Abstract

We performed long non-coding RNA (lncRNA) microarray assay to identify lncRNAs with differential expression between patients with intracranial aneurysm (IA) and healthy control individuals to evaluate their potential use as biomarkers of IA. Arraystar Human lncRNA Microarray v3.0 was performed to identify differentially expressed lncRNAs and mRNAs in plasma samples (4 ml). lncRNAs with the most pronounced differential expression were used to select gene markers, and results were validated by quantitative reverse-transcription polymerase chain reaction (qRT-PCR). Plasma levels of TCONS_00000200 (fold change: 2.28) and ENST00000511927 (fold change: 2.50) were significantly higher in IA patients than in healthy individuals (P<0.001), and plasma levels of ENST00000421997 (fold change: 0.45) and ENST00000538202 (fold change: 0.43) were significantly lower in IA patients than in healthy individuals (P<0.001). qRT-PCR confirmed the same trends of up- and down-regulation of these four lncRNAs. A receiver operating characteristic (ROC) curve for TCONS_00000200 showed that the area under the curve (AUC) was 0.963 (95% confidence interval, 0.919–1.000), optimal cut-off point was 0.0081, sensitivity was 90.0%, and specificity was 96.7%. These results indicate that the lncRNA TCONS_00000200 is differentially expressed in the plasma of IA patients and could serve as a biomarker of IA.

Introduction

Intracranial aneurysm (IA) is a tumour-like structural abnormality formed after pathological dilation and expansion of the cerebral vessel wall. IA rupture can directly result in subarachnoid or cerebral haemorrhage, which has high disability and mortality rates. Therefore, IA is a life-threatening condition, and early detection is critical for successful treatment. However, IA may be asymptomatic before rupture and haemorrhage. In rare cases, IA is detected on brain computed tomography angiography (CTA) or magnetic resonance angiography (MRA) during routine check-up, allowing intervention or surgery to effectively prevent cerebral haemorrhage.

IA is associated with congenital dysplasia and heredity factors. Therefore, genetic screening of IA-related genes using a small venous blood sample could indicate the need for further brain CTA, MRA, or digital subtraction angiography. The search for causative genes is now possible due to advances in high-throughput genomic technology. In particular, long non-coding RNAs (lncRNAs), which are >200 nucleotides in length, play important roles in regulating gene expression at transcriptional and post-transcriptional levels. As novel biomarkers with potential clinical applications, lncRNAs have the following advantages: (1) they are expressed in peripheral blood [1]; (2) their abnormal expression is an indicator of several medical conditions and disease states; (3) their expression has tissue, spatiotemporal, and disease specificity indicative of certain disease stages or types [2]; and (4) they are being explored as targets of drug therapy for neurological tumours [3]. Thus, lncRNAs are attracting much attention from researchers and hold great promise for clinical applications.

Methods

The present study was approved by the Ethics Committee of the Second Affiliated Clinical College of Fujian University of Traditional Chinese Medicine and was carried out in accordance with the Declaration of Helsinki and other relevant guidelines and regulations.

Subjects

Patients admitted to the Second People’s Hospital of Fujian University of Traditional Chinese Medicine or Fujian Provincial Hospital between February 2014 and June 2016 for subarachnoid haemorrhage underwent brain digital subtraction angiography. Five patients were found to have IA after a first screening (Table 1), and an additional 30 patients were found to have IA after a second screening (Table 2). All patients met the diagnostic criteria of IA [4] and provided informed consent.

Table 1
Clinical characteristics of the individuals included in the study (first screening)
Items IA (n=5) Control (n=4) 
Gender (female, %) 3 (60.00%) 2 (50.00%) 
Age (years, mean ± SD) 52.40 ± 8.59 51.72 ± 7.28 
Hypertension, % 4 (80.00%) 75.00%) 
Smokers, % 2 (40.00%) 2 (50.00%) 
Drinkers, % 2 (40.00%) 1 (25.00%) 
Drugs, % 
History of other aneurysms, % 
Items IA (n=5) Control (n=4) 
Gender (female, %) 3 (60.00%) 2 (50.00%) 
Age (years, mean ± SD) 52.40 ± 8.59 51.72 ± 7.28 
Hypertension, % 4 (80.00%) 75.00%) 
Smokers, % 2 (40.00%) 2 (50.00%) 
Drinkers, % 2 (40.00%) 1 (25.00%) 
Drugs, % 
History of other aneurysms, % 

No significant between-group differences were observed in the general information (P>0.05).

Table 2
Clinical characteristics of the individuals included in the study (second screening)
Items IA (n=30) Control (n=20) 
Gender (female,%) 19 (63.33%) 13 (65.00%) 
Age (years, mean ± SD) 53.60 ± 12.72 53.60 ± 12.71 
Hypertension, % 17 (56.66%) 11 (55.00%) 
Smokers, % 6 (20.00%) 4 (20.00%) 
Drinkers, % 5 (16.66%) 3 (15.00%) 
Drugs, % 
History of other aneurysms, % 
Items IA (n=30) Control (n=20) 
Gender (female,%) 19 (63.33%) 13 (65.00%) 
Age (years, mean ± SD) 53.60 ± 12.72 53.60 ± 12.71 
Hypertension, % 17 (56.66%) 11 (55.00%) 
Smokers, % 6 (20.00%) 4 (20.00%) 
Drinkers, % 5 (16.66%) 3 (15.00%) 
Drugs, % 
History of other aneurysms, % 

No significant between-group differences were observed in the general information (P>0.05).

Healthy individuals who visited the Second People’s Hospital of Fujian University of Traditional Chinese Medicine between February 2014 and June 2016 were recruited as a control group. Individuals with no signs of stroke or cerebrovascular abnormalities per brain CT or CTA and who had comparable age and sex as the IA patients were enrolled. Four healthy individuals were selected after a first screening (Table 1), and an additional 20 healthy individuals were selected after a second screening (Table 2).

Arraystar lncRNA array protocol

The study was conducted according to the procedures shown in Figure 1.

Schematic workflow of the study

Figure 1
Schematic workflow of the study

We performed Arraystar LncRNA profiling and analysis and further validated candidate lncRNAs using samples from additional patients. CNC network, GO, and KEGG pathway analyses were also performed.

Figure 1
Schematic workflow of the study

We performed Arraystar LncRNA profiling and analysis and further validated candidate lncRNAs using samples from additional patients. CNC network, GO, and KEGG pathway analyses were also performed.

Sample collection

A peripheral venous blood sample (4 ml) was collected from each subject and placed in a 5-ml EDTA-2K vacuum tube, which was centrifuged at 1000×g for 10 min at room temperature to separate the plasma and cellular components. After separation, 500 µl plasma was added to the RNA preservation solution (Bioteke) and stored at -80°C for later testing.

Total RNA extraction and RNA quality testing

Total RNA was extracted using TRIzol (Life Technologies; cat. no. 10296-028) according to the manufacturer’s protocol and as previously described [5]. Briefly, a 250-μl plasma sample was acquired by centrifuging at 12000×g for 10 min at 4°C. Next, 750 μl TRIzol LS reagent was added to the sample, and the 1.5-ml tube was shaken and incubated for 5 min at 15–30°C to ensure that nucleic acid protein complexes were completely dissociated. After the addition of 0.2 ml chloroform, the sample was shaken for 15 s and incubated for 2–3 min at room temperature. The mixture was further centrifuged at 12000×g for 15 min at 4°C. The aqueous phase of the sample was extracted (∼60%) and transferred to a new tube. Next, 500 μl of 100% isopropanol was added to the aqueous phase, which was incubated for 10 min at 15–30°C and centrifuged at 12000×g for 10 min at 4°C. The supernatant was removed, and the RNA pellet was washed with 1 ml of 75% ethanol, briefly vortexed, and centrifuged at 7500×g for 5 min at 4°C. The RNA pellet was then dried for 5–10 min at room temperature. Finally, the RNA pellet was resuspended in RNase-free water and incubated in a water bath at 55–60°C for 10 min. The sample was stored in a −70°C refrigerator. Total RNA purity and integrity were determined using a NanoDrop ND-1000 spectrophotometer (NanoDrop Products, Wilmington, DE).

RNA labeling and microarray hybridisation

Complementary DNA was labelled with an Arraystar RNA Flash Labeling Kit, purified with an RNeasy Mini Kit (Qiagen), and hybridised with an Arraystar Human LncRNA Microarray V3.0 (8×6 k, Arraystar Inc., Rockville, MD, U.S.A.) under standard conditions. The lncRNA microarray could detect 30586 lncRNAs and 26109 protein-encoding transcripts. lncRNAs were selected from recognised public transcriptome databases, including Refseq, UCSC Known Gene, and Gencode.

Data collection and normalisation

An Agilent scanner was used to perform the microarray scan. The quantile algorithm of Gene Spring v13.0 (Agilent Technologies, CA, U.S.A.) was used to normalise the raw data. Differentially expressed lncRNAs were selected and analysed. Microarray data are available in the Gene Expression Omnibus (GEO) database (GSE75436; http://www.ncbi.nlm.nih.gov/geo). R software v3.2.3 was used for array analysis. Differentially expressed lncRNAs were selected for analysis of gene markers with abnormal (i.e. differential) expression.

Coding-non-coding analysis

Coding gene data were normalised, and data for different transcripts of the same gene were used to calculate the median value as representative of gene expression. Normalised data for the selected lncRNAs and all genes were used to calculate correlation coefficients; records with a |Pearson correlation coefficient| value ≥ 0.9 and P-value ≤ 0.05 were selected. Selected records were used to graph the Coding-non-coding (CNC) network using Cytoscape v2.8.3.

Quantitative reverse-transcription polymerase chain reaction

Quantitative reverse-transcription polymerase chain reaction (qRT-PCR) was performed to verify gene markers with abnormal (i.e., differential) expression according to instructions provided with the TRIzol LS reagent (Invitrogen Life Technologies, U.S.A.) using the 30 IA patients and 20 healthy individuals from the second screening. Primer sequences of lncRNAs and β-actin are shown in Table 3.

Statistical analysis

SPSS v20.0 (SPSS Inc., Chicago, IL, U.S.A.) was used for statistical analysis. Independent samples t tests and Fisher’s exact tests were performed, with significant P-values defined as <0.05. Agilent Feature Extraction v11.0.1.1 was used to capture the microarray map, read the values, and obtain the raw data, which were processed with GeneSpring GX v12.1 (Agilent Technologies) for quantile normalisation and data processing to select high-quality probes for analysis. Differentially expressed lncRNAs were filtered based on t test P-values (|fold change| ≥ 2.0, P-value <0.05). Receiver operating characteristic (ROC) curves were used to analyse the predictive performance of differentially expressed lncRNAs and the optimal cut-off points for IA patients. The Youden index (J = sensitivity + specificity − 1) was also used to assess the predictive performance of the lncRNAs. CNC, Gene Ontology (GO), and Kyoto Encyclopaedia of Genes and Genomes (KEGG) pathway analyses were also performed.

Results

Differentially expressed lncRNAs in plasma samples

Microarray assay was used to measure the plasma levels of lncRNAs in IA patients and healthy individuals and select differentially expressed lncRNAs (criteria: P<0.05, |fold change| ≥ 2.0) (Figure 2), which included 519 up-regulated and 278 down-regulated lncRNAs. Differentially expressed lncRNAs were further analysed to investigate the ten lncRNAs with the largest differential expression (considering multiple factors including fold change and P-value) (Table 3).

Volcano maps for IA patients and healthy control individuals

Figure 2
Volcano maps for IA patients and healthy control individuals

x-axis: log2 (fold change); y-axis: −log10 (P-value); red area: lncRNAs with |fold change| ≥ 2 and P<0.05.

Figure 2
Volcano maps for IA patients and healthy control individuals

x-axis: log2 (fold change); y-axis: −log10 (P-value); red area: lncRNAs with |fold change| ≥ 2 and P<0.05.

Table 3
lncRNAs with the most pronounced differential expression in IA patients
P-value FDR Fold change Regulation Type Seqname Gene symbol Source 
0.000477976 0.075081743 48.5505021 up Noncoding TCONS_00013319 XLOC_005968 LincRNAs identified by Cabili et al. 
7.68221E-05 0.0369362 45.8398828 up Noncoding ENST00000511927 RP11-504G3.1 GENCODE 
2.64818E-06 0.006340623 40.2860164 up Noncoding TCONS_00000200 XLOC_000199 LincRNAs identified by Cabili et al. 
5.70695E-05 0.0369362 33.8583896 up Noncoding TCONS_00010726 XLOC_004448 LincRNAs identified by Cabili et al. 
0.00021227 0.060381322 30.4468496 up Noncoding TCONS_00018266 XLOC_008547 LincRNAs identified by Cabili et al. 
0.000270567 0.064243696 43.4186222 down Noncoding ENST00000538202 RP11-429A20.4 GENCODE 
0.000441893 0.075081743 33.8474532 down Noncoding ENST00000421997 RP11-86H7.1 GENCODE 
0.000498757 0.075081743 13.7918859 down Noncoding ENST00000563397 RP11-525K10.1 GENCODE 
0.002841449 0.156844354 21.9588842 down Noncoding TCONS_00004595 XLOC_002498 LincRNAs identified by Cabili et al. 
0.002144808 0.13167657 11.3773563 down Noncoding ENST00000424968 LINC00240 GENCODE 
P-value FDR Fold change Regulation Type Seqname Gene symbol Source 
0.000477976 0.075081743 48.5505021 up Noncoding TCONS_00013319 XLOC_005968 LincRNAs identified by Cabili et al. 
7.68221E-05 0.0369362 45.8398828 up Noncoding ENST00000511927 RP11-504G3.1 GENCODE 
2.64818E-06 0.006340623 40.2860164 up Noncoding TCONS_00000200 XLOC_000199 LincRNAs identified by Cabili et al. 
5.70695E-05 0.0369362 33.8583896 up Noncoding TCONS_00010726 XLOC_004448 LincRNAs identified by Cabili et al. 
0.00021227 0.060381322 30.4468496 up Noncoding TCONS_00018266 XLOC_008547 LincRNAs identified by Cabili et al. 
0.000270567 0.064243696 43.4186222 down Noncoding ENST00000538202 RP11-429A20.4 GENCODE 
0.000441893 0.075081743 33.8474532 down Noncoding ENST00000421997 RP11-86H7.1 GENCODE 
0.000498757 0.075081743 13.7918859 down Noncoding ENST00000563397 RP11-525K10.1 GENCODE 
0.002841449 0.156844354 21.9588842 down Noncoding TCONS_00004595 XLOC_002498 LincRNAs identified by Cabili et al. 
0.002144808 0.13167657 11.3773563 down Noncoding ENST00000424968 LINC00240 GENCODE 
Table 4
Primer sequences of lncRNAs and β-actin
Gene Primer Sequences (5′→3′) 
β-actin F: 5′ GTGGCCGAGGACTTTGATTG 3′ 
 R: 5′ CCTGTAACAACGCATCTCATATT 3′ 
ENST00000511927 F: 5′ GGTGCAAGCAGTCTTCCCATCT 3′ 
 R: 5′ TGTGCCTGAGGATCAGCTACCC 3′ 
ENST00000421997 F: 5′ TGACGCTGAGTGAAAGAATGC 3′ 
 R: 5′ GAGCACGGATGACCTTGAAG 3′ 
TCONS_00000200 F: 5′ GGTCACATTCACCCTCCTGC 3′ 
 R: 5′ TCACCTCGTTTGCTTCCTGTT 3′ 
ENST00000538202 F: 5′ AGGTAGAATTACCATATCCCACTC 3′ 
 R: 5′ GCTGCCTGCTACATATTTGACT 3′ 
Gene Primer Sequences (5′→3′) 
β-actin F: 5′ GTGGCCGAGGACTTTGATTG 3′ 
 R: 5′ CCTGTAACAACGCATCTCATATT 3′ 
ENST00000511927 F: 5′ GGTGCAAGCAGTCTTCCCATCT 3′ 
 R: 5′ TGTGCCTGAGGATCAGCTACCC 3′ 
ENST00000421997 F: 5′ TGACGCTGAGTGAAAGAATGC 3′ 
 R: 5′ GAGCACGGATGACCTTGAAG 3′ 
TCONS_00000200 F: 5′ GGTCACATTCACCCTCCTGC 3′ 
 R: 5′ TCACCTCGTTTGCTTCCTGTT 3′ 
ENST00000538202 F: 5′ AGGTAGAATTACCATATCCCACTC 3′ 
 R: 5′ GCTGCCTGCTACATATTTGACT 3′ 

qRT-PCR validation of lncRNAs

We initially selected the top ten lncRNAs for validation from a small number of subjects in the first screening. As no significant differences in the expression of six lncRNAs (including TCONS_00013319) were detected among the larger number of subjects in second screening, these lncRNAs were not further validated. The four lncRNAs that underwent further validation showed consistent up- or down-regulation among subjects in the second screening. Therefore, qRT-PCR was performed to validate the four lncRNAs with the most pronounced differential expression: TCONS_00000200 (up), ENST00000511927 (up), ENST00000538202 (down), and ENST00000421997 (down) (Figure 3). Plasma levels of TCONS_00000200 and ENST00000511927 were significantly higher in IA patients than in healthy individuals (P<0.01), whereas plasma levels of ENST00000421997 and ENST00000538202 were significantly lower in IA patients than in healthy individuals (P<0.01). Thus, qRT-PCR showed consistent up- and down-regulation trends for these four lncRNAs as in the microarray assay. One additional lncRNA, ENST00000494340, which showed evidence of up-regulation in IA patients in the first screening was further tested among a larger number of subjects in the second screening, but no significant between-group differences were observed (P>0.05; Table 5 and Figure 3).

Differences in plasma lncRNA expression between IA patients and healthy control individuals

Figure 3
Differences in plasma lncRNA expression between IA patients and healthy control individuals

y-axis represents the relative expression of corresponding lncRNAs (min-max). ****Significant differences.

Figure 3
Differences in plasma lncRNA expression between IA patients and healthy control individuals

y-axis represents the relative expression of corresponding lncRNAs (min-max). ****Significant differences.

Table 5
qRT-PCR results for lncRNAs
LncRNA qRT-PCR 
 IA group a Control group b IA group/control group P-value Up/down-regulation 
TCONS_00000200 1.19 × 10-2 5.21 × 10-3 2.28 <0.001 Up 
ENST00000511927 8.06 × 10-3 3.23 × 10-3 2.50 <0.001 Up 
ENST00000421997 7.19 × 10-3 1.59 × 10-2 0.45 <0.001 Down 
ENST00000538202 2.17 × 10-2 4.99 × 10-2 0.43 <0.001 Down 
ENST00000494340 7.35 × 10-3 8.54 × 10-3 0.86 0.390 Up 
LncRNA qRT-PCR 
 IA group a Control group b IA group/control group P-value Up/down-regulation 
TCONS_00000200 1.19 × 10-2 5.21 × 10-3 2.28 <0.001 Up 
ENST00000511927 8.06 × 10-3 3.23 × 10-3 2.50 <0.001 Up 
ENST00000421997 7.19 × 10-3 1.59 × 10-2 0.45 <0.001 Down 
ENST00000538202 2.17 × 10-2 4.99 × 10-2 0.43 <0.001 Down 
ENST00000494340 7.35 × 10-3 8.54 × 10-3 0.86 0.390 Up 

‘IA group/control group’ indicates the relative fold change of an lncRNA in IA patients compared with healthy individuals.

a represents relative mean expression per qRT-PCR in the IA group with hemorrhage and stroke; b represents relative mean expression per qRT-PCR in the control group. IA group/control group means the relative fold change of an lncRNA in the IA group as compared with the control group.

ROC curves

ROC curves were constructed based on all subjects. TCONS_00000200 and ENST00000511927, the two lncRNAs with the most pronounced differential expression (i.e., up-regulated in IA patients; P<0.01) were analysed to investigate their potential use as biomarkers of IA. The ROC curve of the plasma level of TCONS_00000200 showed that the area under the curve (AUC) was 0.963 (95% confidence interval (CI), 0.919–1.000), optimal cut-off point was 0.0081, sensitivity was 90.0%, and specificity was 96.7% (J = 0.867). The ROC curve of the plasma level of ENST00000511927 showed that the AUC was 0.804 (95% CI, 0.696–0.920), optimal cut-off point was 0.04615, sensitivity was 66.7%, and specificity was 86.7% (J = 0.534). The sensitivity and specificity of TCONS_00000200 were higher than those of ENST00000511927 (Figure 4), suggesting that the plasma level of TCONS_00000200 might better serve as a biomarker of IA.

ROC curves of TCONS_00000200 and ENST 00000511927

Figure 4
ROC curves of TCONS_00000200 and ENST 00000511927

 

Figure 4
ROC curves of TCONS_00000200 and ENST 00000511927

 

CNC analysis

The four lncRNAs with significant differential expression (ENST00000538202, ENST00000511927, ENST00000421997, and TCONS_00000200) and differentially expressed mRNAs identified by microarray assay were included in CNC analysis. All mRNAs with differential expression between IA patients and healthy individuals were selected (Figure 5). Correlation coefficients between the relevant gene and lncRNA are shown in Table 6 and Supplementary Table S1.

CNC network

Figure 5
CNC network

Red nodes represent lncRNAs, blue nodes represent coding genes, solid lines represent positive correlations, and dotted lines represent negative correlations. Node size is proportional to node degree.

Figure 5
CNC network

Red nodes represent lncRNAs, blue nodes represent coding genes, solid lines represent positive correlations, and dotted lines represent negative correlations. Node size is proportional to node degree.

Table 6
CNC analysis correlation coefficients between the relevant gene and lncRNA
Gene LncRNA Correlation coefficient Correlation 
CD276 ENST00000511927 0.79447961 
SPN ENST00000511927 0.813826832 
HAVCR2 ENST00000511927 0.794300016 
HECW1 TCONS_00000200 0.790902277 
OLAH TCONS_00000200 0.929005697 
Gene LncRNA Correlation coefficient Correlation 
CD276 ENST00000511927 0.79447961 
SPN ENST00000511927 0.813826832 
HAVCR2 ENST00000511927 0.794300016 
HECW1 TCONS_00000200 0.790902277 
OLAH TCONS_00000200 0.929005697 

GO and KEGG pathway analyses

Differentially expressed mRNAs from CNC analysis were used for GO and KEGG pathway analyses. GO analysis showed that the differentially expressed mRNAs were mainly involved in the following molecular functions: ATPase-modulating activity, organophosphate hydrolase activity, protein tyrosine/serine/threonine phosphatase activity, and fibroblast growth factor receptor binding. Cellular components mainly included the Golgi, cytoplasm, sarcomeres, transverse tubules, myofibrils, and myosin. Biological processes mainly included negative regulation of muscle tissue development, negative regulation of striated muscle tissue development, skeletal muscle development, organ development, skeletal muscle contraction, ATP hydrolysis-coupled membrane transport, lymphocyte-mediated negative immune regulation, and T-cell activation and negative regulation. The top five GO entries based on enrichment score are listed in Supplementary Table S2, and the top ten GO entries based on enrichment score related to biological processes are listed in Supplementary Table S3. Fifteen GO entries were related to immune inflammatory responses in biological processes (Supplementary Table S4). KEGG pathway analysis identified five metabolic pathways associated with the differentially expressed genes (Supplementary Table S5 and Figure 6).

KEGG pathway analysis of related metabolic pathways

Figure 6
KEGG pathway analysis of related metabolic pathways

Note that CD276 is also known as B7-H3. Up-regulated gene markers (orange) are involved in pathways such as T-cell receptor signalling and leucocyte transendothelial migration.

Figure 6
KEGG pathway analysis of related metabolic pathways

Note that CD276 is also known as B7-H3. Up-regulated gene markers (orange) are involved in pathways such as T-cell receptor signalling and leucocyte transendothelial migration.

Discussion

Okazaki et al. [6] first identified lncRNA while performing large-scale sequencing of the mouse full-length complementary DNA library. With advances in microarray assay and sequencing technology [7], lncRNAs are now attracting a great deal of attention from researchers. In particular, the ‘central dogma’ of molecular biology is now being questioned by the research community. That is, in the past, researchers believed that RNA acted as the intermediary for the transfer of genetic information between DNA and proteins. However, findings from the Human Genome Project revealed that only 1.5% of the 3 billion base pairs in the human genome encode proteins, with the remaining 98.5% being non-protein coding sequences were once considered unwanted ‘junk sequences’ that accumulated during genetic evolution [8]. However, further research showed that these ‘junk sequences’ have important biological functions in normal cells [7]. In 2012, the Encyclopaedia of DNA Elements (ENCODE) study showed that most non-protein coding sequences are lncRNAs located in the nucleus or cytoplasm that exhibit tissue- or spatiotemporal-specific expression [2] but do not or rarely encode protein [9]. These lncRNAs regulate gene expression at the epigenetic, transcription, and post-transcription levels [10,11] and are closely related to human growth and development as well as disease onset and progression. Also, lncRNAs could target mRNA and thereby regulate different degrees of RNA transcription.

lncRNAs play important roles in the development of cardiovascular diseases by regulating endothelial cell and smooth muscle cell (SMC) functions, SMC proliferation, and atherosclerosis [12,13]. lncRNAs expressed in endothelial cells, such as Tie-1-AS and metastasis-associated lung adenocarcinoma transcript 1, regulate vascular development [14,15]. Bell et al. [16] identified an lncRNA, named smooth muscle and endothelial cell-enriched migration/differentiation-associated lncRNA (SENCR), which controls the contractile phenotype of SMCs and is associated with their migration and differentiation. lncRNA-p21 is involved in the regulation of SMC proliferation and atherosclerotic changes [17]. ANRIL has been identified as a genetic susceptibility locus associated with IA and abdominal aortic aneurysm [18–20]. HIF1a-AS1 is overexpressed in the thoracoabdominal aortic aneurysm and plays a key role in the proliferation and apoptosis of vascular SMCs in vitro [21]. The inflammatory response affects mesolamellar vascular SMCs, resulting in energy metabolism disorder, degeneration, apoptosis, and subsequent elastic fibre degeneration and destruction, breakage, and disappearance [22]. Although inflammatory cells do not normally infiltrate the arterial wall, many macrophages and lymphocytes expressing interleukin-6 and tumour necrosis factor-α are found in IA tissue [23] and may contribute to IA formation [24–26]. The arterial wall becomes thinner as it becomes brittle and starts to bulge locally due to elevated intravascular pressure, forming an IA [27]. Li et al. [28] showed that the lncRNA H19 is involved in the development of abdominal aortic aneurysm and that its inhibition could be used to treat aortic aneurysms. These results indicate that lncRNAs are involved in the development of cardiovascular diseases involving endothelial cells, SMCs, and inflammatory responses, including IA.

We found that four differentially expressed lncRNAs and mRNAs in IA patients were associated with sarcomeres, transverse tubules, myofibrils, myosin, ATPase-modulating activity, and regulation of muscle tissue development, suggesting that IA involves the regulation of SMC function. Moreover, GO entries suggested the negative regulation of lymphocyte-mediated immunity and T-cell activation in IA, suggesting its relation to inflammatory responses. Overall CNC, GO, and KEGG pathway analyses showed that IA is associated with complex interactions among many molecular mechanisms, including the involvement of immune-related biological processes and expression of SPN, CD276, and HAVCR2 genes. Although we did not further test the function of these genes and the underlying mechanisms of immune responses in IA, a previous study shows that the pathogenesis of IA may be mediated by proinflammatory cytokines [29]. Further research is needed to investigate the relationship between these genes and the aetiology of IA.

Previous studies show that chromosome 9p21 is a susceptibility site for abdominal aortic aneurysm and IA [30]. In particular, Olsson et al. [31] performed Hapmap tagging and genetic analysis of six single nucleotide polymorphism sites in the 44000 base pair region of 9p21 and found that 9p21 is a susceptibility site for IA and is related to IA rupture. We performed genetic analysis of ten family members from the same lineage of familial IA and identified a novel gene, PKD1, on chromosome 16 (data not shown). In the present study, lncRNA microarray analysis identified 519 up-regulated and 278 down-regulated lncRNAs with differential expression related to IA (P<0.05, |fold change| ≥ 2.0). Five lncRNAs with the most pronounced differential expression were selected for qRT-PCR verification: ENST00000494340, TCONS_00000200, ENST00000511927, ENST00000538202, and ENST00000421997. We found that plasma TCONS_00000200 expression was higher in IA patients than in healthy individuals (P<0.01) and an ROC curve showed that its AUC was 0.963 (95% CI, 0.919–1.000), sensitivity was 90.0%, and specificity was 96.7%, indicating that this lncRNA could serve as a biomarker of IA. We confirmed these results through qRT-PCR of venous blood samples from ten family members from the same lineage of familial IA (data not shown). Nevertheless, future studies including larger cohorts of patients and healthy control individuals are needed to determine the usefulness of this lncRNA in IA diagnosis and prognosis prediction. As stated in an article recently published in Science, ‘understanding the genetic differences that make us human is a long-standing endeavour that requires the comprehensive discovery and comparison of all forms of genetic variation within great ape lineages’ [32].

Conclusion

The plasma level of the lncRNA TCONS_00000200 could serve as a biomarker of IA due to its high sensitivity and specificity.

Author Contribution

Conceived and designed the experiments: Chenghan Wu and Xiaohua Yan. Performed the experiments: Chenghan Wu, Xiaohua Yan, Hailong Song, Yinzhou Wang, Lili Gao, Yali Cai, Qiong Cheng, Yanru Chen, Zheng Zheng, Yuansheng Liao, Jushan Lin, Buni Xie, Weiwu Cai, Shiju Li and Lianming Liao. Analyzed the data: Chenghan Wu, Hailong Song, Xiaohua Yan, Yinzhou Wang, Lili Gao, Yali Cai, Qiong Cheng, Yanru Chen, Zheng Zheng, Yuansheng Liao, Jushan Lin, Buni Xie, Weiwu Cai and Lianming Liao. Contributed reagents/materials/analysis tools: Chenghan Wu, Xiaohua Yan, Hailong Song, Yinzhou Wang, Lili Gao, Yali Cai, Qiong Cheng, Yanru Chen, Zheng Zheng, Yuansheng Liao, Jushan Lin, Buni Xie, Weiwu Cai, Shiju Li, Lianming Liao. Wrote the paper: Chenghan Wu, Hailong Song, Xiaohua Yan. All authors reviewed and approved the final version of the manuscript.

Competing Interests

The authors declare that there are no competing interests associated with the manuscript.

Funding

This work was supported by the National Natural Science Foundation of China [grant numbers 81403255, 81503431]; the Natural Science Foundation of Fujian Province [grant numbers 2011J01196, 2016J01558, 2016J01563, 2016j01567, 2017J01308]; the Fujian Innovation Fund [grant number 2018-cx-45]; the Fujian Provincial Health and Family Planning Commission Scientific Research Fund [grant numbers zlcxn03, 2015-1-85, 2016-1-80]; and the Fujian Provincial Bureau of Foreign Experts Financing [grant number 20153500016].

Abbreviations

     
  • ANRIL

    Antisense noncoding RNA in the INK4 locus

  •  
  • AUC

    area under the curve

  •  
  • CI

    confidence interval

  •  
  • CNC

    coding-non-coding

  •  
  • CTA

    computed tomography angiography

  •  
  • GO

    Gene Ontology

  •  
  • HIF1a

    Hypoxia-inducible factor 1-alpha

  •  
  • IA

    intracranial aneurysm

  •  
  • KEGG

    Kyoto Encyclopaedia of Genes and Genomes

  •  
  • lncRNA

    long non-coding RNA

  •  
  • MRA

    magnetic resonance angiography

  •  
  • qRT-PCR

    quantitative reverse-transcription polymerase chain reaction

  •  
  • ROC

    receiver operating characteristic

  •  
  • SMC

    smooth muscle cell

  •  
  • Tie-1-AS

    Tyrosine kinase containing immunoglobulin and epidermal growth factor homology domain 1-antisense

References

References
1.
Skroblin
P.
and
Mayr
M.
(
2014
)
“Going long”: long non-coding RNAs as biomarkers
.
Circ. Res.
115
,
607
609
[PubMed]
2.
Ponting
C.P.
,
Oliver
P.L.
and
Reik
W.
(
2009
)
Evolution and functions of long noncoding RNAs
.
Cell
136
,
629
641
[PubMed]
3.
Liu
Y.
,
Xu
N.
,
Liu
B.
et al.
(
2016
)
Long noncoding RNA RP11-838N2.4 enhances the cytotoxic effects of temozolomide by inhibiting the functions of miR-10a in glioblastoma cell lines
.
Oncotarget
7
,
43835
43851
[PubMed]
4.
Thompson
B.G.
,
Brown
R.D.
Jr
,
Amin-Hanjani
S.
et al.
(
2015
)
Guidelines for the management of patients with unruptured intracranial aneurysms: a guideline for healthcare professionals from the American Heart Association/American Stroke Association
.
Stroke
46
,
2368
2400
[PubMed]
5.
Song
H.
,
Lu
Y.
,
Qu
Z.
,
Mossine
V.V.
et al.
(
2016
)
Effects of aged garlic extract and FruArg on gene expression and signaling pathways in lipopolysaccharide-activated microglial cells
.
Sci. Rep.
6
,
35323
[PubMed]
6.
Okazaki
Y.
,
Furuno
M.
,
Kasukawa
T.
et al.
(
2002
)
Analysis of the mouse transcriptome based on functional annotation of 60,770 full-length cDNAs
.
Nature
420
,
563
573
[PubMed]
7.
Cabili
M.N.
,
Trapnell
C.
,
Goff
L.
et al.
(
2011
)
Integrative annotation of human large intergenic noncoding RNAs reveals global properties and specific subclasses
.
Genes Dev.
25
,
1915
1927
[PubMed]
8.
Balakirev
E.S.
and
Ayala
F.J.
(
2003
)
Pseudogenes: are they “junk” or functional DNA?
Annu. Rev. Genet.
37
,
123
151
[PubMed]
9.
Spizzo
R.
,
Almeida
M.I.
,
Colombatti
A.
and
Calin
G.A.
(
2012
)
Long non-coding RNAs and cancer: a new frontier of translational research?
Oncogene
31
,
4577
4587
[PubMed]
10.
Mattick
J.S.
(
2003
)
Challenging the dogma: the hidden layer of non-protein-coding RNAs in complex organisms
.
Bioessays
25
,
930
939
[PubMed]
11.
Aryal
B.
,
Rotllan
N.
and
Fernández-Hernando
C.
(
2014
)
Noncoding RNAs and atherosclerosis
.
Curr. Atheroscler. Rep.
16
,
407
[PubMed]
12.
Leung
A.
and
Natarajan
R.
(
2014
)
Noncoding RNAs in vascular disease
.
Curr. Opin. Cardiol.
29
,
199
206
[PubMed]
13.
Li
J.
,
Xuan
Z.
and
Liu
C.
(
2013
)
Long non-coding RNAs and complex human diseases
.
Int. J. Mol. Sci.
14
,
18790
18808
[PubMed]
14.
Li
K.
,
Blum
Y.
,
Verma
A.
,
Liu
Z.
et al.
(
2010
)
A noncoding antisense RNA in tie-1 locus regulates tie-1 function in vivo
.
Blood
115
,
133
139
[PubMed]
15.
Michalik
K.M.
,
You
X.
,
Manavski
Y.
et al.
(
2014
)
Long noncoding RNA MALAT1 regulates endothelial cell function and vessel growth
.
Circ. Res.
114
,
1389
1397
[PubMed]
16.
Bell
R.D.
,
Long
X.
,
Lin
M.
et al.
(
2014
)
Identification and initial functional characterization of a human vascular cell-enriched long noncoding RNA
.
Arterioscler. Thromb. Vasc. Biol.
34
,
1249
1259
[PubMed]
17.
Wu
G.
,
Cai
J.
,
Han
Y.
et al.
(
2014
)
LincRNA-p21 regulates neointima formation, vascular smooth muscle cell proliferation, apoptosis, and atherosclerosis by enhancing p53 activity
.
Circulation
130
,
1452
1465
[PubMed]
18.
Pasmant
E.
,
Sabbagh
A.
,
Vidaud
M.
and
Bièche
I.
(
2011
)
ANRIL, a long, noncoding RNA, is an unexpected major hotspot in GWAS
.
FASEB J.
25
,
444
448
[PubMed]
19.
Helgadottir
A.
,
Thorleifsson
G.
,
Magnusson
K.P.
et al.
(
2008
)
The same sequence variant on 9p21 associates with myocardial infarction, abdominal aortic aneurysm and intracranial aneurysm
.
Nat. Genet.
40
,
217
224
[PubMed]
20.
Foroud
T.
,
Koller
D.L.
,
Lai
D.
et al.
(
2012
)
Genome-wide association study of intracranial aneurysms confirms role of Anril and SOX17 in disease risk
.
Stroke
43
,
2846
2852
[PubMed]
21.
He
Q.
,
Tan
J.
,
Yu
B.
,
Shi
W.
and
Liang
K.
(
2015
)
Long noncoding RNA HIF1A-AS1A reduces apoptosis of vascular smooth muscle cells: implications for the pathogenesis of thoracoabdominal aorta aneurysm
.
Pharmazie
70
,
310
315
[PubMed]
22.
Laaksamo
E.
,
Tulamo
R.
,
Liiman
A.
et al.
(
2013
)
Oxidative stress is associated with cell death, wall degradation, and increased risk of rupture of the intracranial aneurysm wall
.
Neurosurgery
72
,
109
117
[PubMed]
23.
Liu
Z.
,
Zhao
Y.
,
Wei
F.
et al.
(
2014
)
Treatment with telmisartan/rosuvastatin combination has a beneficial synergistic effect on ameliorating Th17/Treg functional imbalance in hypertensive patients with carotid atherosclerosis
.
Atherosclerosis
233
,
291
299
[PubMed]
24.
Mohan
D.
,
Munteanu
V.
,
Coman
T.
and
Ciurea
A.V.
(
2015
)
Genetic factors involves in intracranial aneurysms–actualities
.
J. Med. Life
8
,
336
341
[PubMed]
25.
Starke
R.M.
,
Raper
D.M.
,
Ding
D.
et al.
(
2014
)
Tumor necrosis factor-α modulates cerebral aneurysm formation and rupture
.
Transl. Stroke Res.
5
,
269
277
[PubMed]
26.
Nakaoka
H.
,
Tajima
A.
,
Yoneyama
T.
et al.
(
2014
)
Gene expression profiling reveals distinct molecular signatures associated with the rupture of intracranial aneurysm
.
Stroke
45
,
2239
2245
[PubMed]
27.
Yu
Y.
,
Huang
Q.
and
Liu
J.
(
2015
)
Intracranial saccular aneurysm formation is different from similar extracranial lesions: a hint from the correlation between intracranial fusiform aneurysms and arterial root dilatation
.
World Neurosurg.
84
,
1558
1559
[PubMed]
28.
Li
D.Y.
,
Busch
A.
,
Jin
H.
et al.
(
2018
)
H19 induces abdominal aortic aneurysm development and progression
.
Circulation
138
,
1551
1568
[PubMed]
29.
Sathyan
S.
,
Koshy
L.V.
,
Srinivas
L.
et al.
(
2015
)
Pathogenesis of intracranial aneurysm is mediated by proinflammatory cytokine TNFA and IFNG and through stochastic regulation of IL10 and TGFB1 by comorbid factors
.
J. Neuroinflam.
12
,
135
30.
Helgadottir
A.
,
Thorleifsson
G.
,
Magnusson
K.P.
et al.
(
2008
)
The same sequence variant on 9p21 associates with myocardial infarction, abdominal aortic aneurysm and intracranial aneurysm
.
Nat. Genet.
40
,
217
224
[PubMed]
31.
Olsson
S.
,
Csajbok
L.Z.
,
Jood
K.
,
Nylén
K.
,
Nellgård
B.
and
Jern
C.
(
2011
)
Association between genetic variation on chromosome 9p21 and aneurysmal subarachnoid haemorrhage
.
J. Neurol. Neurosurg. Psychiatry
82
,
384
388
[PubMed]
32.
Kronenberg
Z.N.
,
Fiddes
I.T.
,
Gordon
D.
et al.
(
2018
)
High-resolution comparative analysis of great ape genomes
.
Science
360
,
eaar6343
[PubMed]

Author notes

*

These authors contributed equally to this work.

This is an open access article published by Portland Press Limited on behalf of the Biochemical Society and distributed under the Creative Commons Attribution License 4.0 (CC BY).

Supplementary data