1-37 of 37
Keywords: cell cycle
Close
Follow your search
Access your saved searches in your account

Would you like to receive an alert when new items match your search?
Close Modal
Sort by
Articles
Biosci Rep (2021) 41 (4): BSR-20160519_EOC.
Published: 19 April 2021
... © 2021 The Author(s). 2021 This is an open access article published by Portland Press Limited on behalf of the Biochemical Society and distributed under the Creative Commons Attribution License 4.0 (CC BY) . apoptosis cell cycle STIM1 Tca-8113 cells tongue squamous carcinoma...
Articles
Biosci Rep (2021) 41 (2): BSR-20190503_EOC.
Published: 16 February 2021
... © 2021 The Author(s). 2021 This is an open access article published by Portland Press Limited on behalf of the Biochemical Society and distributed under the Creative Commons Attribution License 4.0 (CC BY) . β-catenin apoptosis bladder cancer cell cycle ENO1 The Editorial...
Articles
Biosci Rep (2020) 40 (9): BSR20202083.
Published: 07 September 2020
...-fluorouracil (5-FU). We found that JCo inhibited oral cancer cell growth, and that JCo might be less cytotoxic to normal cells than to cancer cells. After JCo treatment, cell cycle arrest was observed at the G 0 /G 1 phase through modulation of p53/p21 and Rb signaling. JCo also caused an increase in the sub-G...
Articles
Biosci Rep (2020) 40 (6): BSR20201199.
Published: 19 June 2020
... effective anti-gastric cancer agents based on ISL, aldol condensation reaction was applied to synthesize the ISL analogues. MTS assay was used to evaluate the inhibitory activities of ISL analogues against SGC-7901, BGC-823 and GES-1 cells in vitro . Cell cycle distribution, apoptosis and reactive oxygen...
Includes: Supplementary data
Articles
Biosci Rep (2019) 39 (12): BSR20193094.
Published: 13 December 2019
...) . cell cycle microRNA SCP/CTDSP phosphatases tumor suppressors Lung cancer is the most commonly diagnosed cancer in the world, with high mortality [ 1 ]. Alterations in many cellular processes and signaling pathways contribute to tumorigenesis, and disruption of cell cycle regulation is one of...
Includes: Supplementary data
Articles
Biosci Rep (2019) 39 (10): BSR20190828.
Published: 11 October 2019
... showed that YLT-LL-11 inhibited the proliferation of a DLBCL cell line OCI-LY10 via inducing G0/G1 cell cycle arrest with regulation of the cyclin-dependent kinases (CDKs) expression. Furthermore, YLT-LL-11 facilitated OCI-LY10 cell apoptosis by up-regulation of pro-apoptotic protein BAX and down...
Includes: Supplementary data
Articles
Biosci Rep (2019) 39 (9): BSR20190880.
Published: 24 September 2019
... cell cycle Daunorubicin Hexokinase-II Leukemia Glycolytic shift of energy metabolism is one of the fundamental changes that occur in cancer cells. Otto Warburg first described that even in the presence of adequate amount of oxygen, cancer cells increased the glycolytic flux for faster rate...
Articles
Biosci Rep (2019) 39 (9): BSR20190503.
Published: 09 September 2019
... revealed that ENO1 was critical for the growth and proliferation of BC cells. ENO1 over-expression also promoted the proliferation of SV-HUC-1 cells. At the molecular level, the cell cycle and apoptosis related genes were regulated by ENO1. β-catenin expression was positively regulated by ENO1. Furthermore...
Articles
Biosci Rep (2019) 39 (9): BSR20190654.
Published: 06 September 2019
... and enhanced apoptosis in GC cells. The cell cycle progression was suppressed by miR-497-5p. Mechanistically, miR-497-5p directly targeted and suppressed the expression of pyruvate dehydrogenase kinase 3 (PDK3), which is highly expressed in GC tissues. Over-expression of PDK3 promoted the...
Articles
Biosci Rep (2019) 39 (9): BSR20190227.
Published: 03 September 2019
... to investigate the expression profile and biological role of circMYLK in LSCC. We found that circMYLK was highly expressed in LSCC tissues and cell lines. circMYLK overexpression promoted LSCC cell proliferation and G 1 /S cell cycle transition; whereas circMYLK knockdown had the contrary effects...
Articles
Biosci Rep (2019) 39 (5): BSR20182109.
Published: 14 May 2019
... the cell cycle, apoptosis, targets prediction, molecular docking, and alterations in protein levels were performed to elucidate how Tet functions in colon cancer. We found that Tet robustly induced arrest at the G1 phase in colon cancer cell line HT-29. It induced HT-29 cell apoptosis in a dose...
Articles
Biosci Rep (2019) 39 (5): BSR20190456.
Published: 14 May 2019
... U2OS cells after treatment with hydroxyurea. In addition, hydroxyurea increased cell apoptosis and altered the cell cycle. TET proteins catalyze the oxidation of 5-methylcytosine (5mC) to 5-hydroxymethylcytosine (5hmC); therefore, 5mC and 5hmC levels were evaluated. Increased 5hmC levels were observed...
Includes: Supplementary data
Articles
Biosci Rep (2019) 39 (4): BSR20190040.
Published: 05 April 2019
... of the patients with leukemia. Lentivirus-mediated knockdown of USP39 repressed the proliferation and colony formation of human leukemia cell lines HL-60 and Jurkat cells. Mechanism study showed that USP39 knockdown induced the arrest of cell cycle and apoptosis of leukemia cells. In addition, our...
Includes: Supplementary data
Articles
Biosci Rep (2019) 39 (2): BSR20182306.
Published: 26 February 2019
... 13 02 2019 © 2019 The Author(s). 2019 This is an open access article published by Portland Press Limited on behalf of the Biochemical Society and distributed under the Creative Commons Attribution License 4.0 (CC BY) . cell cycle disease-free survival overall survival pancreatic...
Includes: Supplementary data
Articles
Biosci Rep (2019) 39 (1): BSR20182201.
Published: 18 January 2019
... pathogenesis. Recombinant HapE was purified for use in downstream assays. MTT and colony formation assays were conducted to determine the effects of HapE on cell viability and growth, while flow cytometry was used to examine changes in cell proliferation and cell cycle function. ELISA was performed to examine...
Articles
Biosci Rep (2019) 39 (1): BSR20180906.
Published: 08 January 2019
... associated with poor prognosis of NPC patients. We further observed that knockdown of FEZF1-AS1 inhibited the proliferation of NPC cells in vitro and suppressed NPC xenograft growth in vivo through inducing G2/M cell cycle arrest. The migratory and invasive abilities of NPC cells were also reduced upon FEZF1...
Articles
Biosci Rep (2019) 39 (1): BSR20180941.
Published: 03 January 2019
... of SNHG14 inhibited NSCLC cell proliferation through inducing cell cycle arrest and apoptosis, whereas SNHG14 overexpression exerted the opposite effects. Animal experiment further revealed that down-regulated SNHG14 greatly inhibited NSCLC tumor growth in vivo . Further studies demonstrated that...
Articles
Biosci Rep (2018) 38 (6): BSR20180598.
Published: 21 December 2018
...-related genes. The expressions of both CD31 and CD34 (markers for endothelial progenitor cells) in the FV endothelial cells as well as the proportion of CD31 + /CD34 + cells in peripheral blood were measured in order to evaluate thrombosis. The effect of miR-495 on cell viability, cell cycle, and...
Includes: Supplementary data
Articles
Biosci Rep (2018) 38 (6): BSR20181384.
Published: 21 November 2018
... level of Rhotekin 2 (RTKN2) was up-regulated in osteosarcoma tissues and cell lines. In addition, silencing of RTKN2 of human osteosarcoma cell lines U2OS, inhibited proliferation, and induced G 1 phase cell cycle arrest via reducing the level of the cyclin-dependent kinase 2 (CDK2). Furthermore, RTKN2...
Articles
Biosci Rep (2018) 38 (4): BSR20180454.
Published: 31 August 2018
... neck cancer cells FaDu (human pharyngeal squamous carcinoma cell) and Tca-8113 (human tongue squamous carcinoma cell) with knockdown of GOLIM4 by lentivirus. And the decreased expression of GOLIM4 induced cellular apoptosis. Further experiments revealed that FaDu cell cycle progression was changed...
Includes: Supplementary data
Articles
Biosci Rep (2018) 38 (4): BSR20180005.
Published: 03 July 2018
... assay, BrdU incorporation, wound healing, and colony formation were used to detect melanoma B16F10 cell growth and proliferation. Flow cytometry was used for cell cycle detection. p21 and p27 expression was detected by Western blotting. B16F10 cell xenograft model was established, and treated with CA...
Articles
Biosci Rep (2018) 38 (2): BSR20171456.
Published: 27 April 2018
... tissues. Functionally, we silenced MRPL42 in glioma cells and revealed that MRPL42 knockdown largely blunted the proliferation of U251 and A172 cells. Mechanistically, our results suggested that MRPL42 silencing resulted in increased distribution of cell cycle in G 1 and G 2 /M phases, while the S-phase...
Articles
Biosci Rep (2017) 37 (6): BSR20170799.
Published: 09 November 2017
... proteins, Bcl-2, Bax, and caspase-3 were determined using Western blotting. Transfection of siTCF-3 successfully down-regulated TCF-3 gene expression. In addition, siTCF-3, reduced Eca-109 cell viability and proliferation, in a time-dependent manner, and inhibited progression of cell cycle from G 0 /G 1 to...
Articles
Biosci Rep (2017) 37 (4): BSR20170800.
Published: 04 August 2017
... shRNA targetting ANKRD49 was constructed in U251 and U87 malignant glioma cells. We demonstrated that ANKRD49 knockdown reduced the proliferation rate of U251 and U87 cells. Further mechanism analysis indicated that depletion of ANKRD49 led to the cell-cycle arrest and induced apoptosis in U251 and U87...
Articles
Biosci Rep (2017) 37 (3): BSR20160478.
Published: 21 June 2017
... IGFR R CCTCAACTTGTGATCCGTATTTT Cell cycle Cell apoptosis Erlotinib MicroRNA-223 Non-small cell lung cancer Lung cancer is the most common type of cancer worldwide, and almost 80% of lung cancers are classified as non-small cell lung cancer (NSCLC) [ 1 , 2 ]. NSCLC may remain...
Includes: Supplementary data
Articles
Biosci Rep (2017) 37 (2): BSR20160519.
Published: 02 March 2017
... repressed the proliferation of Tca-8113 cells. In addition, we also showed that STIM1 deficiency reduced colony number of Tca-8113 cells. Knockdown of STIM1 repressed cells to enter M phase of cell cycle and induced cellular apoptosis. Furthermore, we performed microarray and bioinformatics analysis and...
Articles
Biosci Rep (2016) 36 (6): e00405.
Published: 08 November 2016
...-8 assay. Flow cytometry analysis was employed to measure apoptosis of OS cells. Cell cycle distribution was analysed by propidium iodide staining. Transwell assay was performed to evaluate the effect of CuE on invasion potential of OS cells. The protein levels were measured by western blot. In...
Includes: Supplementary data
Articles
Biosci Rep (2016) 36 (5): e00377.
Published: 16 September 2016
...Ajeena Ramanujan; Swati Tiwari The ubiquitin (Ub) ligase anaphase promoting complex/cyclosome (APC/C) and the tumour suppressor retinoblastoma protein (pRB) play key roles in cell cycle regulation. APC/C is a critical regulator of mitosis and G 1 -phase of the cell cycle whereas pRB keeps a check...
Articles
Biosci Rep (2016) 36 (1): e00298.
Published: 19 February 2016
... from 30 patients. In addition, TMEM14A knockdown in two ovarian cancer cell lines, A2780 and HO-8910, reduced cell proliferation, causes cell cycle arrest and suppressed cell invasion. Moreover, silencing of TMEM14A notably repressed G1/S cell cycle transition and cell invasion via down-regulating the...
Includes: Supplementary data
Articles
Biosci Rep (2015) 35 (6): e00273.
Published: 26 November 2015
... tissue samples by quantitative real-time (qRT)-PCR. The effects of Hec1 on PCa cells were studied by RNAi approach. Apoptosis and cell cycle were analysed by flow cytometry. Cells viability was evaluated using cell counting Kit-8. Cyclin B1–Cdc2 (cell division cycle 2) activity was measured by ELISA...
Articles
Biosci Rep (2015) 35 (4): e00243.
Published: 28 August 2015
.... TβRIII over-expression affects TGF-β1-mediated activation of p38 and CDKN2b in CAL-27 cells. apoptosis cell cycle tongue squamous cell carcinoma transforming growth factor type III receptor (TβRIII) transforming growth factor-β1 (TGF-β1) Human tongue squamous cell carcinoma (TSCC) is...
Articles
Biosci Rep (2015) 35 (2): e00189.
Published: 28 April 2015
... underlying molecular mechanisms. In the present study, our results showed that shikonin significantly inhibited the growth of A431 cells in a concentration- and time-dependent manner, and caused cell cycle arrest by upregulation of p21 and p27, and downregulation of cyclins and cyclin-dependent kinases. In...
Articles
Biosci Rep (2014) 34 (6): e00153.
Published: 21 November 2014
... proliferation and migration compared with WT (wild-type) cells. Both Cav-1 KO and WT cells expressed the smooth muscle differentiation markers SM22 and calponin. Cell-cycle phase distribution analysis revealed a higher proportion of Cav-1 KO than WT cells in the S phase. Cav-1 KO cells were hyper-proliferative...
Includes: Supplementary data
Articles
Biosci Rep (2010) 30 (4): 243–255.
Published: 17 March 2010
...Randy Suryadinata; Martin Sadowski; Boris Sarcevic The eukaryotic cell cycle is a fundamental evolutionarily conserved process that regulates cell division from simple unicellular organisms, such as yeast, through to higher multicellular organisms, such as humans. The cell cycle comprises several...
Articles
Biosci Rep (2002) 22 (5-6): 465–486.
Published: 01 December 2002
...Tim Hunt The discovery of the role(s) of protein synthesis and degradation in the operation of the cell cycle is described. © 2002 Plenum Publishing Corporation 2002 Translation cell cycle cyclins meiosis mitosic Bioscience Reports, Vol. 22, Nos. 5 and 6, October and December 2002...
Articles
Biosci Rep (2002) 22 (5-6): 487–499.
Published: 01 December 2002
...Paul M. Nurse The discovery of major regulators of the eukaryotic cell cycle is described. © 2002 Plenum Publishing Corporation 2002 cdc cell cycle cyclic dependent kinases mitosis Bioscience Reports, Vol. 22, Nos. 5 and 6, October and December 2002 ( 2002) NOBEL LECTURE 9 DECEMBER...
Articles
Biosci Rep (1994) 14 (6): 291–300.
Published: 01 December 1994
... transforming Ha-ras (EJ) gene. The growth of all these cell lines was inhibited by milimolar concentrations of sodium butyrate (NaBut). However, whereas the NRK cells as well as the NRK-E1A mut and NRK-ras cells were arrested in the G1 phase of the cell cycle, the NRK-E1A cells progressively accumulated in the...