PE (pre-eclampsia), a pregnancy-specific disorder, is characterized by increased trophoblast cell death and deficient trophoblast invasion and reduced trophoblast-mediated remodelling of spiral arteries. The present study was performed to determine the function of miR-29b (microRNA-29b) in trophoblast cells and its underlying role in the pathogenesis of PE. The prediction of miR-29b target genes was performed using computer-based programs, including Targetscan, Pictar and miRBase. The function of these target genes was analysed further by gene ontology (GO). The effects of miR-29b on apoptosis, and invasion and angiogenesis of trophoblast cell lines (HTR-8/SVneo, BeWo and JAR) were examined by flow cytometry and Matrigel assay respectively. We found that miR-29b induced apoptosis and inhibited invasion and angiogenesis of trophoblast cells. Further studies confirmed that miR-29b regulated the expression of MCL1 (myeloid cell leukaemia sequence 1), MMP2 (encoding matrix metallproteinase 2), VEGFA (vascular endothelial growth factor A) and ITGB1 (integrin β1) genes by directly binding to their 3′-UTRs (untranslated regions). Moreover, we identified that there was an inverse correlation between miR-29b and its target genes in subjects with PE. Taken together, these findings support a novel role for miR-29b in invasion, apoptosis and angiogenesis of trophoblast cells, and miR-29b may become a new potential therapeutic target for PE.

CLINICAL PERSPECTIVES

  • miR-29b, an miRNA that has a role in the regulation of cell proliferation, differentiation and apoptosis, is differentially expressed in PE, but its role in trophoblast cells and in the pathogenesis of the disease remain unknown.

  • In the present study, we report that the up-regulation of miR-29b in placenta may contribute to the onset of PE through the repression of trophoblast cell invasion and angiogensis, and enhancement of trophoblast cell apoptosis. In addition, its target genes, including MMP2, MCL1, VEGFA and ITGB1, may be involved in these processes.

  • Thus new insights into the involvement of miR-29b in the pathogenesis of PE have been provided and may open a new window for therapeutic intervention in the disease. miR-29b could be employed as a new prognostic marker and/or as an effective therapeutic target for PE.

INTRODUCTION

PE (pre-eclampsia), a pregnancy-specific disorder characterized by hypertension and proteinuria, is a major cause of maternal and fetal morbidity and mortality [1]. Although the aetiology of PE is uncertain, the core hypothesis is that poor trophoblast migration/invasiveness associated with a poor remodelling of the spiral arteries are key pathological features of the disease [24]. In addition, several reports have indicated that a typical hallmark of PE includes increased trophoblast cell apoptosis in the placenta [57]. However, an understanding of the underlying molecular mechanisms that are involved in the invasion and survival of trophoblast cells is still not clear [8].

miRNAs (microRNAs) are non-coding RNAs of approximately 22 nt that act as post-transcriptional regulators of gene expression. They function in diverse biological processes, including development, differentiation, apoptosis and oncogenesis [9]. Previous findings have shown that many miRNAs are abundantly expressed in the human placenta [10]. We and others [1114] have reported that several miRNAs are differentially expressed in placenta tissue from subjects with PE. However, the effects of miRNAs in mediating trophoblast cell function have been addressed sparsely [15,16]. As our group has found the aberrant overexpression of seven miRNAs in subjects with PE (miR-29b, miR-16, miR-195, miR-26b, miR-181a, miR-335 and miR-222) [14], it was necessary to investigate further their potential roles in the pathogenesis of the disease.

Several studies have emphasized the importance of miR-29b in the regulation of cell proliferation, differentiation and apoptosis [1721]. Moreover, levels of miR-29b have been found to be higher in the plasma of smokers [22]. However, there has been no study to date addressing the impact of miR-29b on trophoblast cells, and it has not been determined whether miR-29b may have diagnostic or prognostic values in PE.

The aim of the present study was to elucidate the functional role of miR-29b in trophoblast cells. We therefore examined the apoptosis, proliferation, invasion and angiogenesis of trophoblast cells after overexpression or down-regulation of miR-29b. We also studied its regulatory mechanism during this process and found that several key genes involved in PE were the direct targets of miR-29b. These findings highlight the important role of miR-29b in the pathogenesis of PE and provide new insight into the development of the disease.

MATERIALS AND METHODS

Patients and tissue samples

PE was defined as gestational hypertension (systolic pressure >140 mmHg or diastolic blood pressure >90 mmHg on two or more occasions after gestational week 20) with proteinuria (>0.3g/day). Severe PE was defined by the presence of more than one of the following: (i) severe gestational hypertension (systolic pressure >160 mmHg or diastolic blood pressure >110 mmHg on two or more occasions after gestational week 20), (ii) severe proteinuria (≥5 g of protein in a 24 h urine specimen), (iii) oliguria <500 ml in 24 h, (iv) cerebral or visual disturbances, (v) pulmonary oedema or cyanosis, (vi) epigastric or right upper-quadrant pain, (vii) impaired liver function, (viii) thrombocytopenia or (ix) fetal growth restriction [ACOG (American Congress of Obstetricians and Gynecologists) Practice Bulletin] [23]. We collected data from 24 pregnancies complicated by severe late-onset PE and delivered after 34 weeks, and 26 pregnant women during normal term pregnancy, who were recruited as healthy controls. The detailed clinical characteristics of the subjects is summarized in Table 1. For the control group, women with chronic hypertension, cardiovascular disease, renal disease, hepatitis, diabetes, any evidence of intrapartum infection or other pregnancy complications, such as fetal anomalies or chromosomal abnormalities, were excluded from the study.

Table 1
Clinical characteristics of the study population

Values are means±S.E.M. NS, not significant.

Parameter PE (n=24) Control (n=26) P value 
Age (years) 28.1±1.3 28.7±1.1 NS 
Gestational age at delivery (week) 37.0±0.2 38.8±0.4 NS 
Primiparae (n10 (41.6%) 15 (57.6%) NS 
Body mass index (kg/m229.0±1.0 27.2±1.2 NS 
Systolic blood pressure (mmHg) 161.5±4.1 119.6±3.9 <0.05 
Diastolic blood pressure (mmHg) 113.4±2.8 81.7±3.3 <0.05 
Proteinuria (mg/24h) 2209.4±23.6 <0.05 
Alanine aminotransferase (units/l) 33.9±8.6 30.5±6.5 NS 
Blood urea nitrogen (mmol/l) 4.1±0.3 3.8±0.2 NS 
Platelets (n(157.9±22.1)×109 (192.0±31.4)×109 NS 
Birth weight (g) 2835.6±173.0 3415.3±158.3 NS 
Placenta weight (g) 485.8±25.6 526.3±28.4 NS 
Parameter PE (n=24) Control (n=26) P value 
Age (years) 28.1±1.3 28.7±1.1 NS 
Gestational age at delivery (week) 37.0±0.2 38.8±0.4 NS 
Primiparae (n10 (41.6%) 15 (57.6%) NS 
Body mass index (kg/m229.0±1.0 27.2±1.2 NS 
Systolic blood pressure (mmHg) 161.5±4.1 119.6±3.9 <0.05 
Diastolic blood pressure (mmHg) 113.4±2.8 81.7±3.3 <0.05 
Proteinuria (mg/24h) 2209.4±23.6 <0.05 
Alanine aminotransferase (units/l) 33.9±8.6 30.5±6.5 NS 
Blood urea nitrogen (mmol/l) 4.1±0.3 3.8±0.2 NS 
Platelets (n(157.9±22.1)×109 (192.0±31.4)×109 NS 
Birth weight (g) 2835.6±173.0 3415.3±158.3 NS 
Placenta weight (g) 485.8±25.6 526.3±28.4 NS 

Placental tissues were obtained from women who were hospitalized in the Department of Gynecology and Obstetrics of Nanjing Drum Tower Hospital and the Affiliated Hospital of Nanjing University Medical School. Written consent was received from women after a full explanation of the purpose, nature and risk of all procedures used before surgery. The hospital ethics committee approved the consent forms and the protocols to utilize the tissue.

For the placentas, only chorionic tissue blocks (~1 cm3) from the central part of the placenta were collected, and contamination with maternal decidua and amniotic membranes was excluded by morphological observation. All placental tissues were obtained at the time of Caesarean section, were stabilized in RNAlater (Qiagen) and then stored at −80°C until used.

Cell culture

HTR-8/SVneo cells, an immortalized human trophoblast cell line established from first-trimester human cytotrophoblast cells, were kindly provided by Dr Charles H. Graham (Faculty of Health Sciences, Queen's University, Kingston, Ontario, Canada). Human placental cell line derived from a choriocarcinoma (BeWo and JAR cells) were obtained from the A.T.C.C. (Rockville, MD, USA). BeWo cells were cultured in F-12 medium (Gibco) supplemented with 10% FBS (fetal bovine serum) (Gibco), 100 units/ml penicillin, and 100 g/ml streptomycin. HTR-8/SVneo and JAR cells were cultured in RPMI 1640 medium (Gibco) supplemented with 10% FBS, 100 units/ml penicillin, and 100 g/ml streptomycin. All cell lines were incubated at 37°C in a humidified atmosphere of 5% CO2.

Reverse transcription and RT-PCR (real-time PCR)

Total RNA was extracted from the cultured cells and placenta tissues using TRIzol® reagent (Invitrogen), according to the manufacturer's instructions. For quantitative RT-PCR analysis of the genes MMP2 (matrix metalloproteinase 2), MCL1 (myeloid cell leukaemia sequence 1), ITGB1 (integrin β1), VEGFA (vascular endothelial growth factor A) and ACTB (β-actin), 1 μg of total RNA was reverse-transcribed to cDNA with oligdT and Thermoscript (TaKaRa). RT-PCR for these genes was performed on an Applied Biosystems 7300 Sequence Detection System using SYBR green dye (Invitrogen). A 20 μl PCR mixture was used and included 1 μl of reverse-transcribed product, 1× QuantiTect SYBR green PCR Master Mix and 0.5 μM forward and reverse primers. The reactions were incubated in a 96-well plate at 95°C for 10 min, followed by 40 cycles of 95°C for 15 s and 60°C for 1 min. The housekeeping gene ACTB was used as an endogenous control for RNA normalization. All experiments were done in triplicate. The threshold cycle Ct value was defined as the fractional cycle number at which the fluorescence passes the fixed threshold. Mature miR-29b expression was determined by using TaqMan assays (Applied Biosystems) with U6 snRNA as the internal reference control. The method to quantify mature miRNA was performed as described previously [24]. Highly target-specific stem–loop structure and reverse transcription primers were used for reverse transcription. After that, we used specific TaqMan hybridization probes for miRNA amplification, which allowed high specificity for mature miR-29b target and the formation of a reverse transcription primer/mature miR-29b chimaera, extending the 5′-end of the miRNA. RT-PCR was performed using a TaqMan PCR kit on an Applied Biosystems 7300 Sequence Detection System (Applied Biosystems). Relative expression was performed as described previously using the ΔΔCt method [25]. The expression of miR-29b was calculated using the equation 2−ΔCt, where ΔCt=(Ct miR-29bCtU6). The relative amount of miR-29b to internal control was calculated using the equation 2−ΔΔCt, where ΔΔCt=(Ct miR-29bCtU6). The sequences of forward and reverse primers used are listed in Table 2.

Table 2
Primers used for quantitative RT-PCR amplification
Gene Forward (5′→3′) Reverse (5′→3′) 
ACTB CCACGAAACTACCTTCAACTCC TCATACTCCTGCTGCTTGCTGATCC 
ITGB1 CAAAGGAACAGCAGAGAAGC ATTGAGTAAGACAGGTCCATAAGG 
MCL11 GAAAGCTGCATCGAACCATT ACATTCCTGATGCCACCTTC 
MMP2 ACCCTCAGAGCCACCCCTAA AGCCAGCAGTGAAAAGCCAG 
VEGFA CACACAGGATGGCTTGAAGA AGGGCAGAATCATCACGAAG 
miR-29b ACACTCCAGCTGGGTAGCACCATTTGAAA TGGTGTCGTGGAGTCG 
U6 CTCGCTTCGGCAGCACA AACGCTTCACGAATTTGCGT 
Gene Forward (5′→3′) Reverse (5′→3′) 
ACTB CCACGAAACTACCTTCAACTCC TCATACTCCTGCTGCTTGCTGATCC 
ITGB1 CAAAGGAACAGCAGAGAAGC ATTGAGTAAGACAGGTCCATAAGG 
MCL11 GAAAGCTGCATCGAACCATT ACATTCCTGATGCCACCTTC 
MMP2 ACCCTCAGAGCCACCCCTAA AGCCAGCAGTGAAAAGCCAG 
VEGFA CACACAGGATGGCTTGAAGA AGGGCAGAATCATCACGAAG 
miR-29b ACACTCCAGCTGGGTAGCACCATTTGAAA TGGTGTCGTGGAGTCG 
U6 CTCGCTTCGGCAGCACA AACGCTTCACGAATTTGCGT 

Western blot analysis

Lysates (50 μg) obtained from BeWo and JAR cells were electrophoresed by SDS/PAGE (12% gel) (Bio-Rad Laboratories) and electroblotted on to PVDF membranes (Hybond-P; GE Healthcare). After blocking with 5% (w/v) BSA in TBS (Tris-buffered saline)/Tween-20 (Bio-Rad Laboratories), the membranes were incubated with rabbit anti-human polyclonal antibodies against MCL-1, MMP2, integrin β1, FAK (focal adhesion kinase), anti-ERK (extracellular-signal-regulated kinase) 1/2, anti-(phospho-FAK), anti-(phospho-ERK1/2) and anti-GAPDH (glyceraldehyde-3-phosphate dehydrogenase) (all from Cell Signaling Technology). ID (integrated density) values were then calculated using an AlphaImager 3400 (Alpha Innotech). These values were then normalized to the corresponding control. All experiments were repeated at least three times.

Determination of VEGFA levels by ELISA

The expression of VEGFA in the supernatant of trophoblast cell lines was determined using a VEGFA ELISA kit, according to the manufacturer's instructions (R&D Systems).

miRNA target prediction and GO (gene ontology)

Computer-based programs, including Targetscan (http://www.targetscan.org/), Pictar (http://pictar.bio.nyu.edu) and miRBase Targets (http://microrna.sanger.ac.uk), were used to predict potential target genes of miR-29b. The GO of the predicted targets was analysed using functional items via the GO website (http://www.geneontology.org). All gene definitions and functions were based on the National Institute of Health databases (http://www.ncbi.nlm.nih.gov/sites/entrez).

Transfection experiments

Overexpression or down-regulation of miR-29b expression in HTR-8/SVneo, BeWo and JAR cells was achieved by transfecting cells with pre-miR-29b (50 pmol) or anti-miR-29b (100 pmol) (Ambion) using Lipofectamine™ 2000 (Invitrogen), according to the manufacturer's instructions. The corresponding scrambled negative control miRNA was used as the negative control. Cells were harvested by trypsinization 48 h post-transfection and were used for subsequent experiments.

Cell proliferation, cell cycle and apoptosis assays

Cell proliferation was determined using a CCK-8 kit (DojinDo). HTR-8/SVneo, BeWo and JAR cells were plated at 2.5×103 cells/well in 96-well plates and incubated overnight in medium supplemented with 10% FBS. After 48 h transfection, 10 μl of CCK-8 (cholecystokinin octapeptide) was added to each well and incubated for another 3 h. The absorbance values at 450 nm were measured on an ELx-800 Universal Microplate Reader (Bio-tek). For the apoptosis assay, cells were harvested, stained with PI (propidium iodide) and an anti-(annexin V) antibody and then analysed by FACS (Calibur; BD Biosciences). For the cell cycle experiments, the treated cells were harvested, washed once with PBS and fixed in 70% ethanol overnight. Staining of the DNA content was performed with 50 mg/ml PI and 1 mg/ml RNase A for 30 min. Analysis was performed with Cell Quest Pro software. Cell-cycle modelling was performed with ModFit 3.0 software (Verity Software House).

Cell invasion assay

The invasion ability of HTR-8/SVneo and BeWo cells was determined by their ability to cross the 8 μm pores of a migration chamber that consists of transwells fitted with Millipore membranes (6.5 mm filters; Costar). Before cell seeding, inserts were coated with 50 μl of Growth Factor Reduced Matrigel (BD Biosciences). Cells were suspended in serum-free culture medium at a concentration of 4×105 cells/ml and then added to the upper chamber (at 4×104 cells/well). Simultaneously, 0.5 ml of culture medium with 10% FBS was added to the lower compartment, and the transwell-containing plates were incubated for 24 h in a 5% CO2 atmosphere saturated with water. At the end of the incubation, cells that had entered the lower surface of the filter membrane were fixed with 90% ethanol for 30 min at room temperature (20°C), washed three times with distilled water, and stained with 0.1% Crystal Violet in 0.1 M borate and 2% ethanol for 30 min at room temperature. Cells remaining on the upper surface of the filter membrane were gently scraped off with a cotton swab. Images of invaded cells were captured by a photomicroscope (BX51; Olympus). Cell invasion was quantified in a blinded manner by counting the number of the invaded cells on the lower surface of the membrane with five fields (×100 magnification) per chamber. Experiments were performed three times in duplicates.

HTR-8/SVneo capillary tube and network formation assay on Matrigel

Growth Factor Reduced Matrigel (300 μl) in serum-free medium was added to 24-well plates and incubated for at least 1 h to gel (thick-layer Matrigel). HTR-8/SVneo cells (105 cells) were added to the pre-solidified Matrigel, which started the process of forming capillary tubes and networks. After incubation for 8 h, digital images (×100 magnification) were taken from at least five different fields per well, and image analysis was undertaken using Image plus Pro software (Media Cybernetics). Quantification of the network complexity was achieved by measuring the total length of the tubes per mm2.

Plasmid construct and luciferase analysis

The 3′-UTRs (untranslated regions) of MCL1, VEGFA, MMP2 and ITGB1 mRNA, which contain the target sites for miR-29b, were PCR-amplified and then introduced downstream of the luciferase reporter gene in the XbaI-cloning sites of the pGL3 control vector (Promega).

HTR-8/SVneo and BeWo cells were seeded on to 24-well plates 1 day before transfection. For miR-29b co-transfection, 200 ng of firefly luciferase and 20 ng of Renilla luciferase reporter plasmids were transiently transfected into the cells. After 48 h, the luciferase activity was measured using the Dual-luciferase assay kit (Promega). Firefly luciferase activity was normalized to Renilla luciferase activity. All experiments were performed in triplicate.

Statistical analysis

Results are expressed as means±S.E.M.. Statistical significance was assessed by ANOVA with Bonferroni's multiple comparison tests. The correlation between miR-29b expression and its target gene expression in the placenta from subjects with PE was analysed using Pearson correlation and linear regression analysis. Data for all experiments were analysed with Prism software (GraphPad). A statistical significance was set at P<0.05. All experiments were repeated at least three times.

RESULTS

Prediction of target genes of miR-29b and their function network analysis

Previously, we have reported a significant up-regulation of miR-29b in the placentas of Chinese subjects with severe PE [14]. In order to understand the functions of miR-29b in PE, we first predicted its target genes using computer-based programs, including Targetscan, Pictar and miRBase. Using these bioinformatics approaches, we found that there were 851, 684 and 1152 miR-29b-target pairs in Targetscan, Pictar and miRBase respectively (results not shown). In addition, we investigated the biological functions of these target genes using GO. Interestingly, we observed enrichment for genes implicated in important cellular functions, such as proliferation, cell-cycle progression, apoptosis and migration (Figure 1). To date, the role of miR-29b in placenta trophoblast cells and the signalling pathways by which miR-29b exerts its function remain largely unknown. The combination of these factors motivated us to investigate whether miR-29b has any effect on human trophoblast cells.

Function network analysis of miR-29b

Figure 1
Function network analysis of miR-29b

The network was generated through GO analysis, which was used to determine the probable biological function of the targets of miR-29b. The GO of the predicted targets was analysed using functional items via the GO website (http://www.geneontology.org). All gene definitions and functions were based on the National Institute of Health databases (http://www.ncbi.nlm.nih.gov/sites/entrez).

Figure 1
Function network analysis of miR-29b

The network was generated through GO analysis, which was used to determine the probable biological function of the targets of miR-29b. The GO of the predicted targets was analysed using functional items via the GO website (http://www.geneontology.org). All gene definitions and functions were based on the National Institute of Health databases (http://www.ncbi.nlm.nih.gov/sites/entrez).

miR-29b induces the apoptosis of trophoblast cells

First, we determined the basal expression of miR-29b in three trophoblast cell lines, namely HTR-8/SVneo, BeWo and JAR cells. After being normalized to that in JAR cells, the relative fold change of miR-29b in HTR-8/SVneo and BeWo cells was 28.75 and 11.06 respectively (see Supplementary Figure S1A at http://www.clinsci.org/cs/124/cs1240027add.htm). Moreover, we examined the transfection efficiency of miR-29b in the three cell lines and found that there was some variation among the cell lines (see Supplementary Figure S1B). Therefore we have adopted different strategies in the subsequent experiments according to the basal expression of miR-29b and the transfection efficiency in the trophoblast cell lines.

Next we investigated whether miR-29b had an effect on the apoptosis of trophoblast cells. Overexpression of miR-29b increased the apoptosis of HTR-8/SVneo cells 1.5- fold compared with the negative control (P<0.001; Figure 2), whereas down-regulation of miR-29b inhibited this process (P<0.01; Figure 2). We also interfered with the expression of MCL1, an anti-apoptotic member of the Bcl-2 family, which was predicted to be the target of miR-29b (results not shown) and has been shown to play a significant role in the survival of cancer cells [26]. The flow cytometry analysis showed that RNA interference of MCL1 increased the apoptosis of trophoblast cells (P<0.001; Figure 2). Similar results were also observed in BeWo cells (both P<0.001; Figure 2). Taken together, these results suggest that miR-29b promotes the apoptosis of trophoblast cells, which might be partly due to the down-regulation of MCL1 expression. We also investigated the effect of miR-29b on the proliferation and cell cycle of trophoblast cells. However, no significant change was observed on cell proliferation and cell cycle after up-regulating miR-29b (see Supplementary Figures S1C–S1E).

miR-29b induces apoptosis in HTR-8/SVneo and BeWo cells

Figure 2
miR-29b induces apoptosis in HTR-8/SVneo and BeWo cells

(A) Annexin V/PI assays in HTR-8/Svneo (left-hand panels) and BeWo (right-hand panels) cells transfected with pre-miR-29b (pre-29b), pre-negative control (pre-nc), anti-miR-29bi (anti-29b), anti-negative control (anti-nc), short interfering RNA against MCL1 (si-MCL1) or short interfering RNA negative control (si-nc). After 48 h, annexin V assay was performed as described in the Materials and methods section. y-axis, cells stained with PI; x-axis, cells stained by annexin V–FITC. The results are shown as a percentage of apoptotic cells (annexin V-positive) and are representative of three independent experiments with similar results. (B) Percentage of apoptotic HTR-8/SVneo (left-hand panel) and BeWo (right-hand panel) cells. Values are means±S.E.M. ***P<0.001 using a Student's t test.

Figure 2
miR-29b induces apoptosis in HTR-8/SVneo and BeWo cells

(A) Annexin V/PI assays in HTR-8/Svneo (left-hand panels) and BeWo (right-hand panels) cells transfected with pre-miR-29b (pre-29b), pre-negative control (pre-nc), anti-miR-29bi (anti-29b), anti-negative control (anti-nc), short interfering RNA against MCL1 (si-MCL1) or short interfering RNA negative control (si-nc). After 48 h, annexin V assay was performed as described in the Materials and methods section. y-axis, cells stained with PI; x-axis, cells stained by annexin V–FITC. The results are shown as a percentage of apoptotic cells (annexin V-positive) and are representative of three independent experiments with similar results. (B) Percentage of apoptotic HTR-8/SVneo (left-hand panel) and BeWo (right-hand panel) cells. Values are means±S.E.M. ***P<0.001 using a Student's t test.

miR-29b inhibits the invasion of trophoblast cell lines and decreases capillary tube and network formation

It is well known that deficient trophoblast invasion of the placental bed spiral arterioles and altered trophoblast-mediated remodelling of the spiral arteries results in reduced uteroplacental perfusion and the onset of PE [2,3]. Therefore we examined the effect of miR-29b on the invasive capacity of trophoblast cells using Matrigel invasion assays. The results showed that overexpression of miR-29b markedly reduced the invasiveness of HTR-8/SVneo compared with the negative control. Meanwhile, knockdown of endogenous miR-29b promoted invasion (both P<0.001; Figures 3A and 3B). Similar results were obtained in BeWo cells (Figures 3A and 3B). Thus these results indicate that miR-29b may be involved in the suppression of invasion of trophoblast cells.

miR-29b reduces the invasion and impairs capillary tube and network formation of trophoblast cells

Figure 3
miR-29b reduces the invasion and impairs capillary tube and network formation of trophoblast cells

(A) Transwell analysis of HTR-8/SVneo (upper panel) and BeWo (lower panel) cells transfected with pre-miR-29b (pre-29b), pre-negative control (pre-nc), anti-miR-29bi (anti-29b), anti-negative control (anti-nc). The images are representative of three independent experiments. (B) The number of invaded cells was quantified using a microscope at ×100 magnification. Values are means±S.E.M. from three experiments. **P<0.01 and ***P<0.001. (C) Tube formation of HTR-8/SVneo cells treated differently was photographed under a microscope at ×100 magnification (left-hand panels). The images are representative of three independent experiments. Mean tube length was quantified by image pro-plus software (right-hand panel). *P<0.05 and **P<0.01.

Figure 3
miR-29b reduces the invasion and impairs capillary tube and network formation of trophoblast cells

(A) Transwell analysis of HTR-8/SVneo (upper panel) and BeWo (lower panel) cells transfected with pre-miR-29b (pre-29b), pre-negative control (pre-nc), anti-miR-29bi (anti-29b), anti-negative control (anti-nc). The images are representative of three independent experiments. (B) The number of invaded cells was quantified using a microscope at ×100 magnification. Values are means±S.E.M. from three experiments. **P<0.01 and ***P<0.001. (C) Tube formation of HTR-8/SVneo cells treated differently was photographed under a microscope at ×100 magnification (left-hand panels). The images are representative of three independent experiments. Mean tube length was quantified by image pro-plus software (right-hand panel). *P<0.05 and **P<0.01.

A direct effect of miR-29b on angiogenesis has not been studied to date. As VEGFA, a key growth factor that modulates angiogenesis [27], was predicted to be targeted by miR-29b (results not shown), we have investigated the effect of miR-29b on angiogenesis of trophoblast cells. We chose the extravillous trophoblast cell line HTR-8/SVneo, which has an intrinsic capacity to form capillary tubes and networks when cells are cultured on thick-layer Matrigel. After 8 h of incubation, some of the capillary network ‘arms’ became disrupted and HTR8/SVneo cells became aggregated. Tube-like structures were defined as endothelial cord formations that were connected at both ends. We found that, after overexpression of miR-29b, the capillary tube and network formation of HTR-8/SVneo were prevented and the total length of tubes decreased by 60% (P<0.01; Figure 3C). In contrast, neutralization of endogenous miR-29b increased capillary tube and network formation 1.4-fold (P<0.05; Figure 3C). These results demonstrate that miR-29b is involved in the inhibition of angiogenesis of trophoblast cells.

miR-29b targets MMP2, MCL1, VEGFA and ITGB1

The findings described above prompted us to investigate the regulatory mechanism of miR-29b. To characterize the molecular basis of miR-29b in trophoblast cell function, we selected candidate genes based on (i) genes involved in the regulation of invasion, apoptosis and angiogenesis and (ii) putative miR-29b target genes using the online computer programs Targetscan, Pictar and miRBase Targets. This resulted in four candidate genes, namely MMP2, MCL1, VEGFA and ITGB1.

In order to determine whether miR-29b affected the expression of these genes in trophoblast cells, we first analysed their mRNA and protein expression levels after overexpression of miR-29b. Using quantitative RT-PCR, we found that the MMP2, MCL1, VEGFA and ITGB1 mRNA levels were dramatically reduced after overexpression of miR-29b in HTR-8/SVneo, BeWo and JAR cells (both P<0.01; Figure 4A, and Supplementary Figure S2 at http://www.clinsci.org/cs/124/cs1240027add.htm). Strikingly, the protein levels of MCL1, VEGFA, MMP2 and integrin β1 were also substantially decreased after the overexpression of miR-29b in the trophoblast cell lines, as determined by Western blot analysis and ELISA (Figures 4B and 4C). Conversely, anti-miR-29b, by antagonizing endogenous miR-29b, enhanced the expression of the gene targets (both P<0.001; Figures 4B and 4C).

miR-29b inhibits its target gene expression at the mRNA and protein levels

Figure 4
miR-29b inhibits its target gene expression at the mRNA and protein levels

(A) Quantitative RT-PCR was performed to determine the mRNA expression levels of MMP2, MCL1, VEGFA and ITGB1 in HTR-8/SVneo and BeWo transfected with pre-miR-29b (pre-29b), pre-negative control (pre-nc), anti-miR-29bi (anti-29b) and anti-negative control (anti-nc). Values are means±S.E.M. from three experiments performed in duplicate. (B) Western blot analysis of the protein expression of MMP2, MCL1 and integrin β1 performed on total cell extracts from HTR-8/SVneo and BeWo cells transfected with pre-miR-29b (pre-29b), pre-negative control (pre-nc), anti-miR-29bi (anti-29b) and anti-negative control (anti-nc). GAPDH was used as a loading control. The protein bands were quantified and normalized to GAPDH. Quantification of the protein expression is shown in the middle and right-hand panels as means±S.E.M. (C) ELISA of VEGFA levels in the supernatant of serum-starved HTR-8/SVneo and BeWo cells transfected with pre-miR-29b (pre-29b), pre-negative control (pre-nc), anti-miR-29bi (anti-29b) and anti-negative control (anti-nc). Values are means±S.E.M. from three experiments performed in duplicate. *P<0.05, **P<0.01 and ***P<0.001.

Figure 4
miR-29b inhibits its target gene expression at the mRNA and protein levels

(A) Quantitative RT-PCR was performed to determine the mRNA expression levels of MMP2, MCL1, VEGFA and ITGB1 in HTR-8/SVneo and BeWo transfected with pre-miR-29b (pre-29b), pre-negative control (pre-nc), anti-miR-29bi (anti-29b) and anti-negative control (anti-nc). Values are means±S.E.M. from three experiments performed in duplicate. (B) Western blot analysis of the protein expression of MMP2, MCL1 and integrin β1 performed on total cell extracts from HTR-8/SVneo and BeWo cells transfected with pre-miR-29b (pre-29b), pre-negative control (pre-nc), anti-miR-29bi (anti-29b) and anti-negative control (anti-nc). GAPDH was used as a loading control. The protein bands were quantified and normalized to GAPDH. Quantification of the protein expression is shown in the middle and right-hand panels as means±S.E.M. (C) ELISA of VEGFA levels in the supernatant of serum-starved HTR-8/SVneo and BeWo cells transfected with pre-miR-29b (pre-29b), pre-negative control (pre-nc), anti-miR-29bi (anti-29b) and anti-negative control (anti-nc). Values are means±S.E.M. from three experiments performed in duplicate. *P<0.05, **P<0.01 and ***P<0.001.

Lastly, to test further whether MCL1, MMP2, VEGFA and ITGB1 were direct targets of miR-29b, we searched predicted potential binding sites (Figure 5A) and constructed reporter plasmids containing the 3′-UTR of these genes. These reporter constructs were co-transfected with pre-miR-29b or anti-miR-29b in HTR-8/SVneo and BeWo cells. As shown in Figure 5(B), the results demonstrated that the increased expression of miR-29b significantly diminished luciferase activity (both P<0.001; Figure 5B). Conversely, the decreased expression of miR-29b markedly enhanced the luciferase activity (both P<0.001; Figure 5B). These results indicate that these genes are directly regulated by miR-29b.

MCL1, MMP2, VEGFA and ITGB1 are direct targets of miR-29b

Figure 5
MCL1, MMP2, VEGFA and ITGB1 are direct targets of miR-29b

(A) Predicted interaction between the miR-29b seed and the seed matches on human VEGFA, MMP2, MCL1 and ITGB1 3′-UTR mRNAs, as determined with the software Targetscan. Seed regions are highlighted in grey. (B) Analysis of luciferase activity in HTR-8/SVneo and BeWo cells. Cells were co-transfected with pre-miR-29b (pre-29b) (50 pmol) or anti-miR-29bi (anti-29b) (100 pmol), pRL-TK and the firefly luciferase reporter comprising the 3′-UTR of the these putative target genes respectively. pRL-TK expressing Renilla luciferase was co-transfected as an internal control to correct the differences in both transfection and harvest efficiencies. The firefly luciferase activity of each sample was normalized to the Renilla luciferase activity. Values are means±S.E.M. from three experiments performed in duplicate. ***P<0.001.

Figure 5
MCL1, MMP2, VEGFA and ITGB1 are direct targets of miR-29b

(A) Predicted interaction between the miR-29b seed and the seed matches on human VEGFA, MMP2, MCL1 and ITGB1 3′-UTR mRNAs, as determined with the software Targetscan. Seed regions are highlighted in grey. (B) Analysis of luciferase activity in HTR-8/SVneo and BeWo cells. Cells were co-transfected with pre-miR-29b (pre-29b) (50 pmol) or anti-miR-29bi (anti-29b) (100 pmol), pRL-TK and the firefly luciferase reporter comprising the 3′-UTR of the these putative target genes respectively. pRL-TK expressing Renilla luciferase was co-transfected as an internal control to correct the differences in both transfection and harvest efficiencies. The firefly luciferase activity of each sample was normalized to the Renilla luciferase activity. Values are means±S.E.M. from three experiments performed in duplicate. ***P<0.001.

Inverse correlation of miR-29b with MCL1, MMP2, VEGFA and ITGB1 levels in placental tissues from PE

To confirm further the regulation of MCL1, MMP2, VEGFA and ITGB1 by miR-29b in vitro, we first analysed the expression of miR-29b and these genes in placental tissues from 24 subjects with severe PE and 26 healthy controls. Consistent with our previous study [14], miR-29b was significantly increased in placental tissues from subjects with PE (P<0.001; Figure 6A). Interestingly, the expression of MCL1, MMP2, VEGFA and ITGB1 in the subjects with PE was markedly lower compared with the healthy controls (P<0.01; Figure 6A). We next examined the correlation of miR-29b with these genes in our subjects. The Pearson correlation analysis indicated an inverse correlation between miR-29b and these genes (miR-29b and MCL1 mRNA, r=−0.6688, P<0.001; miR-29b and MMP2 mRNA, r=−0.8080, P<0.001; miR-29b and VEGFA mRNA, r=−0.7190, P<0.001; miR-29b and ITGB1 mRNA: r=−0.7586, P<0.01) (Figure 6B).

Significant inverse correlation of miR-29b and MCL1, MMP2, VEGFA and ITGB1 in placental tissues from subjects with PE

Figure 6
Significant inverse correlation of miR-29b and MCL1, MMP2, VEGFA and ITGB1 in placental tissues from subjects with PE

(A) Endogenous expression levels of MCL1, MMP2, VEGFA, ITGB1 and miR-29b in placental samples from subjects with PE (n=24) and those with a normal pregnancy (CON) (n=26) were assessed with quantitative RT-PCR. (B) Inverse correlation between endogenous miR-29b levels and MCL1, MMP2, VEGFA and ITGB1 mRNA levels in PE patients (n=24) determined by quantitative RT-PCR. Statistical analysis was performed using Pearson's correlation and linear regression analysis. R, regression coefficient. (C) Schematic diagram showing the hypothetical role of miR-29b in pathogenesis of PE through inhibition of invasion and angiogenesis of trophoblast cells and promotion of apoptosis of trophoblast cells.

Figure 6
Significant inverse correlation of miR-29b and MCL1, MMP2, VEGFA and ITGB1 in placental tissues from subjects with PE

(A) Endogenous expression levels of MCL1, MMP2, VEGFA, ITGB1 and miR-29b in placental samples from subjects with PE (n=24) and those with a normal pregnancy (CON) (n=26) were assessed with quantitative RT-PCR. (B) Inverse correlation between endogenous miR-29b levels and MCL1, MMP2, VEGFA and ITGB1 mRNA levels in PE patients (n=24) determined by quantitative RT-PCR. Statistical analysis was performed using Pearson's correlation and linear regression analysis. R, regression coefficient. (C) Schematic diagram showing the hypothetical role of miR-29b in pathogenesis of PE through inhibition of invasion and angiogenesis of trophoblast cells and promotion of apoptosis of trophoblast cells.

miR-29b induces the dysregulation of FAK signalling in trophoblast cells

Additionally, in order to understand the pathway regulated by miR-29b in trophoblast cells, we analysed the FAK and ERK signalling pathways, which are involved in the invasion of trophobalst cells. Western blot analysis revealed that transfection of HTR-8/SVneo and BeWo cells with pre-miR-29b reduced the expression of phospho-FAK in both cell lines (P<0.01; Figure 7), whereas phospho-ERK1/2 expression was unaffected. In contrast, cells transfected with anti-miR-29b had increased phospho-FAK expression (P<0.01; Figure 7). This indicates that the overexpression of miR-29b leads to dysregulation of phospho-FAK signalling and suppression of MMP2 and integrin β1.

miR-29b modulates FAK signalling in trophoblast cells

Figure 7
miR-29b modulates FAK signalling in trophoblast cells

(A) HTR-8/SVneo and BeWo cells were transfected with pre-miR-29b (pre-29b), pre-negative control (pre-nc), anti-miR-29bi (anti-29b) and anti-negative control (anti-nc) for 48 h and then the protein levels of phospho-ERK1/2 (pERK1/2), phospho-FAK (pFAK), total ERK1/2 and total FAK were detected by Western blot analysis. (B) The protein bands were quantified and normalized to total ERK1/2 and total FAK respectively. Values are means±S.E.M. from three experiments performed in duplicate. **P<0.01 and ***P<0.001.

Figure 7
miR-29b modulates FAK signalling in trophoblast cells

(A) HTR-8/SVneo and BeWo cells were transfected with pre-miR-29b (pre-29b), pre-negative control (pre-nc), anti-miR-29bi (anti-29b) and anti-negative control (anti-nc) for 48 h and then the protein levels of phospho-ERK1/2 (pERK1/2), phospho-FAK (pFAK), total ERK1/2 and total FAK were detected by Western blot analysis. (B) The protein bands were quantified and normalized to total ERK1/2 and total FAK respectively. Values are means±S.E.M. from three experiments performed in duplicate. **P<0.01 and ***P<0.001.

DISCUSSION

miRNAs are emerging as major players in gene regulation and contribute to diverse biological processes. However, the molecular mechanisms by which miRNAs modulate the function of trophoblast cells are still unclear, especially the role of miRNAs in the pathogenesis of PE remain largely unknown. In the present study, we have found that the functional involvement of an up-regulation of miR-29b in dysregulating trophoblast cell invasion, survival and angiogenesis may lead to the onset of PE (Figure 6C).

Identification of biomarkers for PE diagnosis is of particular interest. Studies on miRNAs have offered the possibilities of developing a novel class of fetal nucleic acid markers in maternal plasma [28,29]. Moreover, abundantly and differentially expressed miRNA species in placental samples and in serum/plasma have been reported [11,12,14,3035]. Future studies that examine early pregnancy miR-29b expression in placental samples (obtained during chorionic villi sampling procedures) or peripheral tissue (e.g. whole blood) with risk of PE could enhance our understanding of the pathogenesis of this disease and contribute to its diagnosis and management.

Trophoblast cells of the human placenta proliferate, migrate and invade the pregnant uterus in order to nourish the developing fetus, in a way that is imitated by malignant tumours [3638]. Hence the normal trophoblast has been termed pesudomalignant. miR-29b has been identified as the best ‘hit’ in several experiments designed to detect miRNAs dysregulated in tumours [3941]. However, no findings have reported the role of miR-29b in PE and trophoblast cells. Our present study identifies MMP2, MCL1, VEGFA and ITGB1 as critical targets of miR-29b in trophoblast cells.

It has been reported in several studies that the Bcl-2 family member MCL1 is decreased in PE [42,43]. However, other investigators have suggested that increased apoptosis in PE might not be associated with significant alterations in Bcl-2 [44]. In our present study, we found the mRNA expression level of MCL1 was decreased in placental tissues from subjects with PE compared with their control counterparts. Meanwhile, we have confirmed that miR-29b decreased the mRNA and protein expression of MCL1 in trophoblast cells lines, and miR-29b or small interfering RNA against MCL1 can induce trophoblast cell apoptosis. All of these findings indicate that MCL1 plays an important role in trophoblast cell survival and turnover, and that miR-29b may contribute to the increased apoptosis of trophoblast cells in PE via down-regulation of MCL1.

It has been demonstrated that human trophoblast invasiveness in vitro depends on the production of MMP2 [45]. In addition, during trophobalst invasion, trophoblast cells undergo variation in integrin phenotype, acquiring integrins α5β1 and α1β1 [46]. In the present study, we observed that the overexpression of miR-29b reduced trophoblast cell invasion via down-regulating the levels of its targets MMP2 and ITGB1, and that the expression of MMP2 and ITGB1 mRNA was decreased in placental tissue from subjects with PE. Taken together, many other molecules involved in the regulation of normal human trophoblast cell invasion besides miR-29b will be revealed in the future, which will contribute to the understanding of the mechanisms underlying PE and possible prevention.

VEGF is a positive regulator of angiogenesis and plays a crucial role in the growth of vascular endothelial cells, the production of blood vessels and the promotion of vessel permeability [47]. Previous studies have elucidated that the hypoxia-driven disruption of the angiogenic balance involving VEGF and sFLT-1 (soluble Fms-like tyrosine kinase-1) might contribute to some of the maternal symptoms of PE [48]. In the present study, for the first time, we found that miR-29b had a binding site in the 3′-UTR of VEGFA mRNA and inhibited tubular network formation, partly via decreased secretion of VEGFA in HTR-8/SVneo cells. However, tube network formation of HTR-8/SVneo cells on Matrigel occurs as a consequence of a number of necessary biological events, including cell migration, proliferation, cell–cell junction formation and cell elongation. It is speculated that other targets of miR-29b may participate in angiogenesis.

Multiple growth factors expressed at the fetal–maternal interface are involved in the regulation of trophoblast migration and invasion through ERK and FAK signalling [49]. However, the molecular mechanisms governing invasion of human trophoblasts remain largely elusive. In trophoblasts, ERKs were shown to regulate the EGF (epidermal growth factor)-dependent induction of MMP2, indicating that proteinases crucial for trophoblast invasion are targets of this particular signalling pathway [50]. Moreover, phosphorylation of Tyr397 on FAK is a critical component of the signalling pathway that mediates cytotrophoblast migration/invasion [51]. Our present findings show that miR-29b may play an essential role in trophobalst invasion though diminishing the activation of FAK phosphorylation, although the precise mechanism for the miR-29b-mediated regulation of FAK remains to be determined.

Published findings on the role of miRNAs in trophoblast cells is surprisingly sparse. Lee et al. [13] studied the role of miRNAs in trophoblast and found that iron–sulfur cluster protein [ISCU (iron–sulfur cluster scaffold homologue)] down-regulation by miR-210 perturbing trophoblast iron metabolism was associated with defective placentation. Luo et al. [52] reported that microRNA-378a-5p promoted trophoblast cell survival, migration and invasion by targeting Nodal. In the present study, we have demonstrated the effects and possible mechanisms of miR-29b on trophoblast function in vitro and analysed further the expression of miR-29b and its targets in vivo in placenta tissues from subjects with PE. In summary, these findings suggest a role for miR-29b in the regulation of altered placental gene expression in PE. Whether other miRNA family members also affect trophoblast cell apoptosis and invasion remains to be investigated.

An important issue that remains to be addressed is why miR-29b is up-regulated in PE. Chang et al. [53] have reported that c-Myc was shown to contribute to miR-29 repression. Meanwhile, another group [21] has found that miR-29 was repressed by NF-κB (nuclear factor κB) acting through YY1 (Yin Yang 1) and the Polycomb group. Taken together, several factors may interact with the regulatory region of miR-29b, including promoters of the miR-29b gene, transcription-factor-binding proteins, chromosomal structures or epigenetic factors. Therefore in the future it will be essential to identify other mechanisms of upregulation.

Conclusions

The results of the present study have suggested that the up-regulation of miR-29b expression may contribute to the onset of PE through repression of trophoblast cell invasion and angiogensis and enhancement of trophoblast cell apoptosis. In addition, its target genes, MMP2, MCL1, VEGFA and ITGB1, appear to be involved in these processes. In summary, understanding the regulation of genes by miR-29b would provide new insights into the pathogenesis of PE, and miR-29b could be employed as a new prognostic marker and/or as an effective therapeutic target for PE.

FUNDING

This work was supported by National Natural Science Foundation of China [project number 81072410] and a special grant for maternal–fetal medicine from Jiangsu Province Health Department of China [project number 81070508].

AUTHOR CONTRIBUTION

Pengfei Li participated in the miR-29b-related cell experiments, statistical and bioinformatics analysis, and writing the paper; Wei Guo participated in placental tissue collection and processing, and analysis and interpretation of the data; Leilei Du performed the quantitative RT-PCR of miR-29b and provided technical support; Junli Zhao performed the quantitative RT-PCR of the target genes of miR-29b; Yaping Wang performed the clinical analysis; Liu Liu performed the plasmid construct and luciferase analysis; Yali Hu supervised the study; and Yayi Hou provided the study concept and designed the experiments.

We thank the women who donated their time and provided placental samples for use in the present study.

Abbreviations

     
  • ACTB

    β-actin

  •  
  • ERK

    extracellular-signal-regulated kinase

  •  
  • FAK

    focal adhesion kinase

  •  
  • FBS

    fetal bovine serum

  •  
  • GAPDH

    glyceraldehyde-3-phosphate dehydrogenase

  •  
  • GO

    gene ontology

  •  
  • ID

    integrated density

  •  
  • ITGB1

    integrin β1

  •  
  • MCL1

    myeloid cell leukaemia sequence 1

  •  
  • miRNA (miR)

    microRNA

  •  
  • MMP2

    matrix metalloproteinase 2

  •  
  • PE

    pre-eclampsia

  •  
  • PI

    propidium iodide

  •  
  • RT-PCR

    real-time PCR

  •  
  • UTR

    untranslated region

  •  
  • VEGFA

    vascular endothelial growth factor A

References

References
1
Sibai
B.
Dekker
G.
Kupferminc
M.
Pre-eclampsia
Lancet
2005
, vol. 
365
 (pg. 
785
-
799
)
2
Redman
C. W.
Sargent
I. L.
Latest advances in understanding preeclampsia
Science
2005
, vol. 
308
 (pg. 
1592
-
1594
)
3
Roberts
J. M.
Gammill
H. S.
Preeclampsia: recent insights
Hypertension
2005
, vol. 
46
 (pg. 
1243
-
1249
)
4
Kaufmann
P.
Black
S.
Huppertz
B.
Endovascular trophoblast invasion: implications for the pathogenesis of intrauterine growth retardation and preeclampsia
Biol. Reprod.
2003
, vol. 
69
 (pg. 
1
-
7
)
5
Whitley
G. S.
Dash
P. R.
Ayling
L. J.
Prefumo
F.
Thilaganathan
B.
Cartwright
J. E.
Increased apoptosis in first trimester extravillous trophoblasts from pregnancies at higher risk of developing preeclampsia
Am. J. Pathol.
2007
, vol. 
170
 (pg. 
1903
-
1909
)
6
Longtine
M. S.
Chen
B.
Odibo
A. O.
Zhong
Y.
Nelson
D. M.
Villous trophoblast apoptosis is elevated and restricted to cytotrophoblasts in pregnancies complicated by preeclampsia, IUGR, or preeclampsia with IUGR
Placenta
2012
, vol. 
33
 (pg. 
352
-
359
)
7
Ray
J. E.
Garcia
J.
Jurisicova
A.
Caniggia
I.
Mtd/Bok takes a swing: proapoptotic Mtd/Bok regulates trophoblast cell proliferation during human placental development and in preeclampsia
Cell Death Differ.
2010
, vol. 
17
 (pg. 
846
-
859
)
8
Broughton Pipkin
F.
Roberts
J. M.
Hypertension in pregnancy
J. Hum. Hypertens.
2000
, vol. 
14
 (pg. 
705
-
724
)
9
Bushati
N.
Cohen
S. M.
microRNA functions
Annu. Rev. Cell Dev. Biol.
2007
, vol. 
23
 (pg. 
175
-
205
)
10
Lim
L. P.
Lau
N. C.
Garrett-Engele
P.
Grimson
A.
Schelter
J. M.
Castle
J.
Bartel
D. P.
Linsley
P. S.
Johnson
J. M.
Microarray analysis shows that some microRNAs downregulate large numbers of target mRNAs
Nature
2005
, vol. 
433
 (pg. 
769
-
773
)
11
Pineles
B. L.
Romero
R.
Montenegro
D.
Tarca
A. L.
Han
Y. M.
Kim
Y. M.
Draghici
S.
Espinoza
J.
Kusanovic
J. P.
Mittal
P.
, et al. 
Distinct subsets of microRNAs are expressed differentially in the human placentas of patients with preeclampsia
Am. J. Obstet. Gynecol.
2007
, vol. 
196
 (pg. 
261.e261
-
261.e266
)
12
Zhu
X. M.
Han
T.
Sargent
I. L.
Yin
G. W.
Yao
Y. Q.
Differential expression profile of microRNAs in human placentas from preeclamptic pregnancies vs normal pregnancies
Am. J. Obstet. Gynecol.
2009
, vol. 
200
 (pg. 
661.e1
-
661.e7
)
13
Lee
D. C.
Romero
R.
Kim
J. S.
Tarca
A. L.
Montenegro
D.
Pineles
B. L.
Kim
E.
Lee
J.
Kim
S. Y.
Draghici
S.
, et al. 
miR-210 targets iron-sulfur cluster scaffold homologue in human trophoblast cell lines: siderosis of interstitial trophoblasts as a novel pathology of preterm preeclampsia and small-for-gestational-age pregnancies
Am. J. Pathol.
2011
, vol. 
179
 (pg. 
590
-
602
)
14
Hu
Y.
Li
P.
Hao
S.
Liu
L.
Zhao
J.
Hou
Y.
Differential expression of microRNAs in the placentae of Chinese patients with severe pre-eclampsia
Clin. Chem. Lab. Med.
2009
, vol. 
47
 (pg. 
923
-
929
)
15
Zhu
X. M.
Han
T.
Wang
X. H.
Li
Y. H.
Yang
H. G.
Luo
Y. N.
Yin
G. W.
Yao
Y. Q.
Overexpression of miR-152 leads to reduced expression of human leukocyte antigen-G and increased natural killer cell mediated cytolysis in JEG-3 cells
Am. J. Obstet. Gynecol.
2010
, vol. 
202
 (pg. 
592.e1
-
592.e7
)
16
Dai
Y.
Diao
Z.
Sun
H.
Li
R.
Qiu
Z.
Hu
Y.
MicroRNA-155 is involved in the remodelling of human-trophoblast-derived HTR-8/SVneo cells induced by lipopolysaccharides
Hum. Reprod.
2011
, vol. 
26
 (pg. 
1882
-
1891
)
17
Fabbri
M.
Garzon
R.
Cimmino
A.
Liu
Z.
Zanesi
N.
Callegari
E.
Liu
S.
Alder
H.
Costinean
S.
Fernandez-Cymering
C.
, et al. 
MicroRNA-29 family reverts aberrant methylation in lung cancer by targeting DNA methyltransferases 3A and 3B
Proc. Natl. Acad. Sci. U.S.A.
2007
, vol. 
104
 (pg. 
15805
-
15810
)
18
Garzon
R.
Heaphy
C. E.
Havelange
V.
Fabbri
M.
Volinia
S.
Tsao
T.
Zanesi
N.
Kornblau
S. M.
Marcucci
G.
Calin
G. A. et al. C. M.
MicroRNA 29b functions in acute myeloid leukemia
Blood
2009
, vol. 
114
 (pg. 
5331
-
5341
)
19
Park
S. Y.
Lee
J. H.
Ha
M.
Nam
J. W.
Kim
V. N.
miR-29 miRNAs activate p53 by targeting p85α and CDC42
Nat. Struct. Mol. Biol.
2009
, vol. 
16
 (pg. 
23
-
29
)
20
Mott
J. L.
Kobayashi
S.
Bronk
S. F.
Gores
G. J.
mir-29 regulates Mcl-1 protein expression and apoptosis
Oncogene
2007
, vol. 
26
 (pg. 
6133
-
6140
)
21
Wang
H.
Garzon
R.
Sun
H.
Ladner
K. J.
Singh
R.
Dahlman
J.
Cheng
A.
Hall
B. M.
Qualman
S. J.
Chandler
D. S.
, et al. 
NF-κB-YY1-miR-29 regulatory circuitry in skeletal myogenesis and rhabdomyosarcoma
Cancer Cell
2008
, vol. 
14
 (pg. 
369
-
381
)
22
Corsten
M. F.
Dennert
R.
Jochems
S.
Kuznetsova
T.
Devaux
Y.
Hofstra
L.
Wagner
D. R.
Staessen
J. A.
Heymans
S.
Schroen
B.
Circulating microRNA-208b and microRNA-499 reflect myocardial damage in cardiovascular disease
Circ. Cardiovasc. Genet.
2010
, vol. 
3
 (pg. 
499
-
506
)
23
ACOG Committee on Practice Bulletins–Obstetrics
Diagnosis and management of preeclampsia and eclampsia
Obstet. Gynecol.
2002
, vol. 
99
 (pg. 
159
-
166
)
24
Chen
C.
Ridzon
D. A.
Broomer
A. J.
Zhou
Z.
Lee
D. H.
Nguyen
J. T.
Barbisin
M.
Xu
N. L.
Mahuvakar
V. R.
Andersen
M. R.
, et al. 
Real-time quantification of microRNAs by stem-loop RT-PCR
Nucleic Acids Res.
2005
, vol. 
33
 pg. 
e179
 
25
Livak
K. J.
Schmittgen
T. D.
Analysis of relative gene expression data using real-time quantitative PCR and the 2−ΔΔCT method
Methods
2001
, vol. 
25
 (pg. 
402
-
408
)
26
Yang-Yen
H. F.
Mcl-1: a highly regulated cell death and survival controller
J. Biomed. Sci.
2006
, vol. 
13
 (pg. 
201
-
204
)
27
Carmeliet
P.
Jain
R. K.
Molecular mechanisms and clinical applications of angiogenesis
Nature
2011
, vol. 
473
 (pg. 
298
-
307
)
28
Chen
X.
Ba
Y.
Ma
L.
Cai
X.
Yin
Y.
Wang
K.
Guo
J.
Zhang
Y.
Chen
J.
Guo
X.
, et al. 
Characterization of microRNAs in serum: a novel class of biomarkers for diagnosis of cancer and other diseases
Cell Res.
2008
, vol. 
18
 (pg. 
997
-
1006
)
29
Gilad
S.
Meiri
E.
Yogev
Y.
Benjamin
S.
Lebanony
D.
Yerushalmi
N.
Benjamin
H.
Kushnir
M.
Cholakh
H.
Melamed
N.
, et al. 
Serum microRNAs are promising novel biomarkers
PLoS ONE
2008
, vol. 
3
 pg. 
e3148
 
30
Enquobahrie
D. A.
Abetew
D. F.
Sorensen
T. K.
Willoughby
D.
Chidambaram
K.
Williams
M. A.
Placental microRNA expression in pregnancies complicated by preeclampsia
Am. J. Obstet. Gynecol.
2011
, vol. 
204
 (pg. 
178.e112
-
178.e121
)
31
Hromadnikova
I.
Kotlabova
K.
Doucha
J.
Dlouha
K.
Krofta
L.
Absolute and relative quantification of placenta-specific micrornas in maternal circulation with placental insufficiency-related complications
J. Mol. Diagn.
2012
, vol. 
14
 (pg. 
160
-
167
)
32
Yang
Q.
Lu
J.
Wang
S.
Li
H.
Ge
Q.
Lu
Z.
Application of next-generation sequencing technology to profile the circulating microRNAs in the serum of preeclampsia versus normal pregnant women
Clin. Chim. Acta
2011
, vol. 
412
 (pg. 
2167
-
2173
)
33
Gunel
T.
Zeybek
Y. G.
Akcakaya
P.
Kalelioglu
I.
Benian
A.
Ermis
H.
Aydinli
K.
Serum microRNA expression in pregnancies with preeclampsia
Genet. Mol. Res.
2011
, vol. 
10
 (pg. 
4034
-
4040
)
34
Wu
L.
Zhou
H.
Lin
H.
Qi
J.
Zhu
C.
Gao
Z.
Wang
H.
Circulating microRNAs are elevated in plasma from severe preeclamptic pregnancies
Reproduction
2012
, vol. 
143
 (pg. 
389
-
397
)
35
Pressman
M. R.
How is slow wave sleep related to hypertension?
Hypertension
2012
, vol. 
59
 pg. 
e10
 
36
Ferretti
C.
Bruni
L.
Dangles-Marie
V.
Pecking
A. P.
Bellet
D.
Molecular circuits shared by placental and cancer cells, and their implications in the proliferative, invasive and migratory capacities of trophoblasts
Hum. Reprod. Update
2007
, vol. 
13
 (pg. 
121
-
141
)
37
Holtan
S. G.
Creedon
D. J.
Haluska
P.
Markovic
S. N.
Cancer and pregnancy: parallels in growth, invasion, and immune modulation and implications for cancer therapeutic agents
Mayo Clin. Proc.
2009
, vol. 
84
 (pg. 
985
-
1000
)
38
Soundararajan
R.
Rao
A. J.
Trophoblast ‘pseudo-tumorigenesis’: significance and contributory factors
Reprod. Biol. Endocrinol.
2004
, vol. 
2
 pg. 
15
 
39
Pekarsky
Y.
Santanam
U.
Cimmino
A.
Palamarchuk
A.
Efanov
A.
Maximov
V.
Volinia
S.
Alder
H.
Liu
C. G.
Rassenti
L.
, et al. 
Tcl1 expression in chronic lymphocytic leukemia is regulated by miR-29 and miR-181
Cancer Res.
2006
, vol. 
66
 (pg. 
11590
-
11593
)
40
Yanaihara
N.
Caplen
N.
Bowman
E.
Seike
M.
Kumamoto
K.
Yi
M.
Stephens
R. M.
Okamoto
A.
Yokota
J.
Tanaka
T.
, et al. 
Unique microRNA molecular profiles in lung cancer diagnosis and prognosis
Cancer Cell
2006
, vol. 
9
 (pg. 
189
-
198
)
41
Gebeshuber
C. A.
Zatloukal
K.
Martinez
J.
miR-29a suppresses tristetraprolin, which is a regulator of epithelial polarity and metastasis
EMBO Rep.
2009
, vol. 
10
 (pg. 
400
-
405
)
42
Soleymanlou
N.
Jurisicova
A.
Wu
Y.
Chijiiwa
M.
Ray
J. E.
Detmar
J.
Todros
T.
Zamudio
S.
Post
M.
Caniggia
I.
Hypoxic switch in mitochondrial myeloid cell leukemia factor-1/Mtd apoptotic rheostat contributes to human trophoblast cell death in preeclampsia
Am. J. Pathol.
2007
, vol. 
171
 (pg. 
496
-
506
)
43
Ray
J.
Jurisicova
A.
Caniggia
I.
The dynamic role of Bcl-2 family members in trophoblast cell fate
Placenta
2009
, vol. 
30
 
Suppl. A
(pg. 
S96
-
S100
)
44
Mendilcioglu
I.
Karaveli
S.
Erdogan
G.
Simsek
M.
Taskin
O.
Ozekinci
M.
Apoptosis and expression of Bcl-2, Bax, p53, caspase-3, and Fas, Fas ligand in placentas complicated by preeclampsia
Clin. Exp. Obstet. Gynecol.
2011
, vol. 
38
 (pg. 
38
-
42
)
45
Huisman
M. A.
Timmer
A.
Zeinstra
M.
Serlier
E. K.
Hanemaaijer
R.
Goor
H.
Erwich
J. J.
Matrix-metalloproteinase activity in first trimester placental bed biopsies in further complicated and uncomplicated pregnancies
Placenta
2004
, vol. 
25
 (pg. 
253
-
258
)
46
Jovanovic
M.
Stefanoska
I.
Radojcic
L.
Vicovac
L.
Interleukin-8 (CXCL8) stimulates trophoblast cell migration and invasion by increasing levels of matrix metalloproteinase (MMP)2 and MMP9 and integrins α5 and β1
Reproduction
2010
, vol. 
139
 (pg. 
789
-
798
)
47
Ferrara
N.
Vascular endothelial growth factor as a target for anticancer therapy
Oncologist
2004
, vol. 
9
 
Suppl. 1
(pg. 
2
-
10
)
48
Levine
R. J.
Maynard
S. E.
Qian
C.
Lim
K. H.
England
L. J.
Yu
K. F.
Schisterman
E. F.
Thadhani
R.
Sachs
B. P.
Epstein
F. H.
, et al. 
Circulating angiogenic factors and the risk of preeclampsia
N. Engl. J. Med.
2004
, vol. 
350
 (pg. 
672
-
683
)
49
Lala
P. K.
Chakraborty
C.
Factors regulating trophoblast migration and invasiveness: possible derangements contributing to pre-eclampsia and fetal injury
Placenta
2003
, vol. 
24
 (pg. 
575
-
587
)
50
Prast
J.
Saleh
L.
Husslein
H.
Sonderegger
S.
Helmer
H.
Knofler
M.
Human chorionic gonadotropin stimulates trophoblast invasion through extracellularly regulated kinase and AKT signaling
Endocrinology
2008
, vol. 
149
 (pg. 
979
-
987
)
51
Ilic
D.
Genbacev
O.
Jin
F.
Caceres
E.
Almeida
E. A.
Bellingard-Dubouchaud
V.
Schaefer
E. M.
Damsky
C. H.
Fisher
S. J.
Plasma membrane-associated pY397FAK is a marker of cytotrophoblast invasion in vivo and in vitro
Am. J. Pathol.
2001
, vol. 
159
 (pg. 
93
-
108
)
52
Luo
L.
Ye
G.
Nadeem
L.
Fu
G.
Yang
B. B.
Dunk
C.
Lye
S.
Peng
C.
MicroRNA-378a-5p promotes trophoblast cell survival, migration and invasion by targeting Nodal
J. Cell Sci.
2012
 
doi: 10.1242/jcs.096412
53
Chang
T. C.
Yu
D.
Lee
Y. S.
Wentzel
E. A.
Arking
D. E.
West
K. M.
Dang
C. V.
Thomas-Tikhonenko
A.
Mendell
J. T.
Widespread microRNA repression by Myc contributes to tumorigenesis
Nat. Genet.
2008
, vol. 
40
 (pg. 
43
-
50
)

Supplementary data