In non-neuronal contexts, ACh (acetylcholine) is thought to be involved in the regulation of vital cell functions, such as proliferation, differentiation, apoptosis and cell–cell interaction. In airways, most cells express the non-neuronal cholinergic system, each containing a specific set of components required for synthesis, signal transduction and ACh hydrolysis. The aim of the present study was determine the expression of cholinergic system components in bronchial aspirates from control subjects and patients with lung cancer. We conducted an analysis of cholinergic components in the stored soluble and cellular fraction of bronchial aspirates from non-cancerous patients and patients diagnosed with lung cancer. The results show that the fluid secreted by human lung cells contains enough AChE (acetylcholinesterase) activity to control ACh levels. Thus these findings demonstrate that: (i) AChE activity is significantly lower in aspirates from squamous cell carcinomas; (ii) the molecular distribution of AChE in both bronchial cells and fluids consisted of amphiphilic monomers and dimers; and (iii) choline acetyltransferase, nicotinic receptors and cholinesterases are expressed in cultured human lung cells, as demonstrated by RT–PCR (reverse transcriptase–PCR). It appears that the non-neuronal cholinergic system is involved in lung physiology and lung cancer. The physiological consequences of the presence of non-neuronal ACh will depend on the particular cholinergic signalling network in each cell type. Clarifying the pathophysiological actions of ACh remains an essential task and warrants further investigation.

INTRODUCTION

As a neurotransmitter, ACh (acetylcholine) plays pivotal roles in both the central and peripheral nervous systems. ACh is also a signalling molecule in the lung (for reviews see [1,2], and also below). Thus ACh plays two different biological roles, acting as a classical neurotransmitter (neuronal) and as a cytomolecule (non-neuronal). The presence of cholinergic components in epithelial cells (intestine, skin and urogenital tract), and mesothelial, endothelial, muscle and immune cell tissues points to the existence of a cholinergic phenotype, modulating basic cell functions, such as gene expression, proliferation, differentiation, cellular adhesion, migration, secretion and absorption.

Multiple studies have established that human lung cells express the non-neuronal cholinergic system (reviewed in [3]), i.e. the synthesizing enzyme ChAT (choline acetyltransferase) [35], nAChR and mAChR (nicotinic and muscarinic ACh receptors respectively) [611], as well as enzymes for ACh hydrolysis AChE (acetylcholinesterase) and BChE (butyrylcholinesterase) [12,13].

In the lung, the role of ACh as an autocrine/paracrine signalling molecule is not yet generally accepted, despite many findings showing that lung cells synthesize the cholinergic components [14]. Importantly, the case for non-neuronal autocrine signalling has also been reported in lung cancers [6,15,16]. The fact that nicotine regulates cellular proliferation by activation of Akt [17] or by β-arrestin-mediated activation of Src and Rb (retinoblastoma)/Raf-1 pathways [18], at the same time as blocking apoptosis [16,19], provides strong evidence that stimulation of nAChR and/or mAChR by endogenous ACh or exogenous agonists associated with tobacco consumption could participate actively in the pathogenesis of lung cancer. The biochemical events between ligands and receptors leading to carcinogenesis and tumour progression are not fully understood. Another point of growing interest links the cholinergic system and angiogenic activity in tumours. Nicotine and endogenous cholinergic pathways could mediate endothelial cell growth and angiogenesis [2022].

Increasing evidence has shown that AChE may be involved in pivotal processes of carcinogenesis and tumour progression. Thus, in leukaemia, ovarian carcinoma and tumour cell lines, aberrations in the AChE gene are frequently found (reviewed [2325]). A role of AChE expression during apoptosis has been demonstrated [26,27], and the mechanism underlying AChE up-regulation is mediated by the JNK (c-Jun N-terminal kinase)/c-Jun pathway [28]. Recently, we have shown that post-translational processing of AChE is altered in lung cancer in a cell-type-dependent manner [13].

The aim of the present study was to determine the level of AChE activity, to investigate the pattern of molecular forms and to detect the expression of cholinergic components important in cholinergic signalling. We show that AChE activity was found in bronchial aspirates, and that the differences between lung diseases may have potential diagnostic uses.

MATERIAL AND METHODS

Chemicals

Acetylthiocholine iodide, DTNB [5,5′-dithiobis-(2-nitrobenzoic acid)], iso-OMPA (tetraisopropyl pyrophosphoramide), Brij 96, enzyme markers for sedimentation analysis [bovine liver catalase (11.4 S020,w) and bovine intestine alkaline phosphatase (6.1 S020,w), HRP (horseradish peroxidase)-conjugated monoclonal anti-(goat IgG) antibodies and recombinant human AChE were purchased from Sigma. Goat antisera against the N-terminal peptide of human AChE (N19) was purchased from Santa Cruz Biotechnology. Molecular-mass protein standards were from Invitrogen. For RT–PCR (reverse transcriptase–PCR) assays, mRNA was extracted using a Chemagic mRNA Direct kit (Chemagen). The GenAmp RNA PCR kit (Applied Biosystems) was used for reverse transcription. Other chemicals were of analytical grade.

Patients

We studied 105 patients admitted to the Virgen de la Arrixaca University Hospital in Murcia between 2003 and 2006; in all of whom pulmonary function was affected. Haemolytic bronchial aspirates (n=20) were discarded. A total of 85 samples of bronchioalveolar aspirates from patients without (control; n=49) or with (n=36) lung cancer were studied. Of these, 70 were male and 15 were female, and their ages ranged from 20 to 88 years. The mean age was 62.60 years.

Histological evaluation of the tumours, according to WHO (World Health Organization) criteria, revealed that ten corresponded to AC (adenocarcinoma), 15 to SCC (squamous cell carcinoma) and 11 to SCLC (small-cell lung carcinoma). Staging was assessed according to the TNM classification system (Tumor Node Metastasis Staging System).

All patients gave their consent after being appropriately informed, and the Ethics Committee of the University Hospital Virgen de la Arrixaca reviewed and approved the study.

Cell culture

The human NSCLC (non-SCLC) cell lines NCI-H1264, NCI-H157, A549 and H23, and the human SCLC cell lines DMS-79, NCI-H69, NCI-H187 and N-417 were gifts from Dr L. Montuenga (Department of Histology and Pathology, Schools of Sciences and Medicine, University of Navarra, Navarra, Spain) and Dr M. Sanchez-Cespedes (Lung Cancer Group, Centro Nacional de Investigaciones Oncologicas, Madrid, Spain). The Caco-2 colon cancer cell line was a gift from the Experimental Science Support Service (University of Murcia, Murcia, Spain). The human breast cancer cell line MCF-7 and human melanoma SK-MEL-28 were purchased from the A.T.C.C. Cell lines were maintained in RPMI medium supplemented with 10% (v/v) fetal bovine serum, 2 mmol/l L-glutamine, 100 units/ml penicillin and 100 μg/ml streptomycin at 37 °C in an atmosphere of 5% CO2.

Processing of the samples

Bronchial aspirates were performed by staff physicians in a standard fashion using a 8.0-mm fibre-optic bronchoscope. Subjects were given local anaesthesia using 4% lidocaine sprayed in the oropharynx and 1% lidocaine instilled over the vocal cords, carina and bronchus. The bronchial aspirates were centrifuged at 462 g for 10 min at 4 °C to pellet the cells. All fractions were rapidly frozen at −80 °C until required. Serum from patients was obtained by drawing whole blood using standard procedures on the same day before the collection of bronchial aspirates.

Cytological examination of the cellular fraction of bronchial aspirates was performed by the pathologists and only cases with unequivocal malignant features allowing tumour typing were considered. Cellular fractions of bronchial aspirates were found to contain ciliated cells in a much greater proportion than squamous cells and macrophages. Both the number of recovered cells and the percentage of viable cells (as estimated by Trypan Blue staining) varied significantly between samples. The number and percentage of cancerous cells in bronchial aspirates from patients with lung cancer ranged from a few cells to several thousand.

Assay of the AChE activity in bronchial aspirates

Recovered bronchial aspirates are variable mixtures of sterile saline solution, ASF (airway surface fluid) and ASF components. Therefore the concentration of recovered molecules in ASF is usually very low because of the saline solution added. Measurement of AChE activity in such samples required a very sensitive methodology. The Ellman method [29] is not sensitive enough to measure AChE activity in such diluted samples. Therefore AChE activity was determined using the ACh/AChE assay kit (Molecular Probes), according to the manufacturer's instructions. AChE activity in bronchial aspirate fractions was measured by adding 0.1 ml of serially diluted samples in duplicate into 96-well microplates. Subsequently, 0.1 ml of the mixture reaction [50 mmol/l Tris/HCl (pH 7.5), 0.2 mol/l Amplex Red reagent, 2 units/ml HRP and 0.2 unit/ml choline oxidase] was added. Reactions were measured using an excitation wavelength of 530 nm and an emission wavelength of 590 nm for 30 min at multiple time points to follow the enzyme kinetics. A standard curve [0–20 m-units/ml of AChE from electric eel (included with the assay kit)] was used in each experiment. One unit of AChE activity represents the hydrolysis of 1 μmol of substrate/min at 37 °C.

Standardization of AChE activity in bronchial aspirates with urea

It is difficult to estimate the actual concentration of recovered molecules in ASF in situ because, when the saline solution is recovered by aspiration, ASF and its components are recovered along with it. The degree to which the process of collecting bronchial aspirates dilutes the ASF was determined using urea as a marker of dilution [30]. Serum and ASF urea concentrations were determined using the kinetic UV assay for urea (Roche Diagnostic), according to the manufacturer's instructions, in a microplate spectrophotometer (Biotek Instrument) and using a standard curve (0–20 mg/dl urea). The following formula was used:

 
formula

Solubilization of AChE from lung epithelial and cultured cells

AChE was extracted from the airway cells by homogenization in 0.5 ml of TBS [Tris-buffered saline; 10 mmol/l Tris/HCl (pH 7.5), 1 mol/l NaCl and 50 mmol/l MgCl2] supplemented with 0.25% Brij 96. After centrifugation at 37500 g for 30 min at 4 °C in a TLA rotor (Beckman), the supernatant containing the soluble and membrane-bound AChE molecules was recovered and stored at −80 °C until use. AChE activity in supernatants was measured by the Ellman method [29]. AChE was assayed with 1 mmol/l acetylthiocholine and 100 μmol/l iso-OMPA (an inhibitor of BChE), and 1 unit of AChE activity represents the hydrolysis of 1 μmol of substrate/min at 37 °C. The hydrolysis of substrate due to non-specific esterases was negligible.

The amount of protein was determined by the Bradford method [31] with BSA as the standard.

Sedimentation analysis

The molecular distribution of AChE in both bronchial cells and fluids was studied by sedimentation analysis in sucrose continuous gradients, as described previously [13]. Briefly, samples and sedimentation markers (bovine liver catalase and intestine alkaline phosphatase) were layered on the top of centrifuge tubes containing 5–20% sucrose gradients, in the presence of 0.5% Brij 96 detergent. The gradient tubes were centrifuged at 35000 rev./min for 18 h at 4 °C in a SW41Ti rotor (Beckman). After centrifugation, fractions of 250 μl were collected from the bottom of the tube and assayed for AChE activity and enzyme markers to obtain the sedimentation profiles.

RT–PCR

The expression of the components of the cholinergic system, such as ChAT, the enzyme that synthesizes ACh, AChE, the enzyme that hydrolyses it, and nAChR subunits, was studied by RT–PCR. mRNA was extracted from cultured human tumour cells using the Chemagic mRNA Direct kit (Chemagen) and reversed-transcribed into cDNA by random priming using the GeneAmp RNA PCR kit (Applied Biosystems). Subsequently, 2–5 μl of cDNA was amplified by 40 cycles of PCR (10 s at 95 °C, 10 s at 55–60 °C, 15 s at 72 °C) on a LightCycler (Roche) using the primer pairs listed in Table 1. Negative controls (without reverse transcriptase) for each primer pair were assayed. The primer pairs employed to detect the mRNA of the cholinergic components are listed in Table 1, where the strategy (intron-spanning/intron-flanking) employed is indicated. β-Actin mRNA was used as an internal control. The PCR products were visualized by electrophoresis on 1.5% (w/v) agarose gels.

Table 1
Primers used for RT–PCR

*Intron-spanning; †Intron-flanking. AChE E1d, N-terminus-extended AChE.

GenePrimerLength (bp)
AChE variant T   
 Forward 5′ AACTTTGCCCGCACAGGGGA 203* 
 Reverse 5′ GCCTCGTCGAGCGTGTCGGT  
AChE variant H   
 Forward 5′ AACTTTGCCCGCACAGGGGA 201* 
 Reverse 5′ GGGAGCCTCCGAGGCGGT  
AChE variant R   
 Forward 5′ CCCCTGGACCCCTCTCGAAAC 315† 
 Reverse 5′ ACCTGGCGGGCTCCCACTC  
AChE E1d   
 Forward 5′ CCTGGTGACGAAAGTCCGA 247† 
 Reverse 5′ TCCTCCACCCAGGAGCCAGAG  
BChE   
 Forward 5′ TGTCTTTGGTTTACCTCTGGAA 297† 
 Reverse 5′ CACTCCCATTCTGCTTCATC  
ChAT   
 Forward 5′ TAGCCAGGTGCCCACAAC 177* 
 Reverse 5′ ATGAGGCTTTCTTCCACAGC  
nAChR α7 subunit   
 Forward 5′ CAGTACTTCGCCAGCACCAT 283† 
 Reverse 5′ AGCCGATGTACAGCAGGTTC  
nAChR α3 subunit   
 Forward 5′ GAAGCCAAAGAGATTCAAGATG 114* 
 Reverse 5′ TTGCAGAAACAATCCTGCTG  
nAChR β4 subunit   
 Forward 5′ GACCAGAGTGTCGTTGAGGA 110* 
 Reverse 5′ GGTAGGAAGAGCCCCACAGT  
β-Actin   
 Forward 5′ AGAAAATCTGGCACCACACC 143† 
 Reverse 5′ GGGGTGTTGAAGGTCTCAAA  
GenePrimerLength (bp)
AChE variant T   
 Forward 5′ AACTTTGCCCGCACAGGGGA 203* 
 Reverse 5′ GCCTCGTCGAGCGTGTCGGT  
AChE variant H   
 Forward 5′ AACTTTGCCCGCACAGGGGA 201* 
 Reverse 5′ GGGAGCCTCCGAGGCGGT  
AChE variant R   
 Forward 5′ CCCCTGGACCCCTCTCGAAAC 315† 
 Reverse 5′ ACCTGGCGGGCTCCCACTC  
AChE E1d   
 Forward 5′ CCTGGTGACGAAAGTCCGA 247† 
 Reverse 5′ TCCTCCACCCAGGAGCCAGAG  
BChE   
 Forward 5′ TGTCTTTGGTTTACCTCTGGAA 297† 
 Reverse 5′ CACTCCCATTCTGCTTCATC  
ChAT   
 Forward 5′ TAGCCAGGTGCCCACAAC 177* 
 Reverse 5′ ATGAGGCTTTCTTCCACAGC  
nAChR α7 subunit   
 Forward 5′ CAGTACTTCGCCAGCACCAT 283† 
 Reverse 5′ AGCCGATGTACAGCAGGTTC  
nAChR α3 subunit   
 Forward 5′ GAAGCCAAAGAGATTCAAGATG 114* 
 Reverse 5′ TTGCAGAAACAATCCTGCTG  
nAChR β4 subunit   
 Forward 5′ GACCAGAGTGTCGTTGAGGA 110* 
 Reverse 5′ GGTAGGAAGAGCCCCACAGT  
β-Actin   
 Forward 5′ AGAAAATCTGGCACCACACC 143† 
 Reverse 5′ GGGGTGTTGAAGGTCTCAAA  

Western blotting

AChE subunits from both ASF and bronchial cells were resolved by reductive SDS/PAGE [32] on 12.5% (w/v) polyacrylamide gels. Proteins were electrotransferred on to PVDF membranes. The membranes were blocked with 5% (w/v) non-fat dried milk in TBS containing 0.1% Tween 20 and then incubated with the anti-AChE antisera (N19; Santa Cruz Biotechnology). As N19 antibodies are produced against the N-terminal peptide of human AChE, it should react with the full set of AChE variants. No bands were obtained in negative control samples (without primary antibody N19) thus verifying that the protein bands corresponded with proteins specifically recognized by the primary antibody. Labelled proteins were revealed with HRP-conjugated anti-(goat IgG) antibodies and the ECL® Western blotting detection system (GE Healthcare). Blots were exposed to Hyperfilm-ECL® (GE Healthcare) for various periods of time. The molecular mass of the AChE subunits was estimated using appropriate protein standards (ECL® DualVue; GE Healthcare), and the intensity of the protein bands was quantified using GelPro Analyzer Software (version 3.1; Media Cybernetic). β-Actin was used as a loading control, and recombinant AChE (1, 5 or 10 μg) was used as a positive control (see Figure 2).

Statistical analysis

The results are given as means±S.E.M. The statistical significance of the difference in ACh content and AChE activity between the cancerous and non-cancerous groups was evaluated using a Student's t test. The non-parametric Mann–Witney U test (signed rank test at P<0.05) was used to compare AChE between the several histological types of lung cancer. Statistical analysis was performed using the SPSS software program (version 10 for Windows; SPSS).

RESULTS

AChE activity in ASF from patients without and with cancer

ASF obtained from the patients contained AChE activity. The AChE activity in non-cancerous samples was 1.34±0.17 m-units/ml and decreased to 1.18±0.18 m-units/ml in tumoral bronchial aspirates (Table 2A). Significantly different levels of AChE activity were detected in bronchial aspirates from patients diagnosed with SCLC, AC and SCC (Table 2B). We have reported previously that AChE activity varied according to the histological classification of lung tumours [12]. In accordance with these previous findings, AChE activity in ASF from patients with SCC were greatly reduced compared with the activity in patients with AC. No significant differences were observed in the AChE activity of ASF from patients with a smoking habit, COPD (chronic obstructive pulmonary disease), bronchitis or pneumonia.

Table 2
AChE activity in ASF of bronchial aspirates

Values are means±S.E.M., with medians (first–third quartile). *The statistical difference between AChE activity in non-cancerous and cancerous samples was evaluated by Student's t test. The non-parametric Mann–Witney U test was used to determine statistical significance (P<0.05) according to histology of lung cancer. COPD, chronic obstructive pulmonary disease.

(A)
DiagnosisAChE (m-units/ml)n
Non-cancerous 1.34±0.17 [0.542 (1.111–2.082)] 37 
Cancerous 1.18±0.18 [0.249 (0.853–1.807] 35 
AC 2.17±0.44 [1.270 (2.626–3.013)] 
SCC 0.51±0.23 [0.274 (0.225–0.662)] 10 
SCLC 0.91±0.24 [0.270 (0.876–1.485)] 
COPD 0.93±0.47 [0.201 (0.529–1.613)] 
Bronchitis 0.56±0.13 [0.225 (0.392–0.898)] 
Pneumonia 0.66±0.27 [0.191 (0.558–1.222)] 
Smoking 0.92±0.18 [0.175 (0.629–1.490)] 25 
(B)
ComparisonP value
Non-cancerous compared with cancerous  0.434* 
Non-cancerous compared with AC  0.038 
Non-cancerous compared with SCC  0.007 
Non-cancerous compared with SCLC  0.431 
AC compared with SCC  0.012 
AC compared with SCLC  0.053 
SCC compared with SCLC  0.133 
COPD compared with non-COPD  0.616 
Bronchitis compared with non-bronchitis  0.143 
Pneumonia compared with non-pneumonia  0.607 
Smoking compared with non-smoking  0.924 
(A)
DiagnosisAChE (m-units/ml)n
Non-cancerous 1.34±0.17 [0.542 (1.111–2.082)] 37 
Cancerous 1.18±0.18 [0.249 (0.853–1.807] 35 
AC 2.17±0.44 [1.270 (2.626–3.013)] 
SCC 0.51±0.23 [0.274 (0.225–0.662)] 10 
SCLC 0.91±0.24 [0.270 (0.876–1.485)] 
COPD 0.93±0.47 [0.201 (0.529–1.613)] 
Bronchitis 0.56±0.13 [0.225 (0.392–0.898)] 
Pneumonia 0.66±0.27 [0.191 (0.558–1.222)] 
Smoking 0.92±0.18 [0.175 (0.629–1.490)] 25 
(B)
ComparisonP value
Non-cancerous compared with cancerous  0.434* 
Non-cancerous compared with AC  0.038 
Non-cancerous compared with SCC  0.007 
Non-cancerous compared with SCLC  0.431 
AC compared with SCC  0.012 
AC compared with SCLC  0.053 
SCC compared with SCLC  0.133 
COPD compared with non-COPD  0.616 
Bronchitis compared with non-bronchitis  0.143 
Pneumonia compared with non-pneumonia  0.607 
Smoking compared with non-smoking  0.924 

AChE molecules in bronchial aspirates

The pattern of molecular forms of AChE in both soluble and cellular fractions of bronchial aspirates was investigated by sedimentation analysis (Figure 1). Abundant 4.4±0.2 S and less 5.9±0.2 S and 2.8±0.1 S AChE forms were identified (Figure 1). These molecular forms corresponded to dimeric (G2A; 4.5 S) and monomeric (G1A; 2.8 S) amphiphilic AChE molecules, whereas the 5.9 S molecules were assigned to hydrophilic dimers of AChE (G2H). All of the samples included in the present study had a similar pattern of AChE forms, indicating that, whatever the pulmonary diseases are, they do not affect the biosynthesis and/or secretion of AChE molecules. Sedimentation analysis of cellular extracts from cultured cancer cells of epithelial origin, such as lung (A549, H157, N417 and H69 cells), breast (MCF-7 cells) or colon (Caco-2 cells), had almost identical AChE molecular compositions. Tetrameric globular forms (G4) were only detected in SCLC cells and their contribution was always scarce (Figure 1B).

Sedimentation profiles of AChE in bronchial aspirates and cultured lung cells
Figure 1
Sedimentation profiles of AChE in bronchial aspirates and cultured lung cells

(A) AChE in the soluble (ASF) and cellular (Cells) fraction of bronchial aspirates was identified by sedimentation analysis in sucrose gradients (5–20%) containing Brij 96. Sedimentation coefficients were calculated by taking internal sedimentation markers [C, catalase (11.4S); P, alkaline phosphatase (6.1S)] as the reference. The Figure shows a profile corresponding to a cancerous ASF and cellular fraction. No differences between non-cancerous and cancerous samples were observed. (B) Enzymatic extracts from NSCLC (A549 and H157), SCLC (N417 and H69), breast cancer (MCF7) and colonic cancer (Caco-2) cells were fractionated by sucrose gradient centrifugation as described above. Amphiphilic globular AChE dimers (G2A) and monomers (G1A) appear in all samples, but globular tetramers (G4) are restricted to cells that grow unattached to the culture plate. AChE activity is expressed in arbitrary units.

Figure 1
Sedimentation profiles of AChE in bronchial aspirates and cultured lung cells

(A) AChE in the soluble (ASF) and cellular (Cells) fraction of bronchial aspirates was identified by sedimentation analysis in sucrose gradients (5–20%) containing Brij 96. Sedimentation coefficients were calculated by taking internal sedimentation markers [C, catalase (11.4S); P, alkaline phosphatase (6.1S)] as the reference. The Figure shows a profile corresponding to a cancerous ASF and cellular fraction. No differences between non-cancerous and cancerous samples were observed. (B) Enzymatic extracts from NSCLC (A549 and H157), SCLC (N417 and H69), breast cancer (MCF7) and colonic cancer (Caco-2) cells were fractionated by sucrose gradient centrifugation as described above. Amphiphilic globular AChE dimers (G2A) and monomers (G1A) appear in all samples, but globular tetramers (G4) are restricted to cells that grow unattached to the culture plate. AChE activity is expressed in arbitrary units.

Detection of AChE proteins in bronchial aspirates by Western blotting

We have reported previously that lung cancer tissues express AChE molecules capable of hydrolysing ACh and also molecules with the same apparent molecular mass but that are not catalytically active [11]. To gain an insight into the differences in the size as well as the content of inactive AChE molecules, immunoblots of both soluble and cellular fractions of bronchial aspirates were used. For this, samples were subjected to reductive SDS/PAGE, transferred on to PVDF membranes and then incubated with antibodies able to detect all AChE molecules. Abundant 50 kDa and less 70 kDa subunits were dectected (Figure 2). As in lung tissues [13], no correlation was found between the AChE units loaded and the labelling intensity of bands, demonstrating the presence of inactive AChE molecules in ASF. The potential use of the AChE units/intensity of labelling ratio (i.e. the relative content of inactive AChE) as a diagnostic tool is under investigation.

Immunoblotting of AChE protein in ASF

Figure 2
Immunoblotting of AChE protein in ASF

Proteins (50 μg) in non-tumoral (NT), AC (A), SCC (S) and SCLC ASF were resolved by reductive SDS/PAGE, as described in the Material and methods section. N19 antibodies recognize the complete set of AChE variants. According to previous findings [13], the labelled bands were assigned to the synaptic AChE (variant T; 68 kDa) and to the read-through AChE-R (50 kDa). Note the weaker labelling of the catalytically active AChE subunit (68 kDa) in SCC (S) and the stronger labelling of the 50 kDa protein band in tumoral ASF. The right-hand panel shows the correlation between AChE activity loaded and the intensity of labelling.

Figure 2
Immunoblotting of AChE protein in ASF

Proteins (50 μg) in non-tumoral (NT), AC (A), SCC (S) and SCLC ASF were resolved by reductive SDS/PAGE, as described in the Material and methods section. N19 antibodies recognize the complete set of AChE variants. According to previous findings [13], the labelled bands were assigned to the synaptic AChE (variant T; 68 kDa) and to the read-through AChE-R (50 kDa). Note the weaker labelling of the catalytically active AChE subunit (68 kDa) in SCC (S) and the stronger labelling of the 50 kDa protein band in tumoral ASF. The right-hand panel shows the correlation between AChE activity loaded and the intensity of labelling.

mRNA expression of cholinergic components in the lung

The role of autocrine growth factors in lung cancer growth has been well-established [6]. Analysis of human lung cancer cell lines by RT–PCR showed the expression of mRNA of ChAT, nAChR subunits and AChE and BChE (Figure 3). All of the cell lines analysed expressed ChAT, AChE and BChE, enzymes required for the synthesis and degradation of ACh. The β4 nAChR subunit was present in all lung cell lines, except H157, H187 and N417 cells. SK-MEL-28 but not MCF7 cells expressed the β4 nAChR subunit. Meanwhile, α7 and α3 nAChR subunit mRNAs were detected in all cell lines. The expression of mRNA coding for the cholinergic components did not indicate any specific pattern either associated with the tissue origin or to the histology of the tumours from which the cell lines are derived.

Expression of cholinergic components in cultured cancer cells

Figure 3
Expression of cholinergic components in cultured cancer cells

mRNA was prepared and RT–PCR was performed for the given cell lines with the primers shown in Table 1. AChE T, AChE variant T; AChE H, AChE variant H; E1d, N-terminus-extended AChE; α3, nAChR α3 subunit;. α7, nAChR α7 subunit; β4, nAChR β4 subunit. No products were detected when RT–PCR was performed in the absence of reverse transcriptase (results not shown).

Figure 3
Expression of cholinergic components in cultured cancer cells

mRNA was prepared and RT–PCR was performed for the given cell lines with the primers shown in Table 1. AChE T, AChE variant T; AChE H, AChE variant H; E1d, N-terminus-extended AChE; α3, nAChR α3 subunit;. α7, nAChR α7 subunit; β4, nAChR β4 subunit. No products were detected when RT–PCR was performed in the absence of reverse transcriptase (results not shown).

DISCUSSION

The results of the present study show that human lung epithelium expresses the components for establishing a physiologically active cholinergic system, possibly needed for correct pulmonary function and involved in cancer growth. The present study shows that: (i) ASF contains enough AChE activity to control the effective levels of the neurotransmitter and/or its degradation product choline; (ii) AChE activity varies according to the histological type of the lung tumour, being highest in ASF from lung ACs and lowest in SCLCs; (iii) the pattern of molecular forms of AChE do not change with cancer; (iv) inactive AChE molecules are present in bronchial aspirates, as in lung tissues, increasing their content in cancerous samples and having histological-type differences; and (v) both SCLC and NSCLC cells express the genes needed for a cholinergic autocrine or paracrine loop.

It has been clearly demonstrated that nicotine and other tobacco components increase the proliferation of non-cancerous and cancerous human lung cell lines [6,18,33,34], at the same time as ACh or carbachol also modulated the proliferation of lung cells [6,35]. By using agonists or antagonists of nAChR and mAChR, the growth of lung cells, and other cell lines, is affected (for reviews see [15,36,37]). It becomes evident that cholinergic signalling can modulate the cellular phenotype and function. Furthermore, it appears likely that nicotine plays its pathological role through direct interaction with cholinergic receptors [18,20,37]. Previous studies elucidating the events implicated in these receptor-dependent responses [6,17,3639] are important not only for tobacco-consumption-associated cancer, but also for lung tumours, such as AC, that have a weaker correlation with smoking than SCC and SCLC.

According to RT–PCR, our results are consistent with others showing that lung cells express the mRNAs needed for establishing functional cholinergic systems in both SCLC and NSCLC cells (reviewed [1,2]). Nevertheless, as far as we know, there is no association between particular cholinergic gene expression patterns and the pathogenesis of lung cancer. A very interesting study by Minna and co-workers [40] shows that tobacco consumption could change the composition of mAChRs on bronchial epithelial cells. It remains to be seen whether these changes are important for the pathogenesis of lung cancers, but they clearly indicate the existence of particular nAChR subunit gene expression patterns which change upon several physiological conditions. As ACh levels could also change with other pathologies, for example in response to inflammatory processes [1,41], the same pathways that are involved in nicotine-associated lung cancer progression could also play a role in the biology of lung cancer not linked to tobacco consumption.

Our present results show that ASF contains an important amount of AChE activity, which varies depending on the histology of the lung carcinoma (Table 2). AChE activity in ASF was higher than the control in AC, and lower in SCLC and SCC. We have shown previously that surgical fragments from SCC have considerably less AChE activity than non-cancerous and AC samples [13]. It is interesting that ASF from smoking-associated lung cancers, such as SCC and SCLC, contains less AChE activity than that from controls or AC. The actual role of AChE activity in cancer is controversial. Cancer promotes changes affecting both AChE gene structure and expression [42,43] and the properties of the protein [13,4447]. More recently, it has been proposed that AChE plays a role in apoptosis [2628], whereas immunohistochemical staining is inversely associated with survival in ovary cancer [48].

AChE biology is a very complex process and the precise physiological role of this enzyme in non-neuronal contexts is poorly understood. AChE can be found as soluble or membrane-bound subunits, but little is known about its regulation and physiological significance. Whether secretion of AChE molecules into the epithelial lining fluid of the bronchi is a controlled process needed for normal pulmonary function needs to be investigated further. Thus it cannot be assumed, but also it cannot be excluded, that a correlation exists between AChE activity in the fluid of aspirates and in malignant epithelium cells. A correlation between AChE activity in both ASF and surgical fragments in SCCs with a large decrease in the AChE activity was found, whereas no correlation between AChE activity in ASF and surgical fragments derived from ACs was observed. We discussed in our previous study [13] that the heterogeneous cellular origin of lung cancers included in the AC group may mask possible differences, and the same can happen with the results of AChE activity in ASF. It is tempting to speculate that in AC the secretion of active AChE is up-regulated and that this phenomenon affects the biology of the tumour. On the other hand, the differences between AChE activity in ASF from AC and SCLC could be of diagnostic interest.

With regard to the molecular composition of AChE, sedimentation analysis revealed that ASF contains abundant amphiphilic dimers (G2A) and fewer monomers (G1A) (Figure 1), the same pattern as in the cellular fraction of bronchial aspirates. The similarity between the AChE pattern in ASF and the expression by tumours of epithelial origin, such as lung [13], breast and metastatic lymph nodes [44,45] and colon [49], reinforces the idea that human epithelia only express the light forms of AChE as enzymatic active forms. As human serum contains a very small amount of AChE activity and high BChE activity and the opposite is found in ASF, it is also possible that ASF AChE comes from the bronchial epithelium. The pattern of molecular forms of AChE from cultured cancer lung cells also shows that only SCLC cells express AChE tetramers, and this appears to be related to adhesion-independent growth, but not to the histological type.

Immunoblotting results indicate that the same labelled protein bands are found in ASF (Figure 2) and the cellular fraction of bronchial aspirates (results not shown). It is remarkable that ASF contains both inactive AChE molecules, as occurs in lung tissue (50 kDa protein band), and active AChE subunits (approx. 70 kDa). In agreement with our previous study [13], SCC had the lowest content of active subunits (Figure 2, lane S). We have previously assigned the 50 kDa protein band to AChE-R, the stress-induced AChE variant, which is synthesized more abundantly in lung cancer tissues and especially in SCC. Interestingly, Soreq and co-workers [50] found that basal levels of CREB (cAMP-response-element-binding protein) were insufficient to block the proliferative effect of AChE-R in AChE-R-transfected glial cells and they hypothesized that this could increase the risk of tumour growth in individuals exposed to anticholinergic agents. The potential diagnostic use derived from the present study and the physiological significance of cholinesterases in lung cancer warrants further investigation.

Abbreviations

     
  • ACh

    acetylcholine

  •  
  • AChE

    acetylcholinesterase

  •  
  • AChE-R

    stress-induced AChE variant

  •  
  • AC

    adenocarcinoma

  •  
  • ASF

    airway surface fluid

  •  
  • BChE

    butyrylcholinesterase

  •  
  • ChAT

    choline acetyltransferase

  •  
  • HRP

    horseradish peroxidase

  •  
  • iso-OMPA

    tetraisopropyl pyrophosphoramide

  •  
  • mAChR

    muscarinic ACh receptor

  •  
  • nAChR

    nicotinic ACh receptor

  •  
  • RT–PCR

    reverse transcriptase–PCR

  •  
  • SCC

    squamous cell carcinoma

  •  
  • SCLC

    small-cell lung carcinoma

  •  
  • NSCLC

    non-SCLC

  •  
  • TBS

    Tris-buffered saline

This work was supported in part by grants from FIS (Fondo de Investigaciones Sanitarias; Projects 01/3025 and 02/1564), SEPAR (Sociedad Española de Neumología y Cirugia Toracica) and MEC (Ministerio Educación y Cultura; Projects SAF2006-070040-C02-01 and SAF2006-070040-C02-02). S. N.-C. is the recipient of a fellowship from the Ministerio de Sanidad y Consumo and FFIS (Fundación para la Formación e Investigación Sanitarias) Murcia. S. N.-C., J. T.-L., I. T.-Z, P. M.-H. and J. C.-H. belong to RTIC Cancer (Instituto de Salud Carlos III). This paper is in memory of Dr Sanchez Gascón, a great man, friend and physician.

References

References
1
Wessler
 
I. K.
Kirkpatrick
 
C. J.
 
The non-neuronal cholinergic system: an emerging drug target in the airways
Pulm. Pharmacol. Ther.
2001
, vol. 
14
 (pg. 
423
-
434
)
2
Racke
 
K.
Matthiesen
 
S.
 
The airway cholinergic system: physiology and pharmacology
Pulm. Pharmacol. Ther.
2004
, vol. 
17
 (pg. 
181
-
198
)
3
Wessler
 
I.
Kilbinger
 
H.
Bittinger
 
F.
Unger
 
R.
Kirkpatrick
 
C. J.
 
The non-neuronal cholinergic system in humans: expression, function and pathophysiology
Life Sci.
2003
, vol. 
72
 (pg. 
2055
-
2061
)
4
Reinheimer
 
T.
Bernedo
 
P.
Klapproth
 
H.
, et al 
Acetylcholine in isolated airways of rat, guinea pig, and human: species differences in role of airway mucosa
Am. J. Physiol.
1996
, vol. 
270
 (pg. 
L722
-
L728
)
5
Klapproth
 
H.
Reinheimer
 
T.
Metzen
 
J.
, et al 
Non-neuronal acetylcholine, a signalling molecule synthesized by surface cells of rat and man
Naunyn Schmiedebergs Arch. Pharmacol.
1997
, vol. 
355
 (pg. 
515
-
523
)
6
Song
 
P.
Sekhon
 
H. S.
Jia
 
Y.
, et al 
Acetylcholine is synthesized by and acts as an autocrine growth factor for small cell lung carcinoma
Cancer Res.
2003
, vol. 
63
 (pg. 
214
-
221
)
7
Zia
 
S.
Ndoye
 
A.
Nguyen
 
V. T.
Grando
 
S. A.
 
Nicotine enhances expression of the α3, α4, α5, and α7 nicotinic receptors modulating calcium metabolism and regulating adhesion and motility of respiratory epithelial cells
Res. Commun. Mol. Pathol. Pharmacol.
1997
, vol. 
97
 (pg. 
243
-
262
)
8
Maus
 
A. D.
Pereira
 
E. F.
Karachunski
 
P. I.
, et al 
Human and rodent bronchial epithelial cells express functional nicotinic acetylcholine receptors
Mol. Pharmacol.
1998
, vol. 
54
 (pg. 
779
-
788
)
9
Wang
 
Y.
Pereira
 
E. F.
Maus
 
A. D.
, et al 
Human bronchial epithelial and endothelial cells express α7 nicotinic acetylcholine receptors
Mol. Pharmacol.
2001
, vol. 
60
 (pg. 
1201
-
1209
)
10
Sekhon
 
H. S.
Jia
 
Y.
Raab
 
R.
, et al 
Prenatal nicotine increases pulmonary α7 nicotinic receptor expression and alters fetal lung development in monkeys
J. Clin. Invest.
1999
, vol. 
103
 (pg. 
637
-
647
)
11
Williams
 
C. L.
 
Muscarinic signaling in carcinoma cells
Life Sci.
2003
, vol. 
72
 (pg. 
2173
-
2182
)
12
Martinez-Moreno
 
P.
Nieto-Ceron
 
S.
Ruiz-Espejo
 
F.
, et al 
Acetylcholinesterase biogenesis is impaired in lung cancer tissues
Chem. Biol. Interact.
2005
, vol. 
157–158
 (pg. 
359
-
361
)
13
Martinez-Moreno
 
P.
Nieto-Ceron
 
S.
Torres-Lanzas
 
J.
, et al 
Cholinesterase activity of human lung tumours varies according to their histological classification
Carcinogenesis
2006
, vol. 
27
 (pg. 
429
-
436
)
14
Proskocil
 
B. J.
Sekhon
 
H. S.
Jia
 
Y.
, et al 
Acetylcholine is an autocrine or paracrine hormone synthesized and secreted by airway bronchial epithelial cells
Endocrinology
2004
, vol. 
145
 (pg. 
2498
-
2506
)
15
Russo
 
P.
Catassi
 
A.
Cesario
 
A.
Servent
 
D.
 
Development of novel therapeutic strategies for lung cancer: targeting the cholinergic system
Curr. Med. Chem.
2006
, vol. 
13
 (pg. 
3493
-
3512
)
16
Dasgupta
 
P.
Chellappan
 
S. P.
 
Nicotine-mediated cell proliferation and angiogenesis: new twists to an old story
Cell Cycle
2006
, vol. 
5
 (pg. 
2324
-
2328
)
17
West
 
K. A.
Brognard
 
J.
Clark
 
A. S.
, et al 
Rapid Akt activation by nicotine and a tobacco carcinogen modulates the phenotype of normal human airway epithelial cells
J. Clin. Invest.
2003
, vol. 
111
 (pg. 
81
-
90
)
18
Dasgupta
 
P.
Rastogi
 
S.
Pillai
 
S.
, et al 
Nicotine induces cell proliferation by β-arrestin-mediated activation of Src and Rb-Raf-1 pathways
J. Clin. Invest.
2006
, vol. 
116
 (pg. 
2208
-
2217
)
19
Maneckjee
 
R.
Minna
 
J. D.
 
Opioids induce while nicotine suppresses apoptosis in human lung cancer cells
Cell Growth Differ.
1994
, vol. 
5
 (pg. 
1033
-
1040
)
20
Villablanca
 
A. C.
 
Nicotine stimulates DNA synthesis and proliferation in vascular endothelial cells in vitro
J. Appl. Physiol.
1998
, vol. 
84
 (pg. 
2089
-
2098
)
21
Heeschen
 
C.
Jang
 
J. J.
Weis
 
M.
, et al 
Nicotine stimulates angiogenesis and promotes tumor growth and atherosclerosis
Nat. Med.
2001
, vol. 
7
 (pg. 
833
-
839
)
22
Heeschen
 
C.
Weis
 
M.
Aicher
 
A.
Dimmeler
 
S.
Cooke
 
J. P.
 
A novel angiogenic pathway mediated by non-neuronal nicotinic acetylcholine receptors
J. Clin. Invest.
2002
, vol. 
110
 (pg. 
527
-
536
)
23
Greenfield
 
S.
 
Non-classical actions of cholinesterases: role in cellular differentiation, tumorigenesis and Alzheimer's disease
Neurochem. Int.
1996
, vol. 
28
 (pg. 
485
-
490
)
24
Small
 
D. H.
Michaelson
 
S.
Sberna
 
G.
 
Non-classical actions of cholinesterases: role in cellular differentiation, tumorigenesis and Alzheimer's disease
Neurochem. Int.
1996
, vol. 
28
 (pg. 
453
-
483
)
25
Soreq
 
H.
Seidman
 
S.
 
Acetylcholinesterase: new roles for an old actor
Nat. Rev. Neurosci.
2001
, vol. 
2
 (pg. 
294
-
302
)
26
Zhang
 
X. J.
Yang
 
L.
Zhao
 
Q.
, et al 
Induction of acetylcholinesterase expression during apoptosis in various cell types
Cell Death Differ.
2002
, vol. 
9
 (pg. 
790
-
800
)
27
Park
 
S. E.
Kim
 
N. D.
Yoo
 
Y. H.
 
Acetylcholinesterase plays a pivotal role in apoptosome formation
Cancer Res.
2004
, vol. 
64
 (pg. 
2652
-
2655
)
28
Deng
 
R.
Li
 
W.
Guan
 
Z.
, et al 
Acetylcholinesterase expression mediated by c-Jun-NH2-terminal kinase pathway during anticancer drug-induced apoptosis
Oncogene
2006
, vol. 
25
 (pg. 
7070
-
7077
)
29
Ellman
 
G. L.
Courtney
 
K. D.
Andres
 
V.
Feather-Stone
 
R. M.
 
A new and rapid colorimetric determination of acetylcholinesterase activity
Biochem. Pharmacol.
1961
, vol. 
7
 (pg. 
88
-
95
)
30
Rennard
 
S. I.
Basset
 
G.
Lecossier
 
D.
, et al 
Estimation of volume of epithelial lining fluid recovered by lavage using urea as marker of dilution
J. Appl. Physiol.
1986
, vol. 
60
 (pg. 
532
-
538
)
31
Bradford
 
M. M.
 
A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding
Anal. Biochem.
1976
, vol. 
72
 (pg. 
248
-
254
)
32
Laemmli
 
U. K.
 
Cleavage of structural proteins during the assembly of the head of bacteriophage T4
Nature
1970
, vol. 
227
 (pg. 
680
-
685
)
33
Cattaneo
 
M. G.
D'atri
 
F.
Vicentini
 
L. M.
 
Mechanisms of mitogen-activated protein kinase activation by nicotine in small-cell lung carcinoma cells
Biochem. J.
1997
, vol. 
328
 (pg. 
499
-
503
)
34
Novak
 
J.
Escobedo-Morse
 
A.
Kelley
 
K.
, et al 
Nicotine effects on proliferation and the bombesin-like peptide autocrine system in human small cell lung carcinoma SHP77 cells in culture
Lung Cancer
2000
, vol. 
29
 (pg. 
1
-
10
)
35
Song
 
P.
Sekhon
 
H. S.
Proskocil
 
B.
Blusztajn
 
J. K.
Mark
 
G. P.
Spindel
 
E. R.
 
Synthesis of acetylcholine by lung cancer
Life Sci.
2003
, vol. 
72
 (pg. 
2159
-
2168
)
36
Tsurutani
 
J.
Castillo
 
S. S.
Brognard
 
J.
, et al 
Tobacco components stimulate Akt-dependent proliferation and NFκB-dependent survival in lung cancer cells
Carcinogenesis
2005
, vol. 
26
 (pg. 
1182
-
1195
)
37
Carlisle
 
D. L.
Liu
 
X.
Hopkins
 
T. M.
Swick
 
M. C.
Dhir
 
R.
Siegfried
 
J. M.
 
Nicotine activates cell-signaling pathways through muscle-type and neuronal nicotinic acetylcholine receptors in non-small cell lung cancer cells
Pulm. Pharmacol. Ther.
2007
, vol. 
20
 (pg. 
629
-
641
)
38
Trombino
 
S.
Bisio
 
A.
Catassi
 
A.
Cesario
 
A.
Falugi
 
C.
Russo
 
P.
 
Role of the non-neuronal human cholinergic system in lung cancer and mesothelioma: possibility of new therapeutic strategies
Curr. Med. Chem. Anticancer Agents
2004
, vol. 
4
 (pg. 
535
-
542
)
39
Dasgupta
 
P.
Kinkade
 
R.
Joshi
 
B.
Decook
 
C.
Haura
 
E.
Chellappan
 
S.
 
Nicotine inhibits apoptosis induced by chemotherapeutic drugs by up-regulating XIAP and survivin
Proc. Natl. Acad. Sci. U.S.A.
2006
, vol. 
103
 (pg. 
6332
-
6337
)
40
Lam
 
D. C.
Girard
 
L.
Ramirez
 
R.
, et al 
Expression of nicotinic acetylcholine receptor subunit genes in non-small-cell lung cancer reveals differences between smokers and nonsmokers
Cancer Res.
2007
, vol. 
67
 (pg. 
4638
-
4647
)
41
Racke
 
K.
Juergens
 
U. R.
Matthiesen
 
S.
 
Control by cholinergic mechanisms
Eur. J. Pharmacol.
2006
, vol. 
533
 (pg. 
57
-
68
)
42
Lapidot-Lifson
 
Y.
Prody
 
C. A.
Ginzberg
 
D.
Meytes
 
D.
Zakut
 
H.
Soreq
 
H.
 
Coamplification of human acetylcholinesterase and butyrylcholinesterase genes in blood cells: correlation with various leukemias and abnormal megakaryocytopoiesis
Proc. Natl. Acad. Sci. U.S.A.
1989
, vol. 
86
 (pg. 
4715
-
4719
)
43
Zakut
 
H.
Ehrlich
 
G.
Ayalon
 
A.
, et al 
Acetylcholinesterase and butyrylcholinesterase genes coamplify in primary ovarian carcinomas
J. Clin. Invest.
1990
, vol. 
86
 (pg. 
900
-
908
)
44
Ruiz-Espejo
 
F.
Cabezas-Herrera
 
J.
Illana
 
J.
Campoy
 
F. J.
Vidal
 
C. J.
 
Cholinesterase activity and acetylcholinesterase glycosylation are altered in human breast cancer
Breast Cancer Res. Treat.
2002
, vol. 
72
 (pg. 
11
-
22
)
45
Ruiz-Espejo
 
F.
Cabezas-Herrera
 
J.
Illana
 
J.
Campoy
 
F. J.
Munoz-Delgado
 
E.
Vidal
 
C. J.
 
Breast cancer metastasis alters acetylcholinesterase activity and the composition of enzyme forms in axillary lymph nodes
Breast Cancer Res. Treat.
2003
, vol. 
80
 (pg. 
105
-
114
)
46
Zakut
 
H.
Even
 
L.
Birkenfeld
 
S.
Malinger
 
G.
Zisling
 
R.
Soreq
 
H.
 
Modified properties of serum cholinesterases in primary carcinomas
Cancer
1988
, vol. 
61
 (pg. 
727
-
737
)
47
Perry
 
C.
Soreq
 
H.
 
The leukemic effect of anticholinesterases
Leuk. Res.
2001
, vol. 
25
 (pg. 
1027
-
1028
)
48
Motamed-Khorasani
 
A.
Jurisica
 
I.
Letarte
 
M.
, et al 
Differentially androgen-modulated genes in ovarian epithelial cells from BRCA mutation carriers and control patients predict ovarian cancer survival and disease progression
Oncogene
2007
, vol. 
26
 (pg. 
198
-
214
)
49
Montenegro
 
M. F.
Ruiz-Espejo
 
F.
Campoy
 
F. J.
, et al 
Acetyl- and butyrylcholinesterase activities decrease in human colon adenocarcinoma
J. Mol. Neurosci.
2006
, vol. 
30
 (pg. 
51
-
54
)
50
Perry
 
C.
Sklan
 
E. H.
Soreq
 
H.
 
CREB regulates AChE-R-induced proliferation of human glioblastoma cells
Neoplasia
2004
, vol. 
6
 (pg. 
279
-
286
)

Author notes

1

These authors contributed equally to this work.