Abstract

Carboxypeptidase A4 (CPA4) is a member of the metallocarboxypeptidase family. Current studies have identified the roles of CPA4 in cancer biology and insulin sensitivity. However, the roles of CPA4 in other diseases are not known. In the present study, we investigated the roles of CPA4 in cardiac hypertrophy. The expression of CPA4 was significantly increased in the hypertrophic heart tissues of human patients and isoproterenol (ISO)-induced hypertrophic heart tissues of mice. We next knocked down Cpa4 with shRNA or overexpressed Cpa4 using adenovirus in neonatal rat cardiomyocytes and induced cardiomyocyte hypertrophy with ISO. We observed that Cpa4 overexpression promoted whereas Cpa4 knockdown reduced ISO-induced growth of cardiomyocyte size and overexpression of hypertrophy marker genes, such as myosin heavy chain β (β-Mhc), atrial natriuretic peptide (Anp), and brain natriuretic peptide (Bnp). Our further mechanism study revealed that the mammalian target of rapamycin (mTOR) signaling was activated by Cpa4 in cardiomyocytes, which depended on the phosphoinositide 3-kinase (PI3K)-AKT signaling. Besides, we showed that the PI3K-AKT-mTOR signaling was critically involved in the roles of Cpa4 during cardiomyocyte hypertrophy. Collectively, these results demonstrated that CPA4 is a regulator of cardiac hypertrophy by activating the PI3K-AKT-mTOR signaling, and CPA4 may serve as a promising target for the treatment of hypertrophic cardiac diseases.

Introduction

In adult mammalian hearts, the proliferative capacity of the cardiomyocytes is limited. Upon injury or increased functional demand, the cardiomyocytes can not proliferate to repair or support the increased demand. Instead, cardiomyocytes can undergo hypertrophic growth, which can compensatorily support the functions of the myocardial tissues [1,2]. Cardiac hypertrophy can be divided into physiological and pathological hypertrophy [3]. Pathological hypertrophy is irreversible and can be induced by hypertension, myocardial infarction, and neuroendocrine factors [3]. The continuous overload of the cardiac tissues and hypertrophic growth leads to arrhythmia, cardiac hypertrophy, and heart failure [1,3]. Therefore, cardiac hypertrophy has been considered the core fundamental mechanism underlying cardiac diseases. Nowadays, cardiovascular diseases are increasing and have been regarded as the first-leading cause of deaths all around the world. Targeting hypertrophy for the treatment of cardiac diseases is a promising strategy [4], which needs a further deep understanding of the mechanisms underlying cardiac hypertrophy.

The hypertrophic growth of cardiomyocytes is regulated by diverse intracellular signalings, such as NAD+-dependent protein deacylase Sirtuins, AMP-dependent protein kinase (AMPK), FOXOs, histone deacetylases (HDACs), and the mammalian target of rapamycin (mTOR) [5–9]. For instance, the phosphoinositide 3-kinase (PI3K)-AKT signaling contributes to nearly all kinds of cardiac hypertrophy. PI3K is activated by neuroendocrine factors (e.g., angiotensin II [Ang II], endothelin 1 [ET-1], isoproterenol [ISO]), insulin, insulin-like growth factors, apelin via the G protein-coupled receptors (GPCRs) [10–12]. The phosphorylated PI3K activates the kinase AKT via a phosphoinositide-dependent protein kinase (PDK1)-dependent or independent manner [10]. The kinase Akt can activate its downstream targets via phosphorylation to participate in cell survival, growth, and proliferation [10,13]. One of the central targets of AKT during cardiac hypertrophy is mTOR. mTOR can regulate the activity of ribosomes and promote protein synthesis via phosphorylating the p70 ribosomal protein S6 kinase 1 (S6K1) [13,14]. The mTOR complex is the key modulator for organ and cell size and controls the hypertrophic growth of different kinds of cells, including smooth muscle cells, cardiomyocytes, skeletal muscle cells, and adipocytes [7,13]. Repression of the activity of mTOR by rapamycin can inhibit cardiac hypertrophy in rodents [15,16].

Carboxypeptidase A4 (CPA4) belongs to the metallocarboxypeptidase family, which participates in the regulation of peptide hormone activity and hormone-regulated tissue growth and differentiation [17]. The roles of CPA4 in cancer biology have been widely investigated. For example, the down-regulation of CPA4 represses cancer growth by inhibiting the c‐MYC pathway in human non-small cell lung cancer [18]. CPA4 can also function as the diagnostic and prognostic marker in human breast cancer. CPA4 high-expression is correlated with aggressive phenotype and poor prognosis [19,20]. The role of CPA4 in regulating of adipocytes was also revealed. Fibroblast growth factor-1 (FGF-1) can facilitate adipogenesis by down-regulating CPA4, which is a negative modulator of adipogenesis to participate in local and systemic insulin sensitivity [21]. However, the roles of CPA4 in cardiac hypertrophy remains unknown.

In the present study, we authors aimed to investigate the biological roles of CPA4 in cardiac hypertrophy in humans and rodents. We observed that CPA4 was overexpressed in hypertrophic hearts and cardiomyocytes. The hyperexpression of CPA4 promoted cardiomyocyte hypertrophy through activating the PI3K-AKT-mTOR signaling pathway.

Materials and methods

Human patient samples

Human samples (six controls and six cardiac hypertrophy) were obtained at The Second Hospital of Hebei Medical University from May 2016 to Jan 2019. Every patient or control donor signed the written form of informed consent. The study design and experimental protocol were approved by the Ethics Committee of Clinical Research of Hebei Medical University.

Animal study

For the animal model of cardiac hypertrophy, 8–12 weeks old male C57BL/6 mice were used. Mice were anesthetized with isoflurane and body temperature maintained on a circulating heated waterpad. The cardiac hypertrophy in mouse was induced by subcutaneously chronic infusion of ISO (Sigma; 50 mg/kg/day) with ALZet minipump 2004 for 28 days, as described in previous work [22]. The animal experiments were performed in the Animal Center of Hebei Medical University. The study design and experimental protocol were approved by the Ethics Committee of Animal Research of Hebei Medical University.

Isolation and culture of neonatal rat cardiomyocytes

To induce in vitro cardiomyocyte hypertrophy, neonatal rat cardiomyocytes from 1- to 3-day-old Sprague–Dawley rats were isolated and used using a previously described protocol [23,24]. The rat cardiomyocytes were cultured in DMEM (HyClone) containing 10% fetal bovine serum (FBS, Thermo Fisher), penicillin/streptomycin (1000 U/ml each; Gibco). A total of 100 mM of 5-Bromo-2-deoxyuridine (Sigma) was supplied to repress the growth of cardiac fibroblasts. Forty-eight hours later, the medium was replaced and the cells were used for further experiments.

In vitro model of cardiomyocyte hypertrophy

To induce cardiomyocyte hypertrophy, the cardiomyocytes were starved with 1% FBS for 24 h. Then, the cardiomyocytes were subjected to hypertrophy induction with ISO (50 μM) treatment for 48 h. A-actinin staining was performed to stain and indicate cardiomyocytes, then cell size was analyzed with the ImageJ software. For drug treatment, rapamycin, LY294002, and Ipatasertib were purchased from Selleck and the concentrations were indicated in the figure legends.

Quantitative real-time PCR

RNA was isolated from fresh tissues and cultured cardiomyocytes using the TRIzol reagent purchased from Thermo Fisher. Two micrograms of RNA was subjected to synthesize the first-strand cDNA by using the cDNA synthesis kit from New England Biolabs. Next, the mRNA expressions of target genes were analyzed with SYBR Green II qRT-PCR kit from QIAGEN on IQ5 (BioRAD). The forward and reverse primers used for quantitative real-time PCR are shown in Table 1.

Table 1
Primers used for quantitative real-time PCR in the present study
Gene symbolForward primer (5′–3′)Reverse primer (5′–3′)
ANP (h) AAGAAAGCACACCAACGCAG GATGGTGACTTCCTCGCCTC 
BNP (h) CTGATCCGGTCCATCTTCCT TGGAAACGTCCGGGTTACAG 
β-MHC (h) CCAAGTTCACTCACATCCATCA AGTGGCAATAAAAGGGGTAGC 
CPA4 (h) AGGTGGATACTGTTCATTGGGG TTGCTGATCTCGTCTCCATTTC 
GAPDH (h) GGCTGTTGTCATACTTCTCATGG GGAGCGAGATCCCTCCAAAAT 
Anp (m) TCTTCCTCGTCTTGGCCTTT CCAGGTGGTCTAGCAGGTTC 
Bnp (m) TGGGAGGTCACTCCTATCCT GGCCATTTCCTCCGACTTT 
β-Mhc (m) CGGACCTTGGAAGACCAGAT GACAGCTCCCCATTCTCTGT 
Cpa4 (m) CCGAGATAAATTCTTTGGGGACC CCAGACACTGAGCTTTAAGTGG 
Gapdh (m) TGTAGACCATGTAGTTGAGGTCA AGGTCGGTGTGAACGGATTTG 
Anp (r) GAAGATGCCGGTAGAAGATGAG AGAGCCCTCAGTTTGCTTTTC 
Bnp (r) CTGGAGACTGGCTAGGACTTC GGTGCTGCCCCAGATGATT 
Mhc (r) GCCCCAAATGCAGCCAT CGCTCAGTCATGGCGGAT 
Cpa4 (r) TAGCCTCCGGGGAATGGTAA CCTCCACTTTTGATCGGCCT 
Gapdh (r) TGACAACTCCCTCAAGATTGTCA GGCATGGACTGTGGTCATGA 
Gene symbolForward primer (5′–3′)Reverse primer (5′–3′)
ANP (h) AAGAAAGCACACCAACGCAG GATGGTGACTTCCTCGCCTC 
BNP (h) CTGATCCGGTCCATCTTCCT TGGAAACGTCCGGGTTACAG 
β-MHC (h) CCAAGTTCACTCACATCCATCA AGTGGCAATAAAAGGGGTAGC 
CPA4 (h) AGGTGGATACTGTTCATTGGGG TTGCTGATCTCGTCTCCATTTC 
GAPDH (h) GGCTGTTGTCATACTTCTCATGG GGAGCGAGATCCCTCCAAAAT 
Anp (m) TCTTCCTCGTCTTGGCCTTT CCAGGTGGTCTAGCAGGTTC 
Bnp (m) TGGGAGGTCACTCCTATCCT GGCCATTTCCTCCGACTTT 
β-Mhc (m) CGGACCTTGGAAGACCAGAT GACAGCTCCCCATTCTCTGT 
Cpa4 (m) CCGAGATAAATTCTTTGGGGACC CCAGACACTGAGCTTTAAGTGG 
Gapdh (m) TGTAGACCATGTAGTTGAGGTCA AGGTCGGTGTGAACGGATTTG 
Anp (r) GAAGATGCCGGTAGAAGATGAG AGAGCCCTCAGTTTGCTTTTC 
Bnp (r) CTGGAGACTGGCTAGGACTTC GGTGCTGCCCCAGATGATT 
Mhc (r) GCCCCAAATGCAGCCAT CGCTCAGTCATGGCGGAT 
Cpa4 (r) TAGCCTCCGGGGAATGGTAA CCTCCACTTTTGATCGGCCT 
Gapdh (r) TGACAACTCCCTCAAGATTGTCA GGCATGGACTGTGGTCATGA 

Abbreviations: Anp, atrial natriuretic peptide; Bnp, brain natriuretic peptide; h, human; m, mouse; r, rat; β-Mhc, myosin heavy chain β.

Western blot

Total protein was extracted from fresh tissues and cultured cardiomyocytes using the RIPA lysis buffer purchased from Millipore. Protease inhibitor cocktail (Roche) was added into the lysis buffer to reduce the degradation of proteins. Then 40 μg of total proteins were separated with SDS/PAGE, followed by membrane transferring and primary antibody incubation at 4°C overnight. Then, the membranes were washed and incubated with secondary antibodies (Servicebio) and expression of proteins was analyzed with ECL kit (Byeotime). Anti-CPA4 and anti-GAPDH antibodies were purchased from Abcam. Anti-pmTOR, anti-mTOR, anti-pS6K1, anti-S6K1, anti-pPI3K, anti-PI3K, anti-pAKT, anti-AKT antibodies were purchased from Cell Signaling Technology.

Adenovirus-mediated gene silence and overexpression

To silence or overexpress Cpa4 in rat cardiomyocytes, the adenovirus system was applied. For gene knockdown, short-hairpin RNA (shRNA) targeting rat Cpa4 (shCpa4, 5′-GCAAGAAACGGCCAGCCATTT-3′) or control shRNA (shCtrl, 5′-GTTCACCGTAGTTCCGTTC-3′) was cloned into the adenovirus expressing plasmid pAdTrack under the control of U6 promoter. For overexpression Cpa4 in cardiomyocytes, rat CPA4 (NM_001109346.2) expressing construct was cloned into the adenovirus expressing plasmid pAdTrack-CMV. The adenovirus packaging plasmids were transfected into HEK293A cells to produce adenovirus using a standard protocol as described previously [25].

Heart function analysis

The fraction shortening and ejection fraction of control and ISO-infused mice were analyzed as described previously [26,27].

Protein synthesis assay

Protein synthesis was monitored by incorporation of [3H]-leucine into proteins as described previously [28].

Statistical analysis

All statistical values were shown as mean ± SD of three independent experiments if no other information was stated. To analyze the difference between the two groups, the standard Student’s t test was utilized. For analysis of the difference among more than two groups, two-way ANOVA followed by Tukey’s post-hoc test was applied. All the P-values less than 0.05 were considered significant. All statistical analyses were performed with the GraphPad Prism software version 8.0.

Results

The expression of CPA4 is up-regulated in human and mouse hypertrophic hearts

CPA4 is a member of the metallocarboxypeptidase family. However, the functional involvement of CPA4 in the cardiovascular system is not clear. Here we attempted to determine the roles of CPA4 in cardiac hypertrophy in humans and rodents. To this purpose, we initially monitored the expression changes in CPA4 during cardiac hypertrophy. We collected six samples of hypertrophic hearts and six control heart tissues, and the hypertrophic growth of human hearts varied with the up-regulation of hypertrophy marker genes, such as atrial natriuretic peptide (ANP), brain natriuretic peptide (BNP), and myosin heavy chain β (β-MHC) (Figure 1A). Next, we tested the mRNA and protein levels of CPA4 with qRT-PCR and Western blot assays, respectively. The results significantly showed that the expression levels of both mRNA and protein of CPA4 were much higher in hypertrophic hearts compared with the controls (Figure 1B,C).

CPA4 is overexpressed in hypertrophic hearts of human and mouse

Figure 1
CPA4 is overexpressed in hypertrophic hearts of human and mouse

(A) mRNA levels of hypertrophy-associated marker genes in control (n=6) and hypertrophic hearts (n=6) in humans. The mRNA levels were analyzed by qRT-PCR. **P<0.01. (B) mRNA level of CPA4 in control (n=6) and hypertrophic hearts (n=6) in humans. The mRNA level was analyzed by qRT-PCR. **P<0.01. (C) The protein level of CPA4 in control (n=5) and hypertrophic hearts (n=56) in humans. The protein level of CPA4 was analyzed by Western blot. **P<0.01. (D) Fractional shortening of mice with cardiac hypertrophy. Cardiac hypertrophy was induced in male C57BL/6 mice with ISO (50 mg/kg, subcutaneously) treatment continuously for 28 days. n=5, **P<0.01. (E) Ejection fraction of mice with cardiac hypertrophy. n=5, **P<0.01. (F) mRNA levels of hypertrophy-associated marker genes in control (n=5) and ISO-induced hypertrophic hearts (n=5) in mice. **P<0.01. (G) mRNA level of Cpa4 in control (n=5) and ISO-induced hypertrophic hearts (n=5) in mice. **P<0.01. (H) The protein level of CPA4 in control (n=5) and ISO-induced hypertrophic hearts (n=5) in mice. The statistical analysis was performed with Student’s t test.

Figure 1
CPA4 is overexpressed in hypertrophic hearts of human and mouse

(A) mRNA levels of hypertrophy-associated marker genes in control (n=6) and hypertrophic hearts (n=6) in humans. The mRNA levels were analyzed by qRT-PCR. **P<0.01. (B) mRNA level of CPA4 in control (n=6) and hypertrophic hearts (n=6) in humans. The mRNA level was analyzed by qRT-PCR. **P<0.01. (C) The protein level of CPA4 in control (n=5) and hypertrophic hearts (n=56) in humans. The protein level of CPA4 was analyzed by Western blot. **P<0.01. (D) Fractional shortening of mice with cardiac hypertrophy. Cardiac hypertrophy was induced in male C57BL/6 mice with ISO (50 mg/kg, subcutaneously) treatment continuously for 28 days. n=5, **P<0.01. (E) Ejection fraction of mice with cardiac hypertrophy. n=5, **P<0.01. (F) mRNA levels of hypertrophy-associated marker genes in control (n=5) and ISO-induced hypertrophic hearts (n=5) in mice. **P<0.01. (G) mRNA level of Cpa4 in control (n=5) and ISO-induced hypertrophic hearts (n=5) in mice. **P<0.01. (H) The protein level of CPA4 in control (n=5) and ISO-induced hypertrophic hearts (n=5) in mice. The statistical analysis was performed with Student’s t test.

Next, we tested whether the up-regulation of CPA4 in hypertrophic hearts was conserved across species. Cardiac hypertrophy was induced in C57BL/6 mice by subcutaneous treatment of ISO (50 mg/kg/day) for continuous 28 days using a protocol reported previously [22]. ISO treatment induced the decrease in fraction shortening and ejection fraction in mice (Figure 1D,E). The hypertrophic growth of mouse hearts was coupled with the overexpression of hypertrophy-associated fetal genes (Anp, Bnp, and β-Mhc) (Figure 1F). Similar to the pattern in humans, the mRNA and protein levels of Cpa4 was significantly higher in ISO-induced hypertrophic hearts compared with the control hearts (Figure 1G,H).

CPA4 is involved in the development of cardiomyocyte hypertrophy

Since CPA4 is overexpressed in hypertrophic myocardial tissues in humans and rodents, CPA4 may regulate the progress of cardiomyocyte hypertrophy. To monitor the function of CPA4, loss-of-function (gene silence) and gain-of-function (gene overexpression) strategies were carried out by using the adenovirus system. Adenovirus-mediated shRNA targeting Cpa4 (shCpa4) significantly down-regulated the expression levels of Cpa4 in rat cardiomyocytes (Figure 2A). Next, we used an in vitro model of cardiomyocyte hypertrophy by treating neonatal rat cardiomyocytes with ISO for 48 h. ISO treatment remarkedly induced the increase in cardiomyocyte size and triggered the hyperexpression of hypertrophic fetal genes (Anp, Bnp, and β-Mhc) (Figure 2B,C). Notably, Cpa4 knockdown repressed ISO-induced hypertrophic growth of rat cardiomyocytes (Figure 2B,C). Cpa4 was also overexpressed in rat cardiomyocytes using the adenovirus system (Figure 2D). By contrast, Cpa4 overexpression can facilitate the increase in the size of cardiomyocytes and overexpression of hypertrophic fetal genes (Figure 2E,F). Collectively, these findings demonstrated that CPA4 promotes cardiomyocyte hypertrophy.

CPA4 promotes the ISO-induced cardiomyocyte hypertrophy

Figure 2
CPA4 promotes the ISO-induced cardiomyocyte hypertrophy

(A) shRNA-mediated knockdown of Cpa4 in rat cardiomyocytes. The rat cardiomyocytes were infected with adenovirus expressing shCtrl (Ad-shCtrl) or shCpa4 (Ad-shCpa4), mRNA, and protein levels were analyzed by qRT-PCR and Western blot 2 days later (n=3). **P<0.01. (B) Cpa4 deficiency represses ISO-induced growth in cardiomyocytes. The rat cardiomyocytes were infected with Ad-shCtrl or Ad-shCpa4 for 24 h, followed by ISO treatment (50 μM) for additional 48 h to induce cardiomyocyte hypertrophy. ImageJ was used to quantify the cardiomyocytes size (n=3). **P<0.01. (C) Cpa4 deficiency represses ISO-induced overexpression of hypertrophy-associated genes. The rat cardiomyocytes were treated as in (B), followed by an analysis of target genes with qRT-PCR (n=3). **P<0.01. (D) Adenovirus-mediated overexpression of Cpa4 in rat cardiomyocytes. The rat cardiomyocytes were infected with adenovirus carrying rat Cpa4 (Ad-Cpa4) or control adenovirus (Ad-Ctrl) for two days, followed by the analysis of mRNA and protein levels with qRT-PCR and Western blot (n=3). **P<0.01. (E) Cpa4 overexpression enhances ISO-induced growth in cardiomyocytes. The rat cardiomyocytes were infected with Ad-Ctrl or Ad-Cpa4 for 24 h, followed by ISO treatment (50 μM) for additional 48 h to induce cardiomyocyte hypertrophy. ImageJ was used to quantify the cardiomyocytes size (n=3). **P<0.01. (F) Cpa4 overexpression facilitates ISO-induced overexpression of hypertrophy-associated genes. The rat cardiomyocytes were treated as in (E), followed by an analysis of mRNA and protein levels with qRT-PCR and Western blot (n=3). **P<0.01. In (A,D), the statistical analysis was performed with Student’s t test. In (B,C,E,F), the statistical analysis was performed with two-way ANOVA followed by Tukey’s post-hoc test.

Figure 2
CPA4 promotes the ISO-induced cardiomyocyte hypertrophy

(A) shRNA-mediated knockdown of Cpa4 in rat cardiomyocytes. The rat cardiomyocytes were infected with adenovirus expressing shCtrl (Ad-shCtrl) or shCpa4 (Ad-shCpa4), mRNA, and protein levels were analyzed by qRT-PCR and Western blot 2 days later (n=3). **P<0.01. (B) Cpa4 deficiency represses ISO-induced growth in cardiomyocytes. The rat cardiomyocytes were infected with Ad-shCtrl or Ad-shCpa4 for 24 h, followed by ISO treatment (50 μM) for additional 48 h to induce cardiomyocyte hypertrophy. ImageJ was used to quantify the cardiomyocytes size (n=3). **P<0.01. (C) Cpa4 deficiency represses ISO-induced overexpression of hypertrophy-associated genes. The rat cardiomyocytes were treated as in (B), followed by an analysis of target genes with qRT-PCR (n=3). **P<0.01. (D) Adenovirus-mediated overexpression of Cpa4 in rat cardiomyocytes. The rat cardiomyocytes were infected with adenovirus carrying rat Cpa4 (Ad-Cpa4) or control adenovirus (Ad-Ctrl) for two days, followed by the analysis of mRNA and protein levels with qRT-PCR and Western blot (n=3). **P<0.01. (E) Cpa4 overexpression enhances ISO-induced growth in cardiomyocytes. The rat cardiomyocytes were infected with Ad-Ctrl or Ad-Cpa4 for 24 h, followed by ISO treatment (50 μM) for additional 48 h to induce cardiomyocyte hypertrophy. ImageJ was used to quantify the cardiomyocytes size (n=3). **P<0.01. (F) Cpa4 overexpression facilitates ISO-induced overexpression of hypertrophy-associated genes. The rat cardiomyocytes were treated as in (E), followed by an analysis of mRNA and protein levels with qRT-PCR and Western blot (n=3). **P<0.01. In (A,D), the statistical analysis was performed with Student’s t test. In (B,C,E,F), the statistical analysis was performed with two-way ANOVA followed by Tukey’s post-hoc test.

CPA4 promotes mTOR activation to participate in cardiomyocyte hypertrophy

Next, we investigated the underlying biological mechanisms. mTOR is a pivotal regulator for protein synthesis and cardiac hypertrophy via activating the ribosomal protein S6K1 [14]. We hypothesized that CPA4 may regulate cardiomyocyte hypertrophy via the mTOR-SK61 signaling pathway. To test this hypothesis, we performed Western blot to analyze the activation of mTOR-S6K1 signaling in cardiomyocytes. ISO treatment increased the phosphorylation of mTOR and S6K1 in rat cardiomyocytes. Remarkably, adenovirus-mediated Cpa4 knockdown repressed ISO-induced increase in phosphorylation of mTOR and S6K1 in rat cardiomyocytes (Figure 3A). By contrast, Cpa4 overexpression facilitated the increase in phosphorylation of mTOR and S6K1 in cardiomyocytes treated by ISO (Figure 3B). Therefore, CPA4 participates in ISO-induced activation of mTOR-S6K1 signaling during cardiomyocyte hypertrophy. mTOR-S6K1 is an important regulator for protein synthesis during cardiac hypertrophy. We also analyzed the effects of CPA4 on protein synthesis. The results showed that CPA4 knockdown repressed while CPA4 overexpression promoted ISO-induced protein synthesis in cardiomyocytes (Figure 3C,D). Besides, we explored whether the activation of mTOR-S6K1 mediated by CPA4 overexpression contributed to the function of CPA4. We treated the cardiomyocytes with mTOR inhibitor rapamycin. Rapamycin treatment significantly repressed cardiomyocyte size and marker gene expressions in ISO-treated cardiomyocytes (Figure 3E,F). Of note, the pro-hypertrophic roles of CPA4 were repressed remarkedly by rapamycin (Figure 3E,F). Therefore, these results implicated that CPA4 activated mTOR-S6K1 signaling, which was essentially involved in CPA4-mediated pro-hypertrophic functions (Figure 3G).

CPA4 promotes mTOR activation to promote cardiomyocyte hypertrophy

Figure 3
CPA4 promotes mTOR activation to promote cardiomyocyte hypertrophy

(A) Cpa4 deficiency reduces ISO-induced activation of the mTOR-S6K1 signaling pathway. The rat cardiomyocytes were infected with Ad-shCtrl or Ad-shCpa4 for 24 h, followed by ISO treatment (50 μM) for ditional 24 h. The protein levels of target protein were analyzed by Western blot. (B) Cpa4 overexpression enhances ISO-induced activation of the mTOR-S6K1 signaling pathway. The rat cardiomyocytes were infected with Ad-Ctrl or Ad-Cpa4 for 24 h, followed by ISO treatment (50 μM) for an additional 24 h. The protein levels of target protein were analyzed by Western blot. (C) Effects of CPA4 knockdown on protein synthesis in ISO-treated cardiomyocytes (n=3). **P<0.01. (D) Effects of CPA4 overexpression on protein synthesis in ISO-treated cardiomyocytes (n=3). **P<0.01. (E) Inhibition of mTOR with rapamycin blocks CPA4-mediated increase in cardiomyocyte size. The cardiomyocytes were infected with Ad-Cpa4 for 24 h, and then the cells were treated with ISO (50 μM) and rapamycin (100 nM) was added to inhibit mTOR for 48 h. ImageJ was used to quantify cell size (n=3). **P<0.01. (F) Inhibition of mTOR with rapamycin blocks CPA4-mediated overexpression of hypertrophic marker genes. The rat cardiomyocytes were treated as in (C), then analysis of mRNA levels of target genes was carried out with qRT-PCR (n=3). **P<0.01. (G) Illustrator showing CPA4 activates mTOR-S6K1 signaling to promote cardiomyocyte hypertrophy. The statistical analysis was performed with two-way ANOVA followed by Tukey’s post-hoc test.

Figure 3
CPA4 promotes mTOR activation to promote cardiomyocyte hypertrophy

(A) Cpa4 deficiency reduces ISO-induced activation of the mTOR-S6K1 signaling pathway. The rat cardiomyocytes were infected with Ad-shCtrl or Ad-shCpa4 for 24 h, followed by ISO treatment (50 μM) for ditional 24 h. The protein levels of target protein were analyzed by Western blot. (B) Cpa4 overexpression enhances ISO-induced activation of the mTOR-S6K1 signaling pathway. The rat cardiomyocytes were infected with Ad-Ctrl or Ad-Cpa4 for 24 h, followed by ISO treatment (50 μM) for an additional 24 h. The protein levels of target protein were analyzed by Western blot. (C) Effects of CPA4 knockdown on protein synthesis in ISO-treated cardiomyocytes (n=3). **P<0.01. (D) Effects of CPA4 overexpression on protein synthesis in ISO-treated cardiomyocytes (n=3). **P<0.01. (E) Inhibition of mTOR with rapamycin blocks CPA4-mediated increase in cardiomyocyte size. The cardiomyocytes were infected with Ad-Cpa4 for 24 h, and then the cells were treated with ISO (50 μM) and rapamycin (100 nM) was added to inhibit mTOR for 48 h. ImageJ was used to quantify cell size (n=3). **P<0.01. (F) Inhibition of mTOR with rapamycin blocks CPA4-mediated overexpression of hypertrophic marker genes. The rat cardiomyocytes were treated as in (C), then analysis of mRNA levels of target genes was carried out with qRT-PCR (n=3). **P<0.01. (G) Illustrator showing CPA4 activates mTOR-S6K1 signaling to promote cardiomyocyte hypertrophy. The statistical analysis was performed with two-way ANOVA followed by Tukey’s post-hoc test.

CPA4 promotes the activation of PDK1 to regulate mTOR and cardiomyocyte hypertrophy

Then, we attempted to study how CPA4 regulates mTOR signaling to promote cardiomyocyte hypertrophy. A previous study showed that CPA4 activated the kinase AKT in cancer cells [18]. Indeed, we also observed that the ISO-induced activation of the PI3K-AKT signaling pathway was repressed by Cpa4 deficiency (Figure 4A). As thus, we hypothesized that CPA4 may regulate the PI3K-AKT signaling to promote the activation of the mTOR-S6K1 pathway and cardiomyocyte hypertrophy. To test the hypothesis, we first repressed the activation of PI3K with LY294002 and monitored the activation of the mTOR-S6K1 pathway. LY294002 treatment significantly repressed CPA4-mediated hyperactivation of the mTOR-S6K1 pathway (Figure 4B). Importantly, LY294002 also blocked the effects of CPA4 overexpression on cardiomyocyte size and expression of hypertrophic fetal genes (Figure 4C,D). Similarly, we also repressed AKT with its inhibitor Ipatasertib. Ipatasertib treatment blocked CPA4-mediated hyperactivation of the mTOR-S6K1 pathway, subsequently repressed CPA4 function in regulating cardiomyocyte size and hypertrophic marker gene expression in ISO-induced cardiomyocyte hypertrophy (Figure 4E–G). Taken together, these findings demonstrated that CPA4 activated the PI3K-AKT signaling to promote the activation of the mTOR-S6K1 pathway and subsequent hypertrophy of cardiomyocytes (Figure 4H).

PI3K-AKT is essential for CPA4 function during cardiomyocyte hypertrophy

Figure 4
PI3K-AKT is essential for CPA4 function during cardiomyocyte hypertrophy

(A) Cpa4 deficiency reduces the PI3K-AKT signaling pathway. The rat cardiomyocytes were infected with Ad-shCtrl or Ad-shCpa4 for 24 h, followed by ISO treatment (50 μM) for an additional 24 h. The protein levels of target protein were analyzed by Western blot. (B) Inhibition of PI3K blocks the effects of CPA4-mediated activation of mTOR-S6K1 signaling. The cardiomyocytes were infected with Ad-Cpa4 for 24 h, and then the cells were treated with ISO (50 μM) and PI3K inhibitor (LY294002, 1 μM) was added to inhibit PI3K for 24 h. The protein levels of target protein were analyzed by Western blot. (C) Inhibition of PI3K blocks CPA4-mediated increase in cardiomyocytes. The cardiomyocytes were infected with Ad-Cpa4 for 24 h, and then the cells were treated with ISO (50 μM) and PI3K inhibitor (LY294002, 1 μM) was added to inhibit PI3K for 24 h. Cardiomyocyte size was quantified with ImageJ (n=3). **P<0.01. (D) Inhibition of PI3K blocks CPA4-mediated overexpression of hypertrophic marker genes. The rat cardiomyocytes were treated as in (C), then analysis of mRNA levels of target genes was carried out with qRT-PCR (n=3). **P<0.01. (E) Inhibition of AKT blocks CPA4-mediated activation of mTOR-S6K1 signaling. The cardiomyocytes were infected with Ad-Cpa4 for 24 h, and then the cells were treated with ISO (50 μM) and AKT inhibitor (Ipatasertib, 1 μM) was added to inhibit AKT for 24 h. The protein levels of target protein were analyzed by Western blot. (F) Inhibition of AKT blocks CPA4-mediated increase in cardiomyocytes. The cardiomyocytes were infected with Ad-Cpa4 for 24 h, and then the cells were treated with ISO (50 μM) and AKT inhibitor (Ipatasertib, 1 μM) was added to inhibit AKT for 48 h. (G) Inhibition of AKT blocks CPA4-mediated overexpression of hypertrophic marker genes. The rat cardiomyocytes were treated as in (F), then analysis of mRNA levels of target genes was carried out with qRT-PCR (n=3). **P<0.01. (H) Illustrator showing CPA4 activates PI3K-AKT-mTOR-S6K1 signaling to promote cardiomyocyte hypertrophy. The statistical analysis was performed with two-way ANOVA and Tukey’s post-hoc test.

Figure 4
PI3K-AKT is essential for CPA4 function during cardiomyocyte hypertrophy

(A) Cpa4 deficiency reduces the PI3K-AKT signaling pathway. The rat cardiomyocytes were infected with Ad-shCtrl or Ad-shCpa4 for 24 h, followed by ISO treatment (50 μM) for an additional 24 h. The protein levels of target protein were analyzed by Western blot. (B) Inhibition of PI3K blocks the effects of CPA4-mediated activation of mTOR-S6K1 signaling. The cardiomyocytes were infected with Ad-Cpa4 for 24 h, and then the cells were treated with ISO (50 μM) and PI3K inhibitor (LY294002, 1 μM) was added to inhibit PI3K for 24 h. The protein levels of target protein were analyzed by Western blot. (C) Inhibition of PI3K blocks CPA4-mediated increase in cardiomyocytes. The cardiomyocytes were infected with Ad-Cpa4 for 24 h, and then the cells were treated with ISO (50 μM) and PI3K inhibitor (LY294002, 1 μM) was added to inhibit PI3K for 24 h. Cardiomyocyte size was quantified with ImageJ (n=3). **P<0.01. (D) Inhibition of PI3K blocks CPA4-mediated overexpression of hypertrophic marker genes. The rat cardiomyocytes were treated as in (C), then analysis of mRNA levels of target genes was carried out with qRT-PCR (n=3). **P<0.01. (E) Inhibition of AKT blocks CPA4-mediated activation of mTOR-S6K1 signaling. The cardiomyocytes were infected with Ad-Cpa4 for 24 h, and then the cells were treated with ISO (50 μM) and AKT inhibitor (Ipatasertib, 1 μM) was added to inhibit AKT for 24 h. The protein levels of target protein were analyzed by Western blot. (F) Inhibition of AKT blocks CPA4-mediated increase in cardiomyocytes. The cardiomyocytes were infected with Ad-Cpa4 for 24 h, and then the cells were treated with ISO (50 μM) and AKT inhibitor (Ipatasertib, 1 μM) was added to inhibit AKT for 48 h. (G) Inhibition of AKT blocks CPA4-mediated overexpression of hypertrophic marker genes. The rat cardiomyocytes were treated as in (F), then analysis of mRNA levels of target genes was carried out with qRT-PCR (n=3). **P<0.01. (H) Illustrator showing CPA4 activates PI3K-AKT-mTOR-S6K1 signaling to promote cardiomyocyte hypertrophy. The statistical analysis was performed with two-way ANOVA and Tukey’s post-hoc test.

Discussion

CPA4 is one of the members of the metallocarboxypeptidase family and it participates in cancer biology. Here we identified the roles of CPA4 in regulating PI3K-AKT-mTOR signaling and promotes cardiac hypertrophy. The expression of CPA4 was overexpressed in human and mouse cardiac hypertrophy. Gene silencing and gene overexpression experiments demonstrated that CPA4 promoted ISO-induced hypertrophy of cardiomyocytes. Further biological mechanism studies revealed that CPA4 promoted ISO-induced activation of the mTOR-S6K1 pathway through activating PI3K-AKT signaling.

CPA4 is a metallocarboxypeptidase that regulates peptide hormone activity and hormone-regulated tissue growth and differentiation [15]. The physiological and pathological roles of CPA4 are not fully understood. Most studies on CPA4 focus on its roles in cancer biology. Previous studies have reported the critical involvement of CPA4 in non-small lung cancer [18], breast cancer [19], hepatocellular carcinoma [29], and gastric cancer [30]. Besides, the role of CPA4 in regulating adipogenesis and insulin sensitivity was also observed in adipose tissues [21]. However, the other roles of CPA4 remain unknown. Here we demonstrated that CPA4 was an important regulator for cardiac hypertrophy across species. CPA4 mRNA and protein levels were up-regulated in hypertrophic myocardial tissues in humans and mice. Gain-of-function and loss-of-function experiments collectively demonstrated that CPA4 promoted ISO-induced cardiomyocyte hypertrophy. Therefore, we identified the pro-hypertrophic roles of CPA4, which implicating that CPA4 is a critical regulator for the cardiovascular system. Since CPA4 was associated with adipogenesis and insulin sensitivity [21], CPA4 may also participate in obesity-associated and diabetic cardiomyopathies.

The mTOR-S6K1 is critically involved in de novo protein synthesis and controls cellular and organ size [14]. During cardiac hypertrophy, the mTOR-S6K1 pathway is activated and promotes cardiomyocyte hypertrophy, cardiac remodeling, and heart failure [11,14]. Besides, previous studies have demonstrated that mTOR inhibitor rapamycin is a promising drug for the treatment of cardiac hypertrophy in rodents [11,13–16]. The upstream regulators of the mTOR-S6K1 signaling pathway are not fully identified. Herein the present study, we identified CPA4 as an indirect upstream activator for the mTOR-S6K1 signaling pathway and activated mTOR during cardiac hypertrophy. Also, we observed that rapamycin treatment blocked the function of CPA4 in cardiomyocyte hypertrophy, implicating that mTOR is essential for CPA4 to show its biological functions.

PI3K-AKT signaling is activated by neuroendocrine factors, insulin, and insulin-like growth factors [10]. The activated AKT can promote the activation of mTOR through phosphorylating and inhibiting mTOR upstream repressor tuberous sclerosis complex (TSC)1/2 complex [14]. Indeed, we observed that CPA4 contributed to ISO-induced activation of PI3K-AKT signaling. The previous study showed that CPA4 deficiency suppressed AKT activation [18], which was consistent with our results. And we showed that PI3K mediated the effects of CPA4 on the kinase AKT. Importantly, we observed that inhibition of PI3K with LY294002 or inhibition of AKT with Ipatasertib blocked the activation effects of CPA4 on the mTOR-S6K1 signaling pathways. Also, the roles of CPA4 was blocked by either inhibition of PI3K with LY294002 or inhibition of AKT with Ipatasertib. Therefore, CPA4 activated the mTOR-S6K1 pathway and promoted cardiomyocyte hypertrophy via up-regulating the activation of PI3K-AKT signaling. Since the PI3K-AKT plays central roles in regulating insulin pathways [6,21], CPA4 may serve as an important regulator for insulin response. In the present study, we did not explore the mechanism underlying the CPA4-mediated regulation of PI3K. This may be one of the limitations of the present study. A previous report showed that CPA4 activated STAT3 in cancer cells [31]. Besides, STAT3 was known to activate PI3K signaling in an RAS-dependent manner [32–34]. Therefore, one potential mechanism by which CPA4 activated PI3K was the activation of STAT3-RAS signaling. But further study is needed to support the hypothesis.

In summary, using human samples and animal and cell models, we demonstrated the pro-hypertrophic roles of CPA4. CPA4 facilitates the development of cardiac hypertrophy by activating the PI3K-AKT-mTOR signaling pathway. Therefore, we identified CPA4 as a new upstream regulator of the mTOR pathway and CPA4 may serve as a potential therapeutic target for cardiac hypertrophy.

Competing Interests

The authors declare that there are no competing interests associated with the manuscript.

Funding

This work was supported by the Health Commission of Hebei Province [grant number 20190058].

Author Contribution

Weinian Gao and Shuguang Zhao designed the study and wrote the manuscript. Weinian Gao performed most of the experiments with help from Na Guo. Ziying Chen and Wenli Zhang collected human samples. Fang Yan and Hongjuan Liao performed the animal study. Kui Chi isolated cardiomyocytes.

Abbreviations

     
  • Anp

    atrial natriuretic peptide

  •  
  • Bnp

    brain natriuretic peptide

  •  
  • CPA4

    carboxypeptidase A4

  •  
  • ISO

    isoproterenol

  •  
  • mTOR

    mammalian target of rapamycin

  •  
  • PDK1

    phosphoinositide-dependent protein kinase

  •  
  • PI3K

    phosphoinositide 3-kinase

  •  
  • shRNA

    short-hairpin RNA

  •  
  • S6K1

    p70 ribosomal protein S6 kinase 1

  •  
  • β-Mhc

    myosin heavy chain β

References

References
1.
Nakamura
M.
and
Sadoshima
J.
(
2018
)
Mechanisms of physiological and pathological cardiac hypertrophy
.
Nat. Rev. Cardiol.
15
,
387
407
[PubMed]
2.
Tang
X.
,
Li
P.-H.
and
Chen
H.-Z.
(
2020
)
Cardiomyocyte senescence and cellular communications within myocardial microenvironment
.
Front. Endocrinol. (Lausanne)
3.
Shimizu
I.
and
Minamino
T.
(
2016
)
Physiological and pathological cardiac hypertrophy
.
J. Mol. Cell. Cardiol.
97
,
245
262
[PubMed]
4.
Rohini
A.
,
Agrawal
N.
,
Koyani
C.N.
and
Singh
R.
(
2010
)
Molecular targets and regulators of cardiac hypertrophy
.
Pharmacol. Res.
61
,
269
280
[PubMed]
5.
Tang
X.
,
Chen
X.-F.
,
Chen
H.-Z.
and
Liu
D.-P.
(
2017
)
Mitochondrial sirtuins in cardiometabolic diseases
.
Clin. Sci.
131
,
2063
2078
[PubMed]
6.
Zhou
S.
,
Tang
X.
and
Chen
H.Z.
(
2018
)
Sirtuins and insulin resistance
.
Front. Endocrinol. (Lausanne)
9
,
748
[PubMed]
7.
Kemi
O.J.
,
Ceci
M.
,
Wisloff
U.
,
Grimaldi
S.
,
Gallo
P.
,
Smith
G.L.
et al.
(
2008
)
Activation or inactivation of cardiac Akt/mTOR signaling diverges physiological from pathological hypertrophy
.
J. Cell. Physiol.
214
,
316
321
[PubMed]
8.
Gélinas
R.
,
Mailleux
F.
,
Dontaine
J.
,
Bultot
L.
,
Demeulder
B.
,
Ginion
A.
et al.
(
2018
)
AMPK activation counteracts cardiac hypertrophy by reducing O-GlcNAcylation
.
Nat. Commun.
9
,
1
17
[PubMed]
9.
Xin
Z.
,
Ma
Z.
,
Jiang
S.
,
Wang
D.
,
Fan
C.
,
Di
S.
et al.
(
2017
)
FOXOs in the impaired heart: new therapeutic targets for cardiac diseases
.
Biochim. Biophys. Acta Mol. Basis Dis.
1863
,
486
498
10.
Aoyagi
T.
and
Matsui
T.
(
2011
)
Phosphoinositide-3 kinase signaling in cardiac hypertrophy and heart failure
.
Curr. Pharm. Des.
17
,
1818
1824
[PubMed]
11.
Proud
C.G.
(
2004
)
Ras, PI3-kinase and mTOR signaling in cardiac hypertrophy
.
Cardiovasc. Res.
63
,
403
413
[PubMed]
12.
Chen
X.-F.
,
Chen
X.
and
Tang
X.
(
2020
)
Short-chain fatty acid, acylation and cardiovascular diseases
.
Clin. Sci.
134
,
657
676
[PubMed]
13.
Sciarretta
S.
,
Forte
M.
,
Frati
G.
and
Sadoshima
J.
(
2018
)
New insights into the role of mTOR signaling in the cardiovascular system
.
Circ. Res.
122
,
489
505
[PubMed]
14.
Xu
L.
and
Brink
M.
(
2016
)
mTOR, cardiomyocytes and inflammation in cardiac hypertrophy
.
Biochim. Biophys. Acta
1863
,
1894
1903
[PubMed]
15.
Gu
J.
,
Hu
W.
,
Song
Z.-P.
,
Chen
Y.-G.
,
Zhang
D.-D.
and
Wang
C.-Q.
(
2016
)
Rapamycin inhibits cardiac hypertrophy by promoting autophagy via the MEK/ERK/Beclin-1 pathway
.
Front. Physiol.
7
,
104
[PubMed]
16.
Shioi
T.
,
McMullen
J.R.
,
Tarnavski
O.
,
Converso
K.
,
Sherwood
M.C.
,
Manning
W.J.
et al.
(
2003
)
Rapamycin attenuates load-induced cardiac hypertrophy in mice
.
Circulation
107
,
1664
1670
[PubMed]
17.
Pallares
I.
,
Bonet
R.
,
Garcia-Castellanos
R.
,
Ventura
S.
,
Aviles
F.X.
,
Vendrell
J.
et al.
(
2005
)
Structure of human carboxypeptidase A4 with its endogenous protein inhibitor, latexin
.
Proc. Natl. Acad. Sci. U.S.A.
102
,
3978
3983
[PubMed]
18.
Fu
Y.
,
Su
L.
,
Cai
M.
,
Yao
B.
,
Xiao
S.
,
He
Q.
et al.
(
2019
)
Downregulation of CPA4 inhibits non small–cell lung cancer growth by suppressing the AKT/c-MYC pathway
.
Mol. Carcinog.
58
,
2026
2039
[PubMed]
19.
Handa
T.
,
Katayama
A.
,
Yokobori
T.
,
Yamane
A.
,
Fujii
T.
,
Obayashi
S.
et al.
(
2019
)
Carboxypeptidase A4 accumulation is associated with an aggressive phenotype and poor prognosis in triple-negative breast cancer
.
Int. J. Oncol.
54
,
833
844
[PubMed]
20.
Bademler
S.
,
Ucuncu
M.Z.
,
Tilgen Vatansever
C.
,
Serilmez
M.
,
Ertin
H.
and
Karanlik
H.
(
2019
)
Diagnostic and prognostic significance of carboxypeptidase A4 (CPA4) in breast cancer
.
Biomolecules
9
,
103
21.
He
J.
,
Chen
D.L.
,
Samocha-Bonet
D.
,
Gillinder
K.R.
,
Barclay
J.L.
,
Magor
G.W.
et al.
(
2016
)
Fibroblast growth factor-1 (FGF-1) promotes adipogenesis by downregulation of carboxypeptidase A4 (CPA4) - a negative regulator of adipogenesis implicated in the modulation of local and systemic insulin sensitivity
.
Growth Factors
34
,
210
216
[PubMed]
22.
Cai
L.
,
Fan
G.
,
Wang
F.
,
Liu
S.
,
Li
T.
,
Cong
X.
et al.
(
2017
)
Protective role for LPA3 in cardiac hypertrophy induced by myocardial infarction but not by isoproterenol
.
Front. Physiol.
8
,
356
23.
Tang
X.
,
Ma
H.
,
Han
L.
,
Zheng
W.
,
Lu
Y.-B.
,
Chen
X.-F.
et al.
(
2016
)
SIRT1 deacetylates the cardiac transcription factor Nkx2.5 and inhibits its transcriptional activity
.
Sci. Rep.
6
,
36576
[PubMed]
24.
Tang
X.
,
Chen
X.-F.
,
Wang
N.-Y.
,
Wang
X.-M.
,
Liang
S.-T.
,
Zheng
W.
et al.
(
2017
)
SIRT2 acts as a cardioprotective deacetylase in pathological cardiac hypertrophy
.
Circulation
136
,
2051
2067
[PubMed]
25.
Jia
Y.-Y.
,
Lu
J.
,
Huang
Y.
,
Liu
G.
,
Gao
P.
,
Wan
Y.-Z.
et al.
(
2014
)
The involvement of NFAT transcriptional activity suppression in SIRT1-mediated inhibition of COX-2 expression induced by PMA/Ionomycin
.
PLoS ONE
9
,
e97999
[PubMed]
26.
Mu
W.
,
Zhang
Q.
,
Tang
X.
,
Fu
W.
,
Zheng
W.
,
Lu
Y.
et al.
(
2014
)
Overexpression of a dominant-negative mutant of SIRT1 in mouse heart causes cardiomyocyte apoptosis and early-onset heart failure
.
Sci. China Life Sci.
57
,
915
924
[PubMed]
27.
Pei
J.-F.
,
Yan
Y.-F.
,
Tang
X.
,
Zhang
Y.
,
Cui
S.-S.
,
Zhang
Z.-Q.
et al.
(
2016
)
Human paraoxonase gene cluster overexpression alleviates angiotensin II-induced cardiac hypertrophy in mice
.
Sci. China Life Sci.
59
,
1115
1122
[PubMed]
28.
Sundaresan
N.R.
,
Gupta
M.
,
Kim
G.
,
Rajamohan
S.B.
,
Isbatan
A.
and
Gupta
M.P.
(
2009
)
Sirt3 blocks the cardiac hypertrophic response by augmenting Foxo3a-dependent antioxidant defense mechanisms in mice
.
J. Clin. Invest.
119
,
2758
2771
[PubMed]
29.
Zhang
H.
,
Hao
C.
,
Wang
H.
,
Shang
H.
and
Li
Z.
(
2019
)
Carboxypeptidase A4 promotes proliferation and stem cell characteristics of hepatocellular carcinoma
.
Int. J. Exp. Pathol.
100
,
133
138
[PubMed]
30.
Sun
L.
,
Guo
C.
,
Yuan
H.
,
Burnett
J.
,
Pan
J.
,
Yang
Z.
et al.
(
2016
)
Overexpression of carboxypeptidase A4 (CPA4) is associated with poor prognosis in patients with gastric cancer
.
Am. J. Transl. Res.
8
,
5071
5075
[PubMed]
31.
Pan
H.
,
Pan
J.
,
Ji
L.
,
Song
S.
,
Lv
H.
,
Yang
Z.
et al.
(
2019
)
Carboxypeptidase A4 promotes cell growth via activating STAT3 and ERK signaling pathways and predicts a poor prognosis in colorectal cancer
.
Int. J. Biol. Macromol.
138
,
125
134
[PubMed]
32.
Park
E.
,
Park
J.
,
Han
S.W.
,
Im
S.A.
,
Kim
T.Y.
,
Oh
D.Y.
et al.
(
2012
)
NVP-BKM120, a novel PI3K inhibitor, shows synergism with a STAT3 inhibitor in human gastric cancer cells harboring KRAS mutations
.
Int. J. Oncol.
40
,
1259
1266
[PubMed]
33.
Mendoza
M.C.
,
Er
E.E.
and
Blenis
J.
(
2011
)
The Ras-ERK and PI3K-mTOR pathways: cross-talk and compensation
.
Trends Biochem. Sci.
36
,
320
328
[PubMed]
34.
Ma
X.
,
Ma
C.X.
and
Wang
J.
(
2014
)
Endometrial carcinogenesis and molecular signaling pathways
.
Am. J. Mol. Biol.
4
,
16
This is an open access article published by Portland Press Limited on behalf of the Biochemical Society and distributed under the Creative Commons Attribution License 4.0 (CC BY).