Chronic fish oil intervention had been shown to have a positive impact on endothelial function. Although high-fat meals have often been associated with a loss of postprandial vascular reactivity, studies examining the effects of fish oil fatty acids on vascular function in the postprandial phase are limited. The aim of the present study was to examine the impact of the addition of fish oil fatty acids to a standard test meal on postprandial vascular reactivity. A total of 25 men received in a random order either a placebo oil meal (40 g of mixed fat; fatty acid profile representative of the U.K. diet) or a fish oil meal (31 g of mixed fat and 9 g of fish oil) on two occasions. Vascular reactivity was measured at baseline (0 h) and 4 h after the meal by laser Doppler iontophoresis, and blood samples were taken for the measurement of plasma lipids, total nitrite, glucose and insulin. eNOS (endothelial NO synthase) and NADPH oxidase gene expression were determined in endothelial cells after incubation with TRLs (triacylglycerol-rich lipoproteins) isolated from the plasma samples taken at 4 h. Compared with baseline, sodium nitroprusside (an endothelium-independent vasodilator)-induced reactivity (P=0.024) and plasma nitrite levels (P=0.001) were increased after the fish oil meal. In endothelial cells, postprandial TRLs isolated after the fish oil meal increased eNOS and decreased NADPH oxidase gene expression compared with TRLs isolated following the placebo oil meal (P≤0.03). In conclusion, meal fatty acids appear to be an important determinant of vascular reactivity, with fish oils significantly improving postprandial endothelium-independent vasodilation.

INTRODUCTION

Endothelial dysfunction, characterized by a decrease in vascular reactivity, is highly prognostic of future cardiovascular events [1,2]. Evidence is now emerging in the literature that mechanisms involved in the control of vascular tone are influenced by dietary factors, with total dietary fat intake and fatty acid composition being a potentially important modulator. In particular, there is a limited, but convincing, body of evidence to indicate positive benefits of diets rich in the long-chain n−3 PUFAs (polyunsaturated fatty acids) EPA (eicosapentaenoic acid) and DHA (docosahexaenoic acid) on endothelial function and vascular reactivity, when assessed after an overnight fast [36]. However, individuals spend a large proportion of the day in the postprandial state and the acute impact of dietary factors on postprandial vascular reactivity is poorly understood.

Over the last decade, a number of studies have examined the impact of meal fat quantity on vascular reactivity measured 2–8 h after a meal, but inconsistent findings have been reported. Although some studies have observed no relationship, a greater number have indicated that increasing the total fat content of a test meal reduces both cardiac and peripheral vascular reactivity [7]. In general, high-fat meals (50–105 g of fat) have been shown to impair endothelium-dependent vasodilation compared with low-fat meals (less than 10 g of fat). A number of studies have suggested that the greater postprandial TAG (triacylglycerol) response after a high-fat meal may be responsible for this effect [810].

Only two studies have examined the impact of EPA and DHA on postprandial vascular reactivity [9,10]. In the study by Vogel et al. [9], the consumption of a meal containing canned red salmon was shown to have little impact on flow-mediated dilation. In subjects with Type 2 diabetes, an improvement in vascular reactivity was observed with the addition of both marine and plant sources of n−3 PUFAs to a MUFA (mono-unsaturated fatty acid)-rich meal, but this association was only observed when the results for the study group was analysed according to fasting TAG concentration [10]. Lower postprandial TAG concentrations measured after the EPA- and DHA-containing meal were inversely correlated with the increase in flow-mediated dilation only in the subjects with Type 2 diabetes with fasting TAG ≥1.69 mmol/l.

Several studies have suggested that the mechanism through which high-fat meals inhibit vascular reactivity is via the induction of a temporary state of fat-induced oxidative stress [11,12]. An excess generation of reactive oxygen species, such as the superoxide anion, in the subendothelial space has been shown to lead to a decrease in the bioavailability of NO, an important endothelium-derived vasodilator [13]. The major source of the superoxide anion in the vasculature is the NADPH oxidase family of enzymes [14]. Studies in animals have suggested that chronic fish oil supplementation may lead to beneficial effects on endothelial function via decreases in tissue oxidative stress and induction of antioxidant enzyme activity [15]; however, very little is known about the effects of fish oil fatty acids on cellular redox status during the postprandial state.

The aim of the present study was to determine whether the addition of fish oil fatty acids (equivalent to two portions of oily fish) to a standard test meal could improve postprandial vascular reactivity at the level of the microcirculation. Underlying molecular mechanisms were investigated by determining the concentration of potential mediators of reactivity in the circulation and by using ex vivo cell culture studies.

MATERIALS AND METHODS

A total of 25 healthy males [age, 46 (4) years; and BMI (body mass index), 25.5 (0.8) kg/m2; values are means (S.E.M.)] were studied on two occasions. Subjects were excluded if they had any metabolic disorders (e.g. diabetes or any other endocrine or liver diseases), were taking dietary supplements [e.g. high-dose fish oil supplements (>1 g of EPA and DHA per day) or high doses of antioxidant vitamins (>800 μg of vitamin A, 60 mg of vitamin C, 10 mg of vitamin E or 400 μg of β-carotene)], were heavy drinkers (>30 units of alcohol per week) or were taking medication that could affect lipoprotein metabolism or blood pressure. The subjects were asked to abstain from alcohol and organized exercise regimens for 24 h before each postprandial investigation. A low-fat evening meal (<10 g of fat) was consumed on the evening before each study day.

The design of the study was a single blind crossover in which subjects attended the clinical unit at the University of Reading on two occasions separated by at least 1 week. Two test meals of different fatty acid composition were given to the volunteers in the form of a warm chocolate drink, containing the test oils, and toasted white bread with strawberry jam. This meal contained 42.8 g of fat, with 40 g provided by the test oil source and the remainder by additional meal items. The placebo oil meal consisted of a 4:1 mixture of palm olein and soybean oil (placebo oil; Aarhus United), providing a fatty acid profile representative of a typical U.K. diet. The fish oil meal contained 31 g of the placebo oil and 9 g of anchovy fish oil (Ocean Nutrition), providing 5.4 g of DHA plus EPA (ratio 3:2), which is equivalent to the levels found in two portions of oily fish. The nutrient and fatty acid composition of the test meals are shown in Tables 1 and 2 respectively.

Table 1
Composition of the test meals

The composition was determined from manufacturers' data and from food tables [27]. Nesquik is a chocolate-flavoured milkshake mix manufactured by Nestlé.

ComponentQuantityCarbohydrate (g)Fat (g)Protein (g)Energy (kJ)
Test oil 40 g 40 1478 
Skimmed milk 150 g 7.5 0.2 5.1 213 
Nesquik 25 g 20.0 0.8 0.8 380 
Skimmed milk powder 15 g 7.8 0.2 5.3 228 
White bread 73 g 51.3 1.6 8.5 1014 
Jam 30 g 27.5 47 
 Total  114.1 42.8 19.7 3360 
ComponentQuantityCarbohydrate (g)Fat (g)Protein (g)Energy (kJ)
Test oil 40 g 40 1478 
Skimmed milk 150 g 7.5 0.2 5.1 213 
Nesquik 25 g 20.0 0.8 0.8 380 
Skimmed milk powder 15 g 7.8 0.2 5.3 228 
White bread 73 g 51.3 1.6 8.5 1014 
Jam 30 g 27.5 47 
 Total  114.1 42.8 19.7 3360 
Table 2
Fatty acid composition of the test meals

The fatty acid composition was determined from manufacturers' data.

Fatty acidPlacebo oil meal (%)Fish oil meal (%)
Myristic acid (C14:01.0 1.0 
Palmitic acid (C16:032.0 26.1 
Stearic acid (C18:0) 4.0 3.9 
Oleic acid (C18:142.0 34.4 
Linoleic acid (C18:220.0 16.0 
Linolenic acid (C18:31.0 0.8 
Arachidonic acid (C20:4– 0.3 
EPA (C20:5– 5.4 
Docosapentaenoic acid (C22:5– 1.6 
DHA (C22:6– 7.9 
Fatty acidPlacebo oil meal (%)Fish oil meal (%)
Myristic acid (C14:01.0 1.0 
Palmitic acid (C16:032.0 26.1 
Stearic acid (C18:0) 4.0 3.9 
Oleic acid (C18:142.0 34.4 
Linoleic acid (C18:220.0 16.0 
Linolenic acid (C18:31.0 0.8 
Arachidonic acid (C20:4– 0.3 
EPA (C20:5– 5.4 
Docosapentaenoic acid (C22:5– 1.6 
DHA (C22:6– 7.9 

Following a 12 h overnight fast, the subjects attended the investigation unit and forearm microvascular function was performed using laser Doppler imaging with iontophoresis. A baseline (0 h) blood sample was then taken before the test meal was given and consumed within 15 min. A second blood sample was taken and microvascular function was assessed 4 h after the meal. No food was allowed during the 4 h test period, but decaffeinated sugar-free drinks were provided ad libitum.

Ethical consent for the study was provided by the University of Reading Research and Ethics Committee, and written informed consent was obtained from the subjects before the study began.

Assessment of vascular reactivity

Peripheral microvascular function was assessed using a validated technique which quantifies the vasodilator responses to 1% ACh (acetylcholine; endothelium-dependent vasodilation) and 1% SNP (sodium nitroprusside; endothelium-independent vasodilation), delivered transdermally using iontophoresis. This non-invasive in vivo method provides a robust surrogate marker of vascular function in other parts of the body and is described in detail elsewhere [16,17]. Briefly, prior to the assessment of vascular reactivity, subjects were taken to a temperature-controlled room (22–24 °C) to rest for 30 min to ensure stable baseline conditions. For the vascular reactivity measurement, participants lay in a semi-recumbent position with their right arm supported on an armrest. A temperature probe and iontophoresis chambers were attached to the volar aspect of the forearm, with ACh and SNP introduced into the anodal and cathodal chambers respectively. Following a basal measurement of skin perfusion, an incremental constant current was delivered progressively in 5 μA steps (5, 10, 15 and 20 μA) to yield a total charge (current×time) of 8000 coulombs during the measurement. A series of 15 scans was performed as the current increased from 0 to 20 μA (with a further five scans performed after the current had been switched off), and skin perfusion was measured using a laser Doppler imager (Moor Instruments). For each scan, median flux values were determined within each of the iontophoresis chambers and plotted against the cumulative charge (0–8000 coulombs). The within-day and between-day coefficients of variation for this method are both <10% [16].

Analytical procedures

Blood samples were collected into EDTA tubes, and the plasma was separated by centrifugation at 1700 g for 10 min in a bench-top centrifuge at 4 °C. Plasma for lipoprotein isolation and analysis of lipids, glucose, insulin and nitrite were stored at −80 °C. TAG and glucose were measured with an ILAB 600 clinical chemistry analyser (Instrumentation Laboratory) using enzyme-based colorimetric tests supplied by the manufacturer. NEFAs (non-esterified fatty acids) were analysed as above using a kit supplied by Alpha Laboratories. All samples for each subject were analysed within a single batch, and the inter-assay coefficient of variation was <4% for all analytes.

Plasma insulin was measured using a specific ELISA incorporating monoclonal antibodies (Dako). Total nitrite levels (a surrogate marker of bioavailable NO) were determined using a commercially available kit following the reduction of nitrate to nitrite (ACTIVE MOTIF; Rixensart). The inter-assay coefficients of variation for these assays were <6%.

To determine molecular mechanisms underlying the effects of meal fatty acids on postprandial vascular reactivity, TRLs [TAG-rich lipoproteins; Sf (Svedberg flotation rate) >400, a fraction which contains predominantly chylomicrons] were isolated from the 4 h postprandial plasma samples and incubated with HUVECs (human umbilical vein endothelial cells) to determine the effects on the gene expression of eNOS (endothelial NO synthase; an enzyme involved in the formation of NO from L-arginine in endothelial cells) and NOX-4, the NADPH oxidase subunit expressed in endothelial cells (an enzyme involved in the formation of the superoxide anion).

Cell culture experiments

To ensure sufficient quantities of the Sf>400 TRL fraction for the cell culture studies, postprandial plasma samples from five different volunteers were pooled before density gradient ultracentrifugation was performed, as described previously [18]. Lipoproteins were passed through PD-10 desalting columns (Amersham Biosciences) and concentrated further using Vivaspin concentrators (Sartorius) before addition to cell cultures. To protect the lipoprotein fraction from oxidation, butylated hydroxytoluene was added at a final concentration of 20 μmol/l. ApoB (apolipoprotein B) was measured in the concentrated lipoprotein fractions in an ILAB 600 clinical chemistry analyser by turbidimetric immunoassay using a kit supplied by Alpha Laboratories.

Pooled HUVECs (Cambrex Bioscience) were maintained in complete medium [endothelial basal medium-2 supplemented with hydrocortisone, FGF-B (fibroblast growth factor-B), VEGF (vascular endothelial growth factor), IGF-1 (insulin-like growth factor-1), EGF (epidermal growth factor), gentamicin sulfate, amphotericin B-1000, heparin, ascorbic acid and 2% (v/v) FBS (fetal bovine serum); Cambrex Bioscience]. For experiments, HUVECs were grown to 60–70% confluence in six-well plates, washed twice with Hepes-buffered saline and incubated in lipid-depleted complete medium, where FBS was replaced by 2% (v/v) charcoal-stripped lipoprotein-deficient FBS (Cambrex Bioscience) for 12 h to induce quiescence. Cells were then incubated with the Sf>400 fraction (0.5 μg of apoB/ml) for 4 h at 37 °C. Only HUVECs passaged less than four times were used in the experiments.

Real-time RT (reverse transcription)-PCR

Total RNA was extracted from the cells using RNeasy Mini Kit and QIA shredder (Qiagen) using protocols recommended by the manufacturer. cDNA was generated from samples (0.8–1.5 μg) of total RNA at 42 °C for 50 min (reaction volume, 20 μl) using an oligo(dT)12–18 primer (Invitrogen) and reverse transcriptase (Superscript II; Invitrogen) using protocols recommended by the manufacturer.

Specific primers for NOX-4 (forward primer, 5′GTGTCTAAGCAGAGCCTCAGC3′; and reverse primer, 5′GGAACCTTCTGTGATCCTCG3′) were designed and real-time RT-PCR was performed as described previously [19]. The primer sequence for eNOS was obtained from Miyomoto et al. [20]. The gene expression of each target gene was normalized to β-actin expression, and the results represent the fold change in mRNA expression relative to the control (no lipoprotein addition), which was arbitrarily defined as 1.

Cell viability and cytotoxicity

The LDH (lactate dehydrogenase) concentration in the medium was determined after incubation with the Sf>400 fraction (0.5 μg of apoB/ml) for 4 h using a commercially available colorimetric cytotoxicity assay (Biogenesis). The cell viability of the monolayers was analysed as described previously [21].

Statistical analysis

Results were analysed using SPSS version 12.1 and are presented as means±S.E.M. The plasma metabolites in the baseline (0 h) and 4 h postprandial samples were analysed using a paired Student's t test. The microvascular responses to ACh and SNP measured at baseline (0 h) and 4 h after the meals were analysed using two-way repeated measures ANOVA. The fold changes in mRNA gene expression were analysed using an independent Student's t test. All data were checked for normality and log-transformed, where necessary, before statistical analysis. These data included the microvascular responses to ACh, SNP and NEFAs. Data which could not be normalized (TAG, glucose and insulin) were analysed using the Wilcoxon non-parametric test. Values of P<0.05 were taken as significant.

RESULTS

The placebo oil and fish oil meals were well-tolerated by the subjects without any unpleasant side effects.

Plasma metabolites

Baseline (0 h) and postprandial (4 h) concentrations are shown in Table 3. There were no significant differences in baseline lipid, glucose, insulin or total nitrite concentrations between the study days. Compared with baseline concentrations, there was a significant increase in TAG concentrations following both meals (P=0.001). Total nitrite and NEFA concentrations were also significantly increased 4 h after the fish oil meal (P<0.03; Table 3).

Table 3
Lipid, glucose, insulin and total nitrite concentrations before and after two high-fat meals in 25 healthy men

Values are means±S.E.M. *P=0.024 and †P=0.001 compared with baseline concentrations; ‡P=0.046 and §P=0.013 compared with the postprandial fish oil meal concentrations.

Placebo oil mealFish oil meal
ParameterBaseline (0 h)Postprandial (4 h)Baseline (0 h)Postprandial (4 h)
TAG (mmol/l) 1.44±0.2 2.48±0.4† 1.40±0.2 2.60±0.3† 
NEFAs (μmol/l) 278.0±26.5 308.5±26.4 270.3±21.7 359.4±32.8* 
Glucose (mmol/l) 5.38±0.1 5.16±0.1‡ 5.57±0.1 5.47±0.1 
Insulin (pmol/l) 27.5±2.4 31.7±6.9 28.1±3.7 22.3±3.9 
Total nitrite (μmol/l) 37.8±2.6 34.9±3.3§ 33.9±2.0 44.6±3.4† 
Placebo oil mealFish oil meal
ParameterBaseline (0 h)Postprandial (4 h)Baseline (0 h)Postprandial (4 h)
TAG (mmol/l) 1.44±0.2 2.48±0.4† 1.40±0.2 2.60±0.3† 
NEFAs (μmol/l) 278.0±26.5 308.5±26.4 270.3±21.7 359.4±32.8* 
Glucose (mmol/l) 5.38±0.1 5.16±0.1‡ 5.57±0.1 5.47±0.1 
Insulin (pmol/l) 27.5±2.4 31.7±6.9 28.1±3.7 22.3±3.9 
Total nitrite (μmol/l) 37.8±2.6 34.9±3.3§ 33.9±2.0 44.6±3.4† 

Between-meal comparisons indicated that, at 4 h, the total nitrite and glucose concentrations were significantly greater after the fish oil compared with the placebo oil meal (P<0.05; Table 3). Postprandial TAG, NEFA and insulin concentrations were similar following both meals.

Microvascular responses to ACh and SNP at baseline and 4 h after the test meals

Figure 1 shows the baseline (0 h) and postprandial (4 h) skin perfusion responses to ACh and SNP following the placebo oil and fish oil meals. These results are presented as flux units against the cumulative charge (0–8000 coulombs); as the charge increases, there is an increase in drug delivery leading to a greater skin perfusion (flux units). Compared with the baseline (0 h) measurement, there was a significant increase in the vasodilatory response to SNP (P=0.024) and, to a lesser extent, ACh (P=0.108) at 4 h after the fish oil meal (Figure 1). Significant differences were not observed between the baseline and postprandial response to ACh or SNP for the placebo oil meal.

Baseline and postprandial microvascular responses to ACh (upper panels) and SNP (lower panels) after the placebo oil and fish oil meals

Figure 1
Baseline and postprandial microvascular responses to ACh (upper panels) and SNP (lower panels) after the placebo oil and fish oil meals

Values are means±S.E.M., n=25. For the fish oil meal, there was a significant increase in the postprandial vasodilatory response to SNP compared with the baseline response (P=0.024).

Figure 1
Baseline and postprandial microvascular responses to ACh (upper panels) and SNP (lower panels) after the placebo oil and fish oil meals

Values are means±S.E.M., n=25. For the fish oil meal, there was a significant increase in the postprandial vasodilatory response to SNP compared with the baseline response (P=0.024).

Cell culture experiments

Cell viability and cytotoxicity

Compared with the control (no lipoprotein addition), there was no loss in cell viability or increase in the release of LDH from HUVECs following incubation with the Sf>400 fraction for a period of 4 h (results not shown).

Real-time RT-PCR

Figure 2 shows the fold changes of eNOS and NOX-4 mRNA in HUVECs following incubation with postprandial Sf>400 TRLs isolated after the placebo oil and fish oil meals compared with no lipoprotein addition (control), which is designated as 1. There was a significantly greater up-regulation of eNOS (P=0.014) and a greater down-regulation of NOX-4 (P=0.025) mRNA expression following incubation with the fish oil compared with the placebo oil meal TRLs (Figure 2).

Relative amounts of mRNAs from HUVECs incubated with Sf>400 (0.5 μg of apoB/ml) isolated 4 h after the placebo oil and fish oil meals
Figure 2
Relative amounts of mRNAs from HUVECs incubated with Sf>400 (0.5 μg of apoB/ml) isolated 4 h after the placebo oil and fish oil meals

Each value represents the amount of RNA relative to the control (no lipoprotein additions), which is arbitrarily defined as 1. Relative amounts were normalized to β-actin expression. Each experiment was performed in duplicate, and values represent means±S.E.M. for four independent experiments. *P=0.014 and †P=0.025 compared with placebo oil.

Figure 2
Relative amounts of mRNAs from HUVECs incubated with Sf>400 (0.5 μg of apoB/ml) isolated 4 h after the placebo oil and fish oil meals

Each value represents the amount of RNA relative to the control (no lipoprotein additions), which is arbitrarily defined as 1. Relative amounts were normalized to β-actin expression. Each experiment was performed in duplicate, and values represent means±S.E.M. for four independent experiments. *P=0.014 and †P=0.025 compared with placebo oil.

DISCUSSION

With the increasing recognition of the pivotal role of vascular dysfunction in the progression of atherosclerosis, the vasculature has emerged as an important target for dietary therapies. Over the past decade, there has been considerable interest in the impact of meal composition on postprandial vascular reactivity. Dietary fat, in particular, has emerged as a potential modulator, as a number of studies have shown an impairment in vascular reactivity 2–8 h after high-fat compared with low-fat meals [7]. This is an important observation as individuals spend the majority of the day in the postprandial state and it is likely that these transient changes in vascular reactivity, repeated on a daily basis, could have implications for long-term vascular health and overall cardiovascular risk.

In the present study, we found that a single meal enriched with 5.4 g of DHA and EPA, equivalent to two portions of oily fish, acutely improved postprandial vascular reactivity in our male cohort. Although the improvement in ACh-induced reactivity (endothelium-dependent vasodilation) did not reach significance, a significant increase in the vasodilatory response to SNP (endothelium-independent vasodilation) was observed compared with baseline measurements. In addition, these improvements were associated with a significant increase in postprandial plasma total nitrite levels, a surrogate marker of bioavailable NO. Although chronic long-chain n−3 PUFA consumption has been shown to have positive effects on vascular reactivity measured in the fasting state, only two previous studies have determined the acute impact of fish and/or fish oils on postprandial vascular reactivity [9,10]. In agreement with the findings of the present study, West et al. [10] observed a tendency for an increase in endothelium-dependent vasodilation with the addition of 4.0 g of EPA/DHA to a high-fat meal in subjects with Type 2 diabetes. In that study, subgroup analysis revealed that only subjects with a higher fasting TAG concentration (≥1.69 mmol/l) had a significant increase in endothelium-dependent vasodilation after the fish-oil-enriched meal [10], with no significant effect in the low TAG subgroup, who displayed similar mean fasting TAG levels to our male cohort. Interestingly, in the study by Vogel et al. [9], the consumption of canned red salmon containing 6 g of n−3 fatty acids had little impact on endothelium-dependent vasodilation in healthy young adults with a lower than average fasting TAG concentration (<1.0 mmol/l). Therefore it appears from these studies that fasting TAG concentration could play a role in the postprandial responsiveness of the vasculature to fish oil fatty acids, in particular the endothelium-dependent response.

A novel, but unexpected, observation in the present study was the significant improvement in endothelium-independent vasodilation at 4 h following the fish oil meal. SNP was used as an NO donor to examine the reactivity of the smooth muscle cell layer. Although the mechanism of NO release from SNP is not fully understood, it is thought to occur by both enzymatic and non-enzymatic processes requiring the presence of cell membranes of the endothelium and smooth muscle layer (vascular tissue) to reduce SNP to NO [22]. Although the studies by West et al. [10] and Vogel et al. [9] did not examine the acute impact of fish oil fatty acids on postprandial endothelium-independent vasodilation, a chronic supplementation study showed that fish oils predominately improved endothelium-independent vasodilation to SNP measured in the fasting state in overweight hyperlipidaemic men [4]. It was suggested by the authors [4] that fish oil fatty acids may enhance the vasodilatory responses to SNP by (i) increasing the biotransformation of SNP to NO, or (ii) increasing the reactivity of the smooth muscle layer to vasorelaxation as a result of decreased calcium influx into the cells. This latter mechanism has also been suggested in a previous review of the chronic effects of fish oil fatty acids on vascular function [23] and in animal studies using isolated rat aortic rings [24]. As the present study is of an acute test meal design, there would be limited ability to influence the fatty acid composition of the smooth muscle cell layer and, therefore, modulate calcium influx into the cells. Given the pivotal role of the endothelial layer in the regulation of vascular tone, the focus of the mechanistic work was on endothelial cell metabolism and its regulation by circulatory modulators, such as TRL particles.

Significant improvements in the endothelium-independent and, to a lesser extent, endothelium-dependent vasodilation after the fish oil meal was accompanied by increases in the concentrations of TAG, NEFAs and total nitrite. In particular, postprandial concentrations of nitrite and glucose were greater after the fish oil compared with the placebo oil meal. As total nitrite levels have been regarded as an index of endothelial NO formation in vivo [25], our present findings indicate that the acute ingestion of fish oil fatty acids may lead to a greater availability of endothelium-derived NO. Although the effects of fish oils on the endothelium-dependent vasodilatory response to ACh did not reach statistical significance, the nitrite responses are consistent with the tendency for an increase in response after the fish oil meal compared with baseline. In the present study, it is not known whether the greater total nitrite concentrations after the fish oil meal reflect greater NO production or a decrease in the rate of degradation of NO in the endothelium.

Post-meal glucose concentrations were also shown to be higher after the fish oil compared with the placebo oil meal. These findings are interesting and, together with the tendency for a lower insulin concentration, suggest that fish oil fatty acids may be acutely influencing postprandial glucose disposal. However, these results need to be interpreted with caution, since the timing of the postprandial blood sample was not concordant with maximal recorded concentrations of both glucose and insulin (generally 60–120 min) after a high-fat mixed meal.

A number of mechanisms to explain the beneficial effects of fish oil fatty acids on endothelial function have been derived from chronic supplementation studies in both humans and animals. Although the mechanisms of how acute fish oil fatty acid intake alters postprandial vascular reactivity are unknown, some studies have hypothesized that fish oil supplementation leads to improvements in vascular reactivity by increasing the bioavailability of NO in the vascular wall [26]. This is thought to occur by a number of mechanisms, including (i) an increase in NO production via effects on eNOS gene regulation and post-transcriptional regulation of eNOS phosphorylation, or (ii) a decrease in NO degradation, due to a decrease in reactive oxygen species generation or an increase in antioxidant enzyme activity. Results from the cell culture component of the present study suggest that one or both of these mechanisms may be important. The lipid composition of the postprandial Sf>400 fraction has been shown to reflect the fatty acid composition of the test meal, and the Sf>400 fraction isolated after the fish oil meal led to a down-regulation of NOX-4 and an up-regulation in eNOS gene expression compared with TRL particles obtained after the placebo oil meal. In our human study, the improvement in endothelium-dependent vasodilation did not reach significance, but the up-regulation of eNOS expression is consistent with the significant increase in total nitrite concentrations after the fish oil meal. The down-regulation of NADPH oxidase, the major source of superoxide anion in the vasculature, would be predicted to be associated with a decrease in NO degradation. Interestingly, both EPA and DHA have been recognized as ligands for PPAR-γ (peroxisome-proliferator-activated receptor-γ), the transcriptional regulator of both NADPH oxidase and SOD (an antioxidant enzyme). At present, the effects of fish oil fatty acids on PPAR-γ activity and cellular redox status are unknown. As NOX-4 is also expressed in vascular smooth muscle cells, we cannot rule out the possibility that fish oils acutely influenced smooth muscle action directly by modulating the redox status within these cells.

In conclusion, the present study provides novel findings which suggest that the inclusion of EPA and DHA in a meal can improve postprandial vascular reactivity. The mechanism of action appears to be predominately in response to the NO donor SNP. Findings from our cell culture studies indicate that fish oil fatty acids may reduce superoxide formation via the down-regulation of NADPH oxidase. These changes are suggestive of an impact of treatment on the redox status of the vascular wall, with a possible influence on circulating NO levels. However, further studies to determine the underlying mechanisms of how fish oil fatty acids influence postprandial vascular reactivity are merited which focus on both endothelium-dependent and -independent pathways.

Abbreviations

     
  • ACh

    acetylcholine

  •  
  • apoB

    apolipoprotein B

  •  
  • DHA

    docosahexaenoic acid

  •  
  • eNOS

    endothelial NO synthase

  •  
  • EPA

    eicosapentaenoic acid

  •  
  • FBS

    fetal bovine serum

  •  
  • HUVEC

    human umbilical vein endothelial cell

  •  
  • LDH

    lactate dehydrogenase

  •  
  • NEFA

    non-esterified fatty acid

  •  
  • PPAR-γ

    peroxisome-proliferator-activated receptor-γ

  •  
  • PUFA

    polyunsaturated fatty acid

  •  
  • RT

    reverse transcription

  •  
  • Sf

    Svedberg flotation rate

  •  
  • SNP

    sodium nitroprusside

  •  
  • TAG

    triacylglycerol

  •  
  • TRL

    TAG-rich lipoprotein

We thank Mrs Jan Luff for help with subject recruitment and study days, and Dr G. Danilo Norata for helpful discussion regarding the incubation of HUVECs with lipoprotein particles. We are also grateful to Aarhus United U.K. Ltd and Ocean Nutrition for providing the test oils.

References

References
1
Schächinger
 
V.
Britten
 
M. B.
Zeiher
 
A. M.
 
Prognostic impact of coronary vasodilator dysfunction on adverse long-term outcome of coronary heart disease
Circulation
2000
, vol. 
101
 (pg. 
1899
-
1906
)
2
Landmesser
 
U.
Hornig
 
B.
Dexler
 
H.
 
Endothelial function: a critical determinant in atherosclerosis?
Circulation
2004
, vol. 
109
 (pg. 
27
-
33
)
3
Tagawa
 
H.
Shimokawa
 
H.
Tagawa
 
T.
Kuroiwa-Matsumoto
 
M.
Hirooka
 
Y.
Takeshita
 
A.
 
Long-term treatment with eicosapentaenoic acid augments both nitric oxide-mediated and non-nitric oxide-mediated endothelium-dependent forearm vasodilatation in patients with coronary artery disease
J. Cardiovasc. Pharmacol.
1999
, vol. 
33
 (pg. 
633
-
640
)
4
Mori
 
T. A.
Watts
 
G. F.
Burke
 
V.
Hilme
 
E.
Puddey
 
I. B.
Beilin
 
L. J.
 
Differential effects of eicosapentaenoic acid and docosahexaenoic acid on vascular reactivity of the forearm microcirculation in hyperlipidaemic, overweight men
Circulation
2000
, vol. 
102
 (pg. 
1264
-
1269
)
5
Nestel
 
P.
Shige
 
H.
Pomeroy
 
S.
Cehun
 
M.
Abbey
 
M.
Raederstorff
 
D.
 
The n-3 fatty acids eicosapentaenoic acid and docosahexaenoic acid increase systemic arterial compliance in humans
Am. J. Clin. Nutr.
2002
, vol. 
76
 (pg. 
326
-
330
)
6
Khan
 
F.
Elherik
 
K.
Bolton-Smith
 
C.
, et al 
The effects of dietary fatty acid supplementation on endothelial function and vascular tone in healthy subjects
Cardiovasc. Res.
2003
, vol. 
59
 (pg. 
955
-
962
)
7
West
 
S. G.
 
Effect of diet on vascular reactivity: an emerging marker for vascular risk
Curr. Atheroscler. Rep.
2001
, vol. 
3
 (pg. 
446
-
455
)
8
Marchesi
 
S.
Lupattelli
 
G.
Schillaci
 
G.
, et al 
Impaired flow-mediated vasoactivity during post-prandial phase in young healthy men
Atherosclerosis
2000
, vol. 
153
 (pg. 
397
-
402
)
9
Vogel
 
R. A.
Corretti
 
M. C.
Plotnick
 
G. D.
 
The postprandial effect of components of the mediterranean diet on endothelial function
J. Am. Coll. Cardiol.
2000
, vol. 
36
 (pg. 
1455
-
1460
)
10
West
 
S. G.
Hecker
 
K. D.
Mustad
 
V. A.
, et al 
Acute effects of monounsaturated fatty acids with and without omega-3 fatty acids on vascular reactivity in individuals with type 2 diabetes
Diabetologia
2005
, vol. 
48
 (pg. 
113
-
122
)
11
Ceriello
 
A.
Cavarape
 
A.
Martinelli
 
L.
, et al 
The post-prandial state in type 2 diabetes and endothelial dysfunction: effects of insulin as part
Diabetic Med.
2004
, vol. 
21
 (pg. 
171
-
175
)
12
Tsai
 
W.-C.
Li
 
Y.-H.
Lin
 
C.-C.
Chao
 
T.-H.
Chen
 
J.-Y.
 
Effects of oxidative stress on endothelial function after a high-fat meal
Clin. Sci.
2004
, vol. 
106
 (pg. 
315
-
319
)
13
Heitzer
 
T.
Schlinzig
 
T.
Krohn
 
K.
Meinertz
 
T.
Münzel
 
T.
 
Endothelial dysfunction, oxidative stress, and risk of cardiovascular events in patients with coronary artery disease
Circulation
2001
, vol. 
104
 (pg. 
2673
-
3678
)
14
Yuokoyama
 
M.
Inoue
 
N.
 
How vascular NAD(P)H oxidase activity and Nox isoform expression are regulated
Arterioscler. Thromb. Vasc. Biol.
2004
, vol. 
24
 (pg. 
1540
-
1541
)
15
Wang
 
H. H.
Hung
 
T. M.
Wei
 
J.
Chiang
 
A. N.
 
Fish oil increases antioxidant enzyme activities in macrophages and reduces atherosclerotic lesions in apoE-knockout mice
Cardiovasc. Res.
2004
, vol. 
61
 (pg. 
169
-
176
)
16
Ramsey
 
J. E.
Ferrell
 
W. R.
Greer
 
I. A.
Sattar
 
N.
 
Factors critical to iontophoretic assessment of vascular reactivity: implications for clinical studies in endothelial function
J. Cardiovasc. Pharmacol.
2002
, vol. 
9
 (pg. 
9
-
17
)
17
Ferrell
 
W. R.
Ramsey
 
J. E.
Brooks
 
N.
, et al 
Elimination of electrically induced iontophoretic artifacts: implications of non-invasive assessment of peripheral microvascular function
J. Vasc. Res.
2002
, vol. 
39
 (pg. 
447
-
455
)
18
Karpe
 
F.
Hamsten
 
A.
 
Determination of apolipoproteins B-48 and B-100 in triglyceride-rich lipoproteins by analytical SDS-PAGE
J. Lipid Res.
1994
, vol. 
35
 (pg. 
1311
-
1317
)
19
Jackson
 
K. G.
Maitin
 
V.
Leake
 
D. S.
Yaqoob
 
P.
Williams
 
C. M.
 
Saturated fat induced changes in Sf 60–400 particle composition reduces uptake of LDL by HepG2 cells
J. Lipid Res.
2006
, vol. 
47
 (pg. 
393
-
403
)
20
Miyomoto
 
Y.
Saito
 
Y.
Kajiyama
 
N.
, et al 
Endothelial nitric oxide synthase gene is positively associated with essential hypertension
Hypertension
1998
, vol. 
32
 (pg. 
3
-
8
)
21
Spencer
 
J. P. E.
Rice-Evans
 
C.
Williams
 
R. J.
 
Modulation of the pro-survival Akt/protein kinase B and ERK1/2 signalling cascades by quercetin and its in vivo metabolites underlie their action on neuronal viability
J. Biol. Chem.
2003
, vol. 
278
 (pg. 
34783
-
34793.
)
22
Wang
 
P. G.
Xian
 
M.
Tang
 
X.
, et al 
Nitric oxide donors: chemical activities and biological applications
Chem. Rev.
2002
, vol. 
102
 (pg. 
1091
-
1134.
)
23
Chin
 
J. P.
Dart
 
A. M.
 
How do fish oils affect vascular function?
Clin. Exp. Pharmacol. Physiol.
1995
, vol. 
22
 (pg. 
71
-
81.
)
24
Engler
 
M. B.
Ma
 
Y. H.
Engler
 
M. M.
 
Calcium-mediated mechanisms of eicosapentaenoic acid-induced relaxation in the hypertensive rat aorta
Am. J. Hyperten.
1999
, vol. 
12
 (pg. 
1225
-
1235.
)
25
Casey
 
D. P.
Beck
 
D. T.
Braith
 
R. W.
 
Systemic plasma levels of nitrite/nitrate (NOx) reflect brachial flow-mediated dilatation response in young men and women
Clin. Exp. Pharmacol. Physiol.
2007
, vol. 
34
 (pg. 
1291
-
1293.
)
26
Harris
 
W. S.
Rambjør
 
G. S.
Windsor
 
S. L.
Diederich
 
D.
 
n-3 fatty acids and urinary excretion of nitric oxide metabolites in humans
Am. J. Clin. Nutr.
1997
, vol. 
65
 (pg. 
459
-
464
)
27
Food Standards Agency
 
McCance and Widdowson's The Composition of Foods
2002
6th summary edn
Cambridge
Royal Society of Chemistry