a plasmid-borne copy of either wild type HIS4AUG or HIS4UUG allele where the AUG codon is mutated to AUU, thus the third codon (UUG) is used as a start codon [11]. The eIF2βWT did not initiate translation from the HIS4UUG construct and did not grow, whereas the eIF2βS264Y mutant could initiate translation from the HIS4UUG construct and grew on the minus histidine plate (Sui¯ phenotype) (Figure 2B, rows 5 and 6). However, whereas the eIF2βS264Y/T238A mutation partially suppressed the Sui¯ phenotype (Ssu¯ phenotype) of the eIF2βS264Y mutant, the eIF2βT238A mutation did not show Sui¯ phenotype (Figure 2B, row 7 and 8). Consistently, the HIS4-LacZ reporter assay showed higher initiation from the UUG codon by the eIF2βS264Y mutant, whereas the eIF2βS264Y/T238A double mutant partially suppressed the UUG codon utilization, and the eIF2βT238A mutant seldom utilized the UUG as a start codon (Figure 2C).
Phenotypic and biochemical analysis of eIF2βS264Y and its intragenic suppressor mutation eIF2βS264Y/T238A
(A) Growth analysis. Yeast strain YP896 (his4Δ, sui3Δ) carrying plasmid-borne eIF2βWT (A1451), eIF2βS264Y (A1446), or eIF2βT238A/S264Y (A1259) double mutant gene were grown overnight, serially diluted, and spotted on SD plate supplemented with uracil, tryptophane and histidine and incubated at 30°C for 2 days. (B) Analysis of Sui¯ phenotype. Yeast strain YP896 (his4Δ, sui3Δ) carrying plasmid-borne eIF2βWT (A1451), eIF2βS264Y (A1446), eIF2βT238A (A1260) or eIF2βT238A/S264Y (A1259) double mutant gene were transformed with either HIS4AUG (A839) or, HIS4UUG (A840) constructs and grown overnight, serially diluted, and spotted on SD plate supplemented with tryptophane and histidine or SD plate supplemented with tryptophane and incubated for 2–3 days at 30°C. (C) Analysis of HIS4-lacZ expression. Yeast strain YP896 (his4Δ, sui3Δ) carrying plasmid borne eIF2βWT (A1451), eIF2βS264Y (A1446), eIF2βT238A (A1260) or eIF2βT238A/S264Y (A1259) double mutant gene were transformed with either A1072 (GAPDHprom_His4AUG_lacZ) or, A1073 (GAPDHprom_His4UUG_lacZ) plasmid constructs and grown on the SCD media supplemented with tryptophane and histidine and harvested at OD600 ∼ 0.8. The whole cell extract was prepared and β-galactosidase activity (nmol of O-nitrophenyl-β-D-galactopyranoside cleaved per min per mg) was measured and the resultant values were plotted as UUG/AUG ratio as described previously [36]. (D) Analysis of GCN4-lacZ expression. Yeast strain YP896 (his4Δ, sui3Δ) carrying plasmid borne eIF2βWT (A1451), eIF2βS264Y (A1446), eIF2βT238A (A1260) or eIF2βT238A/S264Y (A1259) double mutant gene were transformed with GCN4-lacZ construct (p180). The measurement of β-galactosidase activity was done as per (C). (E) Co-Immunoprecipitation assay. Yeast strain YP912 (gcd11Δ, sui3Δ) carrying plasmid borne N-terminal 3xHA-tag eIF2γ subunit (A1404) and derivatives of eIF2β [eIF2βWT (A1451), eIF2βS264Y (A1446), eIF2βT238A (A1260) or eIF2βT238A/S264Y (A1259) double mutant] gene were subjected to Co-IP as described in Figure 1E. The Co-IP beads were analysed by Western blot using anti-HA, anti-eIF2β, anti-eIF2α, anti-eIF3c, anti-actin, and anti-rps20 antibodies and by Northern blot using a probe specific to initiator Met-tRNAi or elongator Met-tRNAe. The input lanes contain 2.5% of the WCE. (F) Analysis of TC on the formaldehyde cross linked 48S ribosome. Yeast strain YP912 carrying derivatives of eIF2β mutant as per (E) were subjected to 1% HCHO cross-linking as described in Materials and Methods. Fractions #7 and #8 containing 40-48S ribosomes were analysed by Western and Northern blots as per (E). The input lanes contain 0.1% of A260 ∼ 20 Units. The graph (right) shows the densitometric quantitation of the TC on the 40S ribosomes from at least three biological replicates. (G) Analysis of guanine nucleotide binding. GDP-BODIPY and GDPγS-BODIPY were titrated with the derivative of purified eIF2 [eIF2βWT, eIF2βS264Y, eIF2βT238A or eIF2βT238A/S264Y double mutant]. The fluorescence anisotropy values were converted to fraction bound and plotted using Hill’s equation (Origin software). The Kd values for GDP and GDPγS for the WT or mutant proteins were determined from the three independent experiments and summarized in the table below (± standard deviations). Statistical differences were determined by one-way ANOVA analysis. The error bar shows the standard deviation obtained from the three biological replicates.
(A) Growth analysis. Yeast strain YP896 (his4Δ, sui3Δ) carrying plasmid-borne eIF2βWT (A1451), eIF2βS264Y (A1446), or eIF2βT238A/S264Y (A1259) double mutant gene were grown overnight, serially diluted, and spotted on SD plate supplemented with uracil, tryptophane and histidine and incubated at 30°C for 2 days. (B) Analysis of Sui¯ phenotype. Yeast strain YP896 (his4Δ, sui3Δ) carrying plasmid-borne eIF2βWT (A1451), eIF2βS264Y (A1446), eIF2βT238A (A1260) or eIF2βT238A/S264Y (A1259) double mutant gene were transformed with either HIS4AUG (A839) or, HIS4UUG (A840) constructs and grown overnight, serially diluted, and spotted on SD plate supplemented with tryptophane and histidine or SD plate supplemented with tryptophane and incubated for 2–3 days at 30°C. (C) Analysis of HIS4-lacZ expression. Yeast strain YP896 (his4Δ, sui3Δ) carrying plasmid borne eIF2βWT (A1451), eIF2βS264Y (A1446), eIF2βT238A (A1260) or eIF2βT238A/S264Y (A1259) double mutant gene were transformed with either A1072 (GAPDHprom_His4AUG_lacZ) or, A1073 (GAPDHprom_His4UUG_lacZ) plasmid constructs and grown on the SCD media supplemented with tryptophane and histidine and harvested at OD600 ∼ 0.8. The whole cell extract was prepared and β-galactosidase activity (nmol of O-nitrophenyl-β-D-galactopyranoside cleaved per min per mg) was measured and the resultant values were plotted as UUG/AUG ratio as described previously [36]. (D) Analysis of GCN4-lacZ expression. Yeast strain YP896 (his4Δ, sui3Δ) carrying plasmid borne eIF2βWT (A1451), eIF2βS264Y (A1446), eIF2βT238A (A1260) or eIF2βT238A/S264Y (A1259) double mutant gene were transformed with GCN4-lacZ construct (p180). The measurement of β-galactosidase activity was done as per (C). (E) Co-Immunoprecipitation assay. Yeast strain YP912 (gcd11Δ, sui3Δ) carrying plasmid borne N-terminal 3xHA-tag eIF2γ subunit (A1404) and derivatives of eIF2β [eIF2βWT (A1451), eIF2βS264Y (A1446), eIF2βT238A (A1260) or eIF2βT238A/S264Y (A1259) double mutant] gene were subjected to Co-IP as described in Figure 1E. The Co-IP beads were analysed by Western blot using anti-HA, anti-eIF2β, anti-eIF2α, anti-eIF3c, anti-actin, and anti-rps20 antibodies and by Northern blot using a probe specific to initiator Met-tRNAi or elongator Met-tRNAe. The input lanes contain 2.5% of the WCE. (F) Analysis of TC on the formaldehyde cross linked 48S ribosome. Yeast strain YP912 carrying derivatives of eIF2β mutant as per (E) were subjected to 1% HCHO cross-linking as described in Materials and Methods. Fractions #7 and #8 containing 40-48S ribosomes were analysed by Western and Northern blots as per (E). The input lanes contain 0.1% of A260 ∼ 20 Units. The graph (right) shows the densitometric quantitation of the TC on the 40S ribosomes from at least three biological replicates. (G) Analysis of guanine nucleotide binding. GDP-BODIPY and GDPγS-BODIPY were titrated with the derivative of purified eIF2 [eIF2βWT, eIF2βS264Y, eIF2βT238A or eIF2βT238A/S264Y double mutant]. The fluorescence anisotropy values were converted to fraction bound and plotted using Hill’s equation (Origin software). The Kd values for GDP and GDPγS for the WT or mutant proteins were determined from the three independent experiments and summarized in the table below (± standard deviations). Statistical differences were determined by one-way ANOVA analysis. The error bar shows the standard deviation obtained from the three biological replicates.
The GCN4 mRNA translation is very sensitive to the levels of TC availability for the translation initiation process, and it is regulated by the four upstream short open reading frames (uORFs 1-4) [11,37,38]. In normal conditions, the TC levels are high, and the 48S scanning ribosome complex translates uORF1; however, after the translation termination, the 40S ribosome stays bound to the GCN4 mRNA to scan downstream and translate the inhibitory uORF3 or uORF4 and dissociate without reaching the main GCN4 ORF. In stress or starvation conditions, the TC levels are low, and the scanning 40S ribosome skips the translation of downstream inhibitory uORF4 and translates the main GCN4 ORF due to the late recruitment of the TC [11]. The GCN4-LacZ reporter assay was used to check the levels of TC in the eIF2β mutants. Consistency with its Met-tRNAiMet and eIF2β binding defects, the eIF2βS264Y mutant showed high levels of β-galactosidase activity (Gcd¯ phenotype), whereas the eIF2βS264Y/T238A double mutant partially suppressed the Gcd¯ phenotype and the eIF2βT238A mutation did not show Gcd¯ phenotype (Figure 2D). Collectively, these data suggest that the eIF2βT238A intragenic suppressor mutation partially suppresses the Sui¯ and Gcd¯ phenotype of the eIF2βS264Y and rescued the growth defect, possibly by restoring eIF2β binding to the eIF2γ subunit (see below).
To confirm whether the eIF2β mutants have Met-tRNAiMet and eIF2γ binding defects, we performed an in vivo co-immunoprecipitation experiment. As described in the previous section, the 3xHA tagged eIF2γ was pulled down from the WCE of different eIF2β mutants, and it was analysed by the Northern blot using an oligonucleotide probe against Met-tRNAi or Met-tRNAe and Western blot using antibodies specific to HA-tag (eIF2γ), eIF2β, eIF2α, eIF3c, Rps20, and β-actin. Compared with the WT, the eIF2βS264Y mutant showed ∼30% binding defect with the eIF2γ subunit and a severe (∼80%) binding defect with the Met-tRNAiMet (Figure 2E, lanes 7 and 8). The absence of eIF3c and the 40S ribosomal protein Rps20 in the pulldown suggests that we analysed free TC unassociated with the multi-factorial complex or 40S ribosome. Notably, the elongator Met-tRNAe does not interact with the eIF2 complex. Remarkably, whereas the eIF2βT238A single mutant binds to the eIF2γ subunit near WT levels, the Met-tRNAiMet and eIF2α subunit binding affinity was observed to be ∼12.5-fold and ∼4.5-fold higher, respectively (Figure 2E, lane 13). Co-IP of the 3xHA-tagged eIF2β subunit showed ∼3.5-fold and 1.3-fold higher binding affinity for the Met-tRNAiMet and eIF2α subunit, respectively (Supplementary Figure S1). A previous report suggests that the Met-tRNAiMet and eIF2α subunit binding sites are in close proximity on the eIF2γ-Domain II, and the eIF2α subunit contributes to the Met-tRNAiMet binding to the eIF2γ subunit [4]. Our data reinforce the notion that the eIF2βT238A substitution mutation alters the ZBD structure to strengthen the Met-tRNAiMet binding affinity with the eIF2γ subunit and by its proximity to the eIF2α subunit also enhance the eIF2α-γ binding affinity.
In the eIF2βS264Y/T238A double mutant, the binding defect of the mutant eIF2β with the eIF2γ subunit was rescued. However, the eIF2βS264Y/T238A double mutant did not fully rescue the Met-tRNAiMet binding defect (Figure 2E, lane 9). It is possible, in the eIF2βS264Y/T238A double mutation, the Ser264 to Tyr substitution may continuously interfere with the Met-tRNAiMet binding, even though the Thr238 to Ala substitution restores the eIF2β binding. Surprisingly, the eIF2βS264Y/T238A double mutation partially suppressed the Gcd¯ phenotype, even though it showed a severe Met-tRNAiMet binding defect with the TC. It is likely that in the eIF2βS264Y/T238A double mutation, the Met-tRNAiMet interaction with the eIF2 complex is weak as captured by this assay; however, the Met-tRNAiMet may have a relatively stable interaction when associated with the 48S scanning ribosomal complex. To test this hypothesis, we treated the yeast cells with 1% formaldehyde to cross-link and stabilize the TC interaction on the 40S ribosome, and using a 15%-40% sucrose density gradient, we fractionated the translation initiation complex and performed Northern and Western blotting. Consistent with our hypothesis, in the eIF2βS264Y mutant, the TC associated with the 40S ribosomal subunit was extremely low, whereas in the eIF2βS264Y/T238A double mutation, the levels of the eIF2αβγ complex associated with the 40S ribosomal subunit significantly improved along with a modest improvement in the Met-tRNAiMet bound to this complex (Figure 2F and Supplementary Figure S2). Interestingly, the eIF2βT238A single mutant showed near WT levels of Met-tRNAiMet bound to the 43-48S ribosomal complex, in contrast to the ∼12.5-fold high Met-tRNAiMet interaction observed in the pull-down experiment (Figure 2E, lane 13 and Figure 2F, lane 8). These observations suggest that eIF2βT238A mutation augments the eIF2α and Met-tRNAiMet binding affinity with the core eIF2γ subunit, and makes the free TC more stable and capable of binding the 40S ribosome comparable to the WT levels.
The eIF2γ G-domain has characteristic motifs for the guanine nucleotide binding. Our mutation analysis suggests that the eIF2β-ZBD interacts with the eIF2γ subunit through the guanine nucleotide-binding interface. To check if the eIF2β-ZBD mutations affect the guanine nucleotide binding affinity of the eIF2 complex, we added 8xHis-tag to the eIF2γ subunit and purified WT or the mutant eIF2 complex from the yeast strain using a method described previously [17]. Interestingly, the level of the eIF2βS264Y subunit was 20% lower in the purified mutant eIF2 complex (Supplementary figure S3), consistent with the eIF2βS264Y binding defect observed in the Co-IP assay (Figures 1E and 2E). Next, we used fluorescent anisotropy to calculate the guanine nucleotide binding affinity using fluorescently labeled GDP or GDPγS with increasing concentrations of the purified eIF2 WT or the mutant proteins. Our result suggests the WT eIF2 binding affinity for GDP is 36.68 nM, consistent with the previously reported data [39]. The GDP binding affinity for the eIF2βS264Y and eIF2βS264Y/T238A double mutant was ∼1.7-fold and ∼1.5-fold lower than the WT, respectively, whereas the eIF2βT238A mutation showed no change in GDP binding affinity (Figure 2G). The calculated WT eIF2 binding affinity for GDPγS was 1.40 μM, consistent with the previously reported data [39]. The eIF2βS264Y and eIF2βS264Y/T238A double mutant showed ∼1.1-fold and ∼1.17-fold lower GDPγS binding affinity than the WT protein. Although the eIF2βT238A mutation showed a ∼2-fold decrease in GDPγS affinity, it showed no genetic or biochemical defects (Figure 2). These results suggest no significant changes in guanine nucleotide binding affinity difference with the eIF2 mutant proteins.
The eIF2β-ZBD R-loop is critical for the Met-tRNAiMet binding
The structure of the eIF2β suggests that the R-loop (resides 245-256) of the ZBD interacts with the Met-tRNAiMet, and the residues Asn252 and Arg253 may be critical for the Met-tRNAiMet binding (Figure 3A). To test this, we mutated Asn252 to Ala or Asp, while Arg253 was mutated to Ala or Glu. After the eviction of the eIF2βWT plasmid, the eIF2βN252A mutation showed no growth defect, whereas the eIF2βN252D mutation caused a growth defect. The eIF2βR253A mutation caused severe growth defects, whereas the eIF2βR253E mutation was lethal, suggesting that the R-loop region is necessary for the Met-tRNAiMet binding (Figure 3B). Since the eIF2βT238A (T-loop) suppressor mutation showed higher affinity for the Met-tRNAiMet binding (Figure 2E), we reasoned that combining this suppressor mutation with the R-loop mutations should rescue its slow growth defect. Consistently, the slow growth phenotype of the eIF2βN252D and eIF2βR253A mutation was partially suppressed when combined with the T-loop eIF2βT238A mutation (Figure 3C), suggesting that the R-loop and T-loop coordinate to interact with the Met-tRNAiMet.
Analysis of eIF2β ZBD residues involved in the Met-tRNAiMet binding
(A) Schematic of eIF2β and Met-tRNAi interaction. The cryoEM structure (6FYX) showing eIF2β (blue) and Met-tRNAi (grey), as per Figure 1B. The eIF2β residues N252 and R253 are represented as sticks and show interactions with the Met-tRNAi residues A1, G67, and G68, indicated in red dotted lines. The distance indicated between these residues is in Å. (B,C) Growth analysis. Yeast strain, YP912 (gcd11Δ, sui3Δ) carrying YCplac22_HA_GCD11 (A1404) and derivatives of eIF2βWT (A1451), eIF2βN252A (A1213), eIF2βN252D (A1214), eIF2βR253A (A1215), eIF2βR253E (A1216) or, empty vector (EV) (A308) were patched on SD plate supplemented with histidine and replica platted on SD plate supplemented with uracil, histidine and 5FOA and incubated for 3–4 days at 30°C for (B). Viable cells from the 5-FOA plate were serially diluted and spotted on the SD plate supplemented with uracil and histidine (C). (D) Yeast cells from (C) were subjected to Co-IP followed by Western and Northern blot analysis as described in Figure 2E. (E) Analysis of TC on the 43-48S ribosomes. Yeast cells from (C) were subjected to 1% HCHO cross-linking, and the amounts of TC on 43-48S ribosomes were performed as described in Figure 2F. The graph (below) shows the densitometric quantitation of the TC on 40S ribosome from at least three biological replicates. (F) Analysis of HIS4-lacZ expression. Yeast cells from (C) were transformed with either pA1072 (GAPDHprom_His4AUG_lacZ) or pA1073 (GAPDHprom_His4UUG_lacZ) plasmids, and the β-galactosidase assay was performed as described for Figure 2C. (G) Analysis of GCN4-lacZ expression. Yeast cells from (C) were transformed with GCN4-lacZ construct (p180), and the β-galactosidase assay was performed as described in Figure 2C. Statistical differences were determined by one-way ANOVA analysis. The error bar shows the standard deviation obtained from at least three biological replicates.
(A) Schematic of eIF2β and Met-tRNAi interaction. The cryoEM structure (6FYX) showing eIF2β (blue) and Met-tRNAi (grey), as per Figure 1B. The eIF2β residues N252 and R253 are represented as sticks and show interactions with the Met-tRNAi residues A1, G67, and G68, indicated in red dotted lines. The distance indicated between these residues is in Å. (B,C) Growth analysis. Yeast strain, YP912 (gcd11Δ, sui3Δ) carrying YCplac22_HA_GCD11 (A1404) and derivatives of eIF2βWT (A1451), eIF2βN252A (A1213), eIF2βN252D (A1214), eIF2βR253A (A1215), eIF2βR253E (A1216) or, empty vector (EV) (A308) were patched on SD plate supplemented with histidine and replica platted on SD plate supplemented with uracil, histidine and 5FOA and incubated for 3–4 days at 30°C for (B). Viable cells from the 5-FOA plate were serially diluted and spotted on the SD plate supplemented with uracil and histidine (C). (D) Yeast cells from (C) were subjected to Co-IP followed by Western and Northern blot analysis as described in Figure 2E. (E) Analysis of TC on the 43-48S ribosomes. Yeast cells from (C) were subjected to 1% HCHO cross-linking, and the amounts of TC on 43-48S ribosomes were performed as described in Figure 2F. The graph (below) shows the densitometric quantitation of the TC on 40S ribosome from at least three biological replicates. (F) Analysis of HIS4-lacZ expression. Yeast cells from (C) were transformed with either pA1072 (GAPDHprom_His4AUG_lacZ) or pA1073 (GAPDHprom_His4UUG_lacZ) plasmids, and the β-galactosidase assay was performed as described for Figure 2C. (G) Analysis of GCN4-lacZ expression. Yeast cells from (C) were transformed with GCN4-lacZ construct (p180), and the β-galactosidase assay was performed as described in Figure 2C. Statistical differences were determined by one-way ANOVA analysis. The error bar shows the standard deviation obtained from at least three biological replicates.
To understand the nature of TC formation in the eIF2βN252D and eIF2βR253A mutants, we performed an in-vivo co-immunoprecipitation assay as describes in the previous section. The eIF2βN252D and eIF2βR253A mutations showed the Met-tRNAiMet binding defect, suggesting destabilization of the TC (Figure 3D). Consistent with its growth defect, the eIF2βN252D mutant showed a lower amount of the TC binding to the 43-48S ribosomal complex, whereas the eIF2βN252D/T238A double mutation partially rescued the growth defect and improved the Met-tRNAiMet levels on the 43-48S ribosomal complex (Figure 3E). However, the eIF2βR253A and the eIF2βR253A/T238A double mutant exacerbate the TC binding to the 43-48S ribosomal complex compared with the eIF2βN252D mutation, which is consistent with its severe slow growth phenotype (Figure 3E).
The eIF2βN252D and eIF2βR253A mutations showed Sui¯ phenotype that can be partially suppressed when combined with the eIF2βT238A mutation (Figure 3F), suggesting that the T-loop eIF2βT238A substitution influences the R-loop residues to alter the Met-tRNAiMet binding conformation to partially rescue the Sui¯ phenotype. Consistent with its Met-tRNAiMet binding defects, the eIF2βN252D and eIF2βR253A mutations showed Gcd¯ phenotype. Interestingly, the eIF2βN252D/T238A mutation partially rescued the Gcd¯ phenotype of the original eIF2βN252D mutation; however, the eIF2βR253A/T238A did not rescue the Gcd¯ phenotype of the original eIF2βR253A mutation (Figure 3G).
Additionally, we tested if the eIF2βT238A mutation suppresses the defects associated with the previously reported eIF2βF217A/Q221A mutations in the HTH region [3,26]. Combining the eIF2βT238A mutation with the eIF2βF217A/Q221A mutations partially suppressed the Sui¯ and the Gcd¯ phenotype without rescuing its slow growth defect (Supplementary Figure S4). Taken together, these results suggest that the T-loop eIF2βT238A substitution plays an important role not only in the rescue of the eIF2βS264Y binding defect but also influences the eIF2β R-loop and HTH region in partially rescuing the defect in the start codon recognition.
The eIF2βT238A mutation suppresses the defect associated with the eIF2γN135D switch-I mutation but not the eIF2γV281K MEHMO mutation
The eIF2γ SW-I and SW-II regions play an important role in the effector function of the Met-tRNAiMet binding and GTPase activity [4,17,24]. The SW-I region is proposed to adopt a different conformation in the GTP bound conditions to enable effector function compared with the GDP bound state [40]. Structural data suggests that the eIF2γ SW-I residue Arg127 interacts with the eIF2β Thr265 residue (S-loop) of the ZBD in the TC (Figures 1B and 4A) [5]. It is possible that the eIF2β-ZBD may be playing an important role in stabilizing the GTP bound SW-I conformation to enable the Met-tRNAiMet binding. Previous studies on the eIF2γN135D SW-I mutation show defects in the Met-tRNAiMet binding, Slg¯, Sui¯, and Gcd¯ phenotype [17]. To check if the eIF2β-ZBD plays an important role in the stabilization of the GTP bound SW-I conformation, we expressed the eIF2γN135D and the eIF2βT238A mutation together in the YP912 (gcd11Δ, sui3Δ) yeast strain. Consistent with our postulation, the eIF2γN135D SW-I mutant’s severe growth defect was partially rescued by the eIF2βT238A mutation (Figure 4B), suggesting that the eIF2βT238A mutation may alter the eIF2β-ZBD conformation that influences the eIF2γN135D mutant SW-I region to adopt a favourable conformation to bind the Met-tRNAiMet. To confirm the better Met-tRNAiMet binding activity in the double mutant, we performed an in vivo co-immunoprecipitation assay. Consistent with the previous report, the eIF2γN135D mutation showed severe defects in the Met-tRNAiMet binding (Figure 4C, lane 8) [17]. However, co-expression of the eIF2γN135D and eIF2βT238A mutation partially rescued the Met-tRNAiMet binding defect (Figure 4C, lane 9). Consistently, the eIF2γN135D mutant's Sui¯ and Gcd¯ phenotype was partially suppressed by the eIF2βT238A mutation, indicating that the altered Met-tRNAiMet binding affinity adversely affects TC formation (Figure 4D,E).
The eIF2βT238A mutation suppresses defects associated with the eIF2γN135D SW-I mutation
(A) Schematic of eIF2β and eIF2γ interaction. The cryoEM structure of partial yeast 48S PIC (6FYX) showing eIF2β (blue), eIF2γ (cyan), Zn2+ ion (sphere; grey) and a GCP molecule. Residues that were mutated in the present study are shown in red color sticks. (B) Growth analysis. Yeast strain YP912 (gcd11Δ, sui3Δ) carrying 3xHA-tagged eIF2γWT (A1) or, eIF2γN135D (A2) were transformed with eIF2βWT (A1452) or, eIF2βT238A (A1272) plasmid constructs. The cells were grown overnight, serially diluted, spotted on SD plate supplemented with uracil and histidine, and incubated at 30°C for 2 days. (C) Co-Immunoprecipitation assay. Yeast cells from (B) were subjected to Co-IP followed by Western and Northern blot as described in Figure 2E. (D) Analysis of HIS4-lacZ expression. Yeast cells from (A) were transformed with either GAPDHprom_His4AUG_lacZ (A1072) or GAPDHprom_His4UUG_lacZ (A1073) plasmids, and the β-galactosidase assay was performed as described for Figure 2C. (E) Analysis of GCN4-lacZ expression. Yeast cells from (B) were transformed with GCN4-lacZ construct (p180), and the β-galactosidase assay was performed as described in Figure 2D. (F) Growth analysis. Yeast strain YP912 (gcd11Δ, sui3Δ) carrying empty vector (EV), eIF2βWT (pA1452) or, eIF2βS264Y (pA890) were transformed with eIF2γWT (pA343) or, eIF2γV281K (pA1421) or, eIF2γN135D (pA57) plasmid constructs. The transformant colonies were patched on an SD plate supplemented with histidine, replica plated on an SD plate supplemented with uracil, histidine and 5-FOA, and incubated for 2–4 days at 30°C. (G) Growth analysis. Yeast strain YP912 (gcd11Δ, sui3Δ) carrying eIF2βWT (A1452)/eIF2γWT (A1), eIF2βWT (A1452)/eIF2γV281K (A1426), eIF2βT238A (A1272)/eIF2γV281K (A1426), or eIF2βT238A (A1272)/ eIF2γWT (A1) plasmid constructs were grown overnight, serially diluted, and spotted on SD plate supplemented with uracil and histidine and incubated at 30°C for 2 days. (H) Co-Immunoprecipitation assay. Yeast cells from (G) were subjected to Co-IP followed by Western blot, as described in Figure 2E. A higher exposure (high) of the eIF2β blot for lanes 5 and 6 is shown. Statistical differences were determined by one-way ANOVA analysis. The error bar shows the standard deviation obtained from at least three biological replicates.
(A) Schematic of eIF2β and eIF2γ interaction. The cryoEM structure of partial yeast 48S PIC (6FYX) showing eIF2β (blue), eIF2γ (cyan), Zn2+ ion (sphere; grey) and a GCP molecule. Residues that were mutated in the present study are shown in red color sticks. (B) Growth analysis. Yeast strain YP912 (gcd11Δ, sui3Δ) carrying 3xHA-tagged eIF2γWT (A1) or, eIF2γN135D (A2) were transformed with eIF2βWT (A1452) or, eIF2βT238A (A1272) plasmid constructs. The cells were grown overnight, serially diluted, spotted on SD plate supplemented with uracil and histidine, and incubated at 30°C for 2 days. (C) Co-Immunoprecipitation assay. Yeast cells from (B) were subjected to Co-IP followed by Western and Northern blot as described in Figure 2E. (D) Analysis of HIS4-lacZ expression. Yeast cells from (A) were transformed with either GAPDHprom_His4AUG_lacZ (A1072) or GAPDHprom_His4UUG_lacZ (A1073) plasmids, and the β-galactosidase assay was performed as described for Figure 2C. (E) Analysis of GCN4-lacZ expression. Yeast cells from (B) were transformed with GCN4-lacZ construct (p180), and the β-galactosidase assay was performed as described in Figure 2D. (F) Growth analysis. Yeast strain YP912 (gcd11Δ, sui3Δ) carrying empty vector (EV), eIF2βWT (pA1452) or, eIF2βS264Y (pA890) were transformed with eIF2γWT (pA343) or, eIF2γV281K (pA1421) or, eIF2γN135D (pA57) plasmid constructs. The transformant colonies were patched on an SD plate supplemented with histidine, replica plated on an SD plate supplemented with uracil, histidine and 5-FOA, and incubated for 2–4 days at 30°C. (G) Growth analysis. Yeast strain YP912 (gcd11Δ, sui3Δ) carrying eIF2βWT (A1452)/eIF2γWT (A1), eIF2βWT (A1452)/eIF2γV281K (A1426), eIF2βT238A (A1272)/eIF2γV281K (A1426), or eIF2βT238A (A1272)/ eIF2γWT (A1) plasmid constructs were grown overnight, serially diluted, and spotted on SD plate supplemented with uracil and histidine and incubated at 30°C for 2 days. (H) Co-Immunoprecipitation assay. Yeast cells from (G) were subjected to Co-IP followed by Western blot, as described in Figure 2E. A higher exposure (high) of the eIF2β blot for lanes 5 and 6 is shown. Statistical differences were determined by one-way ANOVA analysis. The error bar shows the standard deviation obtained from at least three biological replicates.
MEHMO syndrome is caused by one of the human eIF2γI222T mutations [41]. Dever and co-workers used yeast as a model system to characterize an eIF2γV281K mutation (Figure 4A) (corresponding to the human eIF2γI222T mutation) and showed that the mutation impaired eIF2β binding and enhanced translation initiation from a near-cognate UUG codon [42]. We reasoned that if the eIF2βT238A mutation rescue the eIF2γ-β interaction defect of the eIF2βS264Y mutation, then it could also rescue the eIF2γ-β interaction defect of the eIF2γV281K MEHMO mutation. However, co-expression of the eIF2γV281K and eIF2βT238A suppressor mutation did not rescue the growth defect associated with the eIF2γV281K mutation (Figure 4G, row 3). Moreover, the Co-IP of 3xHA-tagged eIF2γV281K and eIF2βT238A suppressor mutation did not restore eIF2β-γ interaction (Figure 4H, lane 6). The eIF2β likely has two independent interaction sites on the eIF2γ subunit: The first (site-I), the eIF2β hydrophobic rich α1-helix (residue 127-143) interaction with the eIF2γ surface hydrophobic rich patch residues (276-297) and the second (site-II), the eIF2β-ZBD (T-loop residue 238-240 and S-loop residues 262-265) interaction with GTP binding interface of the eIF2γ subunit (Figure 5A) [3]. Both these interactions could be necessary for the stable eIF2β-γ complex formation and function. However, mutations that disrupt both of these interaction sites should have a catastrophic effect on the TC formation. Consistently, co-expression of the eIF2βS264Y and eIF2γV281K mutation was lethal in yeast (Figure 4F, row 4 and Figure 5F).
Models depicting the locations of eIF2 mutations and their impacts on Met-tRNAiMet and eIF2β-γ binding
eIF2γ (light orange), eIF2β (blue), eIF2α (teal), GTP (green), and Met-tRNAiMet (black). (A) The WT eIF2 complex showing interactions of eIF2α, eIF2β, and Met-tRNAiMet with the eIF2γ subunit. The eIF2β α1-helix and ZBD interact with the eIF2γ G-domain at site-I and site-II (guanine nucleotide binding interphase), respectively. (B) The eIF2βS264Y ZBD (S-loop) mutation (red arrowhead) disrupts the interaction with the eIF2γ G-domain at site-II. However, the α1-helix remains anchored at the site-I region, making the eIF2β C-terminal domain highly mobile, causing dissociation of the Met-tRNAiMet (grey) from the TC. (C) The suppressor mutation eIF2βS264Y/T238A in the T-loop (red arrowhead) restores the eIF2β ZBD binding to the site-II. However, the Met-tRNAiMet binding defect is partially rescued. (D) The eIF2βN252D and eIF2βR253A mutations (red arrowhead) in the R-loop disrupt the interaction with the Met-tRNAiMet, causing it to dissociate from the TC. (E) The eIF2βN252D/T238A suppressor mutation (red arrowheads) partially restores the Met-tRNAiMet binding. (F) The eIF2βS264Y and eIF2γV281K mutation (red arrowheads) disrupt the interaction of eIF2β with the eIF2γ subunit both at the site-I and site-II region, preventing eIF2β-γ interaction. In the absence of the eIF2β binding with the eIF2γ subunit, the Met-tRNAiMet could not bind to form TC, causing lethality.
eIF2γ (light orange), eIF2β (blue), eIF2α (teal), GTP (green), and Met-tRNAiMet (black). (A) The WT eIF2 complex showing interactions of eIF2α, eIF2β, and Met-tRNAiMet with the eIF2γ subunit. The eIF2β α1-helix and ZBD interact with the eIF2γ G-domain at site-I and site-II (guanine nucleotide binding interphase), respectively. (B) The eIF2βS264Y ZBD (S-loop) mutation (red arrowhead) disrupts the interaction with the eIF2γ G-domain at site-II. However, the α1-helix remains anchored at the site-I region, making the eIF2β C-terminal domain highly mobile, causing dissociation of the Met-tRNAiMet (grey) from the TC. (C) The suppressor mutation eIF2βS264Y/T238A in the T-loop (red arrowhead) restores the eIF2β ZBD binding to the site-II. However, the Met-tRNAiMet binding defect is partially rescued. (D) The eIF2βN252D and eIF2βR253A mutations (red arrowhead) in the R-loop disrupt the interaction with the Met-tRNAiMet, causing it to dissociate from the TC. (E) The eIF2βN252D/T238A suppressor mutation (red arrowheads) partially restores the Met-tRNAiMet binding. (F) The eIF2βS264Y and eIF2γV281K mutation (red arrowheads) disrupt the interaction of eIF2β with the eIF2γ subunit both at the site-I and site-II region, preventing eIF2β-γ interaction. In the absence of the eIF2β binding with the eIF2γ subunit, the Met-tRNAiMet could not bind to form TC, causing lethality.
Discussion
Structural data suggest that the eIF2β-Ser264 residue is part of a zinc-binding domain and interacts via its side chain with the 2′OH and 3′OH groups of the guanine nucleotide’s ribose sugar moiety in the TC. It appears that the eIF2β may be interacting with the core eIF2γ subunit’s guanine nucleotide binding interface via the ZBD, and the eIF2βS264Y mutation may have disrupted this interaction. The yeast two-hybrid and Co-IP experiments confirm the eIF2βS264Y and eIF2γ interaction defect (Figure 1D,E). Biochemical characterization of the eIF2βS264Y mutation and the suppressor mutation revealed no significant changes in the guanine nucleotide binding affinity. However, the eIF2βT238A mutation partially suppresses the Sui¯ and Gcd¯ phenotype of the eIF2βS264Y mutation, suggesting the importance of the T-loop residue in the TC formation (Figure 2C,D). The Co-IP assay and the analysis of the initiation factors associated with the 40S ribosomal subunit confirm the eIF2β and Met-tRNAiMet binding defect in the eIF2βS264Y mutation. The eIF2βS264Y mutation may have disrupted the S-loop conformation, leading to the eIF2β interaction defect. In the absence of the stable eIF2β association with the eIF2γ subunit’s guanine nucleotide binding interface, the Met-tRNAiMet frequently falls from the eIF2γ subunit, thus lowering the TC levels (Figure 5B). However, whereas the eIF2βT238A suppressor mutation in the T-loop fully rescued the eIF2β binding defect of the eIF2βS264Y mutation, the partial Met-tRNAiMet binding defect persists, probably because of the continuous interference of the Ser264Tyr mutant residue with the Met-tRNAiMet binding pocket, thus showing the partial Sui¯ and Gcd¯ phenotype (Figures 2E,F and 5C). Therefore, the eIF2β subunit may be contributing to the Met-tRNAiMet binding via R-loop as well as the polar interaction of S-loop's Thr265 residue with the eIF2γ subunit’s Arg127 in the SW-I region (Figure 1B). The T-loop eIF2βT238A mutation could likely influence the R-loop and S-loop conformation for the Met-tRNAiMet binding. Previous studies on the eIF2γN135D mutation in the SW-I region show Met-tRNAiMet binding defect and an attendant Sui¯ and Gcd¯ phenotype [17]. However, when the eIF2βT238A mutation was combined with the eIF2γN135D SW-I mutation, it partially suppresses its Slg¯, Sui¯, and Gcd¯ phenotype (Figure 4A–D). This reinforces the notion that the eIF2β-ZBD could perturb the eIF2γ SW-I conformation to maintain the geometry of the Met-tRNAiMet binding pocket.
The R-loop is projected into the Met-tRNAiMet acceptor arm. The cryo-EM structure data suggest that this R-loop’s Asn252 and Arg253 residue interact with the A1 and G67/G68 nucleotide residue of the Met-tRNAiMet acceptor arm, respectively (Figure 3A) [5]. The mutation of Asn252 to the negatively charged aspartic acid may disrupt interaction with the A1 nucleotide, causing the Met-tRNAiMet binding defect (Figure 5D), which is consistent with the low levels of Met-tRNAiMet on the 40S ribosomal subunit. Whereas the more severe Arg253 to Ala mutation could disrupt the two-hydrogen bond interaction with the G67/G68 Met-tRNAiMet nucleotide residues and showed severe slow growth phenotype, the Arg253 to negatively charged glutamic acid substitution was lethal. Remarkably, the T-loop eIF2βT238A mutation partially suppresses the Met-tRNAiMet binding defect, Sui¯, and Gcd¯ phenotype of the R-loop eIF2βN252D mutation. We propose that the eIF2β zinc-binding domain's S-loop and T-loop coordinate with the Zn2+ ion to facilitate the eIF2β subunit's interaction with the guanine nucleotide-binding interface of the eIF2γ G-domain and help to position HTH domain and the R-loop to interact with the Met-tRNAiMet via Asn252 and Arg253 residue. However, the eIF2βT238A mutation could perturb these loop’s conformation and subtly orient the S-loop and R-loop conformation to enhance the interaction and orientation of the Met-tRNAiMet binding with the eIF2 complex (Figure 5E). This could be the reason why the eIF2βT238A mutation showed a strong affinity (∼12.5-fold) for the Met-tRNAiMet binding to the eIF2 complex (Figure 2E, lane 16). However, this augmented Met-tRNAiMet binding affinity in the eIF2βT238A mutant may be only restricted to the TC complex formation level. Once the TC is loaded onto the 40S ribosomal subunit, the Met-tRNAiMet binding affinity of the eIF2βT238A mutant to the 43-48S complex is comparable to the WT levels (Figure 2E, lane 16 and Figure 2F).
Overall, the partial rescue of the Sui¯ and Gcd¯ phenotype of eIF2β S-loop (S264Y), R-loop (N252D), HTH (F217/Q221A) and the eIF2γ SW-I (N135D) mutations by the eIF2β T-loop (T238A) mutation reinforce the notion that the eIF2β-ZBD modulates the Met-tRNAiMet binding affinity through the guanine nucleotide-binding interface. It not only moderately restores the Met-tRNAiMet binding to alleviate the Gcd¯ phenotype but also prevents premature delivery of the Met-tRNAiMet in the PIN conformation to partially rescue the Sui¯ phenotype.
Castilho and coworkers have previously established that the eIF2β region from residue 128-159 is sufficient to interact with the eIF2γ subunit. They also demonstrated that the eIF2βY131A/S132A double mutation causes an eIF2γ subunit binding defect. Moreover, combining the eIF2βS264Y mutation with eIF2βY131A/S132A mutation causes lethality [32]. The cryo-EM data suggest that the eIF2β hydrophobic amino acid-rich α1-helix interacts with the eIF2γ-G domain surface hydrophobic rich patch residues (276-297) [3]. Interestingly, the cryo-EM structure of partial yeast 48S complex containing eIF2βS264Y mutation subunit shows only α1-helix interacting with the eIF2γ-G domain; however, the eIF2β-ZBD and HTH domain is not resolved in this structure [15], possibly high mobility of these domains (Figure 5B). These data and our findings indicate that the eIF2β-ZBD interacts with the eIF2γ subunit via the guanine nucleotide-binding interface. Moreover, the inability of the eIF2βT238A mutation to suppress the growth defect of the eIF2γV281K G-domain mutation and the co-expression of the eIF2βS264Y and eIF2γV281K mutation causing synthetic lethality suggest that the eIF2β may have two independent interaction sites on the eIF2γ subunit (Figures 4F–H and 5F). We propose the eIF2β α1-helix interaction with the eIF2γ G-domain could be a primary binding site (site-I), whereas a slightly flexible eIF2β-ZBD interaction with the guanine nucleotide-binding interface may be acting as a secondary binding site (site-II). Both these interactions of eIF2β with the eIF2γ subunit are critical for binding the Met-tRNAiMet to the eIF2 complex (Figure 5A). Thus, the eIF2β subunit anchors on the eIF2γ G-domain via its α1-helix, whereas the flexible secondary binding between the eIF2β-ZBD and eIF2γ guanine nucleotide-binding interface may allow eIF2β subunit movement to load and stabilize the Met-tRNAiMet during the TC formation and Met-tRNAiMet unloading during delivery to the P-site of 40S ribosome.
Materials and methods
Growth media
Synthetic dextrose (SD): 0.17% yeast nitrogen base without NH4(SO4), 0.5% NH4(SO4)2, 2% glucose.
Synthetic complete dropout (SCD): 0.17% yeast nitrogen base without NH4(SO4), 0.5% NH4(SO4)2, 2% glucose supplemented with adenine, alanine, arginine, asparagine, aspartate, cysteine, glutamine, glutamate, glycine, inositol, isoleucine, lysine, methionine, p-amino benzoic acid, phenyl alanine, proline, serine, threonine, tyrosine, and valine (2 mg/ml each).
Preparation of yeast strain (Table 1)
The oligonucleotides (Table 3) oPA1117/oPA1118 carrying SUI3 ORF specific flanking sequence was used to PCR amplify 2.5 kb LoxP-LEU2-LoxP cassette from the pUG73 (B4034) plasmid template and transformed into the yeast strain YP824 harbouring SUI3_GCD11/URA3 (A1118) plasmid to delete the chromosomal SUI3 gene by homologous recombination method. The oligonucleotide oPA887 and oPA160 binds to the LEU2 cassette and the SUI3 3′ UTR region, respectively and gives 1 kb PCR amplification from the genome of this intermediate strain which confirmed the insertion of the LoxP-LEU2-LoxP cassette and removal of the SUI3 ORF. The Cre recombinase enzyme expression from the plasmid YCplac22_Gal_Cre [43] removed the LoxP-LEU2-LoxP DNA sequence to generate yeast strain YP896 [43]. The oligonucleotides oPA929/oPA930 carrying GCD11 ORF specific flanking sequence were used to PCR amplify 2.5 kb LoxP-LEU2-LoxP cassette from the pUG73 plasmid template and transformed into the yeast strain YP896 to delete the chromosomal GCD11 gene by homologous recombination method. The oligonucleotide oPA887 and oPA390 binds to the LEU2 cassette and the GCD11 3′ UTR region, respectively and amplify 1 kb PCR product from the genome of this intermediate strain which confirmed the insertion of the LoxP-LEU2-LoxP cassette and removal of the GCD11 ORF from the genome. The Cre recombinase enzyme expression from the plasmid YCplac22_Gal_Cre further removed the LoxP-LEU2-LoxP DNA sequence to generate a final yeast strain YP912. Table 1.
Sr. No. . | Strain . | Genotype . | Reference . |
---|---|---|---|
1 | YP824 | MATα leu2-3, -112, ura3-52, trp1-63Δ, GCN2+, Gal2+ his4Δ::KanMx6 | [28] |
2 | YP896 | MATα ura3-52, leu2-3,-112 trp1-63Δ his4::KanMx6 sui3::LoxP GAL2+ p[GCD11-SUI3,URA3] | This study |
3 | YP912 | MATα ura3-52 leu2-3,-112 trp1-63Δ his4::KanMx6 sui3::LoxP gcd11::LoxP GAL2+ p[GCD11-SUI3,URA3] | This study |
4 | YP920 | MATa his3-Δ1 ura3-Δ0 leu2Δ0 trp1-1 met15-Δ0 sui2Δ::hisG sui3Δ::KanMX4 gcd11Δ::NAT gcn2Δ::hisG pep4::HIS3 p1780[SUI2, SUI3, GCD11, URA3] | [22] |
5 | YP930 | MATa trp1-901 leu2-3 leu2-112 ura3-52 his3-200 ade2-201 gal4-Δ gal80-ΔLYS2::GAL1UAS-GAL1TATA-HIS3, GAL2UAS-GAL2TATA-ADE2 URA3::MEL1UAS-MEL1TATA-lacZ | [44] |
Sr. No. . | Strain . | Genotype . | Reference . |
---|---|---|---|
1 | YP824 | MATα leu2-3, -112, ura3-52, trp1-63Δ, GCN2+, Gal2+ his4Δ::KanMx6 | [28] |
2 | YP896 | MATα ura3-52, leu2-3,-112 trp1-63Δ his4::KanMx6 sui3::LoxP GAL2+ p[GCD11-SUI3,URA3] | This study |
3 | YP912 | MATα ura3-52 leu2-3,-112 trp1-63Δ his4::KanMx6 sui3::LoxP gcd11::LoxP GAL2+ p[GCD11-SUI3,URA3] | This study |
4 | YP920 | MATa his3-Δ1 ura3-Δ0 leu2Δ0 trp1-1 met15-Δ0 sui2Δ::hisG sui3Δ::KanMX4 gcd11Δ::NAT gcn2Δ::hisG pep4::HIS3 p1780[SUI2, SUI3, GCD11, URA3] | [22] |
5 | YP930 | MATa trp1-901 leu2-3 leu2-112 ura3-52 his3-200 ade2-201 gal4-Δ gal80-ΔLYS2::GAL1UAS-GAL1TATA-HIS3, GAL2UAS-GAL2TATA-ADE2 URA3::MEL1UAS-MEL1TATA-lacZ | [44] |
Cloning and plasmid preparations (Table 2)
The oligonucleotide pair oPA160/oPA161 (Table 3) was used to PCR amplify SUI3 gene from the yeast chromosome, the PCR product and the vectors YCplac111_EV (A308) and YCplac22_EV (A823) were digested with the BamHI-SalI restriction endonuclease (RE) and ligated to generate recombinant plasmid YCplac111_SUI3 (A1451) and YCplac22_SUI3 (A1452), respectively. The YCplac111-SUI3-S264Y (A1446) and YCplac33-SUI3-S264Y (A1084) construct were generated by subcloning a BamHI-SalI digested 1.9 kb fragment from the pRS313-SUI3-S264Y (A479) plasmid and ligated into the BamHI-SalI digested YCplac111-EV (A308) and YCplac33-EV (A309) vector, respectively. Tables 2 and 3.
Sr No . | Plasmid No. . | Plasmid name . | Plasmid type . | Reference . |
---|---|---|---|---|
1 | A1 | YCplac111_HA_GCD11 | Single Copy | This study |
2 | A2 | YCplac111_HA-GCD11-N135D | Single Copy | This study |
3 | A57 | YCplac111_GCD11-N135D | Single Copy | [17] |
4 | A200 | YCplac111_SUI3prom+HA | Single Copy | This study |
5 | A202 | YCplac111_HA_SUI3 | Single Copy | This study |
6 | A308 | YCplac111_EV | Single Copy | [45] |
7 | A309 | YCplac33_EV | Single Copy | [45] |
8 | A325 | YCplac111_GCD11prom | Single Copy | This study |
9 | A326 | YCplac111_GCD11prom+HA | Single Copy | This study |
10 | A343 | YCplac111_GCD11 | Single Copy | [17] |
11 | A479 | pRS313_SUI3-S264Y | Low Copy | This study |
12 | p180 | YCplac33_GCN4_lacZ | Single Copy | [46] |
13 | A591 | pRS425_EV | High Copy | [47] |
14 | A643 | pDEST22_AD (Empty Vector) | High Copy | Invitrogen |
15 | A644 | pEXP32-Krev1 | Invitrogen | |
16 | A823 | YCplac22_EV | Single Copy | [45] |
17 | A839 | YCplac33_His4AUG | Single Copy | [48] |
18 | A840 | YCplac33_His4UUG | Single Copy | [48] |
19 | A890 | YCplac22_Sui3-S264Y | Single Copy | [28] |
20 | A1072 | YCplac33_GAPDHprom_His4AUG_lacZ | Single Copy | [48] |
21 | A1073 | YCplac33_GAPDHprom_His4UUG_lacZ | Single Copy | [48] |
22 | A1084 | YCplac33_Sui3-2 | Single Copy | This study |
23 | A1095 | YCplac111_GCD11, SUI3 | Single Copy | This study |
24 | A1118 | YCplac33_GCD11, SUI3 | Single Copy | This study |
25 | A1213 | YCplac111_SUI3-N252A | Single Copy | This study |
26 | A1214 | YCplac111_SUI3-N252D | Single Copy | This study |
27 | A1215 | YCplac111_SUI3-R253A | Single Copy | This study |
28 | A1216 | YCplac111_SUI3-R253E | Single Copy | This study |
29 | A1236 | pDEST32mod (Empty Vector) | High Copy | This study |
30 | A1237 | pDEST32mod_SUI3 | High Copy | This study |
31 | A1238 | pDEST32mod_SUI3-S264Y | High Copy | This study |
32 | A1242 | pDEST22_GCD11 | High Copy | This study |
33 | A1259 | YCplac111_SUI3-S264Y/T238A | Single Copy | This study |
34 | A1260 | YCplac111_SUI3-T238A | Single Copy | This study |
35 | A1266 | pRS425_GCD11, SUI3, SUI2 | High Copy | This study |
36 | A1272 | YCplac22_SUI3-T238A | Single Copy | This study |
37 | A1394 | YCplac111_HA_SUI3-T238A | Single Copy | This study |
38 | A1404 | YCplac22_HA_GCD11 | Single Copy | This study |
39 | A1413 | pRS425_GCD11, SUI3-S264Y/T238A, SUI2 | High Copy | This study |
40 | A1414 | pRS425_GCD11, SUI3-T238A, SUI2 | High Copy | This study |
41 | A1421 | YCplac111_GCD11-V281K | Single Copy | This study |
42 | A1426 | YCplac111_3xHAGCD11-V281K | Single Copy | This study |
43 | A1446 | YCplac111_SUI3-S264Y | Single Copy | This study |
44 | A1451 | YCplac111_SUI3 | Single Copy | This study |
45 | A1452 | YCplac22_SUI3 | Single Copy | This study |
46 | A1453 | YCplac22_GCD11 | Single Copy | This study |
47 | A1488 | YCplac111_SUI3prom | Single Copy | This study |
48 | A1490 | YCplac111_SUI3-F217A/Q221A | Single Copy | This study |
49 | A1492 | YCplac111_SUI3-F217A/Q221A/T238A | Single Copy | This study |
50 | A1493 | YCplac111_SUI3-N252D/T238A | Single Copy | This study |
51 | A1494 | YCplac111_SUI3-R253A/T238A | Single Copy | This study |
52 | A1507 | pRS425_GCD11, SUI3-S264Y, SUI2 | High Copy | This study |
53 | B4034 | pUG73 | [43] |
Sr No . | Plasmid No. . | Plasmid name . | Plasmid type . | Reference . |
---|---|---|---|---|
1 | A1 | YCplac111_HA_GCD11 | Single Copy | This study |
2 | A2 | YCplac111_HA-GCD11-N135D | Single Copy | This study |
3 | A57 | YCplac111_GCD11-N135D | Single Copy | [17] |
4 | A200 | YCplac111_SUI3prom+HA | Single Copy | This study |
5 | A202 | YCplac111_HA_SUI3 | Single Copy | This study |
6 | A308 | YCplac111_EV | Single Copy | [45] |
7 | A309 | YCplac33_EV | Single Copy | [45] |
8 | A325 | YCplac111_GCD11prom | Single Copy | This study |
9 | A326 | YCplac111_GCD11prom+HA | Single Copy | This study |
10 | A343 | YCplac111_GCD11 | Single Copy | [17] |
11 | A479 | pRS313_SUI3-S264Y | Low Copy | This study |
12 | p180 | YCplac33_GCN4_lacZ | Single Copy | [46] |
13 | A591 | pRS425_EV | High Copy | [47] |
14 | A643 | pDEST22_AD (Empty Vector) | High Copy | Invitrogen |
15 | A644 | pEXP32-Krev1 | Invitrogen | |
16 | A823 | YCplac22_EV | Single Copy | [45] |
17 | A839 | YCplac33_His4AUG | Single Copy | [48] |
18 | A840 | YCplac33_His4UUG | Single Copy | [48] |
19 | A890 | YCplac22_Sui3-S264Y | Single Copy | [28] |
20 | A1072 | YCplac33_GAPDHprom_His4AUG_lacZ | Single Copy | [48] |
21 | A1073 | YCplac33_GAPDHprom_His4UUG_lacZ | Single Copy | [48] |
22 | A1084 | YCplac33_Sui3-2 | Single Copy | This study |
23 | A1095 | YCplac111_GCD11, SUI3 | Single Copy | This study |
24 | A1118 | YCplac33_GCD11, SUI3 | Single Copy | This study |
25 | A1213 | YCplac111_SUI3-N252A | Single Copy | This study |
26 | A1214 | YCplac111_SUI3-N252D | Single Copy | This study |
27 | A1215 | YCplac111_SUI3-R253A | Single Copy | This study |
28 | A1216 | YCplac111_SUI3-R253E | Single Copy | This study |
29 | A1236 | pDEST32mod (Empty Vector) | High Copy | This study |
30 | A1237 | pDEST32mod_SUI3 | High Copy | This study |
31 | A1238 | pDEST32mod_SUI3-S264Y | High Copy | This study |
32 | A1242 | pDEST22_GCD11 | High Copy | This study |
33 | A1259 | YCplac111_SUI3-S264Y/T238A | Single Copy | This study |
34 | A1260 | YCplac111_SUI3-T238A | Single Copy | This study |
35 | A1266 | pRS425_GCD11, SUI3, SUI2 | High Copy | This study |
36 | A1272 | YCplac22_SUI3-T238A | Single Copy | This study |
37 | A1394 | YCplac111_HA_SUI3-T238A | Single Copy | This study |
38 | A1404 | YCplac22_HA_GCD11 | Single Copy | This study |
39 | A1413 | pRS425_GCD11, SUI3-S264Y/T238A, SUI2 | High Copy | This study |
40 | A1414 | pRS425_GCD11, SUI3-T238A, SUI2 | High Copy | This study |
41 | A1421 | YCplac111_GCD11-V281K | Single Copy | This study |
42 | A1426 | YCplac111_3xHAGCD11-V281K | Single Copy | This study |
43 | A1446 | YCplac111_SUI3-S264Y | Single Copy | This study |
44 | A1451 | YCplac111_SUI3 | Single Copy | This study |
45 | A1452 | YCplac22_SUI3 | Single Copy | This study |
46 | A1453 | YCplac22_GCD11 | Single Copy | This study |
47 | A1488 | YCplac111_SUI3prom | Single Copy | This study |
48 | A1490 | YCplac111_SUI3-F217A/Q221A | Single Copy | This study |
49 | A1492 | YCplac111_SUI3-F217A/Q221A/T238A | Single Copy | This study |
50 | A1493 | YCplac111_SUI3-N252D/T238A | Single Copy | This study |
51 | A1494 | YCplac111_SUI3-R253A/T238A | Single Copy | This study |
52 | A1507 | pRS425_GCD11, SUI3-S264Y, SUI2 | High Copy | This study |
53 | B4034 | pUG73 | [43] |
Sr No . | Oligonucleotide Name . | Sequence (5′ → 3′) . |
---|---|---|
1 | oPA160 | CGAGGATCCTGGGCGTCGTTGAATGGC |
2 | oPA161 | CGCAGTCGACCCTGTCCTTGGGAAGTAAAC |
3 | oPA321 | AGCGGATCCAGCGTAATCTGGAACGTCATATGGATATCCTGCATAGTCCGGGACGTCATACGGATAGCCCGCATAGTCAGGAACATCGTATGGGTAGGACATCTCGTGCGTGCTTATTATATGACTGG |
4 | oPA390 | CAGAGAGCTCCAGATCCAACCGCGGGAAGTGGC |
5 | oPA391 | CGCGGATCCGACTTACAAGACCAAGAACCTAGC |
6 | oPA393 | AGCGGATCCGTGATGGTGATGGTGATGGTGATGTCCGGACATGTCTACCTCTAATGCGCGATG |
7 | oPA887 | AGTTATCCTTGGATTTGG |
8 | oPA929 | TCGCGCATTAGAGGTAGACATGAGTGACTTACAAGACCACAGCTGAAGCTTCGTACGC |
9 | oPA930 | TGGTTTTATTGGTTCCTTAAGCGATGGGTTCCAATGCATAGGCCACTAGTGGATCTG |
10 | oPA1092 | GACAGGATCCTCCTCCGATTTAGCTGCTG |
11 | oPA1117 | GTCATATAATAAGCACGCACGAGATGTCCTCCGATTTACAGCTGAAGCTTCGTACGC |
12 | oPA1118 | GTAAAGCACCAACATCACATTCTCCTTCTCTTAGCATAGGCCACTAGTGGATCTG |
13 | oPA1282 | GTACGCGGCCGCTCTCCATGTACAAACCACCGATAAG |
14 | oPA1283 | GTCAACTAGTTGGGCGTCGTTGAATGGC |
15 | oPA1284 | CAGTCCCGGGCCTGTCCTTGGGAAGTAAAC |
16 | oPA1285 | CTAGCCCGGGCCTGAATTCAGTTCTACTGGGATGA |
17 | oPA1286 | GTCACTCGAGCAATGATTTAAATGCAATTCCGAAGGA |
18 | oPA1299 | GAGAGAACAGTCAGCCAGACTGTTCTTTATGGTCT |
19 | oPA1300 | GAACAGTCTGGCTGACTGTTCTCTCTTCAATTCGGT |
20 | oPA1301 | AGAGAACAGTCAAACGCACTGTTCTTTATGGTCTG |
21 | oPA1302 | AAGAACAGTGCGTTTGACTGTTCTCTCTTCAATTC |
22 | oPA1307 | AGAGAACAGTCAAACGAACTGTTCTTTATGGTCTG |
23 | oPA1308 | AAGAACAGTTCGTTTGACTGTTCTCTCTTCAATTC |
24 | oPA1309 | AGAGAACAGTCAGACAGACTGTTCTTTATGGTCTG |
25 | oPA1310 | GAACAGTCTGTCTGACTGTTCTCTCTTCAATTC |
26 | oPA1440 | CTCCAAGCTTGAAGCAAGCC |
27 | oPA1441 | CACCGAGCTCGCTAGCCCGGGACTAGTCGACGTTTGATTCGACCTCGAC |
28 | oPA1450 | CACGGTCGACTAGTTCCTCCGATTTAGCTGCTG |
29 | oPA1451 | CACCGAGCTCTCACATTCTCCTTCTCTTACC |
30 | oPA1520 | TGTCACTTGTAAAGCGTGTAAGAGTATTAACACCG |
31 | oPA1521 | TACTCTTACACGCTTTACAAGTGACATACTCC |
32 | oPA1600 | CGCAGTCGACGCGGCCGCTCTCCATGTACAAACCACCGATAAG |
33 | oPA1651 | CACCGAGCTCTGGGCGTCGTTGAATGGC |
34 | oPA1732 | GGTTTCGATCCGAGGACATCAGGGTTATGAGCCC |
35 | oPA1771 | CTCCTATTAAGCCAATATCCGCTCAGTTGAAG |
36 | oPA1772 | GGATATTGGCTTAATAGGAGCACCGTCAGC |
37 | oPA1868 | AACTCTCGACCTTCAGA |
38 | oPA1888 | GGGTAAGGCTCAATCCAAAGCTATGGAGAATGTCTTAAG |
39 | oPAx01 | CACCGGATCCAGCGTAATCTGGAACGTCATATGGATATCCTGCATAGTCCGGGACGTCATACGGATAGCCCGCATAGTCAGGAACATCGTATGGGTAGGACATGTCTACCTCTAATGCGCGATG |
Sr No . | Oligonucleotide Name . | Sequence (5′ → 3′) . |
---|---|---|
1 | oPA160 | CGAGGATCCTGGGCGTCGTTGAATGGC |
2 | oPA161 | CGCAGTCGACCCTGTCCTTGGGAAGTAAAC |
3 | oPA321 | AGCGGATCCAGCGTAATCTGGAACGTCATATGGATATCCTGCATAGTCCGGGACGTCATACGGATAGCCCGCATAGTCAGGAACATCGTATGGGTAGGACATCTCGTGCGTGCTTATTATATGACTGG |
4 | oPA390 | CAGAGAGCTCCAGATCCAACCGCGGGAAGTGGC |
5 | oPA391 | CGCGGATCCGACTTACAAGACCAAGAACCTAGC |
6 | oPA393 | AGCGGATCCGTGATGGTGATGGTGATGGTGATGTCCGGACATGTCTACCTCTAATGCGCGATG |
7 | oPA887 | AGTTATCCTTGGATTTGG |
8 | oPA929 | TCGCGCATTAGAGGTAGACATGAGTGACTTACAAGACCACAGCTGAAGCTTCGTACGC |
9 | oPA930 | TGGTTTTATTGGTTCCTTAAGCGATGGGTTCCAATGCATAGGCCACTAGTGGATCTG |
10 | oPA1092 | GACAGGATCCTCCTCCGATTTAGCTGCTG |
11 | oPA1117 | GTCATATAATAAGCACGCACGAGATGTCCTCCGATTTACAGCTGAAGCTTCGTACGC |
12 | oPA1118 | GTAAAGCACCAACATCACATTCTCCTTCTCTTAGCATAGGCCACTAGTGGATCTG |
13 | oPA1282 | GTACGCGGCCGCTCTCCATGTACAAACCACCGATAAG |
14 | oPA1283 | GTCAACTAGTTGGGCGTCGTTGAATGGC |
15 | oPA1284 | CAGTCCCGGGCCTGTCCTTGGGAAGTAAAC |
16 | oPA1285 | CTAGCCCGGGCCTGAATTCAGTTCTACTGGGATGA |
17 | oPA1286 | GTCACTCGAGCAATGATTTAAATGCAATTCCGAAGGA |
18 | oPA1299 | GAGAGAACAGTCAGCCAGACTGTTCTTTATGGTCT |
19 | oPA1300 | GAACAGTCTGGCTGACTGTTCTCTCTTCAATTCGGT |
20 | oPA1301 | AGAGAACAGTCAAACGCACTGTTCTTTATGGTCTG |
21 | oPA1302 | AAGAACAGTGCGTTTGACTGTTCTCTCTTCAATTC |
22 | oPA1307 | AGAGAACAGTCAAACGAACTGTTCTTTATGGTCTG |
23 | oPA1308 | AAGAACAGTTCGTTTGACTGTTCTCTCTTCAATTC |
24 | oPA1309 | AGAGAACAGTCAGACAGACTGTTCTTTATGGTCTG |
25 | oPA1310 | GAACAGTCTGTCTGACTGTTCTCTCTTCAATTC |
26 | oPA1440 | CTCCAAGCTTGAAGCAAGCC |
27 | oPA1441 | CACCGAGCTCGCTAGCCCGGGACTAGTCGACGTTTGATTCGACCTCGAC |
28 | oPA1450 | CACGGTCGACTAGTTCCTCCGATTTAGCTGCTG |
29 | oPA1451 | CACCGAGCTCTCACATTCTCCTTCTCTTACC |
30 | oPA1520 | TGTCACTTGTAAAGCGTGTAAGAGTATTAACACCG |
31 | oPA1521 | TACTCTTACACGCTTTACAAGTGACATACTCC |
32 | oPA1600 | CGCAGTCGACGCGGCCGCTCTCCATGTACAAACCACCGATAAG |
33 | oPA1651 | CACCGAGCTCTGGGCGTCGTTGAATGGC |
34 | oPA1732 | GGTTTCGATCCGAGGACATCAGGGTTATGAGCCC |
35 | oPA1771 | CTCCTATTAAGCCAATATCCGCTCAGTTGAAG |
36 | oPA1772 | GGATATTGGCTTAATAGGAGCACCGTCAGC |
37 | oPA1868 | AACTCTCGACCTTCAGA |
38 | oPA1888 | GGGTAAGGCTCAATCCAAAGCTATGGAGAATGTCTTAAG |
39 | oPAx01 | CACCGGATCCAGCGTAATCTGGAACGTCATATGGATATCCTGCATAGTCCGGGACGTCATACGGATAGCCCGCATAGTCAGGAACATCGTATGGGTAGGACATGTCTACCTCTAATGCGCGATG |
Introduction of T238A mutation in the SUI3 gene was accomplished by fusion PCR using oligonucleotide pairs oPA160/oPA1521, oPA1520/oPA161 and YCplac111-SUI3 (A1451) as a template and cloned into the YCplac111-EV (A308) vector at the BamHI-SalI site to generate YCplac111-SUI3-T238A (A1260) construct. To generate the YCplac111-SUI3-T238A/S264Y (A1259) mutant construct, the same oligonucleotide set was used to amplify a 1.9 kb fragment from the pRS313-SUI3-S264Y (A479) plasmid and digested using BamHI-SalI RE and ligated into the YCplac111-EV (A308) vector. The 1.9 kb SUI3-T238A fragment was digested from the YCplac111-SUI3-T238A (A1260) plasmid and subcloned into the YCplac22-EV (A823) vector at the BamHI-SalI site to generate YCplac22-SUI3-T238A (A1272) construct.
The SUI3 mutations N252A and N252D were introduced by fusion PCR (1.9 kb) using oligonucleotide pairs oPA160/oPA1300, oPA1299/oPA161 and oPA160/oPA1310, oPA1309/oPA161, respectively using YCplac111-SUI3 (A1451) template. The PCR amplified products were digested using BamHI-SalI RE and ligated into the YCplac111-EV (A308) vector to generate YCplac111-SUI3-N252A (A1213) and YCplac111-SUI3-N252D (A1214) constructs. The SUI3 mutations R253A and R253E were introduced by fusion PCR using oligonucleotide pairs oPA160/oPA1302, oPA1301/oPA161 and oPA160/oPA1308, oPA1307/oPA161, respectively and YCplac111-SUI3 (A1451) as a template. The PCR amplified products were digested using BamHI-SalI RE and ligated into YCplac111-EV (A308) vector to generate YCplac111-SUI3-R253A (A1215) and YCplac111-SUI3-R253E (A1216) constructs.
The site-directed mutations SUI3-N252D/T238A and SUI3-R253A/T238A were generated by fusion PCR amplification using the oligonucleotide pair oPA160/oPA1521, oPA161/oPA1520 from YCplac111-SUI3-N252D (A1214) and YCplac111-SUI3-R253A (A1215) template, respectively. The 1.9 kb PCR amplified product was digested using BamHI-SalI RE and ligated into the YCplac111-EV (A308) vector to generate YCplac111-SUI3-N252D/T238A (A1493) and YCplac111-SUI3-R253A/T238A (A1494) constructs, respectively.
The 1.9 kb SUI3 gene was amplified from the YCplac111-SUI3 (A1451) plasmid using oligonucleotide pair oPA1077/oPA161 and digested using SphI-SalI RE. The digested product was ligated into the YCplac111-GCD11 (A343) plasmid to generate YCplac111-GCD11-SUI3 (A1095) plasmid. The 4.4 kb GCD11-SUI3 fragment was digested from the YCplac111_GCD11, SUI3 (A1095) plasmid and subcloned into YCplac33 (A309) at the SphI-SacI site to generate YCplac33-GCD11-SUI3 (A1118) plasmid. To add N-terminal 3x-HA tag at the eIF2β subunit, a 0.7 kb SUI3_prom+3xHA PCR product was amplified using oligonucleotide pair oPA1651/oPA321 and YCplac111-SUI3 (A1451) as a template and ligated into the YCplac111 (A308) vector at the SacI-BamHI site to generate YCplac111-SUI3prom+3xHA (A200) intermediate construct. The 1.1 kb SUI3 ORF+terminator region was PCR amplified using oligonucleotides oPA1092/oPA161 and ligated into the intermediate construct A200 at the BamHI-SalI site to generate YCplac111-3xHA-SUI3 (A202) plasmid. The 1.1 kb SUI3-T238A fragment was PCR amplified using oligonucleotides oPA1092/oPA161 and YCplac111-SUI3-T238A (A1260) as a template and ligated at the BamHI-SalI site of the intermediate construct to generate the YCplac111-3xHA-SUI3-T238A (A1394) plasmid.
The F217A/Q221A mutation was introduced into the SUI3 gene by PCR amplifying the 1.1 kb fragment using oligonucleotide pair oPA1092/oPA1889, oPA161/oPA1888, and YCplac111-SUI3 (A1451) as a template. The amplified product was digested using BamHI-SalI RE and ligated into the YCplac111-SUI3prom (A1488) vector backbone to generate the YCplac111-SUI3-F217A/Q221A construct (A1490). Another construct, YCplac111_SUI3-F217A/Q221A/T238A (A1492), was also generated by a 1.1 kb fusion PCR amplified product from YCplac111-SUI3-T238A (A1260) plasmid template using the same set of oligonucleotide pairs. The BamHI-SalI digested PCR product was ligated into the YCplac111-SUI3prom (A1488) vector backbone.
The YCplac22-3xHA-GCD11 (A1404) and YCplac22-GCD11 (A1453) constructs were generated by digesting ∼2.5 kb GCD11 and 3xHA-GCD11 product from YCplac111-3xHA-GCD11 (A1) and YCplac111-His8-GCD11 (A343) respectively using SacI-SalI RE and subcloned into YCplac22-EV (A823) vector. Using the oPA390/oPA393 oligonucleotide pair, a ∼ 0.6 kb GCD11 promoter region was PCR amplified from the yeast genome. This PCR product was digested with the SacI-SalI RE and ligated into the YCplac111-EV (A308) plasmid at the SacI-SalI site to generate the YCplac111-GCD11prom (A325) intermediate plasmid construct. Using oPA390/oPAx01 oligonucleotide pair, a ∼0.65 kb GCD11 promoter and 3xHA tag region was PCR amplified from the yeast genome, digested with the SacI-SalI RE and ligated into the YCplac111-EV (A308) plasmid at the SacI-SalI site to generate the YCplac111-GCD11prom +3xHA (A326) intermediate plasmid construct. YCplac111-3xHA-GCD11 (A1) construct was generated by 2.1 kb PCR amplification of GCD11 ORF+ terminator region from the YCplac111-GCD11 (A343) plasmid using oligonucleotide pair oPA391/oPA1600 and digested PCR product was ligated into the YCplac111-GCD11prom+3xHA (A326) vector at the BamHI-SalI site. Using the same set of oligonucleotide pairs, a 2.1 kb PCR amplified product from the YCplac111-GCD11-N135D (A57) plasmid was digested and ligated into the YCplac111-GCD11prom +3xHA (A326) vector at the BamHI-SalI site to generate YCplac111-3xHA-GCD11-N135D (A2) plasmid. The V281K mutation was introduced into the GCD11 gene by PCR amplification of 2.1 kb product using oligonucleotide pairs oPA391/oPA1772, oPA1771/oPA1600, and YCplac111-His8-GCD11 (A343) as a template. The 2.1 kb PCR product was digested using BamHI-SalI RE and cloned into YCplac111_GCD11prom (A325) and YCplac111_GCD11prom+HA (A326) vectors to generate YCplac111_GCD11-V281K (A1421) and YCplac111_3xHA-GCD11-V281K (A1426) constructs, respectively.
The 8xHis-tagged GCD11 gene was PCR amplified from YCplac111-His8-GCD11 (A343) plasmid using oligonucleotide pairs oPA390/oPA1282 and digested with the SacI/NotI RE and cloned into the Leu2-HC backbone pRS425 (A591) vector to generate an intermediate vector. The SUI3 and SUI2 genes were PCR amplified using oligonucleotide pairs oPA1283/oPA1284 and oPA1285/oPA1286, respectively. The PCR products were digested with SpeI/SmaI and SmaI/XhoI RE and cloned into the above intermediate vector to generate pRS425_GCD11, SUI3, SUI2 (A1266) plasmid. The same set of primers was used to create mutant derivatives of SUI3 constructs (A1507: S264Y, A1413: S264Y/T238A, A1414: T238A).
The oligonucleotide pair oPA1440/oPA1441 was used to amplify 487 bp DNA Binding Domain (DBD) from the pEXP32-Krev1 (A644) vector. This fragment was cloned into the same vector at the HindIII/SacI site, resulting in the deletion of the Krev1 gene and the introduction of additional restriction sites for further cloning. The resultant plasmid was called pDEST32mod (A1236). The SUI3 ORF (WT or mutants) were PCR amplified using the oligonucleotide pair oPA1450/oPA1451 from either YCplac111_SUI3 (A1451) or pRS313_SUI3-S264Y (A479) plasmid templates and cloned at the SalI/SacI site, in-frame with the DBD-domain to generate pDEST32mod_SUI3 (A1237) and pDEST32mod_SUI3-S264Y (A1238) plasmids, respectively. The GCD11 ORF was PCR amplified using oligonucleotide pair oPA1448/oPA1449 and YCplac111_GCD11 (A343) as a template, digested with the SalI/SacI RE, and cloned in-frame with the Activation Domain (AD) to generate pDEST22_GCD11 (A1242) construct.
Screening for the eIF2βS264Y intragenic suppressor mutations
Yeast strain YP896 (his4Δ, sui3Δ) was swapped with the eIF2βS264Y mutant sui3-2/URA3 plasmid to prepare a strain for the suppressor screening. Separately, YCplac111_SUI3-S264Y (A1446) plasmid was transformed into a hyper-mutagenic XL1-Red Escherichia coli strain to generate mutagenic library (sui3-2*/LEU2). The mutagenic plasmid library and the empty vector control were transformed into the above yeast strain and plated on the SD plate supplemented with histidine and tryptophane. Yeast colonies growing faster than the empty vector control transformant were selected for further analysis. These colonies were subjected to the 5-FOA selection to evict the sui3-2/URA3 (A1084) plasmid, and the sui3-2*/LEU2 suppressor plasmid was isolated from the resultant mutation was confirmed by DNA sequencing.
LacZ reporter assay to quantitate Sui¯ and Gcd¯ phenotype
Yeast two-hybrid assay
A yeast two-hybrid protein interaction assay was performed using the YP930 reporter yeast strain. The wild-type eIF2γ protein was fused with the Activating domain (AD), and the eIF2βWT or eIF2βS264Y mutant protein was fused with the DNA-binding domain (DBD). Yeast cells YP930 were co-transformed with a control plasmid containing DBD and AD empty vector or with the AD-GCD11 construct along with the derivatives of DBD-SUI3 (WT or mutants) constructs. The colonies were grown on the SCD plate supplemented with histidine, uracil and adenine plate. The colonies were patched on the fresh SCD plate supplemented with histidine, uracil and adenine, replica plated or spotted on the SCD plate supplemented with uracil and adenine and SCD plate supplemented with uracil, adenine and 3AT and grown for 2-3 days.
Co-Immunoprecipitation assay
Yeast cells were grown in 35 ml of SD medium at 30°C to the mid-log phase, harvested by centrifugation at 3000 × g and resuspended in the lysis buffer (20 mM HEPES, pH 7.5, 100 mM KCl, 5 mM MgCl2, 5 mM NaF, 1 mM EDTA, containing one tablet of Roche cocktail protease inhibitor (#05892970001) and 2 μM of each protease inhibitors Aprotinin, Leupeptin, PMSF and Pepstatin). The WCE was prepared by mechanical lysis of cells using glass beads. Monoclonal anti-HA conjugated antibody agarose beads (10 μl) (Sigma, #A2095) were washed 3 times with 1× PBS and resuspended in 10 μl of binding buffer (lysis buffer plus 0.2% Nonidet P-40 and 1% BSA). The yeast WCE (300 μg) was mixed with these beads and incubated in a nutating mixer at 4°C for 1 h. The beads were washed 5 times with the washing buffer (20 mM HEPES pH 7.5, 100 mM KCl, 5 mM MgCl2, 5 mM NaF, 1 mM EDTA, 0.2% NP-40). The beads were suspended in 20 μl of the lysis buffer and split into two halves. One half was separated on 12% SDS-PAGE. The resolved proteins were transferred to the PVDF membrane and analysed by the Western blot using anti-eIF2β (BioBharati Life Science), anti-eIF2α (BioBharati Life Science), anti-eIF2γ (BioBharati Life Science), anti-eIF3c (BioBharati Life Science), anti-RPS20 (BioBharati Life Science), anti-actin (Santa Cruz #sc-47778) with mouse monoclonal anti-HA (Sigma, #H9658) antibodies and horseradish peroxidase (HRP) conjugated mouse secondary antibody (Sigma, #A9044). The blot was developed using a SuperSignal kit (Thermo Scientific #34075). The other half of the beads were treated with a Trizol reagent (Ambion #15596026) to extract RNA. The RNA from the aqueous phase was precipitated using two volumes of ice-cold ethanol, 20 µg GlycoBlue, and 1/10th volume of 3M sodium acetate pH 5.0 and incubating at −20°C for 2 h. The RNA pellet was recovered by centrifugation at 13,000xg for 30 min at 4°C and washed with ice-cold 70% ethanol. The RNA pellet was air dried and reconstituted in 8 μl of 2× RNA loading dye (95% formamide, 0.02% SDS, 0.1mM EDTA, 0.01% bromophenol blue, and 0.005% xylene cyanol) and resolved on the 8% Urea-PAGE. The RNA was transferred to the nylon membrane (Cytiva, #10416296) and analysed by the Northern blotting using a biotinylated probe specific against initiator Met-tRNAi (oPA1732) and elongator Met-tRNAe (oPA1868) and developed using Chemiluminescence kit (Thermo # 89880).
Quantification of blots
The Western and Northern blots were visualized using Vilber Lourmat Fusion Solo S chemiluminescence doc (EvolutionCapt Solo S 17.00 software). Densitometric analysis was performed using NIH ImageJ software. For the Co-IP experiment, different amount of proteins or the Met-tRNAi pull down with the HA-tagged eIF2γ subunit were quantified from the blot by normalizing with the anti-HA band. The quantification of the 43-48S ribosomal fractions was performed by normalizing with the ribosomal protein (RPS20). The significant differences between eIF2 WT and the mutant proteins were performed using one-way ANOVA analysis.
eIF2 purification
Yeast strain YP920 (GCD11Δ, SUI2Δ, SUI3Δ) carrying high copy of IMT4 and either high copy [pRS425_GCD11, SUI3, SUI2] (A1266), [pRS425_GCD11, SUI3-S264Y/T238A, SUI2] (A1413), [pRS425_GCD11, SUI3-T238A, SUI2] (A1414), or [pRS425_GCD11, SUI3-S264Y, SUI2] (A1507) plasmid were grown in the 6 L SCD+Met liquid culture to A600 ∼ 2. The cells were pelleted by centrifugation at 4000 × g and flash-frozen in the liquid nitrogen. The cells were lysed in using a mixer mill (MM-40) in liquid nitrogen and re-suspended in the lysis buffer [75mM Tris-Cl pH 7.6, 100 mM KCl, 1 mM EDTA, 1 mM EGTA, 100 µM GDP-Mg2+, 5 mM NaF, 10 mM β-mercaptoethnol, protease inhibitor cocktail (Roche# 05892791001), and 2 μM of each protease inhibitors Aprotinin, Leupeptin, PMSF and Pepstatin]. The cell lysate was clarified by centrifugation at 13,000xg for 30 min at 4°C and the supernatant was dialysed in the NCLB-20 buffer (20 mM Tris-Cl pH 7.6, 500 mM KCl, 20 mM imidazole, 0.1 mM MgCl2, 5 mM NaF, 10 mM β-mercaptoethnol, 10% glycerol and protease inhibitor cocktail). The dialysed sample was incubated with 5 ml Nickel-NTA beads (Qiagen #30230) for 30 min at 4°C and subsequently washed with the NCLB-20 buffer. The 8xHis-tag eIF2 protein or its mutant derivatives were eluted by NCEB-200 buffer (20 mM Tris-Cl pH 7.6, 500 mM KCl, 200 mM imidazole, 0.1 mM MgCl2, 10% Glycerol, 5 mM NaF, 10 mM, β- mercaptoethnol, protease inhibitor). The eluted proteins were further dialysed in HSDB buffer (20 mM Tris-Cl pH 7.6, 100 mM KCl, 0.1 mM MgCl2, 10% glycerol, 5 mM NaF, 1 mM DTT, protease inhibitor) and the protein was purified sequentially by Heparin and cation exchange column chromatography using 50–1000 mM KCl gradient as described previously [17]. The purified proteins were dialysed in a storage buffer (20 mM HEPES pH 7.5, 100 mM potassium acetate pH 7.5, 0.1 mM magnesium acetate, 10% glycerol, and 1 mM DTT) and flash frozen in the liquid nitrogen for further use.
Fluorescence anisotropy analysis
Where r is the measured anisotropy, and rF and rB are the anisotropies of the free and saturated bound proteins, respectively. The rF value is obtained by measuring the anisotropy of the free fluorophores as described earlier [49]. The values were fitted into a non-linear quadratic equation using Origin software. Where Vmax: maximum velocity, K: Michaelis’ constant, n: cooperative sites = 1
43-48S ribosome profile analysis
Yeast cells carrying WT or different derivatives of eIF2 mutants were grown in 250 ml SCD supplemented with uracil and histidine liquid culture till A600 ∼0.8. The liquid culture was snap-chilled on ice and mixed with ice-cold formaldehyde (1% final concentration) for 60 min. The formaldehyde crosslinking reaction was stopped by adding 0.1 M ice-cold glycine and incubating for 15 min on ice. Cells were harvested by centrifugation at 3000 × g for 5 min and washed twice with 1x lysis buffer (20 mM Tris-Cl pH 7.5, 50 mM KCl, 10 mM MgCl2, and 1 mM DTT). The cells were resuspended in 2 v/v of lysis buffer supplemented with a protease inhibitor cocktail, and cells were lysed mechanically with the glass beads. Cell debris was removed by centrifugation at 3000 × g for 5 min, and the supernatant was further clarified at 13,000 × g for 30 min at 4°C. A quantity of A260 ∼20 units from the WCE was layered on a 15%-40% sucrose density gradient and resolved by ultracentrifugation at 39,000 rpm (Beckman SW41) for 5 hrs at 4°C. Starting from the top to the bottom, 0.7 ml fractions were sequentially collected using the BioComp Inc fractionator. Fractions #7 and #8 containing 40-48S ribosomal subunits were taken for analysis. Each collected fraction was split into 0.25 and 0.45 ml. The 0.25 ml fraction was precipitated using two volumes of prechilled acetone on ice for 30 min. The pellet was obtained by spinning at 13,000 × g for 20 min at 4°C and washed with 70% prechilled ethanol. The pellet was dissolved in 25 µl of 2x SDS-Laemmli buffer, and part of it was resolved on 12% SDS-PAGE for Western blot analysis. For RNA extraction, the rest of the fractions (0.45 ml) were mixed with 900 μl of prechilled pure ethanol and 90 μl of 3M sodium acetate pH 5.0. The RNA was precipitated overnight at −20°C and pelleted down by centrifugation at 13000-× g for 30 min at 4°C. The pellet was resuspended in 300 μl of SDS-RNA lysis buffer (20 mM Tris-HCl pH 7.4, 100 mM NaCl, 1% SDS, and 2.5 mM EDTA) and RNA extraction was done twice with hot phenol (70°C) for 15 min in a thermomixer (1000 rpm) to reverse-crosslink the RNA. The aqueous phase containing RNA was precipitated by mixing with 500 μl ice-cold ethanol and 50 μl 3 M sodium acetate, pH 5.0. and incubating at −20°C for 2 h. The RNA was pelleted by centrifugation at 13,000 × g for 30 min at 4°C, and the pellet was washed with 70% ethanol. The air-dried pellet was reconstituted in 25 μl 2× RNA loading dye and part of it was resolved using 10% Urea-PAGE for Northern blot analysis as described above.
Data Availability
All relevant data are included within the main article and its Supplementary File.
Competing Interests
The authors declare that there are no competing interests associated with the manuscript.
Funding
This work was supported by the Department of Biotechnology [grant number BT/PR44585/BRB/10/2002/2021] and an intramural support from the Department of Atomic Energy, Government of India (to P.V.A.)
CRediT Author Contribution
Aranyadip Gayen: Formal analysis, Validation, Investigation, Writing—original draft. Pankaj V. Alone: Conceptualization, Formal analysis, Supervision, Funding acquisition, Writing—original draft, Writing—review & editing.
Acknowledgements
The authors thank Thomas E. Dever, NIH for providing plasmids and yeast strains.