Fibrotic lung diseases, such as idiopathic pulmonary fibrosis, are associated with spontaneous dry cough and hypersensitivity to tussive agents. Understanding the pathophysiology driving enhanced cough may help us to define better therapies for patients. We hypothesized that lung fibrosis induced by intratracheal bleomycin would exacerbate the cough reflex induced by tussive agents in guinea pigs. Disease progression in the lungs was characterized at days 1, 7, 14, 21 and 28 after bleomycin administration. Inflammatory and fibrotic markers, as well as neurotrophin levels, were assessed in bronchoalveolar lavage fluid and/or lung tissue. Cough sensitivity to citric acid, capsaicin and allylisothiocyanate was evaluated in conscious animals at days 14 and 21 after bleomycin administration. Pulmonary lesions evolved from an early inflammatory phase (from day 1 to day 7) to a fibrotic stage (between days 14 and 28). Fibrosis was related to increased levels of matrix metalloproteinase-2 in bronchoalveolar lavage fluid (day 21: saline, 0.26 ng/ml; bleomycin, 0.49 ng/ml). At day 14, we also observed increased cough reflexes to citric acid (163%), capsaicin (125%) and allylisothiocyanate (178%). Cough exacerbation persisted, but at a lower extent, by day 21 for capsaicin (100%) and allylisothiocyanate (54%). Moreover, bronchoalveolar lavage fluid concentrations of brain-derived neurotrophic factor, suggested to induce nerve remodelling in chronic cough, were also enhanced (day 1: saline, 14.21 pg/ml; bleomycin, 30.09 pg/ml). In summary, our model of bleomycin-induced cough exacerbation may be a valuable tool to investigate cough hypersensitivity and develop antitussive therapies for fibrotic lung diseases.

CLINICAL PERSPECTIVES

  • Treatment of enhanced cough associated with lung fibrotic diseases, such as IPF, is a significant unmet need. Therefore new effective antitussive therapies require to be developed and, with that purpose, the establishment of new animal models is essential.

  • In the present paper, we describe for the first time exacerbated cough associated with pulmonary fibrosis in an animal model, which was induced by bleomycin. Bleomycin administration was also related to increased BALF concentrations of MMP-2 and BDNF in animals.

  • All of these findings are very much in agreement with previous observations in patients with IPF. In consequence, this animal model is expected to be a valuable tool to better understand and treat enhanced cough associated with fibrotic pulmonary diseases.

INTRODUCTION

Enhanced cough reflex is one of the main symptoms seen in clinical care [1,2]. This can be associated with underlying pathologies, including fibrotic pulmonary diseases such as IPF (idiopathic pulmonary fibrosis). In approximately 80% of cases, IPF is associated with dry cough, which is usually resistant to conventional therapies [24]. This fact contributes to severely reduce patients' quality of life [5].

The mechanisms behind increased coughing in lung fibrosis are not completely understood. However, remodelling of sensory afferent vagal fibres in the respiratory tract seems to be crucial [3]. This remodelling could be mediated by neurotrophins such as NGF (nerve growth factor) and BDNF (brain-derived neurotrophic factor) [3,6]. Therefore the development of new pharmacological therapies directed towards neurogenic components may be more effective to palliate cough in fibrotic pulmonary diseases.

New animal models are necessary to study enhanced cough pathophysiology in lung fibrosis and test new therapies before their evaluation in clinical trials. In this regard, the most useful animal model for cough studies is the conscious guinea pig [1,7]. Recently, antitussive properties of antifibrotic treatments were tested in allergic guinea pigs with enhanced cough reflex [8]. However, this kind of model clearly does not mimic the pathology associated with pulmonary fibrosis in patients. In contrast, exposure of rodents to bleomycin, a chemotherapeutic antibiotic that causes pulmonary fibrosis as a side effect in humans, has been extensively used to study lung fibrosis [9].

Our aim was to develop and characterize a model of enhanced cough associated with lung fibrosis. In particular, we hypothesized that lung fibrosis induced by intratracheal bleomycin would enhance cough reflex in guinea pigs. In this animal model, we assessed: (i) the progression of lung inflammation and fibrosis; (ii) responses to the tussive agents citric acid, capsaicin and AITC (allylisothiocyanate); (iii) lung expression of ion channels potentially involved in cough; and (iv) levels of NGF and BDNF in BALF (bronchoalveolar lavage fluid).

MATERIALS AND METHODS

Animals

Male Dunkin–Hartley guinea pigs (300–350 g) were purchased from a commercial breeder (Charles River Laboratories, Cerdanyola del Vallès, Spain). Animals were housed in groups of three or four in a room with controlled temperature (20–24°C), humidity (45–65%), air cycles (10–20 renovations/h) and a 12 h light/12 h dark cycle. Standard maintenance diet supplemented with vitamin C, irradiated hay and water were available ad libitum. Care and use of animals was undertaken in compliance with the European Community Directive 86/609/CEE for the use of laboratory animals. Experimental procedures were approved by the Ethics Committee of Almirall.

Bleomycin-induced model of lung fibrosis time course

Animals under 2% isoflurane anaesthesia received a single dose of 8 IU/kg bleomycin sulfate (B2434; Sigma–Aldrich) or vehicle (0.2 ml saline) by intratracheal administration using MicroSprayer® Aerosolizers (Model IA-1B-GP for Guinea Pig; PennCentury). Bleomycin was prepared immediately before administration.

At the end of the study, animals were killed by intraperitoneal administration of sodium pentobarbital (200 mg/kg; Dolethal; Vetoquinol). BALF and lung tissue samples were obtained for subsequent studies.

BALF and lung tissue sampling and processing

To obtain BALF samples, tracheas were cannulated and lungs were lavaged twice with 3 ml of PBS with 5% (v/v) FBS.

Then, 1.5 ml of BALF was used to perform total cell counts using an automated cell counter (Sysmex XT-2000iV; Sysmex Corporation). In addition, differential cell counts were evaluated on cytospin preparations stained with Diff-Quick (Medion Diagnostics). According to morphological criteria, monocytes/macrophages, heterophils (the counterpart of neutrophils in the guinea pig), eosinophils and lymphocytes were identified. Results are expressed as cells/ml, obtained by multiplying the percentage of each subpopulation by the total cell number of each sample.

The remaining BALF sample was kept on ice before being centrifuged at 500 g for 10 min at 4°C. Supernatants were stored at −80°C for later analysis.

After obtaining BALF, the thoracic cavity was opened. The right first-order bronchus was clamped. Then, right pulmonary lobes were isolated, rinsed with saline and frozen in liquid nitrogen for later gene expression analysis. Left lobes, used for subsequent histopathological evaluation, were inflated with 3 ml of 10% neutral-buffered formalin and immersed in further fixative.

Neurotrophic factors and matrix metalloproteinase levels in BALF

Specific ELISA kits (Elabscience) were used to determine the concentration of NGF (E-EL-GP0006), BDNF (E-EL-GP1313), MMP (matrix metalloproteinase)-2 (E-EL-GP0693) and MMP-9 (E-EL-GP1086) following the manufacturer's instructions. After thawing, BALF supernatants were centrifuged at 1000 g for 10 min at 4°C. The samples obtained were assayed without any further dilution against the corresponding standard curves, with serial dilutions prepared in PBS with 5% (v/v) FBS.

Histopathological evaluation

One transverse section of both cranial and caudal left lobes from each animal was embedded in paraffin. Sections of 3 μm were stained with H&E (haematoxylin and eosin) to evaluate inflammation and with Masson's trichrome stain to determine the presence of fibrosis.

Lesions were graded semi-quantitatively considering both their intensity and extension, and following an arbitrary score (0, no lesion; 1, mild; 2, moderate; 3, marked). Histological studies were performed in a blinded fashion by an independent certified pathologist.

Gene expression of cytokines and ion channels

Total RNA was extracted from the right middle lung lobe with the RNeasy isolation kit (Qiagen). RNA was quantified using a NanoDrop Lite Spectrophotometer (Thermo Fisher Scientific). All samples showed an A260/A280 ratio of ∼2.0, generally accepted as pure for RNA. Then, 1 μg of RNA was reverse-transcribed in a 20 μl reaction volume for cDNA synthesis using the High-Capacity cDNA Reverse Transcription Kit (Life Technologies).

Validated TaqMan® assays (Life Technologies) with hydrolysis probes (Table 1) were used to evaluate the gene expression for TNFα (tumour necrosis factor α), IL-1β (interleukin 1β), TGFβ1 (transforming growth factor β), TRPA1 (transient receptor potential cation channel, ankyrin subfamily, member 1), TRPV1 (transient receptor potential cation channel, vanilloid subfamily, member 1) and B2M (β2-microglobulin). The expression of Nav1.7 (voltage-gated sodium channel type 1.7), encoded by the gene SCN9A, was evaluated with a customized TaqMan assay as described previously [10] (Table 1).

Table 1
Description of the commercial assays, primers and probes used to evaluate gene expression by qPCR
Assay nameTargetReference*Probe (5′→3′)Primers (5′→3′)
B2m β2-Microglobulin Cp04183281_m1   
Cytokines     
Tgfb1 Transforming growth factor β1 Cp03755159_m1   
Tnfa Tumour necrosis factor α Cp03755724_g1   
Il1b Interleukin 1β Cp03755067_m1   
Ion channels     
Trpv1 Transient receptor potential cation channel, vanilloid subfamily, member 1 Cp03755295_m1   
Trpa1 Transient receptor potential cation channel, ankyrin subfamily, member 1 Cp04230142_m1   
Nav1.7 Voltage-gated sodium channels type 1.7 (SCN9A gene) [10CCCCCTCTTCTCATAGCAAAACCTAA Forward, TTTTGCGGCTGCCCTAGA 
    Reverse, CATGGCAATGAGCTGGACTTT 
Assay nameTargetReference*Probe (5′→3′)Primers (5′→3′)
B2m β2-Microglobulin Cp04183281_m1   
Cytokines     
Tgfb1 Transforming growth factor β1 Cp03755159_m1   
Tnfa Tumour necrosis factor α Cp03755724_g1   
Il1b Interleukin 1β Cp03755067_m1   
Ion channels     
Trpv1 Transient receptor potential cation channel, vanilloid subfamily, member 1 Cp03755295_m1   
Trpa1 Transient receptor potential cation channel, ankyrin subfamily, member 1 Cp04230142_m1   
Nav1.7 Voltage-gated sodium channels type 1.7 (SCN9A gene) [10CCCCCTCTTCTCATAGCAAAACCTAA Forward, TTTTGCGGCTGCCCTAGA 
    Reverse, CATGGCAATGAGCTGGACTTT 

*Validated commercial TaqMan® assays specific for the guinea pig.

†Endogenous control.

‡Custom TaqMan® assay.

For Nav1.7 expression studies, the TURBO DNA-free™ Kit (Life Technologies) was used to remove contaminating DNA from RNA extractions before RNA was reverse-transcribed.

PCR mixtures were transferred to 96-well reaction plates (HSP-9601; Bio-Rad Laboratories) at 20 μl/well. These were sealed with adhesive and incubated on a CFX96 Touch real-time PCR detection system (Bio-Rad Laboratories). The TaqMan® Fast Advanced Master Mix (Life Technologies) was used for amplification with the following conditions: 95°C for 10 min, and 40 cycles of 95°C for 15 s and 60°C for 1 min. Fluorescence signals measured during amplification were used to obtain the quantification cycle (Cq) for each sample using the Bio-Rad Laboratories CFX Manager 2.1 software. Each sample was run in triplicate and data were analysed by the comparative Cq method (2−∆∆Cq) with the vehicle group of each time point serving as the calibrator. B2M was used as a reference gene to normalize mRNA levels of the target genes. Controls of analytical specificity included omission of reverse transcriptase and no template controls.

Cough induction

At days 14 and 21 after bleomycin administration, cough reflex was evaluated in conscious unrestrained guinea pigs using whole-body plethysmography chambers (Buxco Research Systems). In accordance with preliminary assays, submaximal doses for tussive agents as well as times and methods of nebulization were selected (results not shown). Citric acid (Sigma–Aldrich) was dissolved and diluted in 0.9% saline. A 1 mM stock solution of capsaicin (Sigma–Aldrich) was prepared in 100% ethanol and further dissolved with saline to obtain a 30 μM concentration. AITC (Sigma–Aldrich) was prepared in 20% ethanol and 5% Tween 80 (Panreac) in distilled water. Preliminary studies also showed that none of the vehicles used to dissolve these challenges induces cough in guinea pigs.

After a 2 min baseline reading of airway function, animals were exposed to one of the challenges. Citric acid (0.3 M) or capsaicin (30 μM) was administered by aerosol with a micropump nebulizer (Aeroneb Lab; Aerogen) whereas AITC (10 mM) was delivered via an ultrasonic nebulizer (De Vilbiss). The number of coughs was counted during the exposure to citric acid (10 min), capsaicin (5 min) or AITC (10 min) and for a further 5 min for capsaicin and AITC challenges. Coughs were assessed and counted by a trained observer in agreement with the ERS guidelines on the assessment of cough [1], considering changes in posture (quick large abdominal movement and opening of the mouth), characteristic sounds and changes in airflow, recorded with the Finepointe software (Buxco Research Systems).

Data analysis

Time-course data are shown as means±S.E.M. Comparisons between multiple groups were performed using two-way ANOVA followed by Sidak's tests.

Cough counts are expressed as the median±interquartile range. In this case, comparisons between groups were performed using non-parametric Mann–Whitney tests. The percentages of enhancement in response to tussive agents were calculated in respect to the median of the corresponding saline group.

For ELISA data analysis, the concentration in samples was interpolated using second-order polynomial (quadratic) equations.

In all cases, data were considered statistically significant when P<0.05.

All statistical analyses were performed using GraphPad Prism (version 6.0).

RESULTS

White blood cell count in the BALF

Cell profile analysis showed that intratracheal administration of bleomycin induced a significant increase in the total number of white blood cells in BALF (Figure 1A).

Time course of cell infiltration in BALF following bleomycin intratracheal administration in guinea pigs

Figure 1
Time course of cell infiltration in BALF following bleomycin intratracheal administration in guinea pigs

Changes in the total number of WBCs (A), heterophils (the counterpart of neutrophils in the guinea pig) (B), monocytes/macrophages (C), eosinophils (D) and lymphocytes (E) were compared with those obtained in the saline control group. n=10–13 animals per group. Results are expressed as means±S.E.M. †P=0.055, *P<0.05, **P<0.01 and ***P<0.001 compared with time-matched saline-exposed animals (two-way ANOVA and Sidak's post-hoc test).

Figure 1
Time course of cell infiltration in BALF following bleomycin intratracheal administration in guinea pigs

Changes in the total number of WBCs (A), heterophils (the counterpart of neutrophils in the guinea pig) (B), monocytes/macrophages (C), eosinophils (D) and lymphocytes (E) were compared with those obtained in the saline control group. n=10–13 animals per group. Results are expressed as means±S.E.M. †P=0.055, *P<0.05, **P<0.01 and ***P<0.001 compared with time-matched saline-exposed animals (two-way ANOVA and Sidak's post-hoc test).

Initially, this was characterized by an acute heterophilia. In particular, the number of heterophils peaked 24 h after administration, being increased 19-fold compared with saline-treated subjects (Figure 1B).

Monocytes/macrophages were the most abundant inflammatory cells in BALF for both groups along the entire time course. However, their number was also enhanced in the bleomycin group, but in a more sustained way than heterophils (Figure 1C). A similar profile was observed for eosinophils, which were significantly increased in bleomycin-administered animals (group factor: P=0.02) until day 14 (Figure 1D).

Finally, no significant changes were observed over time or between groups in lymphocyte counts in BALF (Figure 1E).

Histopathological evaluation of the lungs

Histopathological evaluation of the lungs of bleomycin-administered guinea pigs revealed altered architecture at all time points.

Inflammation was present from day 1, reached a peak of moderate inflammation at day 7, and slowly decreased to mild levels with time (Figure 2A). A focally extensive peribronchial–peribronchiolar pattern of alveolar inflammation was predominantly found (Figures 2C and 2D), followed by more occasional multifocal or diffuse patterns. The nature of the inflammatory cell infiltrate varied gradually. At day 1, affected alveolar septa and lumina were mainly occupied by polymorphonuclear heterophils and eosinophils, with lesser numbers of macrophages and lymphocytes. The proportion of polymorphonuclear cells decreased with time. From day 14, the inflammatory infiltrate was predominantly mononuclear, composed of macrophages, fewer lymphocytes and plasma cells, with occasional polymorphonuclear cells.

Histopathological lung tissue changes induced by bleomycin intratracheal administration in guinea pigs

Figure 2
Histopathological lung tissue changes induced by bleomycin intratracheal administration in guinea pigs

Time-course histopathological analysis of lung inflammation (A) and fibrosis (B) induced by a single intratracheal dose of bleomycin in guinea pigs. n=10–13 animals per group. Results are expressed as means±S.E.M. **P<0.01 and ****P<0.0001 compared with time-matched saline-exposed animals (two-way ANOVA and Sidak's post-test). Representative microphotographs show lung parenchyma in saline-exposed guinea pigs (C and E) and in bleomycin-exposed guinea pigs 14 days after administration (D and F). Note the prominent peribronchial-peribronchiolar distribution of the lesions (*). (C and D) H&E stain. Scale bars, 250 μm. (E and F) Masson's trichrome stain; collagen deposition is stained blue. Scale bars, 50 μm.

Figure 2
Histopathological lung tissue changes induced by bleomycin intratracheal administration in guinea pigs

Time-course histopathological analysis of lung inflammation (A) and fibrosis (B) induced by a single intratracheal dose of bleomycin in guinea pigs. n=10–13 animals per group. Results are expressed as means±S.E.M. **P<0.01 and ****P<0.0001 compared with time-matched saline-exposed animals (two-way ANOVA and Sidak's post-test). Representative microphotographs show lung parenchyma in saline-exposed guinea pigs (C and E) and in bleomycin-exposed guinea pigs 14 days after administration (D and F). Note the prominent peribronchial-peribronchiolar distribution of the lesions (*). (C and D) H&E stain. Scale bars, 250 μm. (E and F) Masson's trichrome stain; collagen deposition is stained blue. Scale bars, 50 μm.

In order to assess the degree and extent of interstitial fibrosis, Masson's trichrome-stained slides were evaluated (Figures 2E and 2F). From day 7 to day 14, mild to moderate collagen deposition was seen expanding alveolar walls. This was observed mainly in peribronchial–peribronchiolar areas where inflammation was also present. Less frequently, a multifocal pattern of deposition was seen. Fibrosis decreased thereafter down to mild levels (Figure 2B).

Gene expression of cytokines and ion channels in the lung

Gene expression for all of the cytokines and ion channels analysed was detected in lung tissue of both saline- and bleomycin-administered animals.

Regarding cytokines, TGFβ1 expression was higher than that of TNFα and IL-1β, both of which had similar expression levels. When effects of bleomycin administration were evaluated, an up-regulation in IL-1β levels was already detected at 24 h (Figure 3A). Changes in IL-1β persisted up to day 7, coinciding with a moderate overexpression of TGFβ1 and TNFα (Figures 3A, 3B and 3C). Thereafter, from day 14, differences between both groups were no longer observed (Figures 3A, 3B and 3C).

Effect on lung cytokines and ion channels mRNA expression after bleomycin intratracheal administration in guinea pigs

Figure 3
Effect on lung cytokines and ion channels mRNA expression after bleomycin intratracheal administration in guinea pigs

Time course of relative mRNA expression for IL-1β (A), TNFα (B), TGFβ1 (C), TRPV1 (D), TRPA1 (E) and Nav1.7 (F) in the lung after intratracheal administration of saline or bleomycin. Expression levels are normalized to the transcript levels of the reference gene B2M. n=10–13 animals per group. *P<0.05 compared with the time-matched saline group (two-way ANOVA and Sidak's post-test).

Figure 3
Effect on lung cytokines and ion channels mRNA expression after bleomycin intratracheal administration in guinea pigs

Time course of relative mRNA expression for IL-1β (A), TNFα (B), TGFβ1 (C), TRPV1 (D), TRPA1 (E) and Nav1.7 (F) in the lung after intratracheal administration of saline or bleomycin. Expression levels are normalized to the transcript levels of the reference gene B2M. n=10–13 animals per group. *P<0.05 compared with the time-matched saline group (two-way ANOVA and Sidak's post-test).

With respect to ion channels, their levels of expression were lower than those for cytokines. Among them, Nav1.7 was the most highly expressed, followed by TRPA1 and TRPV1. In any case, no differences were found between bleomycin and saline at any time point (Figures 3D, 3E and 3F).

Neurotrophins and MMPs levels in BALF

For most of the BALF samples, concentrations of MMP-2 and BDNF were in the range of detection of the corresponding ELISA kits. On the other hand, MMP-9 and NGF were generally undetectable.

Bleomycin induced an increase in MMP-2 levels between days 7 and 28 after administration, which was particularly significant at day 21 (saline: 0.26±03 ng/ml; bleomycin: 0.49±0.08 ng/ml; P<0.001; Figure 4A).

Effect on BALF MMPs and neurotrophic factors after bleomycin intratracheal administration in guinea pigs

Figure 4
Effect on BALF MMPs and neurotrophic factors after bleomycin intratracheal administration in guinea pigs

Time-course changes in BALF levels of MMP-2 (A) and BDNF (B), measured by ELISA. n=5–13 animals per group. **P<0.01 and ***P<0.001 compared with time-matched saline-exposed animals (two-way ANOVA and Sidak's post-test).

Figure 4
Effect on BALF MMPs and neurotrophic factors after bleomycin intratracheal administration in guinea pigs

Time-course changes in BALF levels of MMP-2 (A) and BDNF (B), measured by ELISA. n=5–13 animals per group. **P<0.01 and ***P<0.001 compared with time-matched saline-exposed animals (two-way ANOVA and Sidak's post-test).

At the same time, we observed that BDNF levels were affected in bleomycin-administered guinea pigs (group factor: P=0.04). This would be associated with an increase in BDNF concentrations at days 1 and 7, despite not reaching statistical significance at any particular time point (Figure 4B).

Cough reflex induced by tussive agents

At day 14 after intratracheal bleomycin administration, guinea pig cough sensitivity was significantly changed for all the tussive challenges tested. In particular, cough counts were increased by 163% for citric acid, 125% for capsaicin and 178% for AITC when compared with the respective saline groups (Figure 5).

Altered cough reflex to different tussive agents after bleomycin intratracheal administration in guinea pigs

Figure 5
Altered cough reflex to different tussive agents after bleomycin intratracheal administration in guinea pigs

Cough responses to 0.3 M citric acid (A), 30 μM capsaicin (B) and 10 mM AITC (C) after intratracheal administration of bleomycin in guinea pigs. n=16 animals per group. Individual data, medians and interquartile ranges are represented. *P<0.05 and **P<0.01 compared with time-matched saline-exposed animals (Mann–Whitney test).

Figure 5
Altered cough reflex to different tussive agents after bleomycin intratracheal administration in guinea pigs

Cough responses to 0.3 M citric acid (A), 30 μM capsaicin (B) and 10 mM AITC (C) after intratracheal administration of bleomycin in guinea pigs. n=16 animals per group. Individual data, medians and interquartile ranges are represented. *P<0.05 and **P<0.01 compared with time-matched saline-exposed animals (Mann–Whitney test).

At day 21, cough counts induced by citric acid were similar in the saline and bleomycin groups. However, the number of coughs after both capsaicin and AITC exposure was still significantly enhanced, although less pronounced than at day 14 (Figure 5).

DISCUSSION

To our knowledge, the present study found for the first time increased cough sensitivity in an induced animal model of lung fibrosis. In addition, it explores further translation between animal models and pulmonary fibrosis in patients, including alterations in neurotrophic factors.

Our approach to induce lung fibrosis was to use a single intratracheal administration of bleomycin. We selected this method as it is the most commonly used and the best described in animal models of lung fibrosis [9,11,12]. This method is particularly well characterized in mice and rats. However, although a small proportion of cough studies have been performed using these species, there is scepticism as to whether they evoke a cough that resembles the reflex seen in humans [1,7,13,14]. In contrast, it is widely agreed that the most suitable species to investigate cough is the guinea pig [1,7]. Unfortunately, bleomycin-induced lung injury is far less well characterized in guinea pigs, with very few studies describing it [15,16]. Therefore we first assessed the progression of lung inflammation and fibrosis under our experimental conditions. Our study revealed that a biphasic process, with an early inflammatory phase followed by a fibrotic stage, takes places after bleomycin administration in guinea pigs. This is in agreement with the observations of other groups for mice and rats [11].

In our case, histological studies showed that bleomycin-induced inflammation was especially pronounced between days 1 and 7. This coincided with an overexpression of the pro-inflammatory cytokines IL-1β and TNFα. In addition, a higher count of white blood cells was observed in BALF after bleomycin instillation. Specifically, we detected increased numbers of heterophils, eosinophils and monocytes/macrophages. Such an inflammatory response is similar to what has been found in samples from IPF patients [17,18]. However, these alterations in inflammatory markers were no longer observed by day 21.

On the other hand, fibrotic lesions appeared later and persisted for longer. In particular, we observed collagen deposition in lung tissue between days 7 and 28, peaking at day 14. As reported by others, bleomycin-induced fibrosis was mainly observed in peribronchial–peribronchiolar areas [1921]. Alternatively, a multifocal deposition of collagen was occasionally detected, similar to what is described in IPF patients [22]. These different patterns could suggest interindividual differences. However, we should not discard the possibility that the fibrotic pattern could also depend on the properties of the aerosol generated during bleomycin administration.

Initial histological signs of fibrosis coincided with an up-regulation in TGFβ1 and IL-1β, which are involved in fibroblast proliferation and collagen synthesis [9,23]. Moreover, MMP-2 levels were increased in BALF, in agreement with previous observations in humans [24]. In our case, MMP-2 concentrations were maximal by day 21, but still enhanced after 28 days. Previously, Cisneros-Lira et al. [16] showed an enhanced enzymatic activity of both MMP-2 and MMP-9 in lungs of guinea pigs 6 weeks after bleomycin administration. Overall, the data suggest that in our model fibroproliferative response is still active when inflammation is notably reverted.

Exacerbated cough was observed 14 days after bleomycin instillation for all three cough challenges used: (i) citric acid, which non-specifically stimulates A-δ and C nervous fibres; (ii) capsaicin, a TRPV1 agonist which specifically stimulates C fibres an some A-δ fibres; and (iii) AITC, an activator of TRPA1 channels, which are present on C fibres [1,7]. In contrast, Brozmanova et al. [15] did not observe enhanced cough reflexes to citric acid in a similar guinea pig model induced by bleomycin. These differences could be related to the method of bleomycin administration. Whereas they injected bleomycin intratracheally with a needle, we used MicroSprayer® Aerosolizers. In our experience, our technique allows a better distribution of compounds within the lungs. This could also explain why they found a lower incidence of fibrotic changes at day 14 after bleomycin administration [15]. Another factor that could explain these differences would be that we used a different strain of guinea pigs. It is possible that fibrotic response to bleomycin in guinea pigs is strain-dependent as it is in mice [12,25]. Furthermore, the conditions of the citric acid challenge were also slightly different in both studies [15].

Increased cough responses to capsaicin that we observed in bleomycin-administered guinea pigs resemble what has been reported in subjects with IPF [26]. Thus, as with human patients, animals with lung fibrosis may show an altered function of capsaicin chemically sensitive unmyelinated C fibres [26]. This could also be involved in the increased number of coughs induced by the TRPA1 agonist AITC in bleomycin-administered animals.

Underlying inflammation may be related to enhanced cough responses, as inflammatory mediators activate TRPA1 and are thought to participate in cough hypersensitization. This would be supported by the contribution of inflammatory mediators to other animal models of enhanced coughing [7,8,27]. The contribution of inflammation to cough exacerbation could also explain the total or partial remission that we observed at day 21 of enhanced responses to citric acid, capsaicin and AITC. Therefore, in future experiments, it would be interesting to determine the role of inflammation in cough hypersensitivity related to bleomycin exposure. Taking into account the observed time course of lung inflammation and fibrosis, cough could be evaluated at earlier time points. At 24 h after bleomycin administration, the contribution of inflammation to cough exacerbation could be assessed before fibrosis is initiated. Additionally, cough responses might be measured at day 7, when tissue inflammation is maximal according to histopathological and qPCR (quantitative PCR) studies. Finally, the effect of anti-inflammatory drugs in response to tussive agents could be determined to prove the proposed link between inflammation and cough hypersensitization.

On the other hand, the reduction of exacerbation between days 14 and 21 could also be related to the partial remission of fibrosis observed between these time points. Regarding this, it is necessary to point out that we induced lung injury using a single administration of bleomycin. Other groups have shown that bleomycin exposure may fail to recapitulate some of the characteristics of IPF, including its progressive and irreversible course [9]. It has been suggested that the reason behind this would be that IPF would result from recurrent episodes of lung injury [9]. It may therefore be interesting in future studies to evaluate whether repetitive bleomycin administrations favour in guinea pigs the persistency of fibrosis, as they do in mice [25,28], and a more sustained cough exacerbation.

Although the causes of cough hypersensitivity in lung fibrosis are unknown, different hypotheses have been proposed. One of them suggests that neurotrophins generated in diseased lung parenchyma induce a remodelling of nerve fibres involved in cough [3,6]. Accordingly, IPF patients have higher levels of the neurotrophins NGF and BDNF in their bronchial epithelial lining fluid than control subjects [26]. Similarly, in guinea pigs, levels of BDNF in BALF were increased up to day 14 after bleomycin administration. This could explain the sensory neuroplasticity observed in our model. However, we did not detect changes in pulmonary gene expression of TRPV1, TRPA1 or Nav1.7, all of them located in sensory nerves. It is possible that alterations in these ion channels occur in other structures involved in cough such as the vagal nerve or the central nervous system [10,29]. It is also feasible that changes take place at levels other than the mRNA expression. For instance, ion channel proteins are regulated by different post-translational modifications and their conformational state controls channels function [30,31]. Further research is therefore required to understand whether neurotrophins sensitize cough reflexes during lung fibrosis and the associated molecular mechanisms.

In conclusion, in the present paper, we describe for the first time an animal model with enhanced cough sensitivity related to induced lung fibrosis, such as is observed in IPF patients. Our results also support the use of capsaicin as a valid cough inducer to evaluate cough hypersensitivity associated with lung fibrosis. However, it points to the need to study cough responses to other challenges apart from capsaicin in patients too. We think that our model could be used to better understand the pathophysiology of cough exacerbation associated with pulmonary fibrosis and to evaluate antitussive therapies for these conditions.

AUTHOR CONTRIBUTION

All authors contributed to the conception and the design of the research. Joan Antoni Fernández-Blanco, Mònica Aguilera and Anna Domènech performed experiments and analysis, wrote the paper and prepared the Figures. Gema Tarrasón, Neus Prats, Montse Miralpeix and Jorge De Alba edited and revised the paper before submission. All authors approved the final version of the paper.

We acknowledge the significant technical assistance of Isabel Pagán, Núria Torán, Cloti Hernández and Gloria Aniorte and the scientific support of Vicente García-González of Almirall R&D Centre (Sant Feliu de Llobregat). We also thank Jorge Martínez, Ph.D. Dipl. ECVP, of the Departament de Sanitat i Anatomia Animals, Universitat Autònoma Barcelona, who provided support in histopathological studies.

FUNDING

This work was supported by Almirall S.A., Barcelona, Spain.

Abbreviations

     
  • AITC

    allylisothiocyanate

  •  
  • B2M

    β2-microglobulin

  •  
  • BALF

    bronchoalveolar lavage fluid

  •  
  • BDNF

    brain-derived neurotrophic factor

  •  
  • Cq

    quantification cycle

  •  
  • H&E

    haematoxylin and eosin

  •  
  • IL-1β

    interleukin 1β

  •  
  • IPF

    idiopathic pulmonary fibrosis

  •  
  • MMP

    matrix metalloproteinase

  •  
  • Nav1.7

    voltage-gated sodium channel type 1.7

  •  
  • NGF

    nerve growth factor

  •  
  • qPCR

    quantitative PCR

  •  
  • TGFβ1

    transforming growth factor β1

  •  
  • TNFα

    tumour necrosis factor α

  •  
  • TRPA1

    transient receptor potential cation channel, ankyrin subfamily, member 1

  •  
  • TRPV1

    transient receptor potential cation channel, vanilloid subfamily, member 1

References

References
1
Morice
 
A.H.
Fontana
 
G.A.
Belvisi
 
M.G.
Birring
 
S.S.
Chung
 
K.F.
Dicpinigaitis
 
P.V.
Kastelik
 
J.A.
McGarvey
 
L.P.
Smith
 
J.A.
Tatar
 
M.
, et al 
ERS guidelines on the assessment of cough
Eur. Respir. J.
2007
, vol. 
29
 (pg. 
1256
-
1276
)
[PubMed]
2
Key
 
A.L.
Holt
 
K.
Hamilton
 
A.
Smith
 
J.A.
Earis
 
J.E.
 
Objective cough frequency in Idiopathic Pulmonary Fibrosis
Cough
2010
, vol. 
6
 pg. 
4
 
[PubMed]
3
Harrison
 
N.K.
 
Idiopathic pulmonary fibrosis: a nervous cough?
Pulm. Pharmacol. Ther.
2004
, vol. 
17
 (pg. 
347
-
350
)
[PubMed]
4
Turner-Warwick
 
M.
Burrows
 
B.
Johnson
 
A.
 
Cryptogenic fibrosing alveolitis: clinical features and their influence on survival
Thorax
1980
, vol. 
35
 (pg. 
171
-
180
)
[PubMed]
5
Swigris
 
J.J.
Stewart
 
A.L.
Gould
 
M.K.
Wilson
 
S.R.
 
Patients' perspectives on how idiopathic pulmonary fibrosis affects the quality of their lives
Health Qual. Life Outcomes
2005
, vol. 
3
 pg. 
61
 
[PubMed]
6
Harrison
 
N.K.
 
Cough, sarcoidosis and idiopathic pulmonary fibrosis: raw nerves and bad vibrations
Cough
2013
, vol. 
9
 pg. 
9
 
[PubMed]
7
Nasra
 
J.
Belvisi
 
M.G.
 
Modulation of sensory nerve function and the cough reflex: understanding disease pathogenesis
Pharmacol. Ther.
2009
, vol. 
124
 (pg. 
354
-
375
)
[PubMed]
8
Okazaki
 
A.
Ohkura
 
N.
Fujimura
 
M.
Katayama
 
N.
Kasahara
 
K.
 
Effects of pirfenidone on increased cough reflex sensitivity in guinea pigs
Pulm. Pharmacol. Ther.
2013
, vol. 
26
 (pg. 
603
-
608
)
[PubMed]
9
Degryse
 
A.L.
Lawson
 
W.E.
 
Progress toward improving animal models for idiopathic pulmonary fibrosis
Am. J. Med. Sci.
2011
, vol. 
341
 (pg. 
444
-
449
)
[PubMed]
10
Muroi
 
Y.
Ru
 
F.
Kollarik
 
M.
Canning
 
B.J.
Hughes
 
S.A.
Walsh
 
S.
Sigg
 
M.
Carr
 
M.J.
Undem
 
B.J.
 
Selective silencing of NaV1.7 decreases excitability and conduction in vagal sensory neurons
J. Physiol.
2011
, vol. 
589
 (pg. 
5663
-
5676
)
[PubMed]
11
Moeller
 
A.
Ask
 
K.
Warburton
 
D.
Gauldie
 
J.
Kolb
 
M.
 
The bleomycin animal model: a useful tool to investigate treatment options for idiopathic pulmonary fibrosis?
Int. J. Biochem. Cell Biol.
2008
, vol. 
40
 (pg. 
362
-
382
)
[PubMed]
12
Moore
 
B.B.
Hogaboam
 
C.M.
 
Murine models of pulmonary fibrosis
Am. J. Physiol. Lung Cell. Mol. Physiol.
2008
, vol. 
294
 (pg. 
L152
-
L160
)
[PubMed]
13
Kamei
 
J.
Hitosugi
 
H.
Kasuya
 
Y.
 
Cough induced activity of spirapril in rats
Gen. Pharmacol.
1993
, vol. 
24
 (pg. 
1443
-
1445
)
[PubMed]
14
Chen
 
L.
Lai
 
K.
Lomask
 
J.M.
Jiang
 
B.
Zhong
 
N.
 
Detection of mouse cough based on sound monitoring and respiratory airflow waveforms
PLoS One
2013
, vol. 
8
 pg. 
e59263
 
[PubMed]
15
Brozmanova
 
M.
Hanacek
 
J.
Tatar
 
M.
Szepe
 
P.
 
The influence of hyperoxia on cough reflex intensity in guinea pigs treated with bleomycin
Bratisl. Lek. Listy
2004
, vol. 
105
 (pg. 
65
-
71
)
[PubMed]
16
Cisneros-Lira
 
J.
Gaxiola
 
M.
Ramos
 
C.
Selman
 
M.
Pardo
 
A.
 
Cigarette smoke exposure potentiates bleomycin-induced lung fibrosis in guinea pigs
Am. J. Physiol. Lung Cell. Mol. Physiol.
2003
, vol. 
285
 (pg. 
L949
-
L956
)
[PubMed]
17
Suga
 
M.
Iyonaga
 
K.
Okamoto
 
T.
Gushima
 
Y.
Miyakawa
 
H.
Akaike
 
T.
Ando
 
M.
 
Characteristic elevation of matrix metalloproteinase activity in idiopathic interstitial pneumonias
Am. J. Respir. Crit. Care Med.
2000
, vol. 
162
 (pg. 
1949
-
1956
)
[PubMed]
18
Stijn
 
W.
Stijn
 
E.V.
Bart
 
M.V.
Marijke
 
W.
Christophe
 
D.
Jonas
 
Y.
Jana
 
S.
Eric
 
K.V.
Geert
 
M.V.
Wim
 
A.W.
 
Multiplex protein profiling of bronchoalveolar lavage in idiopathic pulmonary fibrosis and hypersensitivity pneumonitis
Ann. Thorac. Med.
2013
, vol. 
8
 pg. 
38
 
[PubMed]
19
Verma
 
R.
Kushwah
 
L.
Gohel
 
D.
Patel
 
M.
Marvania
 
T.
Balakrishnan
 
S.
 
Evaluating the ameliorative potential of quercetin against the bleomycin-induced pulmonary fibrosis in Wistar rats
Pulm. Med.
2013
, vol. 
2013
 pg. 
921724
 
[PubMed]
20
Polosukhin
 
V. V
Degryse
 
A.L.
Newcomb
 
D.C.
Jones
 
B.R.
Ware
 
L.B.
Lee
 
J.W.
Loyd
 
J.E.
Blackwell
 
T.S.
Lawson
 
W.E.
 
Intratracheal bleomycin causes airway remodeling and airflow obstruction in mice
Exp. Lung Res.
2012
, vol. 
38
 (pg. 
135
-
146
)
[PubMed]
21
Grande
 
N. R.
Peão
 
M.N.D.
de Sá, A.P.Á.
 
C.M.
 
Lung fibrosis induced by bleomycin: structural changes and overview of recent advances
Scanning Microsc
1998
, vol. 
12
 (pg. 
487
-
494
)
22
Katzenstein
 
A.L.
Myers
 
J.L.
 
Idiopathic pulmonary fibrosis: clinical relevance of pathologic classification
Am. J. Respir. Crit. Care Med.
1998
, vol. 
157
 (pg. 
1301
-
1315
)
[PubMed]
23
Fernandez
 
I.E.
Eickelberg
 
O.
 
The impact of TGF-β on lung fibrosis: from targeting to biomarkers
Proc. Am. Thorac. Soc.
2012
, vol. 
9
 (pg. 
111
-
116
)
[PubMed]
24
McKeown
 
S.
Richter
 
A.G.
O'Kane
 
C.
McAuley
 
D.F.
Thickett
 
D.R.
 
MMP expression and abnormal lung permeability are important determinants of outcome in IPF
Eur. Respir. J.
2009
, vol. 
33
 (pg. 
77
-
84
)
[PubMed]
25
Chung
 
M.P.
Monick
 
M.M.
Hamzeh
 
N.Y.
Butler
 
N.S.
Powers
 
L.S.
Hunninghake
 
G.W.
 
Role of repeated lung injury and genetic background in bleomycin-induced fibrosis
Am. J. Respir. Cell Mol. Biol.
2003
, vol. 
29
 (pg. 
375
-
380
)
[PubMed]
26
Hope-Gill
 
B.D. M.
Hilldrup
 
S.
Davies
 
C.
Newton
 
R.P.
Harrison
 
N.K.
 
A study of the cough reflex in idiopathic pulmonary fibrosis
Am. J. Respir. Crit. Care Med.
2003
, vol. 
168
 (pg. 
995
-
1002
)
[PubMed]
27
Bolser
 
D.C.
 
Experimental models and mechanisms of enhanced coughing
Pulm. Pharmacol. Ther.
2004
, vol. 
17
 (pg. 
383
-
388
)
[PubMed]
28
Degryse
 
A.L.
Tanjore
 
H.
Xu
 
X.C.
Polosukhin
 
V. V
Jones
 
B.R.
McMahon
 
F.B.
Gleaves
 
L.A.
Blackwell
 
T.S.
Lawson
 
W.E.
 
Repetitive intratracheal bleomycin models several features of idiopathic pulmonary fibrosis
Am. J. Physiol. Lung Cell. Mol. Physiol.
2010
, vol. 
299
 (pg. 
L442
-
L452
)
[PubMed]
29
Chung
 
K.F.
McGarvey
 
L.
Mazzone
 
S.B.
 
Chronic cough as a neuropathic disorder
Lancet Respir. Med.
2013
, vol. 
1
 (pg. 
414
-
422
)
[PubMed]
30
Laedermann
 
C.J.
Cachemaille
 
M.
Kirschmann
 
G.
Pertin
 
M.
Gosselin
 
R.-D.
Chang
 
I.
Albesa
 
M.
Towne
 
C.
Schneider
 
B.L.
Kellenberger
 
S.
, et al 
Dysregulation of voltage-gated sodium channels by ubiquitin ligase NEDD4–2 in neuropathic pain
J. Clin. Invest.
2013
, vol. 
123
 (pg. 
3002
-
3013
)
[PubMed]
31
Armstrong
 
C.M.
 
Na channel inactivation from open and closed states
Proc. Natl. Acad. Sci. U.S.A.
2006
, vol. 
103
 (pg. 
17991
-
17996
)
[PubMed]