Vinexin-β is one of the adaptor proteins that are primarily involved in signal transduction and cytoskeletal organization under various pathological conditions, including cardiac hypertrophy. However, the role of Vinexin-β in myocardial infarction (MI) remains unknown. In this study, dramatically up-regulated Vinexin-β expression was observed in both ischaemic human hearts and infarcted animal hearts. To explore the potential involvement of Vinexin-β in MI further, we induced MI injury in global Vinexin-β-knockout mice and wild-type (WT) controls as well as in mice with cardiac-specific over-expression of the human Vinexin-β gene-transgenic (TG) and -non-transgenic (NTG) littermates. Compared with that observed in WT controls, Vinexin-β deficiency significantly decreased MI-induced infarct size, concomitant with an improved cardiac function, leading to an increase in the survival rate. The myocardial apoptosis in the border zone was dramatically reduced by Vinexin-β deficiency, resulting from the altered expression of apoptotic factors. Furthermore, Vinexin-β depletion mitigated the inflammatory response, as evidenced by reduced inflammatory cell infiltration, decreased expression of cytokines and the inactivation of NF-κB (nuclear factor κB) signalling. In contrast, Vinexin-β-TG mice were much more susceptible to MI injury compared with NTG controls. Further mechanism analyses suggested that Vinexin-β exerted detrimental effects largely dependent on blocking AKT signalling. The effects and mechanisms of Vinexin-β on MI observed in vivo were further confirmed by our in vitro assays. When collected, these data demonstrate for the first time that Vinexin-β increases MI-induced mortality and worsens cardiac dysfunction through aggravation of myocardial apoptosis and inflammatory response.

CLINICAL PERSPECTIVES

  • MI and the resultant heart failure are among the leading causes of global mortality. Thus, to clarify the mechanisms underlying the pathogenesis and progression of MI, is helpful to develop an effective therapeutic strategy for heart failure. Vinexin-β is an adaptor protein that is highly expressed in the heart and is involved in cardiac hypertrophy-induced heart damage. However, the role of Vinexin-β in MI is largely unknown.

  • The present study demonstrated that, as a novel regulator of MI injury, Vinexin-β could strikingly exacerbate inflammatory and apoptotic responses post-MI surgery, leading to worsened cardiac dysfunction and increased mortality. Conversely, Vinexin-β deficiency dramatically ameliorates MI-induced heart damage.

  • From a clinical perspective, counterbalance of the level of Vinexin-β represents a promising strategy for the prevention and therapy of MI-related cardiac diseases.

INTRODUCTION

Myocardial infarction (MI) and the resultant congestive heart failure are among the major causes of morbidity and mortality worldwide [1]. Once MI occurs, immune cells infiltrate into the infarcted myocardium, accompanied by increased secretion of inflammatory cytokines, e.g. tumour necrosis factor α (TNF-α), interleukin (IL)-1β and IL-6 [2,3]. The continuous inflammatory response leads directly to myocardial apoptosis [2,4,5], which is responsible for cardiomyocyte dropout during both the acute ischaemic and the chronic stages after MI [6,7]. Notably, even low levels of cardiac myocyte apoptosis are sufficient to trigger the development of heart failure [8], suggesting that anti-apoptotic and anti-inflammatory strategies would be of great therapeutic value in MI. Therefore, it is imperative to exploit potent molecular targets that regulate cardiomyocyte apoptosis after MI.

Vinexin belongs to an adaptor protein family that also includes c-Cbl-associated protein (CAP)/ponsin and arginine-binding protein 2 (ArgBP2) [9]. There are three isoforms of Vinexin, i.e. Vinexin-α, -β and -γ, sharing a C-terminal sequence containing three Src homology 3 (SH3) domains, with the first and second SH3 domains responsible for vinculin binding [10,11]. Based on these domains, these isoforms are mainly involved in signal transduction and actin cytoskeletal organization [12]. Vinexin-β differs from the other two isoforms in its highest expression level in the heart [10], implying that Vinexin-β has a potential functional role in cardiac dysfunction. Most recently, we determined that Vinexin-β plays a pivotal regulatory role in the pathogenesis of pressure-overload-induced pathological cardiac hypertrophy [13]. However, there are no reports describing the role of Vinexin-β in MI. Although pressure overload and myocardial ischaemia are both major contributors to heart failure, they trigger different cardiac pathological processes [14,15]. Therefore, it would be intriguing to investigate whether Vinexin-β plays a crucial role in the pathogenesis of MI-induced cardiac dysfunction.

In the present study, we investigated the role of Vinexin-β in MI using gain- and loss-of-function approaches, and determined that, compared with controls, mice with cardiac-specific over-expression of Vinexin-β developed more severe cardiac dysfunction on ischaemic stress, whereas Vinexin-β deficiency ameliorated this pathological process. Moreover, we provided evidence that the effect of Vinexin-β is greatly associated with inhibition of AKT signalling on ischaemic stress.

MATERIALS AND METHODS

Reagents

Antibodies against the following proteins were purchased from Cell Signaling Technology: Bax (#2772), Bcl-2 (#2870), cleaved caspase-3 (#9661), caspase-3 (#9662), ERK1/2 (#4695), p-ERK1/2Thr202/Tyr204 (#4370), MEK1/2 (#9122), p-MEK1/2Ser217/221 (#9154), JNK1/2 (#9258), p-JNK1/2Ser217/221 (#4668), p38 (#9212), p-p38Thr180/Thr182 (#4511), AKT (#4691), p-AKTSer473 (#4060), GSK-3β (#9315), p-GSK-3βS9Ser9 (#9322), FOXO3A (#2497), p-FOXO3ASer318/321 (#9465) and GAPDH (#2118). Anti-Vinexin-β (ab68222), anti-MAC1 (ab75476) and anti-CD3 (ab16669) were purchased from Abcam. The anti-LY6G (551459) antibody was purchased from BD Biosciences. The BCA protein assay kit (#23225) was purchased from Pierce (Thermo Scientific). Cell culture reagents and all other reagents were purchased from Life Technologies.

Human heart samples

Samples from failing human hearts were collected from the left ventricles (LVs) of hearts from patients with ischaemic heart disease (IHD) undergoing heart transplantation [patient 1: male, aged 74 years, cardiac troponin I (cTnI)=0.735 ng/ml; N-terminus of the prohormone brain natriuretic peptide (NT-proBNP–a blood test)=21 799 pg/ml; Holter: old inferior and anterior MI, ventricular aneurysm; ultrasonic cardiogram (UCG): left ventricular (LV) volume dilatation, regional wall motion abnormality (RWMA), ejection fraction (EF)=33%. Patient 2: male, aged 63 years, cTnI=3.963 ng/ml; electrocardiography (ECG): acute anterior and anteroseptal MI; UCG: LV volume dilatation, RWMA, ventricular aneurysm, EF=33%. Patient 3: male, aged 63 years, cTnI=0.047 ng/ml; NT-proBNP=4537 pg/ml; ECG: old extensive anterior MI; UCG: LV volume dilatation, RWMA, EF=25%. Patient 4: male, aged 52 years, ECG: ischaemic ST–T change on anteroseptal and inferior wall; UCG: LV volume dilatation, EF=33%. Patient 5: male, aged 58 years, NT-proBNP=4030 pg/ml; ECG: ST–T change; UCG: enlarged heart, decreased amplitude of LV wall motion, EF=15%). Control samples were obtained from the LVs of healthy heart donors who died as a result of accidents but whose hearts failed to match for transplantation, which were the same samples as we had published previously [1619]. Written informed consent was obtained from the patients and the families of the donors, and all experiments using human samples were approved by the Human Research Ethics Committee of Renmin Hospital of Wuhan University.

Experimental animals and MI mouse model

The animal protocol was approved by the Animal Care and Use Committee of Renmin Hospital of Wuhan University. The Vinexin-β-knockout (KO) mice were generously provided by the RIKEN Bio Resource Center (BRC). Transgenic (TG) mice expressing full-length human Vinexin-β cDNA, under the control of the α-myosin heavy chain (α-MHC) promoter, were created, as reported previously [13]. Male Vinexin-β-KO mice, Vinexin-β-TG mice and their respective controls [wild-type (WT) and non-transgenic (NTG) littermates] aged 8–10 weeks with body weights of 23–27 g were included and randomly grouped for the experiments described below.

The left anterior descending (LAD) coronary artery ligation was performed as described previously [20]. Briefly, mice were anaesthetized with sodium pentobarbital (90 mg/kg, P3761, Sigma–Aldrich) by intraperitoneal injection and were ventilated with a small animal ventilator (model VFA-23-BV, Kent Scientific). Anaesthesia was thought to be adequate when the pedal withdrawal reflex was negative. The pericardium of each mouse was opened after thoracotomy, and the LAD was encircled and ligated using a 7/0 silk suture. Sham-operated mice underwent the same surgical procedure without ligation of the LAD. After full recovery, the animals were returned to independently ventilated cages. All animals that died within 24 h of surgery were excluded. During the 1-week follow-up, animal deaths were recorded. For tissue collection, the mice were killed with an overdose of anaesthetic (sodium pentobarbital 180 mg/kg, intraperitoneal injection). The surgery and subsequent analyses were carried out in a blinded fashion.

Echocardiography and invasive haemodynamic measurement

As reported previously [18,19,21], cardiac structure and function were monitored non-invasively by echocardiography and invasively by haemodynamic measurement via pressure–volume loop analysis at 1 week after MI. Briefly, echocardiography was performed under isoflurane anaesthesia using a MyLab 30CV ultrasound system (Biosound Esaote) with a 15-MHz linear-array transducer. The LV end-systolic diameter (LVESD), LV end-diastolic diameter (LVEDD), and septal and LV wall thicknesses were obtained and used to calculate the percentage of fractional shortening (FS%).

Cardiac haemodynamics were measured under isoflurane anaesthesia with a 1.4-F microtip catheter (SPR-839; Millar Instruments) inserted into the right carotid artery and advanced into the LV. After stabilization for 15 min, the heart rate and pressure–volume signals were recorded continuously with a pressure–volume conductance system (MPVS-300 Signal Conditioner, Millar Instruments) in a stable state during different cardiac cycles. The results were analysed with Chart 5.0 software as described previously [18,19,21].

Histological analysis and determination of LV infarct size

After animals were killed, the hearts were excised, infused with 10% potassium chloride to achieve diastolic cardiac arrest and subsequently fixed in 10% formalin. The hearts were then embedded in paraffin and cut serially from the apex to the base. Sections (5 μm) were stained with haematoxylin and eosin (H&E) for histopathology and determination of LV infarct size. The infarcted area of the LV was measured using a quantitative digital image analysis system (Image-Pro Plus 6.0, Media Cybernetics). The infarct size was expressed as a percentage of the infarcted area in relation to the total LV area.

Immunofluorescence staining

To detect inflammatory cell infiltration, sections were stained using standard immunofluorescence staining procedures. Briefly, paraffin sections were prepared, dried, de-waxed, hydrated and repaired at high pressure. Then, the sections were rinsed with double-distilled water and PBS, blocked with 10% goat serum and incubated with the following primary antibodies overnight at 4°C: anti-CD3 (CD3+ lymphocytes), anti-LY6G (neutrophils) and anti-MAC1 (macrophages). After rinsing in PBS, the slides were incubated with the indicated secondary antibodies for 1 h at room temperature and subsequently washed in PBS. The following secondary antibodies were used: donkey anti-rabbit IgG (H+L)–Alexa Fluor 568 (A10042, Invitrogen), donkey anti-mouse IgG (H+L)–Alexa Fluor 488 (A21202, Invitrogen) and anti-rat IgG (H+L)–Alexa Fluor 555 (#4417, Cell Signaling Technology). The nuclei were stained with DAPI (S36939, Invitrogen). Quantitative assessments of MAC1-, LY6G- and CD3-positive cells were performed by at least two independent investigators in three to five randomly selected fields for each heart, using a quantitative digital image analysis system (Image-Pro Plus 6.0).

Cell culture and hypoxia exposure

Neonatal rat cardiomyocytes (NRCMs) were prepared from neonatal Sprague–Dawley rats (1–2 days old) as described previously [13,20]. To isolate the cardiomyocytes, heart tissue from neonatal rats was excised and digested in PBS containing 0.03% trypsin and 0.04% collagenase type II. The collected cardiomyocytes were then seeded at a density of 1×106 cells/well in six-well culture plates, with F10 medium supplemented with 10% FBS and penicillin/streptomycin. After 48 h, the culture medium was replaced with F10 medium containing 0.1% FBS and 0.1 mM bromodeoxyuridine. Subsequently, the NRCMs were infected with adenoviral short hairpin Vinexin-β (AdshVinexin-β) to silence Vinexin-β or with adenoviral Vinexin-β (AdVinexin-β) to over-express it. Alternatively, NRCMs were co-infected with AdshVinexin-β and AddnAKT (adenovirus expressing dominant-negative mutant of AKT) or with AdVinexin-β and AdcaAKT (adenovirus expressing constitutively active AKT), respectively, according to previous reports [13]. Next, the cells were exposed to hypoxic stimulation in a Biospherix C-Chamber (model C-274) inside a standard culture chamber with an atmosphere of 5% O2, 5% CO2 and 90% N2 maintained by the ProOx 110 oxygen controller and the ProCO2 controller (Biospherix). Cell viability was assessed using a cell counting kit (CCK8, 96992, Sigma–Aldrich) and a colorimetric lactate dehydrogenase (LDH) cytotoxicity assay (G1782, Promega) according to the manufacturer's instructions.

Determination of cell death

Terminal deoxynucleotidyltransferase-mediated dUTP nick-end labelling (TUNEL) was used to detect apoptotic cardiomyocytes using the ApopTag Plus Fluorescein In Situ Apoptosis Detection Kit (#S7111, Millipore) according to the manufacturer's recommendations. The TUNEL-positive cells in the border zone (defined as 1- to 2-mm sectors immediately adjacent to the infarct zone) were evaluated in five to seven different fields under a ×40 microscope objective.

Hoechst 33258/propidium iodide (PI) double staining was used for the determination of cell death in vitro. Briefly, primary NRCMs were subjected to hypoxia for 24 h followed by fixation with 4% paraformaldehyde for 15 min at 37°C. Subsequently, the cells were successively stained with Hoechst 33258 (H3569, Invitrogen) and PI (P4864, Sigma–Aldrich). Finally, the slides were sealed with glycerol and photographed using a fluorescence microscope.

Real-time quantitative reverse transcription–PCR and Western blot analysis

Real-time quantitative reverse transcription–PCR (qRT-PCR) and Western blotting were performed as previously described [18,19,21]. In brief, the TRIzol Reagent (Invitrogen) was used for total RNA isolation from the border zone of the ventricles. A Transcriptor First Strand cDNA Synthesis Kit (04896866001, Roche) with oligo(dT) primers was used for reverse transcription of RNA into cDNA. LightCycler 480 SYBR Green I Master Mix (04707516001, Roche) was used for transcript amplification. Each result was then normalized to glyceraldehyde-3-phosphate dehydrogenase (GAPDH) gene expression. The primers used for qRT-PCR are as follows: Bad-Mouse: forward CCAGAGTTTGAGCCGAGTGAGCA; reverse ATAGCCCCTGCGCCTCCATGAT; Bak-Mouse: forward CCCAGGACACAGAGGAGGTC, reverse GCCCAACAGAACCACACCAAAA; Bax-Mouse: forward GCCCAACAGAACCACACCAAAA, reverse GCACTTTAGTGCACAGGGCCTTG; Bcl-2-Mouse: forward TGGTGGACAACATCGCCCTGTG, reverse GGTCGCATGCTGGGGCCATATA; Survivin-Mouse: forward TTGGCGGAGGTTGTGGTGACGCCAT, reverse TCGGGTTGTCATCGGGTTCCCAGCCTT.

For Western blotting, total protein was extracted from frozen tissue samples of the border zone of LVs and primary myocyte cells. The BCA protein assay kit was used to determine the protein concentration. After the protein extracts (50 μg) were fractionated by SDS/PAGE, they were transferred on to nitrocellulose membranes and probed with various primary antibodies. The membranes were then incubated with a corresponding secondary antibody, i.e. horseradish peroxidase-conjugated AffiniPure Goat Anti-Mouse IgG (H+L) (115-035-003) or horseradish peroxidase-conjugated AffiniPure Goat Anti-Rabbit IgG (H+L) (111-035-003) (Jackson Immuno-Research), for 1 h and subsequently treated with ECL reagents (#170-5060/5061, Bio-Rad Laboratories) before using a Bio-Rad ChemiDoc XRS+ for visualization according to the manufacturer's instructions. The specific protein expression levels were normalized to GAPDH.

Statistical analysis

The results are presented as means±S.D. Differences between groups were evaluated using ANOVA followed by an unpaired Student's t-test, or ANOVA with the appropriate post-hoc test to determine statistical significance. Survival analysis was performed using the Kaplan–Meier method. A P value <0.05 was considered to be statistically significant.

RESULTS

Vinexin-β expression is up-regulated in human ischaemic hearts and murine ischaemic hearts

To investigate the role of Vinexin-β in the pathogenesis of MI, we first examined Vinexin-β expression in the LVs of patients with IHD undergoing heart transplantation due to end-stage heart failure. The Western blot results revealed that the protein levels of Vinexin-β were 40.17% greater in the heart failure samples compared with donor hearts (Figure 1A). In parallel, after 1 and 4 weeks of MI in the murine hearts, the protein levels of Vinexin-β progressively increased in the myocardium from the border zone (Figure 1B). These data imply a potential role for Vinexin-β in the regulation of MI.

Increased Vinexin-β expression in human hearts from patients with IHD and infarcted mouse hearts

Figure 1
Increased Vinexin-β expression in human hearts from patients with IHD and infarcted mouse hearts

(A) Representative Western blots of Vinexin-β in hearts from normal donors (n=6) and patients with IHD (n=5). (B) Western blot analysis of Vinexin-β in hearts from C57BL/6J mice subjected to MI at the indicated time points (n=4 at each time point). Top, representative blots; bottom, quantitative results. *P<0.05 vs normal donors or sham hearts.

Figure 1
Increased Vinexin-β expression in human hearts from patients with IHD and infarcted mouse hearts

(A) Representative Western blots of Vinexin-β in hearts from normal donors (n=6) and patients with IHD (n=5). (B) Western blot analysis of Vinexin-β in hearts from C57BL/6J mice subjected to MI at the indicated time points (n=4 at each time point). Top, representative blots; bottom, quantitative results. *P<0.05 vs normal donors or sham hearts.

Vinexin-β aggravates the outcomes of MI surgery

The altered expression of Vinexin-β after MI prompted us to investigate the functional role of Vinexin-β in MI. To this end, global Vinexin-β-KO mice were utilized and an MI model was successfully established in these mice and their WT controls. In the first 7 days post-MI, a much lower mortality rate was observed in Vinexin-β-KO mice compared with WT controls. As shown in Figure 2(A), only 17 of 34 WT mice (50%) survived up to 7 days post-MI, whereas 22 of 27 KO mice (81.48%) survived. To investigate the causes responsible for better survival in the KO mice, infarct size and cardiac function were analysed post-MI. At 1 week after MI, compared with WT mice, knockout of Vinexin-β was associated with significantly decreased infarct size in the heart cross-sections (13.9±1.1% in WT group vs 8.3±1.2% in the KO group, P <0.05; Figures 2B and 2C). Furthermore, a cardiac catheterization test and echocardiographic analysis revealed that Vinexin-β depletion dramatically improved cardiac systolic and diastolic functions post-MI. As shown in Figure 2(D), the LVEF (EF%), FS%, dP/dtmax and dP/dtmin were significantly improved in KO mice compared with those of WT controls. Taken together, these data indicate that Vinexin-β deficiency could reduce MI-induced mortality, infarct size and cardiac dysfunction.

Vinexin-β increases mortality and infarct size after an MI

Figure 2
Vinexin-β increases mortality and infarct size after an MI

(A) Comparison of post-MI mortality between WT and Vinexin-β-KO mice. (B and C) Measurement of infarct size using H&E staining in WT and Vinexin-β-KO mice at 7 day after MI (n=5–7). *P<0.05 vs WT/MI group. (D) Cardiac function was measured by echocardiographic and haemodynamic assessments in WT and Vinexin-β-KO mice after MI (n=7–10). *P<0.05 vs WT/sham group; #P<0.05 vs WT/MI group. (E) Mortality rate of NTG and Vinexin-β-TG mice at 7 days post-MI. (F and G) Determination of infarct size by H&E staining in NTG and Vinexin-β-TG mice at 7 day after MI (n=5–7). *P<0.05 vs NTG/MI group. (H) Comparisons of cardiac function as measured by echocardiographic and haemodynamic assessments between NTG and Vinexin-β-TG mice after MI (n=7–10). *P<0.05 vs NTG/sham group; #P<0.05 vs NTG/MI group.

Figure 2
Vinexin-β increases mortality and infarct size after an MI

(A) Comparison of post-MI mortality between WT and Vinexin-β-KO mice. (B and C) Measurement of infarct size using H&E staining in WT and Vinexin-β-KO mice at 7 day after MI (n=5–7). *P<0.05 vs WT/MI group. (D) Cardiac function was measured by echocardiographic and haemodynamic assessments in WT and Vinexin-β-KO mice after MI (n=7–10). *P<0.05 vs WT/sham group; #P<0.05 vs WT/MI group. (E) Mortality rate of NTG and Vinexin-β-TG mice at 7 days post-MI. (F and G) Determination of infarct size by H&E staining in NTG and Vinexin-β-TG mice at 7 day after MI (n=5–7). *P<0.05 vs NTG/MI group. (H) Comparisons of cardiac function as measured by echocardiographic and haemodynamic assessments between NTG and Vinexin-β-TG mice after MI (n=7–10). *P<0.05 vs NTG/sham group; #P<0.05 vs NTG/MI group.

To further confirm the potential deleterious effects of Vinexin-β on MI-induced heart damage, the TG mice with cardiac-specific over-expression of the human Vinexin-β gene were subjected to MI surgery and the outcomes of MI were compared with those in NTG littermates. As expected, Vinexin-β over-expression led to an increased mortality rate after MI; 48.3% of mice survived 7 days after MI in the NTG group, whereas only 25.0% of Vinexin-β-TG mice survived (Figure 2E). Further analysis revealed that the increased mortality rate was associated with increased infarct size (10.7±3.1% in the NTG group vs 21.2±2.6% in the TG group, P <0.05, Figures 2F and 2G) and aggravated cardiac dysfunction as demonstrated by decreased FS%, EF%, dP/dtmax and dP/dtmin at 7 day post-MI (Figure 2H). However, it is interesting that, at baseline, neither the KO nor the TG mice manifested structural or functional cardiac abnormalities compared with their WT or NTG controls [13]. Collectively, these results demonstrate that Vinexin-β could increase post-MI mortality rates, promote infarct size and cause deterioration of cardiac dysfunction.

Vinexin-β exacerbates myocardial apoptosis in the border zone post-MI

Apoptosis is a major contributor to mortality and infarct size after MI [8]. Thus, we investigated whether Vinexin-β affects myocardial apoptosis in the border zone by using TUNEL staining. After the sham operation, the TUNEL-positive cardiomyocytes were very low (<0.1%) and similar in all the sham groups. However, after MI, the number of apoptotic cells was significantly lower in Vinexin-β-KO hearts compared with WT controls (Figure 3A), whereas significantly more apoptotic cells were observed in Vinexin-β-TG hearts compared with NTG controls (Figure 3D).

Vinexin-β increases apoptosis and regulates expression of apoptosis-related genes in response to MI in vivo

Figure 3
Vinexin-β increases apoptosis and regulates expression of apoptosis-related genes in response to MI in vivo

(A and D) Myocardial apoptosis measured by TUNEL staining in heart sections from (A) WT and Vinexin-β-KO mice and (D) NTG and Vinexin-β-TG mice after MI (n=5–7). *P<0.05 vs WT or NTG/MI. (B and E) qRT-PCR results showing mRNA levels of Bax, Bad, Bak, Bcl-2 and survivin in hearts from (B) WT and Vinexin-β-KO mice and (E) NTG and Vinexin-β-TG mice at 7 days after MI induction (n=4). *P<0.05 vs WT or NTG/sham; #P<0.05 vs WT or NTG/MI. (C and F) Western blot and quantitative analysis showing the protein levels of Bax, Bcl-2 and cleaved caspase-3 in (C) WT and Vinexin-β-KO mice and (F) NTG and Vinexin-β-TG mice at 7 day post-MI (n=7–15). Left panel, representative Western blots. Right panel, semi-quantitative results. *P<0.05 vs WT or NTG/sham; #P<0.05 vs WT or NTG/MI.

Figure 3
Vinexin-β increases apoptosis and regulates expression of apoptosis-related genes in response to MI in vivo

(A and D) Myocardial apoptosis measured by TUNEL staining in heart sections from (A) WT and Vinexin-β-KO mice and (D) NTG and Vinexin-β-TG mice after MI (n=5–7). *P<0.05 vs WT or NTG/MI. (B and E) qRT-PCR results showing mRNA levels of Bax, Bad, Bak, Bcl-2 and survivin in hearts from (B) WT and Vinexin-β-KO mice and (E) NTG and Vinexin-β-TG mice at 7 days after MI induction (n=4). *P<0.05 vs WT or NTG/sham; #P<0.05 vs WT or NTG/MI. (C and F) Western blot and quantitative analysis showing the protein levels of Bax, Bcl-2 and cleaved caspase-3 in (C) WT and Vinexin-β-KO mice and (F) NTG and Vinexin-β-TG mice at 7 day post-MI (n=7–15). Left panel, representative Western blots. Right panel, semi-quantitative results. *P<0.05 vs WT or NTG/sham; #P<0.05 vs WT or NTG/MI.

To further confirm the pro-apoptotic properties of Vinexin-β, the mRNA and protein levels of apoptosis- and survival-related factors were evaluated. The qRT-PCR results revealed significantly higher mRNA levels of the anti-apoptotic gene Bcl-2 and survinin, whereas decreased transcriptions of the pro-apoptotic genes Bax, Bad and Bak was observed in Vinexin-β-KO hearts compared with WT controls (Figure 3B). In agreement with the qRT-PCR results, Western blot analyses revealed that Vinexin-β-KO preserved the expression of the anti-apoptotic protein Bcl-2 and diminished the expression of the pro-apoptotic protein Bax and cleaved-caspase-3 (Figure 3C). In contrast, in hearts from TG mice, the mRNA and/or protein expressions of Bax, Bad, Bak and cleaved-caspase-3 were dramatically up-regulated, whereas the levels of Bcl-2 and survivin were significantly down-regulated compared with those in NTG hearts (Figures 3E and 3F).

Vinexin-β promotes hypoxia-induced cardiomyocyte death

To confirm that Vinexin-β is directly involved in cardiomyocyte death, we tested whether Vinexin-β promotes cell death in NRCMs exposed to hypoxia. Cultured primary NRCMs were infected with AdshVinexin-β to silence Vinexin-β or with AdVinexin-β to over-express it. Subsequently, the transfected cells were exposed to hypoxic conditions for 24 h. Consistent with the in vivo results, Vinexin-β significantly promoted hypoxia-induced cell death and regulated apoptosis-related protein expression in cardiomyocytes after stimulation of hypoxia. As shown in Figures 4(A) and 4(C), AdshVinexin-β infection resulted in decreased numbers of PI-positive cells, enhanced cell viability and reduced LDH release. Accordingly, an elevated level of the anti-apoptotic protein Bcl-2, and decreased levels of the pro-apoptotic protein Bax and cleaved-caspase-3, were investigated in AdshVinexin-β infection compared with adenovirus-expressing shRNA (AdshRNA) controls (Figure 4E). Conversely, AdVinexin-β infection led to more PI-positive cells, lower cell viability, significantly higher levels of pro-apoptotic proteins and lower levels of Bcl-2 than in adenovirus-containing GFP (AdGFP)-infected cardiomyocytes at 24h post-hypoxia (Figures 4B, 4D and 4F). Collectively, these data suggest that Vinexin-β could directly promote the death of primary cardiomyocytes, which is associated with the altered expression of apoptosis-related proteins.

Vinexin-β increases cell death and modulates expression of apoptosis-related genes in response to hypoxia in vitro

Figure 4
Vinexin-β increases cell death and modulates expression of apoptosis-related genes in response to hypoxia in vitro

(A and B) Double staining of NRCMs with Hoechst 33258 and PI, which was performed on NRCMs infected with (A) AdshVinexin-β and (B) AdVinexin-β adenoviral vectors after exposure to hypoxia for 24 h (three independent experiments). (C and D) Determination of cell viability and cell toxicity by CCK8 assay and LDH release in NRCMs with (C) Vinexin-β knockdown or (D) over-expression after exposure to hypoxia for 24 h (three independent experiments). *P<0.05 vs AdshRNA or AdGFP/normoxia; #P<0.05 vs AdshRNA or AdGFP/hypoxia. (E and F) Representative Western blot results showing the protein levels of Bax, Bcl-2 and cleaved caspase-3 in NRCMs infected with (E) AdshVinexin-β and (F) AdVinexin-β after 24 h of hypoxia (three independent experiments). Top panel, representative Western blot. Bottom panel, quantitative results. *P<0.05 vs AdshRNA or AdGFP/normoxia; #P<0.05 vs AdshRNA or AdGFP/hypoxia.

Figure 4
Vinexin-β increases cell death and modulates expression of apoptosis-related genes in response to hypoxia in vitro

(A and B) Double staining of NRCMs with Hoechst 33258 and PI, which was performed on NRCMs infected with (A) AdshVinexin-β and (B) AdVinexin-β adenoviral vectors after exposure to hypoxia for 24 h (three independent experiments). (C and D) Determination of cell viability and cell toxicity by CCK8 assay and LDH release in NRCMs with (C) Vinexin-β knockdown or (D) over-expression after exposure to hypoxia for 24 h (three independent experiments). *P<0.05 vs AdshRNA or AdGFP/normoxia; #P<0.05 vs AdshRNA or AdGFP/hypoxia. (E and F) Representative Western blot results showing the protein levels of Bax, Bcl-2 and cleaved caspase-3 in NRCMs infected with (E) AdshVinexin-β and (F) AdVinexin-β after 24 h of hypoxia (three independent experiments). Top panel, representative Western blot. Bottom panel, quantitative results. *P<0.05 vs AdshRNA or AdGFP/normoxia; #P<0.05 vs AdshRNA or AdGFP/hypoxia.

Vinexin-β enlarges MI-triggered inflammatory response

Considering that the inflammatory response is another major contributor to ischaemic cardiac injury, resulting from its important impact on triggering myocardial apoptosis [2224], we determined the effects of Vinexin-β on the inflammatory response in the infarcted heart. As shown in Figure 5(A), the MAC1-positive macrophages, LY6G-positive neutrophils and CD3-positive T-cells migrated to and accumulated in the border zone of the hearts of WT and NTG mice after MI. Vinexin-β depletion led to a dramatically reduced accumulation of these cell types (Figures 5A and 5B), whereas the infiltration of these inflammatory cells was significantly increased by cardiac-specific Vinexin-β over-expression (Figures 5A and 5C). In addition, the production of IL-1β, TNF-α and IL-6 was consistently and markedly attenuated in the heart tissue of Vinexin-β-KO mice compared with WT controls (Figure 5D), but significantly elevated in the Vinexin-β-TG hearts compared with NTG hearts (Figure 5E). These results suggest that Vinexin-β exerts a pro-inflammatory effect after MI.

Vinexin-β augmented the inflammatory response after MI

Figure 5
Vinexin-β augmented the inflammatory response after MI

(A) Representative images of macrophage, neutrophil and T-cell accumulation measured by immunofluorescence staining for MAC1, LY6G and CD3 in the hearts of WT and Vinexin-β-KO mice, and in NTG and Vinexin-β-TG mice at 7 day after MI. (B and C) Quantitative analysis of inflammatory and immune cell infiltration in hearts from (B) WT and Vinexin-β-KO mice and (C) NTG and Vinexin-β-TG mice at 7 day post-MI (n=5–7). *P<0.05 vs WT or NTG/MI. (D and E) The mRNA levels of IL-1β, IL-6 and TNF-α measured by qRT-PCR in heart tissues from (D) WT and Vinexin-β-KO mice and (E) NTG and Vinexin-β-TG mice at 7 day after MI (n=4). (F and G) Western blot results showing the levels of total and phosphorylated p65 and IκBα in (F) WT and Vinexin-β-KO mice and (G) NTG and Vinexin-β-TG mice (n=7–15). Top panel: representative blots. Bottom panel: quantitative analysis. *P<0.05 vs WT or NTG/sham; #P<0.05 vs WT or NTG/MI.

Figure 5
Vinexin-β augmented the inflammatory response after MI

(A) Representative images of macrophage, neutrophil and T-cell accumulation measured by immunofluorescence staining for MAC1, LY6G and CD3 in the hearts of WT and Vinexin-β-KO mice, and in NTG and Vinexin-β-TG mice at 7 day after MI. (B and C) Quantitative analysis of inflammatory and immune cell infiltration in hearts from (B) WT and Vinexin-β-KO mice and (C) NTG and Vinexin-β-TG mice at 7 day post-MI (n=5–7). *P<0.05 vs WT or NTG/MI. (D and E) The mRNA levels of IL-1β, IL-6 and TNF-α measured by qRT-PCR in heart tissues from (D) WT and Vinexin-β-KO mice and (E) NTG and Vinexin-β-TG mice at 7 day after MI (n=4). (F and G) Western blot results showing the levels of total and phosphorylated p65 and IκBα in (F) WT and Vinexin-β-KO mice and (G) NTG and Vinexin-β-TG mice (n=7–15). Top panel: representative blots. Bottom panel: quantitative analysis. *P<0.05 vs WT or NTG/sham; #P<0.05 vs WT or NTG/MI.

As nuclear factor κB (NF-κB) signalling activation is largely responsible for the inflammatory response during progression of MI [25], we examined the effect of Vinexin-β on MI-induced activation of the NF-κB pathway. The elevated phosphorylation level of the NF-κB family member p65 and degradation of inhibitor of NF-κB α (IκBα) were less prominently elevated in Vinexin-β-KO mice compared with WT mice post-MI (Figure 5F), whereas the Vinexin-β-TG mice exhibited a more drastic phosphorylation of p65 and degradation of IκBα compared with NTG mice (Figure 5G), implying that Vinexin-β promotes an inflammatory response through activation of the NF-κB pathway after MI.

Vinexin-β negatively regulates AKT signalling in ischaemic hearts and hypoxic cardiomyocytes

Next, we were very interested in characterizing the downstream effectors that might account for the observed deleterious effect exerted by Vinexin-β after MI. First, the MAPK (mitogen-activated protein kinase) cascade, which is known to be involved in the MI response and could be governed by a Vinexin member [26,27], was examined to see whether it could be affected by Vinexin-β in hearts responding to MI. As shown in Figures 6(A) and 6(B), the levels of phosphorylated MAPK/ERK kinase (MEK) 1/2, extracellular-signal-regulated kinase (ERK) 1/2, c-Jun N-terminal kinase (JNK) and p38 were elevated in response to ischaemic stress. However, no significant difference was observed between Vinexin-β-KO and WT mice or between Vinexin-β-TG and NTG mice post-MI. These data indicate that there are other signalling pathways in Vinexin-β-regulated MI injury, and thus we further examined whether the function of Vinexin-β in MI progression is associated with AKT signalling, a molecular event that participates in Vinexin-β-mediated cardiac hypertrophy and in cell survival [13]. It was observed that the levels of phosphorylated AKT, glycogen synthase kinase 3β (GSK-3β) and forkhead box O3A (FOXO3A) were significantly higher in Vinexin-β-KO mice than in WT controls, whereas Vinexin-β over-expression greatly inactivated the phosphorylation levels of those proteins in AKT signalling compared to that in NTG mice (Figure 6C).

Vinexin-β exerts deleterious effects after MI through inactivation of the AKT signalling pathway

Figure 6
Vinexin-β exerts deleterious effects after MI through inactivation of the AKT signalling pathway

(A and B) Western blot results of phosphorylated and total MEK1/2, ERK1/2, JNK1/2 and p38 protein levels from (A) WT and Vinexin-β-KO mice and (B) NTG and Vinexin-β-TG mice at 7 day post-MI (n=7–15). (C) Representative Western blot results of phosphorylated and total AKT, FOXO3A and GSK-3β protein levels from WT and Vinexin-β-KO mice or in NTG and TG mice at 7 day after MI (n=7–15). Bottom panel: quantitative analysis. *P<0.05 vs WT or NTG/MI. (D) Western blot results showing the levels of phosphorylated and total AKT, FOXO3A and GSK-3β in NRCMs infected with AdshVinexin-β or AdVinexin-β after 24 h of hypoxia (three independent experiments). Bottom panel: quantitative analysis. *P<0.05 vs AdshRNA or AdGFP/hypoxia. (E) The cell viability and LDH release of AdshRNA-, AdshVinexin-β-, AddnAKT- or AdshVinexin-β+AddnAKT-infected cardiomyocytes after exposure to hypoxia for 24 h. (F) The cell viability and LDH release of cardiomyocytes infected with AdGFP, AdVinexin-β, AdcaAKT or AdVinexin-β+AdcaAKT and treated with hypoxia for 24 h. Histograms quantify three independent experiments. *P<0.05 vs AdshRNA or AdGFP/hypoxia; #P<0.05 vs AdshVinexin-β or AdVinexin-β/hypoxia.

Figure 6
Vinexin-β exerts deleterious effects after MI through inactivation of the AKT signalling pathway

(A and B) Western blot results of phosphorylated and total MEK1/2, ERK1/2, JNK1/2 and p38 protein levels from (A) WT and Vinexin-β-KO mice and (B) NTG and Vinexin-β-TG mice at 7 day post-MI (n=7–15). (C) Representative Western blot results of phosphorylated and total AKT, FOXO3A and GSK-3β protein levels from WT and Vinexin-β-KO mice or in NTG and TG mice at 7 day after MI (n=7–15). Bottom panel: quantitative analysis. *P<0.05 vs WT or NTG/MI. (D) Western blot results showing the levels of phosphorylated and total AKT, FOXO3A and GSK-3β in NRCMs infected with AdshVinexin-β or AdVinexin-β after 24 h of hypoxia (three independent experiments). Bottom panel: quantitative analysis. *P<0.05 vs AdshRNA or AdGFP/hypoxia. (E) The cell viability and LDH release of AdshRNA-, AdshVinexin-β-, AddnAKT- or AdshVinexin-β+AddnAKT-infected cardiomyocytes after exposure to hypoxia for 24 h. (F) The cell viability and LDH release of cardiomyocytes infected with AdGFP, AdVinexin-β, AdcaAKT or AdVinexin-β+AdcaAKT and treated with hypoxia for 24 h. Histograms quantify three independent experiments. *P<0.05 vs AdshRNA or AdGFP/hypoxia; #P<0.05 vs AdshVinexin-β or AdVinexin-β/hypoxia.

To provide further confirmation of the relationships of the AKT pathway and Vinexin-β-modulated MI outcomes, we subjected NRCMs to hypoxia after infection with either AdshVinexin-β and the AdshRNA control or AdVinexin-β and the AdGFP control. As shown in Figure 6(D), after 24 h of hypoxia, the protein expressions of phosphorylated AKT, GSK-3β and FOXO3A were higher in cells treated with AdshVinexin-β compared with cells receiving the AdshRNA treatment, whereas these protein levels were much lower in AdVinexin-β-infected NRCMs compared with the AdGFP controls. Furthermore, to evaluate the importance of AKT signalling in the regulation of MI by Vinexin-β, AddnAKT and AdcaAKT were co-infected with AdshVinexin-β and AdVinexin-β, respectively. Figure 6(E) indicated that, after infection with AddnAKT, the protective effects of AdshVinexin-β on hypoxia-induced cytotoxicity was strikingly reversed, whereas AdcaAKT largely reversed AdVinexin-β-induced exacerbation of cardiomyocyte damage (Figure 6F), as evidenced by the CCK8 and LDL release assays. Taken together, inhibition of the AKT signalling pathway is largely responsible for the detrimental effects of Vinexin-β on MI-induced heart damage.

DISCUSSION

This study characterized the adaptor molecule Vinexin-β as a novel mediator of the pathological process of MI. Vinexin-β expression was strongly induced in ischaemic human hearts and infarcted animal hearts. Vinexin-β deficiency improved survival and LV function, whereas cardiac-specific over-expression of Vinexin-β decreased survival and worsened LV function. Our findings also provide evidence of a role for Vinexin-β in the regulation of apoptosis and inflammation under ischaemic stress, beyond its well-established role in modulating cell migration. Furthermore, these effects of Vinexin-β are largely dependent on the inhibition of AKT signalling. To the best of our knowledge, these results provide the first direct evidence that Vinexin-β exacerbates cardiac dysfunction after MI. These data have important clinical implications for employing Vinexin-β inhibition in the treatment of ischaemic cardiac injury.

Vinexin-β is primarily involved in cytoskeletal organization, signal transduction and cell spreading [28]. Several reports have suggested that Vinexin-β is an important modulator of prostate cancer cell growth [29] and the wound-healing process [12]. We previously revealed that Vinexin-β was down-regulated and preserved cardiac function during the progression of cardiac hypertrophy by inhibiting cardiomyocyte hypertrophy and cardiac fibrosis [13]. However, in the current setting of myocardial ischaemia-induced heart failure, dramatically elevated Vinexin-β protein levels were detected in human and animal ischaemic hearts, and Vinexin-β increased the mortality rate and worsened cardiac dysfunction after MI. Although both pressure overload and myocardial ischaemia are the aetiologies of heart failure, different pathological processes are involved. Pressure-overload-induced heart failure is primarily accounted for by cardiomyocyte hypertrophy and cardiac fibrosis [13]. However, after MI, myocardial apoptosis and inflammation were important pathological events responsible for infarct size expansion and cardiac remodelling, ultimately leading to heart failure [30,31]. Thus, the discrepancy that Vinexin-β plays opposite roles in pressure-overload- and myocardial ischaemia-induced cardiac dysfunction appears to originate from the different pathogenesis involved in these diseases. Furthermore, our recently published data demonstrated that Vinexin-β could interact with AKT and inhibit its phosphorylation to ameliorate pressure overload-induced cardiac hypertrophy, which might also explain the vital role of Vinexin-β in cardiac damage post-MI, because AKT has the opposite role in cardiac hypertrophy and MI [13]. During pathological cardiac hypertrophy, the activation of AKT promotes the enlargement of cardiomyocytes, whereas AKT exhibits an anti-apoptotic property during IHD [32,33].

Apoptotic cells can be detected in the border zone after MI [6]. As the regenerative ability of the myocardium is limited, apoptosis essentially contributes to cardiomyocyte loss after MI. Apoptosis-induced cardiomyocyte loss is directly responsible for increased infarct size in IHD and the following cardiac dysfunction or even heart failure [34]. Thus, an effective attenuation of apoptosis contributes to reduced infarct size after MI [35]. In the present study, Vinexin-β was found to play a previously unrecognized role in the mediation of myocardial apoptosis, which extends beyond its commonly known role as a modulator of cell migration. In fact, apoptosis-induced cardiomyocyte loss is a common pathological process shared by many cardiomyopathy-related disorders [36]. Thus, our studies provide clues about the role of Vinexin-β in other types of apoptosis-related cardiomyopathies, such as dilated cardiomyopathy and peripartum cardiomyopathy.

The interruption of homoeostasis between pro- and anti-apoptosis-related proteins is the underlying cause of myocardial apoptosis after MI [37]. Strategies aimed at normalizing the balance between pro- and anti-apoptosis-related proteins have been shown to effectively inhibit myocardial apoptosis elicited by MI [38]. Our findings indicated that, on the one hand, Vinexin-β augmented the expression of pro-apoptotic proteins such as Bax, Bad and Bak; on the other hand, it suppressed the anti-apoptotic proteins Bcl-2 and survivin. However, it should be noted that the transcription of apoptosis-related factors occurs in the nucleus, whereas Vinexin-β is mainly localized in focal adhesions, suggesting the participation of certain cytoplasmic molecular programmes in the regulation of the apoptotic response by Vinexin-β. Among the intricate molecular events occurring in MI injury, AKT signalling has been highlighted for its role in regulating the expression of apoptosis-related proteins to promote cardiomyocyte survival [39,40]. Our results indicated that Vinexin-β inhibited AKT signalling, as indicated by the fact that Vinexin-β depletion augmented AKT, GSK-3β and FOXO3A phosphorylations, and that Vinexin-β over-expression attenuated the phosphorylated levels of these proteins. Thus, Vinexin-β appears to regulate apoptosis-related proteins at least partially via the inactivation of AKT signalling.

After an MI insult, inflammatory and immune cells infiltrate into the necrotic myocardium together with increased secretion of inflammatory mediators, including IL-1β, IL-6 and TNF-α [2,3]. Although post-infarction inflammation is important for the removal of necrotic myocytes and extracellular matrix debris [2,41], prolonged inflammation could directly promote myocardial apoptosis [2,4,5], and thereby exert a detrimental effect on the pathological process of MI [38]. In the present study, Vinexin-β KO significantly mitigated macrophages, neutrophils and T-cell infiltration into the infarcted myocardium and the production of pro-inflammatory cytokines (IL-6, TNF-α and IL-1β), whereas induction of Vinexin-β expression promoted inflammatory and immune cell infiltration and cytokine release; this demonstrated that Vinexin-β augmented the inflammatory response during MI. To elucidate the mechanisms underlying the effect of Vinexin-β on the inflammation induced by MI, we explored the effect of Vinexin-β on the NF-κB family of transcription factors, members of which are responsible for inflammatory cytokine production [42]. The mammalian NF-κB superfamily consists of five members–RelA (p65), RelB, c-Rel, p50 and p52–among which p65 is the most predominant in the heart [42]. The present study showed that Vinexin-β enhanced the MI-induced activation of p65, and this effect is mediated by increased degradation of IκBα. Together, these data demonstrate that Vinexin-β promotes the inflammatory response after MI by activating NF-κB signalling, which may partially explain the deleterious effect of Vinexin-β on myocardial apoptosis and cardiac dysfunction after MI.

Although the functions and underlying mechanism of Vinexin-β on MI have been investigated using both in vivo and in vitro gene-regulatory approaches, the present study has limitations. Given that genetic intervention is not yet clinically applicable or available [43], the exogenous inhibition or activation of specific molecular targets with drugs is an alternative clinical approach, and thereby further study of the exogenous inhibition of Vinexin-β via pharmaceutical approaches is warranted. In fact, since the value of some endogenous proteins, such as neuregulin, in the heart has been highlighted, novel drugs have been developed and are currently undergoing testing in clinical trials for the treatment of cardiac disorders [44]. Therefore, the cardioprotective effects of exogenous Vinexin-β inhibition will provide the possibility for clinical translation of this inhibition to practice.

In conclusion, our data demonstrate for the first time that Vinexin-β mediates myocardial apoptosis and the inflammatory response to exacerbate cardiac dysfunction and infarct size in an animal model of MI by inhibiting the AKT signalling pathway. The recognition of Vinexin-β as an innate detrimental factor in MI may provide novel clues for the treatment of IHD.

Abbreviations

     
  • AdcaAKT

    adenovirus expressing constitutively active AKT

  •  
  • AddnAKT

    adenovirus expressing dominant-negative mutant of AKT

  •  
  • AdGFP

    adenovirus-containing GFP

  •  
  • AdshRNA

    adenovirus-expressing shRNA

  •  
  • AdshVinexin-β

    adenoviral short hairpin Vinexin-β

  •  
  • AdVinexin-β

    adenoviral Vinexin-β

  •  
  • CCK8

    cell counting kit

  •  
  • cTnI

    cardiac troponin I

  •  
  • ECG

    electrocardiography

  •  
  • EF

    ejection fraction

  •  
  • ERK

    extracellular-signal-regulated kinase

  •  
  • FOXO3A

    forkhead box O 3A

  •  
  • FS

    fractional shortening

  •  
  • GAPDH

    glyceraldehyde-3-phosphate dehydrogenase

  •  
  • GSK-3β

    glycogen synthase kinase 3β

  •  
  • H&E

    haematoxylin and eosin

  •  
  • IHD

    ischaemic heart disease

  •  
  • IκBα

    inhibitor of NF-κB

  •  
  • IL

    interleukin

  •  
  • JNK

    c-Jun N-terminal kinase

  •  
  • KO

    knockout

  •  
  • LAD

    left anterior descending

  •  
  • LDH

    lactate dehydrogenase

  •  
  • LV

    left ventricle or left ventricular

  •  
  • MAPK

    mitogen-activated protein kinase

  •  
  • MEK

    MAPK/ERK kinase

  •  
  • MI

    myocardial infarction

  •  
  • NF-κB

    nuclear factor-κB

  •  
  • NRCM

    neonatal rat cardiomyocyte

  •  
  • NTG

    non-transgenic

  •  
  • NT-proBNP

    N-terminus of the prohormone brain natriuretic peptide

  •  
  • PI

    propidium iodide

  •  
  • qRT-PCR

    real-time quantitative reverse transcription–PCR

  •  
  • RWMA

    regional wall motion abnormality

  •  
  • SH3

    Src homology 3

  •  
  • TG

    transgenic

  •  
  • TNF-α

    tumour necrosis factor α

  •  
  • TUNEL

    terminal deoxynucleotidyl transferase-mediated dUTP nick-end labelling

  •  
  • UCG

    ultrasonic cardiogram

  •  
  • WT

    wild-type

AUTHOR CONTRIBUTION

Xiaoxiong Liu, Nian Wan and Xiao-Jing Zhang performed experiments and data analysis, wrote the manuscript, and contributed equally to this study; Yichao Zhao and Yan Zhang performed data analysis and wrote the manuscript; Gangying Hu and Fengwei Wan provided material and data analysis; Rui Zhang and Xueyong Zhu performed experiments; Hao Xia and Hongliang Li designed the overall research, analysed data and wrote the manuscript.

The Vinexin-β-KO mice were generously provided by the RIKEN BRC.

FUNDING

This work was supported by the National Science Fund for Distinguished Young Scholars [grant number 81425005], the National Natural Science Foundation of China [grant numbers 81170086 and 81270184], the National Science and Technology Support Project [grant numbers 2011BAI15B02, 2012BAI39B05, 2013YQ030923-05, 2014BAI02B01 and 2015BAI08B01], the Key Project of the National Natural Science Foundation [grant number 81330005], the National Basic Research Program China [grant number 2011CB503902] and the Natural Science Foundation of Hubei Province [grant number 2013CFB259].

References

References
1
Go
 
A.S.
Mozaffarian
 
D.
Roger
 
V.L.
Benjamin
 
E.J.
Berry
 
J.D.
Borden
 
W.B.
Bravata
 
D.M.
Dai
 
S.
Ford
 
E.S.
Fox
 
C.S.
, et al 
Heart disease and stroke statistics–2013 update: a report from the American Heart Association
Circulation
2013
, vol. 
127
 (pg. 
e6
-
e245
)
[PubMed]
2
Nahrendorf
 
M.
Pittet
 
M.J.
Swirski
 
F.K.
 
Monocytes: protagonists of infarct inflammation and repair after myocardial infarction
Circulation
2010
, vol. 
121
 (pg. 
2437
-
2445
)
[PubMed]
3
Zamilpa
 
R.
Ibarra
 
J.
de Castro Bras
 
L.E.
Ramirez
 
T.A.
Nguyen
 
N.
Halade
 
G.V.
Zhang
 
J.
Dai
 
Q.
Dayah
 
T.
Chiao
 
Y.A.
, et al 
Transgenic overexpression of matrix metalloproteinase-9 in macrophages attenuates the inflammatory response and improves left ventricular function post-myocardial infarction
J. Mol. Cell. Cardiol.
2012
, vol. 
53
 (pg. 
599
-
608
)
[PubMed]
4
Toldo
 
S.
Mezzaroma
 
E.
Van Tassell
 
B.W.
Farkas
 
D.
Marchetti
 
C.
Voelkel
 
N.F.
Abbate
 
A.
 
Interleukin-1beta blockade improves cardiac remodelling after myocardial infarction without interrupting the inflammasome in the mouse
Exp. Physiol.
2013
, vol. 
98
 (pg. 
734
-
745
)
[PubMed]
5
Kin
 
H.
Wang
 
N.P.
Halkos
 
M.E.
Kerendi
 
F.
Guyton
 
R.A.
Zhao
 
Z.Q.
 
Neutrophil depletion reduces myocardial apoptosis and attenuates NFkappaB activation/TNFalpha release after ischemia and reperfusion
J. Surg. Res.
2006
, vol. 
135
 (pg. 
170
-
178
)
[PubMed]
6
Li
 
J.
Zhang
 
Y.
Li
 
C.
Xie
 
J.
Liu
 
Y.
Zhu
 
W.
Zhang
 
X.
Jiang
 
S.
Liu
 
L.
Ding
 
Z.
 
HSPA12B attenuates cardiac dysfunction and remodelling after myocardial infarction through an eNOS-dependent mechanism
Cardiovasc. Res.
2013
, vol. 
99
 (pg. 
674
-
684
)
[PubMed]
7
Lal
 
H.
Zhou
 
J.
Ahmad
 
F.
Zaka
 
R.
Vagnozzi
 
R.J.
Decaul
 
M.
Woodgett
 
J.
Gao
 
E.
Force
 
T.
 
Glycogen synthase kinase-3alpha limits ischemic injury, cardiac rupture, post-myocardial infarction remodeling and death
Circulation
2012
, vol. 
125
 (pg. 
65
-
75
)
[PubMed]
8
Wencker
 
D.
Chandra
 
M.
Nguyen
 
K.
Miao
 
W.
Garantziotis
 
S.
Factor
 
S.M.
Shirani
 
J.
Armstrong
 
R.C.
Kitsis
 
R.N.
 
A mechanistic role for cardiac myocyte apoptosis in heart failure
J. Clin. Invest.
2003
, vol. 
111
 (pg. 
1497
-
1504
)
[PubMed]
9
Kioka
 
N.
Ueda
 
K.
Amachi
 
T.
 
Vinexin, CAP/ponsin, ArgBP2: a novel adaptor protein family regulating cytoskeletal organization and signal transduction
Cell Struct. Funct.
2002
, vol. 
27
 (pg. 
1
-
7
)
[PubMed]
10
Kioka
 
N.
Sakata
 
S.
Kawauchi
 
T.
Amachi
 
T.
Akiyama
 
S.K.
Okazaki
 
K.
Yaen
 
C.
Yamada
 
K.M.
Aota
 
S.
 
Vinexin: a novel vinculin-binding protein with multiple SH3 domains enhances actin cytoskeletal organization
J. Cell. Biol.
1999
, vol. 
144
 (pg. 
59
-
69
)
[PubMed]
11
Tujague
 
M.
Thomsen
 
J.S.
Mizuki
 
K.
Sadek
 
C.M.
Gustafsson
 
J.A.
 
The focal adhesion protein vinexin alpha regulates the phosphorylation and activity of estrogen receptor alpha
J. Biol. Chem.
2004
, vol. 
279
 (pg. 
9255
-
9263
)
[PubMed]
12
Kioka
 
N.
Ito
 
T.
Yamashita
 
H.
Uekawa
 
N.
Umemoto
 
T.
Motoyoshi
 
S.
Imai
 
H.
Takahashi
 
K.
Watanabe
 
H.
Yamada
 
M.
Ueda
 
K.
 
Crucial role of vinexin for keratinocyte migration in vitro and epidermal wound healing in vivo
Exp. Cell Res.
2010
, vol. 
316
 (pg. 
1728
-
1738
)
[PubMed]
13
Chen
 
K.
Gao
 
L.
Liu
 
Y.
Zhang
 
Y.
Jiang
 
D.S.
Wei
 
X.
Zhu
 
X.H.
Zhang
 
R.
Chen
 
Y.
Yang
 
Q.
, et al 
Vinexin-beta protects against cardiac hypertrophy by blocking the Akt-dependent signalling pathway
Basic Res. Cardiol.
2013
, vol. 
108
 pg. 
338
 
[PubMed]
14
Heineke
 
J.
Molkentin
 
J.D.
 
Regulation of cardiac hypertrophy by intracellular signalling pathways
Nat. Rev. Mol. Cell Biol.
2006
, vol. 
7
 (pg. 
589
-
600
)
[PubMed]
15
Heusch
 
G.
Libby
 
P.
Gersh
 
B.
Yellon
 
D.
Bohm
 
M.
Lopaschuk
 
G.
Opie
 
L.
 
Cardiovascular remodelling in coronary artery disease and heart failure
Lancet
2014
, vol. 
383
 (pg. 
1933
-
1943
)
[PubMed]
16
Zhang
 
Y.
Liu
 
X.
She
 
Z.G.
Jiang
 
D.S.
Wan
 
N.
Xia
 
H.
Zhu
 
X.H.
Wei
 
X.
Zhang
 
X.D.
Li
 
H.
 
Interferon regulatory factor 9 is an essential mediator of heart dysfunction and cell death following myocardial ischemia/reperfusion injury
Basic Res. Cardiol.
2014
, vol. 
109
 pg. 
434
 
[PubMed]
17
Jiang
 
D.S.
Wei
 
X.
Zhang
 
X.F.
Liu
 
Y.
Zhang
 
Y.
Chen
 
K.
Gao
 
L.
Zhou
 
H.
Zhu
 
X.H.
Liu
 
P.P.
, et al 
IRF8 suppresses pathological cardiac remodelling by inhibiting calcineurin signalling
Nat. Commun.
2014
, vol. 
5
 pg. 
3303
 
[PubMed]
18
Jiang
 
D.S.
Li
 
L.
Huang
 
L.
Gong
 
J.
Xia
 
H.
Liu
 
X.
Wan
 
N.
Wei
 
X.
Zhu
 
X.
Chen
 
Y.
, et al 
Interferon regulatory factor 1 is required for cardiac remodeling in response to pressure overload
Hypertension
2014
, vol. 
64
 (pg. 
77
-
86
)
[PubMed]
19
Jiang
 
D.S.
Bian
 
Z.Y.
Zhang
 
Y.
Zhang
 
S.M.
Liu
 
Y.
Zhang
 
R.
Chen
 
Y.
Yang
 
Q.
Zhang
 
X.D.
Fan
 
G.C.
, et al 
Role of interferon regulatory factor 4 in the regulation of pathological cardiac hypertrophy
Hypertension
2013
, vol. 
61
 (pg. 
1193
-
1202
)
[PubMed]
20
Xiao
 
J.
Moon
 
M.
Yan
 
L.
Nian
 
M.
Zhang
 
Y.
Liu
 
C.
Lu
 
J.
Guan
 
H.
Chen
 
M.
Jiang
 
D.
, et al 
Cellular FLICE-inhibitory protein protects against cardiac remodelling after myocardial infarction
Basic Res. Cardiol.
2012
, vol. 
107
 pg. 
239
 
[PubMed]
21
Li
 
H.
Tang
 
Q.Z.
Liu
 
C.
Moon
 
M.
Chen
 
M.
Yan
 
L.
Bian
 
Z.Y.
Zhang
 
Y.
Wang
 
A.B.
Nghiem
 
M.P.
, et al 
Cellular FLICE-inhibitory protein protects against cardiac remodeling induced by angiotensin II in mice
Hypertension
2010
, vol. 
56
 (pg. 
1109
-
1117
)
[PubMed]
22
Van Tassell
 
B.W.
Toldo
 
S.
Mezzaroma
 
E.
Abbate
 
A.
 
Targeting interleukin-1 in heart disease
Circulation
2013
, vol. 
128
 (pg. 
1910
-
1923
)
[PubMed]
23
Nishida
 
K.
Yamaguchi
 
O.
Otsu
 
K.
 
Crosstalk between autophagy and apoptosis in heart disease
Circ. Res.
2008
, vol. 
103
 (pg. 
343
-
351
)
[PubMed]
24
Ing
 
D.J.
Zang
 
J.
Dzau
 
V.J.
Webster
 
K.A.
Bishopric
 
N.H.
 
Modulation of cytokine-induced cardiac myocyte apoptosis by nitric oxide, Bak, and Bcl-x
Circ. Res.
1999
, vol. 
84
 (pg. 
21
-
33
)
[PubMed]
25
Gonzalez
 
A.
Ravassa
 
S.
Beaumont
 
J.
Lopez
 
B.
Diez
 
J.
 
New targets to treat the structural remodeling of the myocardium
J. Am. Coll. Cardiol.
2011
, vol. 
58
 (pg. 
1833
-
1843
)
[PubMed]
26
Xuan
 
W.
Liao
 
Y.
Chen
 
B.
Huang
 
Q.
Xu
 
D.
Liu
 
Y.
Bin
 
J.
Kitakaze
 
M.
 
Detrimental effect of fractalkine on myocardial ischaemia and heart failure
Cardiovasc. Res.
2011
, vol. 
92
 (pg. 
385
-
393
)
[PubMed]
27
Matsuyama
 
M.
Mizusaki
 
H.
Shimono
 
A.
Mukai
 
T.
Okumura
 
K.
Abe
 
K.
Shimada
 
K.
Morohashi
 
K.
 
A novel isoform of Vinexin, Vinexin gamma, regulates Sox9 gene expression through activation of MAPK cascade in mouse fetal gonad
Genes Cells
2005
, vol. 
10
 (pg. 
421
-
434
)
[PubMed]
28
Mizutani
 
K.
Ito
 
H.
Iwamoto
 
I.
Morishita
 
R.
Deguchi
 
T.
Nozawa
 
Y.
Asano
 
T.
Nagata
 
K.I.
 
Essential roles of ERK-mediated phosphorylation of vinexin in cell spreading, migration and anchorage-independent growth
Oncogene
2007
, vol. 
26
 (pg. 
7122
-
7131
)
[PubMed]
29
Mizutani
 
K.
Nagata
 
K.
Ito
 
H.
Ehara
 
H.
Nozawa
 
Y.
Deguchi
 
T.
 
Possible roles of vinexinbeta in growth and paclitaxel sensitivity in human prostate cancer PC-3 cells
Cancer Biol. Ther.
2007
, vol. 
6
 (pg. 
1800
-
1804
)
[PubMed]
30
Rafiq
 
K.
Kolpakov
 
M.A.
Seqqat
 
R.
Guo
 
J.
Guo
 
X.
Qi
 
Z.
Yu
 
D.
Mohapatra
 
B.
Zutshi
 
N.
An
 
W.
, et al 
c-Cbl inhibition improves cardiac function and survival in response to myocardial ischemia
Circulation
2014
, vol. 
129
 (pg. 
2031
-
2043
)
[PubMed]
31
Ma
 
Y.
Halade
 
G.V.
Zhang
 
J.
Ramirez
 
T.A.
Levin
 
D.
Voorhees
 
A.
Jin
 
Y.F.
Han
 
H.C.
Manicone
 
A.M.
Lindsey
 
M.L.
 
Matrix metalloproteinase-28 deletion exacerbates cardiac dysfunction and rupture after myocardial infarction in mice by inhibiting M2 macrophage activation
Circ. Res.
2013
, vol. 
112
 (pg. 
675
-
688
)
[PubMed]
32
Yan
 
L.
Wei
 
X.
Tang
 
Q.Z.
Feng
 
J.
Zhang
 
Y.
Liu
 
C.
Bian
 
Z.Y.
Zhang
 
L.F.
Chen
 
M.
Bai
 
X.
, et al 
Cardiac-specific mindin overexpression attenuates cardiac hypertrophy via blocking AKT/GSK3beta and TGF-beta1-Smad signalling
Cardiovasc. Res.
2011
, vol. 
92
 (pg. 
85
-
94
)
[PubMed]
33
Fujio
 
Y.
Nguyen
 
T.
Wencker
 
D.
Kitsis
 
R.N.
Walsh
 
K.
 
Akt promotes survival of cardiomyocytes in vitro and protects against ischemia-reperfusion injury in mouse heart
Circulation
2000
, vol. 
101
 (pg. 
660
-
667
)
[PubMed]
34
Zhao
 
Z.Q.
Morris
 
C.D.
Budde
 
J.M.
Wang
 
N.P.
Muraki
 
S.
Sun
 
H.Y.
Guyton
 
R.A.
 
Inhibition of myocardial apoptosis reduces infarct size and improves regional contractile dysfunction during reperfusion
Cardiovasc. Res.
2003
, vol. 
59
 (pg. 
132
-
142
)
[PubMed]
35
Chandrashekhar
 
Y.
Sen
 
S.
Anway
 
R.
Shuros
 
A.
Anand
 
I.
 
Long-term caspase inhibition ameliorates apoptosis, reduces myocardial troponin-I cleavage, protects left ventricular function, and attenuates remodeling in rats with myocardial infarction
J. Am. Coll. Cardiol.
2004
, vol. 
43
 (pg. 
295
-
301
)
[PubMed]
36
Hayakawa
 
Y.
Chandra
 
M.
Miao
 
W.
Shirani
 
J.
Brown
 
J.H.
Dorn
 
G.W.
Armstrong
 
R.C.
Kitsis
 
R.N.
 
Inhibition of cardiac myocyte apoptosis improves cardiac function and abolishes mortality in the peripartum cardiomyopathy of Galpha(q) transgenic mice
Circulation
2003
, vol. 
108
 (pg. 
3036
-
3041
)
[PubMed]
37
Pu
 
J.
Yuan
 
A.
Shan
 
P.
Gao
 
E.
Wang
 
X.
Wang
 
Y.
Lau
 
W.B.
Koch
 
W.
Ma
 
X.L.
He
 
B.
 
Cardiomyocyte-expressed farnesoid-X-receptor is a novel apoptosis mediator and contributes to myocardial ischaemia/reperfusion injury
Eur. Heart J.
2013
, vol. 
34
 (pg. 
1834
-
1845
)
[PubMed]
38
Li
 
H.L.
Zhuo
 
M.L.
Wang
 
D.
Wang
 
A.B.
Cai
 
H.
Sun
 
L.H.
Yang
 
Q.
Huang
 
Y.
Wei
 
Y.S.
Liu
 
P.P.
, et al 
Targeted cardiac overexpression of A20 improves left ventricular performance and reduces compensatory hypertrophy after myocardial infarction
Circulation
2007
, vol. 
115
 (pg. 
1885
-
1894
)
[PubMed]
39
del Peso
 
L.
Gonzalez-Garcia
 
M.
Page
 
C.
Herrera
 
R.
Nunez
 
G.
 
Interleukin-3-induced phosphorylation of BAD through the protein kinase Akt
Science
1997
, vol. 
278
 (pg. 
687
-
689
)
[PubMed]
40
Ahmed
 
N.N.
Grimes
 
H.L.
Bellacosa
 
A.
Chan
 
T.O.
Tsichlis
 
P.N.
 
Transduction of interleukin-2 antiapoptotic and proliferative signals via Akt protein kinase
Proc. Natl. Acad. Sci. U.S.A.
1997
, vol. 
94
 (pg. 
3627
-
3632
)
[PubMed]
41
Frangogiannis
 
N.G.
 
Regulation of the inflammatory response in cardiac repair
Circ. Res.
2012
, vol. 
110
 (pg. 
159
-
173
)
[PubMed]
42
Gordon
 
J.W.
Shaw
 
J.A.
Kirshenbaum
 
L.A.
 
Multiple facets of NF-kappaB in the heart: to be or not to NF-kappaB
Circ. Res.
2011
, vol. 
108
 (pg. 
1122
-
1132
)
[PubMed]
43
Dykxhoorn
 
D.M.
Lieberman
 
J.
 
The silent revolution: RNA interference as basic biology, research tool, and therapeutic
Annu. Rev. Med.
2005
, vol. 
56
 (pg. 
401
-
423
)
[PubMed]
44
Odiete
 
O.
Hill
 
M.F.
Sawyer
 
D.B.
 
Neuregulin in cardiovascular development and disease
Circ. Res.
2012
, vol. 
111
 (pg. 
1376
-
1385
)
[PubMed]