The common cold is one of the most frequent human inflammatory diseases caused by viruses and can facilitate bacterial superinfections, resulting in sinusitis or pneumonia. The active ingredient of the drug Soledum, 1,8-cineole, is commonly applied for treating inflammatory diseases of the respiratory tract. However, the potential for 1,8-cineole to treat primary viral infections of the respiratory tract remains unclear. In the present study, we demonstrate for the first time that 1,8-cineole potentiates poly(I:C)-induced activity of the antiviral transcription factor interferon regulatory factor 3 (IRF3), while simultaneously reducing proinflammatory nuclear factor (NF)-κB activity in human cell lines, inferior turbinate stem cells (ITSCs) and in ex vivo cultivated human nasal mucosa. Co-treatment of cell lines with poly(I:C) and 1,8-cineole resulted in significantly increased IRF3 reporter gene activity compared with poly(I:C) alone, whereas NF-κB activity was reduced. Accordingly, 1,8-cineole- and poly(I:C) treatment led to increased nuclear translocation of IRF3 in ITSCs and a human ex vivo model of rhinosinusitis compared with the poly(I:C) treatment approach. Nuclear translocation of IRF3 was significantly increased in ITSCs and slice cultures treated with lipopolysaccharide (LPS) and 1,8-cineole compared with the LPS-treated cells mimicking bacterial infection. Our findings strongly suggest that 1,8-cineole potentiates the antiviral activity of IRF3 in addition to its inhibitory effect on proinflammatory NF-κB signalling, and may thus broaden its field of application.

CLINICAL PERSPECTIVES

  • Although the common cold syndrome is one of the most frequent virally caused human diseases and can facilitate severe secondary infections such as sinusitis or pneumonia, treatment strategies often do not target the underlying viral infection.

  • Applying ex vivo cultivated human nasal tissue as a model system of rhinosinusitis, we demonstrate here that 1,8-cineole, the active ingredient of the drug Soledum, potentiates the antiviral activity of IRF3 in addition to its inhibitory effect on proinflammatory NF-κB signalling.

  • The antiviral activity of 1,8-cineole shown in the present study may broaden its range of applications, particularly in terms of treating the common cold syndrome and related rhinovirus-dependent airway infections.

INTRODUCTION

The common cold syndrome is one of the most frequent inflammatory diseases, affecting an adult on average two to four times a year (reviewed in Heikkinen and Jarvinen [1]). Infection of the respiratory tract by rhinoviruses [2], or to a lesser extent by coronaviruses or influenza viruses, is followed by typical symptoms ranging from sneezing, sore throat, cough and nasal congestion, to tiredness and malaise [3,4]. In addition, the common cold has been reported to lead to an increase in acute exacerbations in patients with asthma or chronic obstructive pulmonary disease (COPD) [57]. The damage to the respiratory epithelium during viral infection further facilitates bacterial infections of the respiratory tract and subsequent inflammatory diseases such as sinusitis and pneumonia (reviewed in Heikkinen and Jarvinen [1]).

Natural, plant-derived monoterpenoids are commonly applied for treatment of inflammatory diseases of the respiratory tract [8]. Initially identified by Cloez in 1870 [9] as the dominant portion of Eucalyptus globulus oil, the monoterpenoid 1,8-cineole was described to have an antibacterial activity [10,11], as well as anti-inflammatory effects in animal models of allergic airway inflammation [12,13] and acute pulmonary inflammation [14]. 1,8-cineole is currently therapeutically applied as the active ingredient of the drug Soledum. Placebo-controlled, double-blind trials demonstrated an effective treatment of acute sinusitis with 1,8-cineole in 152 patients [15]. Worth et al. [16] further demonstrated that 1,8-cineole improved lung function and reduced exacerbations in 242 patients with COPD. Likewise, Juergens et al. [17,18] showed the beneficial effects of 1,8-cineole in 12 of 16 patients with bronchial asthma. Indicating a potential molecular mechanism via cytokine inhibition, 1,8-cineole reduced the production of the proinflammatory cytokines tumour necrosis factor (TNF)-α and interleukin (IL)-1β in human monocytes [19]. We extended these findings by demonstrating that 1,8-cineole inhibits the activity of the transcription factor nuclear factor κ light chain enhancer of activated B-cells (NF-κB), a key mediator of proinflammatory signalling. In particular, we showed a 1,8-cineole-dependent reduction of nuclear translocation of NF-κB-p65 and decreased NF-κB-dependent transcriptional activity [20]. This novel mode of action was recently confirmed by Zhao et al. [14], who showed a NF-κB-associated reduction of proinflammatory cytokines after 1,8-cineole treatment in mice. Despite these promising effects against bacteria-induced inflammation, the potential effect of 1,8-cineole for treating the predisposing viral infection remains unclear. In the present study, we applied the dsRNA analogue poly(I:C) (polyinosinic:polycytidylic acid) to mimic viral infection in vitro and ex vivo. Poly(I:C) is broadly described as inducing antiviral responses in a broad variety of cell types such as human alveolar, corneal and bronchial epithelial cells [21,22], as well as in the lungs of mice [23]. Poly(I:C) is recognized by toll-like receptor 3 (TLR3), in turn leading to a cellular antiviral response via activation of the MyD88-independent signalling pathway, culminating in activation of interferon regulatory factor 3 (IRF3) and production of type I interferons (IFNs). In addition to activation of IRF3, MyD88-independent signalling results in a late and weak activation of NF-κB, followed by a moderate release of proinflammatory cytokines [24,25]. Notably, Wang et al. [26] reported in 2009 a TLR3-mediated recognition of rhinoviral dsRNA intermediates in rhinovirus-infected airway epithelial cells, highlighting the suitability of poly(I:C) to mimic rhinoviral infection.

In the present study, we determined potential effects of 1,8-cineole on antiviral IRF3 activity using human cell lines and human nasal stem cells isolated from the inferior turbinate. Inferior turbinate stem cells (ITSCs) represent a promising cellular model system due to their easy expandability and endogenous niche within the respiratory epithelium [27,28]. In addition to cellular models, we very recently described the successful application of ex vivo cultivated human nasal slices from the inferior turbinate as a novel model system for the late phase of rhinosinusitis. Here, treatment with 1,8-cineole significantly reduced the amount of Alcian Blue-stained mucin within goblet cells. Accordingly, we observed a significant reduction of MUC2 gene expression in ex vivo cultivated nasal slices accompanied by attenuated expression levels of TNF-α [29]. In the present study, we also demonstrate for the first time that 1,8-cineole leads to elevated levels of antiviral IRF3 activity in human cell lines and ITSCs, as well as in ex vivo cultivated human nasal tissue in a viral mimic model. In particular, poly(I:C) treatment of human cell lines resulted in increased activity, nuclear translocation and respective target gene expression of IRF3 and NF-κB. Exposure to poly(I:C) and 1,8-cineole led to significantly increased IRF3 activity, accompanied by reduced nuclear translocation of NF-κB-p65 and diminished NF-κB activity. Notably, nuclear translocation of IRF3 was significantly increased in ITSCs and nasal slice cultures treated with poly(I:C) and 1,8-cineole compared with the poly(I:C) treatment approaches. Moreover, LPS treatment of human nasal slice cultures led to increased activity of IRF3, which was significantly increased further after co-treatment with 1,8-cineole.

MATERIALS AND METHODS

Cell culture

Human cell lines U373 and U251 were cultivated in Dulbecco's Modified Eagle Medium (DMEM) high glucose (Sigma-Aldrich) containing 1% L-glutamate (200 mM, Sigma-Aldrich) and 10% FBS (Sigma-Aldrich) in a humidified incubator (Binder) at 37°C and 5% CO2. ITSCs were isolated from inferior turbinates obtained during nasal surgery after an informed consent according to local and international guidelines (Bezirksregierung Detmold). Isolation and further experimental procedures were ethically approved by the ethics commission of the Ärztekammer Westfalen-Lippe and the medical faculty of the Westfälische Wilhems-Universität Münster. Isolation and cultivation procedures were performed as described in Hauser et al. [27]. U373 and U251 cells as well as ITSCs were treated with poly(I:C) (the sodium salt, 100 μg/, Sigma-Aldrich), lipopolysaccharides (LPSs, 1 μg/ml, rough strains from Salmonella enterica Re 595, Sigma-Aldrich), or LPS/poly(I:C) and 1,8-cineole (10−4 M, prepared as described in Greiner et al. [20], Klosterfrau Healthcare Group, Cassella-med GmbH & Co. KG).

Tissue culture of nasal turbinate slices

Human nasal inferior turbinates were isolated during nasal surgery after informed consent was obtained according to local and international guidelines (Bezirksregierung Detmold). As for the previous section isolation and further experimental procedures were ethically approved by the ethics commission of the Ärztekammer Westfalen-Lippe and the medical faculty of the Westfälische Wilhems-Universität Münster. Sliced inferior turbinate tissue (200 μm thickness) was transferred to culture plate inserts (0.4 μm nitrocellulose membrane, Millipore/Greiner) and cultivated at the interface of air and B-ALI differentiation medium (Lonza Group) as described previously [29]. Nasal slices were cultured for at least 1 week, followed by treatment with LPS (100 ng/ml, rough strains from Salmonella enterica), or co-treatment with LPS and 1,8-cineole (10−4 M) for 24 h followed by immunohistochemistry as described below. Treatment of nasal slice cultures with poly(I:C) (100 μg/ml) or poly(I:C) and 1,8-cineole (10−4 M) was performed for 2 h and 4 h, followed by immunohistochemistry as described below.

Transient transfection and gene reporter assays

U373 and U251 cells were transfected with 2.2 μg of pRL-CMV (Promega Corp.) and 1.1 μg of TK(NF-κB)6LUC [30] for NF-κB reporter gene assays or 2.2 μg of pRL–CMV (Promega Corp.) as well as 1 μg of IRF3–Gal4 and 1 μg of UAS–LUC (kindly provided by Katherine A. Fitzgerald, Department of Medicine, University of Massachusetts Medical School, Worcester, U.S.A.). Transfection was performed using a rat NSC Nucleofector Kit (Amaxa Biosystems, Lonza Group AG) and Nucleofector II device (Lonza Group) according to the manufacturer's guidelines. FPred (1.5 μg, Lonza Group) or pmaxGFP (0.3 μg, Lonza Group) served as a transfection control. After transfection, 24 h later, U373 and U251 cells were treated with poly(I:C), LPS (1 μg/ml, rough strains from Salmonella enterica Re 595), or combinations of LPS/poly(I:C) and 1,8-cineole (1×10−4 M or 2×10−4 M prepared as described in Greiner et al. [20], Klosterfrau Healthcare Group) for 24 h. Luciferase activity was subsequently assessed by applying Dual-Luciferase Reporter Assay System (Promega Corp.) according to the manufacturer's guidelines. Statistical analysis was performed using GraphPad Prism software, and bioluminescence of constitutively active Renilla luciferase (pRL–CMV vector) served for normalization.

Reverse transcription-PCR

Total RNA was isolated from untreated and poly(I:C)-treated U251 cells as described above using an RNeasy Mini Kit (QIAGEN) according to the manufacturer's guidelines or via phenol/chloroform extraction. The quality and concentration of RNA were determined using Nanodrop UV spectrophotometry followed by cDNA synthesis via application of a First Strand cDNA Synthesis Kit (Thermo Fisher Scientific) according to the manufacturer's guidelines. PCR was performed using GoTaq polymerase (Promega Corp.) according to the manufacturer's guidelines. For primer sequences (0.5 μM, Metabion) see Table 1. 

Table 1
Primer sequences

GAPDH, glyceraldehyde 3-phosphate dehydrogenase.

Target Forward primer Reverse primer 
CD14 GCCATCCAGAATCTAGCGCT TTGGCTGGCAGTCCTTTAGG 
IFN-β TGCTCTCCTGTTGTGCTTCT AGCTGCTTAATCTCCTCAGGG 
IL-8 GTGCAGTTTTGCCAAGGAGT CTCTGCACCCAGTTTTCCTT 
GAPDH CATGAGAAGTATGACAACAGCCT AGTCCTTCCACGATACCAAAGT 
MD2 GTCTGCAACTCATCCGATGC CGTCATCAGATCCTCGGCAA 
MyD88 GGCGGAGGAGATGGACTTTG AGCGGCCACCTGTAAAGG 
RANTES CCCTCGCTGTCATCCTCATT ACGACTGCTGGGTTGGAG 
TIRAP CCGAATATCCTCCTGGCCAG GGTCAAAACTAGCCCCGTGA 
TLR3 GGACTTTGAGGCGGGTGTTT CAAACAGAGTGCATGGTTCAGT 
TLR4 AAAATCCCCGACAACCTCCC GCTCCCAGGGCTAAACTCTG 
TNF-α CAGAGGGCCTGTACCTCATC GGAAGACCCCTCCCAGATAG 
TRAM CAGTGCTGAGCCACGAATTC TTGCTGGGAGGGTGACATTG 
TRIF GGACGCCATAGACCACTCAG CTGGCGAAGATCTGGGAGTG 
Target Forward primer Reverse primer 
CD14 GCCATCCAGAATCTAGCGCT TTGGCTGGCAGTCCTTTAGG 
IFN-β TGCTCTCCTGTTGTGCTTCT AGCTGCTTAATCTCCTCAGGG 
IL-8 GTGCAGTTTTGCCAAGGAGT CTCTGCACCCAGTTTTCCTT 
GAPDH CATGAGAAGTATGACAACAGCCT AGTCCTTCCACGATACCAAAGT 
MD2 GTCTGCAACTCATCCGATGC CGTCATCAGATCCTCGGCAA 
MyD88 GGCGGAGGAGATGGACTTTG AGCGGCCACCTGTAAAGG 
RANTES CCCTCGCTGTCATCCTCATT ACGACTGCTGGGTTGGAG 
TIRAP CCGAATATCCTCCTGGCCAG GGTCAAAACTAGCCCCGTGA 
TLR3 GGACTTTGAGGCGGGTGTTT CAAACAGAGTGCATGGTTCAGT 
TLR4 AAAATCCCCGACAACCTCCC GCTCCCAGGGCTAAACTCTG 
TNF-α CAGAGGGCCTGTACCTCATC GGAAGACCCCTCCCAGATAG 
TRAM CAGTGCTGAGCCACGAATTC TTGCTGGGAGGGTGACATTG 
TRIF GGACGCCATAGACCACTCAG CTGGCGAAGATCTGGGAGTG 

Real-time PCR

Total RNA was isolated from ITSCs treated as described above using an RNeasy Mini Kit followed by cDNA synthesis with a qSqript cDNA Synthesis Kit (Quanta) according to the manufacturer's guidelines. All quantitative (q)PCR reactions were performed as triplicates using 5x EvaGreen QPCR-Mix II (Bio-Budget Technologies) according to the manufacturer's guidelines and assayed with a Rotor Gene 6000 (QIAGEN). Primer sequences (0.25 μM, Metabion) were CCCTCGCTGTCATCCTCATT (RANTES forward), ACGACTGCTGGGTTGGAG (RANTES reverse), CTGCACCACCAACTGCTTAG (GAPDH forward) and GTCTTCTGGGTGGCAGTGAT (GAPDH reverse).

Immunocytochemistry

For immunocytochemistry, U251 and U373 cells, and ITSCs treated as described above were fixed using 4% paraformaldehyde (PFA) (4% PFA, 100 mM NaH2PO4, 0.4 mM CaCl2) for 20 min followed by permeabilization and blocking with 0.02% PBT [0.02% Triton-X100 (Sigma-Aldrich) in PBS] with 5% goat serum (Dianova). The primary antibodies anti-NF-κB-p65 (sc-372 or sc8008) or anti-IRF3 (sc-9082, all from Santa Cruz Biotechnologies) were applied for 1 h. Respective secondary fluorochrome-conjugated antibodies (A21428, A21422, A21201, Molecular Probes) were subsequently added for 1 h under light exclusion. Nuclear counterstaining was performed by applying 4′,6-diamidino-2-phenylindole (DAPI; 1:2000, Life Technologies) for 15 min, followed by covering with Mowiol. Fluorescence imaging was done using confocal laser scanning microscopy (LSM 780, Carl Zeiss) and ZEN software (Carl Zeiss). Image processing and analysis were performed using Fiji [31] followed by statistical analysis with GraphPad Prism software.

Immunohistochemistry

Nasal slices cultivated and treated as described above were removed from the culture inserts followed by preparation of 10 μm thick cryosections. For immunohistochemistry, 4% PFA was applied for 20 min followed by permeabilization and blocking with 0.1% PBT, made up with 5% goat serum, and addition of primary antibodies anti-NF-κB-p65 (sc-372 or sc8008), anti-IRF3 (sc-9082) or anti-CK14 (sc-7156) for 2 h. Respective secondary fluorochrome-conjugated antibodies (A21428, A21422, A21201) were subsequently applied for 1 h under light exclusion. Nuclear counterstaining was done using DAPI (1:2000) for 15 min followed by covering with Mowiol. Fluorescence imaging was done via confocal scanning laser microscopy (LSM 780) and ZEN software followed by image processing and analysis using Fiji [31]. Statistical analysis was performed using GraphPad Prism software.

RESULTS

Poly(I:C)-driven mimicry of viral infection increases activity of NF-κB and IRF3

Assessing the presence of protein transcripts relevant to NF-κB and IRF3 signalling in U251 cells, we showed expression of TLR3 and TLR4, lymphocyte antigen 96 (MD2), myeloid differentiation primary response gene 88 (MYD88), TIR-domain-containing, adapter-inducing interferon-β (TRIF), toll/interleukin (IL)-1 receptor domain-containing adapter protein (TIRAP) and TRIF-related adapter molecule (TRAM) (Figure 1A). In order to mimic viral infection in U251 cells, we applied the dsRNA analogue poly(I:C) to simulate the presence of dsRNA replication intermediates of ssRNA viruses [24,26]. U251 cells transiently transfected with a dual luciferase NF-κB reporter system showed a significant increase in luciferase activity after treatment with increasing concentrations of poly(I:C) (25–1000 μg/ml) compared with untreated controls. In addition, we observed significantly augmented luciferase activities compared with controls in response to poly(I:C) (25–1000 μg/ml) in U251 cells transiently transfected with a IRF3-driven luciferase reporter system (Figure 1B).

dsRNA analogue poly(I:C) leads to increased activity of NF-κB and IRF3

Figure 1
dsRNA analogue poly(I:C) leads to increased activity of NF-κB and IRF3

(A) RT-PCR revealed expression of transcripts encoding proteins involved in NF-κB and IRF3 signalling in U251 cells. (B) Poly(I:C) treatment resulted in significantly increased luciferase activities in U251 cells transiently transfected with TK(NF-κB)6LUC and pRL–CMV vector or IRF3–GAL4, UAS–LUC and pRL–CMV vectors compared with untreated controls (***P<0.001 was considered significant; unpaired Student's t-test, two tailed, 95% CI. (C, D) Quantification of fluorescence intensities of immunocytochemical staining (displayed as intensity scale), depicting significantly increased nuclear localization of NF-κB-p65 and IRF3 in U251 cells after poly(I:C) treatment compared with untreated controls (data of three independent measurements merged; ***P<0.001 was considered significant). (E) RT-PCR showing increased expression levels of the NF-κB target gene TNF-α as well as IRF3 target genes RANTES and IFN-β after exposure to poly(I:C) compared with untreated controls. NTC, no template control.

Figure 1
dsRNA analogue poly(I:C) leads to increased activity of NF-κB and IRF3

(A) RT-PCR revealed expression of transcripts encoding proteins involved in NF-κB and IRF3 signalling in U251 cells. (B) Poly(I:C) treatment resulted in significantly increased luciferase activities in U251 cells transiently transfected with TK(NF-κB)6LUC and pRL–CMV vector or IRF3–GAL4, UAS–LUC and pRL–CMV vectors compared with untreated controls (***P<0.001 was considered significant; unpaired Student's t-test, two tailed, 95% CI. (C, D) Quantification of fluorescence intensities of immunocytochemical staining (displayed as intensity scale), depicting significantly increased nuclear localization of NF-κB-p65 and IRF3 in U251 cells after poly(I:C) treatment compared with untreated controls (data of three independent measurements merged; ***P<0.001 was considered significant). (E) RT-PCR showing increased expression levels of the NF-κB target gene TNF-α as well as IRF3 target genes RANTES and IFN-β after exposure to poly(I:C) compared with untreated controls. NTC, no template control.

Significantly increased nuclear translocation of IRF3 and NF-κB-p65 after poly(I:C) treatment is accompanied by an increased expression of IRF3 and NF-κB target genes

Validating the increase in sustained IRF3 and NF-κB activity, we showed an augmented nuclear translocation of IRF3 and NF-κB-p65 in U251 cells after poly(I:C) treatment compared with the control (Figure 1C and see Supplementary Figures S1 and S2). Quantification of immunocytochemical staining confirmed the increase in the amount of nuclear IRF3 after 2 h and 4 h of poly(I:C) treatment. Accordingly, significantly elevated nuclear translocation of NF-κB-p65 was observed in U251 cells treated with poly(I:C) for 2 h compared with controls (Figure 1D). Reverse transcription (RT)-PCR analysis further demonstrated increased expression of the IRF3 target genes Regulated on Activation, Normal T-cell Expressed and Secreted (RANTES) and IFN-β. In addition, we detected an elevated expression of the NF-κB target gene TNF-α in poly(I:C)-treated U251 cells compared with untreated controls (Figure 1E).

Poly(I:C)-induced activity of IRF3 is further increased by co-treatment with 1,8-cineole

To investigate potential effects of 1,8-cineole on IRF3 after poly(I:C)-mediated simulation of viral infection, we transiently transfected U373 cells with a dual IRF3 luciferase reporter system. Poly(I:C) treatment of U373 cells transiently transfected with the dual IRF3 reporter system led to significantly increased luciferase activity compared with controls. Although we observed no effects of 1,8-cineole alone (see Supplementary Figure S3A), combination of poly(I:C) and 1,8-cineole led to a further increase of luciferase activity if compared with poly(I:C)-treated cells (Figure 2A).

1,8-cineole leads to increased IRF3 activity and reduced activity of NF-κB in U373 cells stimulated with poly(I:C) or LPS

Figure 2
1,8-cineole leads to increased IRF3 activity and reduced activity of NF-κB in U373 cells stimulated with poly(I:C) or LPS

(A) Luciferase activity in U373 cells transiently transfected with IRF3-driven luciferase reporters was significantly increased after treatment with poly(I:C) compared with untreated controls. Co-treatment with poly(I:C) and 1,8-cineole resulted in significantly increased luciferase activity when compared with the poly(I:C) treatment approach. Significantly increased luciferase activity in U373 cells, transiently transfected with NF-κB-dependent luciferase reporters after exposure to poly(I:C), was significantly decreased after co-treatment with 1,8-cineole (***P<0.001, **P<0.01 and *P<0.05 were considered significant, unpaired Student's t-test, two tailed, 95% CI; data merged from two independent measurements). (B) Treatment with LPS resulted in significantly increased luciferase activity in U373 cells transiently transfected with IRF3-luciferase reporters compared with untreated controls. Co-treatment with LPS and 1,8-cineole resulted in significantly increased amounts of luciferase activity compared with the LPS-treated cells. U373 cells transiently transfected with NF-κB-driven luciferase reporters showed significantly increased luciferase activity after LPS treatment, which was significantly decreased after co-treatment with 1,8-cineole (***P<0.001, **P<0.01 were considered significant, unpaired Student's t-test, two tailed, 95% CI). Data were merged from two independent measurements. (C, D) The amount of nuclear localized NF-κB-p65 was significantly reduced in U373 cells after co-treatment with poly(I:C) and 1,8-cineole compared with poly(I:C) stimulation for 2 h (immunocytochemical staining displayed as intensity scale; ***P<0.001 was considered significant, Student's t-test, two tailed, 95% CI).

Figure 2
1,8-cineole leads to increased IRF3 activity and reduced activity of NF-κB in U373 cells stimulated with poly(I:C) or LPS

(A) Luciferase activity in U373 cells transiently transfected with IRF3-driven luciferase reporters was significantly increased after treatment with poly(I:C) compared with untreated controls. Co-treatment with poly(I:C) and 1,8-cineole resulted in significantly increased luciferase activity when compared with the poly(I:C) treatment approach. Significantly increased luciferase activity in U373 cells, transiently transfected with NF-κB-dependent luciferase reporters after exposure to poly(I:C), was significantly decreased after co-treatment with 1,8-cineole (***P<0.001, **P<0.01 and *P<0.05 were considered significant, unpaired Student's t-test, two tailed, 95% CI; data merged from two independent measurements). (B) Treatment with LPS resulted in significantly increased luciferase activity in U373 cells transiently transfected with IRF3-luciferase reporters compared with untreated controls. Co-treatment with LPS and 1,8-cineole resulted in significantly increased amounts of luciferase activity compared with the LPS-treated cells. U373 cells transiently transfected with NF-κB-driven luciferase reporters showed significantly increased luciferase activity after LPS treatment, which was significantly decreased after co-treatment with 1,8-cineole (***P<0.001, **P<0.01 were considered significant, unpaired Student's t-test, two tailed, 95% CI). Data were merged from two independent measurements. (C, D) The amount of nuclear localized NF-κB-p65 was significantly reduced in U373 cells after co-treatment with poly(I:C) and 1,8-cineole compared with poly(I:C) stimulation for 2 h (immunocytochemical staining displayed as intensity scale; ***P<0.001 was considered significant, Student's t-test, two tailed, 95% CI).

1,8-cineole leads to strongly reduced nuclear translocation of NF-κB-p65 as well as significantly reduced levels of NF-κB activity after poly(I:C) treatment

Next, we determined the effects of 1,8-cineole on NF-κB after poly(I:C) stimulation. Luciferase activity in U251 cells transiently transfected with a dual NF-κB reporter system showed an increase of NF-κB activity after poly(I:C) treatment compared with controls. Co-treatment with 1,8-cineole resulted in significantly decreased luciferase activity compared with poly(I:C)-treated cells (Figure 2A), demonstrating the reduction of proinflammatory NF-κB activity by 1,8-cineole in a model of viral infection. Treatment of U373 cells with poly(I:C) similarly resulted in increased nuclear translocation of NF-κB-p65 compared with the untreated controls. Moreover, we observed a significantly decreased nuclear localization of NF-κB-p65 after exposure of U373 cells to poly(I:C) and 1,8-cineole compared with poly(I:C)-stimulated cells (Figures 2C and 2D). No differences in the controls were observed in cells treated with 1,8-cineole alone (see Supplementary Figure S3B).

1,8-cineole treatment results in significantly augmented IRF3 activity and reduced activity of NF-κB-p65 after LPS stimulation

In order to investigate the activity of IRF3 after LPS treatment, U373 cells were transiently transfected with a dual IRF3 reporter system. In the present study, we detected significantly higher luciferase bioluminescence after LPS treatment compared with untreated controls. U373 cells co-treated with LPS and 1,8-cineole showed a further increase in IRF3 activity compared with cells treated with LPS alone (Figure 2B).

A dual luciferase reporter gene assay revealed significantly increased NF-κB activity after treatment with LPS compared with controls. Co-treatment with 1,8-cineole resulted in a significant decrease in luciferase activity compared with the cells exposed to LPS alone (Figure 2B). In accordance with our previous findings [20], we observed significantly reduced amounts of nuclear NF-κB-p65 after treatment with 1,8-cineole and LPS compared with LPS stimulation alone (data not shown).

Poly(I:C) leads to increased nuclear translocation of IRF3 and NF-κB in ITSCs

With regard to the endogenous environment of rhinosinusitis, we studied stem cells isolated from the respiratory epithelium of adult human inferior turbinate (Figures 3A and 3B) for further determination of the potential effects of 1,8-cineole on the activity of IRF3 and NF-κB. To validate the suitability of ITSCs to investigate poly(I:C)- and LPS-induced activation of IRF3 and NF-κB, we showed expression of TLR3 and TLR4 in ITSCs isolated from three independent donors (Figure 3C). Exposure of ITSCs to poly(I:C) for 2 h resulted in significantly increased nuclear translocation of IRF3 accompanied by highly elevated amounts of nuclear localized NF-κB-p65 compared with controls (Figures 3D–3F).

ITSCs treated with poly(I:C) show significantly increased IRF3 activity accompanied by significantly reduced NF-κB-activity after co-treatment with 1,8-cineole

Figure 3
ITSCs treated with poly(I:C) show significantly increased IRF3 activity accompanied by significantly reduced NF-κB-activity after co-treatment with 1,8-cineole

(A) Schematic view of the nasal cavity. (B) Isolated ITSCs cultivated as characteristic free-floating spheres and in an adherent state. (C) ITSCs expressed TLR3 and TLR4, relevant receptors of poly(I:C) and LPS recognition. (DF) Compared with controls, poly(I:C) treatment of ITSCs for 2 h resulted in significantly increased nuclear translocation of IRF3, accompanied by significantly elevated amounts of nuclear localized NF-κB-p65. Co-treatment with poly(I:C) and 1,8-cineole led to further significantly increased nuclear translocation of IRF3 and significantly decreased amounts of nuclear localized NF-κB-p65 compared with poly(I:C) stimulation. Immunocytochemical staining is displayed as an intensity scale (***P<0.001 and *P<0.05 were considered significant, unpaired Student's t-test, two tailed, 95% CI).

Figure 3
ITSCs treated with poly(I:C) show significantly increased IRF3 activity accompanied by significantly reduced NF-κB-activity after co-treatment with 1,8-cineole

(A) Schematic view of the nasal cavity. (B) Isolated ITSCs cultivated as characteristic free-floating spheres and in an adherent state. (C) ITSCs expressed TLR3 and TLR4, relevant receptors of poly(I:C) and LPS recognition. (DF) Compared with controls, poly(I:C) treatment of ITSCs for 2 h resulted in significantly increased nuclear translocation of IRF3, accompanied by significantly elevated amounts of nuclear localized NF-κB-p65. Co-treatment with poly(I:C) and 1,8-cineole led to further significantly increased nuclear translocation of IRF3 and significantly decreased amounts of nuclear localized NF-κB-p65 compared with poly(I:C) stimulation. Immunocytochemical staining is displayed as an intensity scale (***P<0.001 and *P<0.05 were considered significant, unpaired Student's t-test, two tailed, 95% CI).

Co-treatment of ITSCs with poly(I:C) and 1,8-cineole results in increased IRF3 activity accompanied by significantly reduced activity of NF-κB

ITSCs were co-treated with 1,8-cineole and poly(I:C), as described above, and subjected to immunocytochemical analysis of nuclear IRF3 and p65. In the present study, co-treatment of ITSCs with poly(I:C) and 1,8-cineole led to significantly increased nuclear translocation of IRF3 compared with poly(I:C) stimulation (Figures 3D and 3E). However, a significant decrease in the amount of nuclear localized NF-κB-p65 was observed in ITSCs exposed to poly(I:C) and 1,8-cineole compared with poly(I:C)-treated cells (Figures 3D and 3F).

1,8-cineole leads to significantly decreased nuclear localization of NF-κB-p65 in LPS-treated ITSCs

ITSCs were exposed to LPS to mimic bacterial infection common during late rhinosinusitis. LPS treatment of ITSCs for 2 h led to an increased nuclear translocation of NF-κB-p65 compared with controls (Figure 4A). Co-treatment with 1,8-cineole resulted in a significant decrease in nuclear NF-κB-p65 compared with poly(I:C) stimulation (Figure 4B). Notably, we observed no changes in nuclear translocation of IRF3 and NF-κB after treatment with 1,8-cineole alone (see Supplementary Figure S3C).

1,8-cineole leads to significantly decreased activity of NF-κB in LPS-treated ITSCs and highly elevated expression of the IRF3 target gene RANTES in a model of superinfection

Figure 4
1,8-cineole leads to significantly decreased activity of NF-κB in LPS-treated ITSCs and highly elevated expression of the IRF3 target gene RANTES in a model of superinfection

(A, B) LPS treatment of ITSCs for 2 h led to a significantly elevated nuclear translocation of NF-κB-p65, which was significantly decreased after co-treatment with 1,8-cineole. Immunocytochemical staining is displayed as an intensity scale. (C) Real-time PCR depicting significantly increased expression levels of the IRF3 target gene RANTES in ITSCs pre-treated with poly (I:C) for 4 h followed by co-exposure to poly(I:C) and LPS for 20 h compared with controls. Co-treatment of ITSCs with poly(I:C)/LPS and 1,8-cineole after poly(I:C) pre-treatment resulted further in elevated expression levels of RANTES (***P<0.001 and **P<0.01 were considered significant, unpaired Student's t-test, two tailed, 95% CI). n.d., not detectable.

Figure 4
1,8-cineole leads to significantly decreased activity of NF-κB in LPS-treated ITSCs and highly elevated expression of the IRF3 target gene RANTES in a model of superinfection

(A, B) LPS treatment of ITSCs for 2 h led to a significantly elevated nuclear translocation of NF-κB-p65, which was significantly decreased after co-treatment with 1,8-cineole. Immunocytochemical staining is displayed as an intensity scale. (C) Real-time PCR depicting significantly increased expression levels of the IRF3 target gene RANTES in ITSCs pre-treated with poly (I:C) for 4 h followed by co-exposure to poly(I:C) and LPS for 20 h compared with controls. Co-treatment of ITSCs with poly(I:C)/LPS and 1,8-cineole after poly(I:C) pre-treatment resulted further in elevated expression levels of RANTES (***P<0.001 and **P<0.01 were considered significant, unpaired Student's t-test, two tailed, 95% CI). n.d., not detectable.

Expression of the IRF3 target gene RANTES is elevated in ITSCs after treatment with 1,8-cineole in a model of superinfection

As a model of superinfection, ITSCs were pre-treated with poly(I:C) for 4 h followed by co-exposure to poly(I:C) and LPS for 20 h. Compared with controls, significantly increased expression levels of the IRF3 target gene RANTES were observed after simulation of superinfection (Figure 4C). Co-treatment of ITSCs with poly(I:C), LPS and 1,8-cineole led to further increase in RANTES expression compared with poly(I:C)/LPS stimulation (Figure 4C).

1,8-cineole leads to increased nuclear IRF3 and decreased nuclear translocation of NF-κB-p65 in ex vivo human nasal turbinate slices stimulated with poly(I:C)

We investigated the potential effects of 1,8-cineole on IRF3 activity in ex vivo cultivated human nasal turbinate tissue treated with poly(I:C). Cultured nasal turbinate tissue remained an intact epithelial layer, demonstrated by expression of CK14 at the protein level (see Supplementary Figure S3A). After 2 h of poly(I:C) treatment, turbinate tissue revealed slightly increased amounts of nuclear IRF3, which were further elevated after co-treatment with 1,8-cineole (Figure 5A). Quantification of nuclear fluorescence intensities in the immunohistochemical staining revealed a statistically significant increase in nuclear translocation of IRF3 after co-treatment of nasal slice cultures with poly(I:C) and 1,8-cineole compared with controls and poly(I:C)-treated human nasal slices (Figure 5B). In contrast to the fast kinetics of poly(I:C)-dependent activation of IRF3 observed in ITSCs (2 h, see Figures 3D and 3E), poly(I:C) treatment of ex vivo cultivated human nasal slices resulted in a delayed, but significantly increased, nuclear translocation of IRF3 after 4 h (Figure 5C). In addition, we observed further increased amounts of nuclear localized IRF3 after co-treatment with poly(I:C) and 1,8-cineole compared with poly(I:C)-treated slices (Figure 5C). A statistically significant increase in nuclear IRF3 was observed after co-treatment of nasal slice cultures with poly(I:C) and 1,8-cineole compared with controls (Figure 5D).

Ex vivo cultivated human nasal turbinate tissue stimulated with poly(I:C) shows a significantly increased amount of nuclear IRF3 after co-treatment with 1,8-cineole

Figure 5
Ex vivo cultivated human nasal turbinate tissue stimulated with poly(I:C) shows a significantly increased amount of nuclear IRF3 after co-treatment with 1,8-cineole

(A) Immunohistochemical staining (displayed as an intensity scale) of human nasal turbinate slice cultures showed increased amounts of nuclear localized IRF3 after 2 h of poly(I:C) treatment compared with untreated controls; this increased further after co-treatment with 1,8-cineole. (B) Quantification of nuclear fluorescence intensities of immunohistochemical staining revealed significantly increased nuclear localization of IRF3 after co-treatment with poly(I:C) and 1,8-cineole for 2 h compared with the poly(I:C) treatment approach and controls (***P<0.001 was considered significant, unpaired Student's t-test, two tailed, 95% CI). (C) Increased nuclear translocation of IRF3 in poly(I:C)-treated nasal slice cultures after 4 h was increased further after co-treatment with 1,8-cineole. (D) Quantification of nuclear fluorescence intensities of immunohistochemical staining showed significantly increased nuclear localization of IRF3 after 4 h of poly(I:C) treatment and co-treatment with poly(I:C) and 1,8-cineole compared with controls (***P<0.001 was considered significant, unpaired Student's t-test, two tailed, 95% CI).

Figure 5
Ex vivo cultivated human nasal turbinate tissue stimulated with poly(I:C) shows a significantly increased amount of nuclear IRF3 after co-treatment with 1,8-cineole

(A) Immunohistochemical staining (displayed as an intensity scale) of human nasal turbinate slice cultures showed increased amounts of nuclear localized IRF3 after 2 h of poly(I:C) treatment compared with untreated controls; this increased further after co-treatment with 1,8-cineole. (B) Quantification of nuclear fluorescence intensities of immunohistochemical staining revealed significantly increased nuclear localization of IRF3 after co-treatment with poly(I:C) and 1,8-cineole for 2 h compared with the poly(I:C) treatment approach and controls (***P<0.001 was considered significant, unpaired Student's t-test, two tailed, 95% CI). (C) Increased nuclear translocation of IRF3 in poly(I:C)-treated nasal slice cultures after 4 h was increased further after co-treatment with 1,8-cineole. (D) Quantification of nuclear fluorescence intensities of immunohistochemical staining showed significantly increased nuclear localization of IRF3 after 4 h of poly(I:C) treatment and co-treatment with poly(I:C) and 1,8-cineole compared with controls (***P<0.001 was considered significant, unpaired Student's t-test, two tailed, 95% CI).

Besides the increased activity of IRF3, we observed significantly increased nuclear translocation of NF-κB in poly(I:C)-treated nasal slice cultures compared with controls after 2 h (Figure 6). Co-treatment with 1,8-cineole and poly(I:C) for 2 h resulted in significantly decreased nuclear NF-κB compared with slices treated with poly(I:C) alone (Figure 6).

1,8-cineole leads to a reduction in nuclear localized NF-κB of ex vivo cultivated human nasal turbinate slices after poly(I:C)-dependent stimulation

Figure 6
1,8-cineole leads to a reduction in nuclear localized NF-κB of ex vivo cultivated human nasal turbinate slices after poly(I:C)-dependent stimulation

(A) Immunohistochemical staining (displayed as an intensity scale) of human nasal turbinate slice cultures showed increased nuclear translocation of NF-κB-p65 in poly(I:C)-treated nasal slice cultures compared with controls after 2 h. Co-treatment with poly(I:C) and 1,8-cineole for 2 h resulted in highly decreased NF-κB activity. (B) Quantification of nuclear fluorescence intensities of immunohistochemical staining revealed significantly increased nuclear localization of NF-κB-p65 after 2 h of poly(I:C) treatment, which was significantly decreased after co-treatment with 1,8-cineole (***P<0.001 was considered significant, unpaired Student's t-test, two tailed, 95% CI).

Figure 6
1,8-cineole leads to a reduction in nuclear localized NF-κB of ex vivo cultivated human nasal turbinate slices after poly(I:C)-dependent stimulation

(A) Immunohistochemical staining (displayed as an intensity scale) of human nasal turbinate slice cultures showed increased nuclear translocation of NF-κB-p65 in poly(I:C)-treated nasal slice cultures compared with controls after 2 h. Co-treatment with poly(I:C) and 1,8-cineole for 2 h resulted in highly decreased NF-κB activity. (B) Quantification of nuclear fluorescence intensities of immunohistochemical staining revealed significantly increased nuclear localization of NF-κB-p65 after 2 h of poly(I:C) treatment, which was significantly decreased after co-treatment with 1,8-cineole (***P<0.001 was considered significant, unpaired Student's t-test, two tailed, 95% CI).

Co-treatment of nasal slice cultures with 1,8-cineole and LPS leads to nuclear translocation of IRF3 and decrease in nuclear NF-κB

In a model of late rhinosinusitis, nasal slice cultures were treated with LPS followed by analysis via immunohistochemistry. We observed an increase in nuclear IRF3 after exposure to LPS, and a further increase in nasal slices co-treated with 1,8-cineole (Figure 7A, middle panels). LPS treatment resulted in an increased nuclear translocation of NF-κB in human nasal slice cultures, which was highly decreased after co-treatment with 1,8-cineole (Figure 7A, right panels, see also Supplementary Figure S4A). We quantified the nuclear fluorescence intensities in the immunohistochemical staining and showed a statistically significant increase in nuclear translocation of IRF3 after co-treatment of nasal slice cultures with LPS and 1,8-cineole compared with controls (Figure 7B). The amount of nuclear NF-κB after LPS stimulation was significantly decreased after co-treatment with 1,8-cineole (Figure 7C, see also Supplementary Figures S4B and S4C).

Ex vivo cultivated human nasal turbinate slices stimulated with LPS show increased IRF3 activity and decreased NF-κB activity after co-treatment with 1,8-cineole

Figure 7
Ex vivo cultivated human nasal turbinate slices stimulated with LPS show increased IRF3 activity and decreased NF-κB activity after co-treatment with 1,8-cineole

(A) Immunohistochemical analysis (displayed as an intensity scale) of human nasal slice cultures depicting increased fluorescence intensity of IRF3 and NF-κB-p65 after LPS treatment compared with controls. Co-treatment with LPS and 1,8-cineole resulted in increased nuclear fluorescence intensity of IRF3 as well as decreased NF-κB-p65 nuclear fluorescence intensity compared with the LPS-stimulated approach. (B, C) Quantification of nuclear fluorescence intensity of cells in the epithelial layer of cultured human nasal turbinates showed significantly increased nuclear localization of IRF3 and NF-κB-p65 after LPS treatment compared with controls. Nuclear localization of IRF3 was significantly increased after co-treatment with LPS and 1,8-cineole compared with controls, whereas the amount of nuclear localized NF-κB-p65 was significantly decreased compared with the LPS approach (***P<0.001, unpaired Student's t-test, two tailed, 95% CI).

Figure 7
Ex vivo cultivated human nasal turbinate slices stimulated with LPS show increased IRF3 activity and decreased NF-κB activity after co-treatment with 1,8-cineole

(A) Immunohistochemical analysis (displayed as an intensity scale) of human nasal slice cultures depicting increased fluorescence intensity of IRF3 and NF-κB-p65 after LPS treatment compared with controls. Co-treatment with LPS and 1,8-cineole resulted in increased nuclear fluorescence intensity of IRF3 as well as decreased NF-κB-p65 nuclear fluorescence intensity compared with the LPS-stimulated approach. (B, C) Quantification of nuclear fluorescence intensity of cells in the epithelial layer of cultured human nasal turbinates showed significantly increased nuclear localization of IRF3 and NF-κB-p65 after LPS treatment compared with controls. Nuclear localization of IRF3 was significantly increased after co-treatment with LPS and 1,8-cineole compared with controls, whereas the amount of nuclear localized NF-κB-p65 was significantly decreased compared with the LPS approach (***P<0.001, unpaired Student's t-test, two tailed, 95% CI).

DISCUSSION

Model systems of airway diseases include cellular models, such as primary cultures and cell lines of human tracheal or nasal epithelium. In an alveolar epithelial cell line and a bronchial epithelial cell line treated with dsRNA and influenza A virus Guillot et al. [21] showed immune response via secretion of the cytokines IL-8, RANTES and IFN-β. Moreover, primary cell cultures of human tracheal or nasal epithelium infected with rhinoviruses further revealed increased levels of viral RNA and a release of infectious particles [32]. In the present study, ITSCs were successfully applied as a novel stem cell model of airway disease. In addition to their great potential for regenerative medicine [33], ITSCs are easily expandable and retain their genetic stability during cultivation [28]. Notably, these cells are endogenously located within the respiratory epithelium of the human inferior turbinate [27], further emphasizing their applicability for pharmacological research of the upper respiratory tract. Along with these promising cellular model systems, mouse models are broadly used to simulate airway diseases in vivo [34], although potential differences in the upstream signalling of the antiviral response may question the transferability to the human system [35]. Facing this challenge, organ slice cultures remain promising alternatives in terms of resembling the endogenous niche. Here, Switalla et al. [36] showed a normal innate cytokine response to immunomodulators in human, precision-cut, lung slices. Likewise, increased immune responses were observed in human lung slices infected with the influenza virus [37], enabling the application of the model system to functionally test an inhalable nanoparticle-based influenza vaccine [38]. Primary human nasal tissue cultures used in the present study closely resemble the complex architecture of the endogenous niche, including an intact ciliated epithelial surface comprising acetyl-α-tubulin-positive cilia, a basal membrane and mucus-filled goblet cells [29]. Arruda et al. [39] showed that replication of human rhinovirus occurred in the upper respiratory tract, in particular within the nasal epithelium and the nasopharynx, underlining the suitability of the applied stem cell and tissue model systems for mimicking rhinoviral infection.

To simulate rhinoviral infection in ex vivo cultivated human nasal tissue as well as in human stem cells and cell lines, poly(I:C) was applied. This dsRNA analogue is described to mediate antiviral responses in a broad range of cell types [2123], as well as in mice after intraperitoneal administration [40]. At the molecular level, both rhinoviral dsRNA intermediates and poly(I:C) are recognized via TLR3, which in turn leads to activation of the MyD88-independent signalling pathway, resulting in recruitment of TRIF and activation of IRF3. Active IRF3 dimers translocate into the nucleus and regulate the expression of IFN-β and RANTES, thereby mediating the cellular antiviral response [25]. In addition to mediation of the IRF3 activation, TRIF can also activate a late and weak NF-κB response through the TNF receptor-associated factor 6 (TRAF6). Activation of NF-κB is followed by expression of its target genes, including the proinflammatory cytokine TNF-α. Accordingly, we observed an increase in antiviral IRF3 and proinflammatory NF-κB activity accompanied by elevated expression of IFN-β, RANTES and TNF-α after poly(I:C) treatment. Co-treatment with poly(I:C) and 1,8-cineole led to significantly increased IRF3 activity, whereas NF-κB activity was significantly reduced compared with poly(I:C)-treated cells.

These findings are in general accordance with other studies, hence terpenoids are known to possess direct antiviral properties (reviewed in Sun et al. [41]). In particular, α-terpinene, γ-terpinene and α-pinene, and also 1,8-cineole, were shown to have antiviral activity against the DNA virus herpes simplex virus type 1 by directly inactivating free virus particles [42]. Chiang et al. [43] further described a broad range of antiviral activity of the terpenoid alcohol linalool and the triterpenoid ursolic acid, namely against adenoviruses, hepatitis B virus, Coxsackievirus B1 and enterovirus 71.

As well as mimicking viral infection, we applied LPS to simulate secondary bacterial infection common during late rhinosinusitis [44]. Consistent with our previous findings [20,29] and the broadly described anti-inflammatory activity of monoterpenoids (reviewed in Salminen et al. [45]), LPS treatment led to significantly increased NF-κB activity, which was significantly decreased after co-treatment with 1,8-cineole. Similar to poly(I:C)-mediated MyD88-independent signalling, IRF3 can be activated by LPS in a TRIF-dependent manner. In the present study, recognition of LPS by the TLR4 is followed by recruitment of TRIF, in turn leading to nuclear translocation of IRF3 and expression of respective target genes [46]. We also observed an increased nuclear translocation of IRF3 in human nasal slice cultures after LPS stimulation. Co-treatment with 1,8-cineole significantly increased the amount of nuclear IRF3, suggesting an antiviral activity of 1,8-cineole during late rhinosinusitis. Moreover, 1,8-cineole led to significantly elevated expression levels of the IRF3 target gene RANTES in poly(I:C)-pre-treated ITSCs after additional co-treatment with LPS and poly(I:C) mimicking bacterial superinfection.

The potential therapeutic impact of activating IRF3-mediated antiviral responses while simultaneously inhibiting proinflammatory NF-κB signalling was impressively shown by Bartlett et al. [47]. In particular, the authors demonstrated reduced inflammation but unchanged antiviral responses in vivo in rhinovirus-infected mice lacking NF-κB-p65. However, IFN-α receptor 1-deficient mice infected with rhinoviruses showed elevated levels of rhinovirus replication and decreased antiviral responses, suggesting a new therapeutic strategy against rhinoviral infection via reduction of NF-κB-dependent proinflammatory signalling, accompanied by increased antiviral IFN signalling [47]. In addition to the common cold syndromes, rhinovirus infections also increase acute exacerbations in asthma patients [6]. Rhinovirus-induced asthma is often accompanied by glucocorticoid resistance in an NF-κB-dependent manner, resulting in inefficient treatment of asthma exacerbations [48]. As 1,8-cineole is already established for treating steroid-dependent asthma [17], the IRF3-dependent antiviral activity of 1,8-cineole observed in the present study, in addition to the already described inhibitory effects on NF-κB signalling [20], may further broaden its range of application.

In summary, this study demonstrates for the first time that 1,8-cineole, which is clinically approved as the active ingredient of Soledum, activates IRF3-mediated antiviral response in a human ex vivo model of rhinosinusitis. Our findings may broaden the range of clinical applications of 1,8-cineole, particularly in terms of treating the common cold syndrome and related ssRNA virus-dependent airway infections.

AUTHOR CONTRIBUTION

Janine Müller and Johannes Greiner collected and assembled the data, analysed and interpreted them, helped write the manuscript and approved the final manuscript. Marie Zeuner collected and assembled the data, analysed and interpreted them, conceived of and designed the study and approved the final manuscript. Viktoria Brotzmann, Johanna Schäfermann and Frederique Wieters collected and assembled the data and approved the final manuscript. Darius Widera, Holger Sudhoff and Barbara Kaltschmidt conceived of and designed the study, analysed and interpreted the data, helped write the manuscript and approved the final manuscript. Christian Kaltschmidt conceived of and designed the study, analysed and interpreted the data, and approved the final manuscript. Janine Müller, Johannes Greiner, Marie Zeuner, Holger Sudhoff, Barbara Kaltschmidt and Christian Kaltschmidt contributed equally to this work.

The excellent technical help of Angela Kralemann-Köhler and Monika Wart is gratefully acknowledged. We thank Katherine A. Fitzgerald, Department of Medicine, University of Massachusetts Medical School, Worcester, U.S.A. for kindly providing the IRF3 gene reporter system.

FUNDING

The present study was sponsored by Klosterfrau Healthcare Group, Cassella-med GmbH & Co. KG, Cologne, Germany. The study sponsor did not participate in the study design and data analysis.

Abbreviations

     
  • COPD

    chronic obstructive pulmonary disease

  •  
  • DAPI

    4′,6-diamidino-2-phenylindole

  •  
  • IFN

    interferon

  •  
  • IL

    interleukin

  •  
  • IRF3

    interferon regulatory factor 3

  •  
  • ITSC

    inferior turbinate stem cell

  •  
  • LPS

    lipopolysaccharide

  •  
  • NF-κB

    nuclear factor κ light chain enhancer of activated B-cells

  •  
  • PBT

    PBS + Triton-X100

  •  
  • PFA

    paraformaldehyde

  •  
  • RANTES

    Regulated on Activation, Normal T-cell Expressed and Secreted

  •  
  • RT-PCR

    reverse transcription PCR

  •  
  • TLR

    toll-like receptor

  •  
  • TNF

    tumour necrosis factor

  •  
  • TRAM

    TRIF-related adapter molecule

  •  
  • TIRAP

    toll/IL-1 receptor domain-containing adapter protein

  •  
  • TRIF

    TIR domain-containing adapter-inducing IFN-β

References

References
1
Heikkinen
T.
Jarvinen
A.
The common cold
Lancet
2003
, vol. 
361
 (pg. 
51
-
59
)
[PubMed]
2
Arruda
E.
Pitkaranta
A.
Witek
T.J.
Jr
Doyle
C.A.
Hayden
F.G.
Frequency and natural history of rhinovirus infections in adults during autumn
J. Clin. Microbiol.
1997
, vol. 
35
 (pg. 
2864
-
2868
)
[PubMed]
3
Gwaltney
J.M.
Jr.
Rhinovirus infection of the normal human airway
Am. J. Respir. Crit. Care Med.
1995
, vol. 
152
 
4 Pt 2
(pg. 
S36
-
S39
)
[PubMed]
4
Allan
G.M.
Arroll
B.
Prevention and treatment of the common cold: making sense of the evidence
Can. Med. Assoc. J.
2014
, vol. 
186
 (pg. 
190
-
199
)
5
Nicholson
K.G.
Kent
J.
Ireland
D.C.
Respiratory viruses and exacerbations of asthma in adults
BMJ
1993
, vol. 
307
 (pg. 
982
-
986
)
[PubMed]
6
Corne
J.M.
Marshall
C.
Smith
S.
Schreiber
J.
Sanderson
G.
Holgate
S.T.
Johnston
S.L.
Frequency, severity, and duration of rhinovirus infections in asthmatic and non-asthmatic individuals: a longitudinal cohort study
Lancet
2002
, vol. 
359
 (pg. 
831
-
834
)
[PubMed]
7
George
S.N.
Garcha
D.S.
Mackay
A.J.
Patel
A.R.
Singh
R.
Sapsford
R.J.
Donaldson
G.C.
Wedzicha
J.A.
Human rhinovirus infection during naturally occurring COPD exacerbations
Eur. Respir. J.
2014
, vol. 
44
 (pg. 
87
-
96
)
[PubMed]
8
Yuan
G.
Wahlqvist
M.L.
He
G.
Yang
M.
Li
D.
Natural products and anti-inflammatory activity
Asia Pac. J. Clin. Nutr.
2006
, vol. 
15
 (pg. 
143
-
152
)
[PubMed]
9
Cloez
M.S.
Étude chimique de l'eucalyptol
Comptes Rendus
1870
, vol. 
70
 (pg. 
687
-
690
)
10
Djenane
D.
Yanguela
J.
Amrouche
T.
Boubrit
S.
Boussad
N.
Roncales
P.
Chemical composition and antimicrobial effects of essential oils of Eucalyptus globulus, Myrtus communis and Satureja hortensis against Escherichia coli O157:H7 and Staphylococcus aureus in minced beef
Food Sci. Technol. Int.
2011
, vol. 
17
 (pg. 
505
-
515
)
[PubMed]
11
Mulyaningsih
S.
Sporer
F.
Reichling
J.
Wink
M.
Antibacterial activity of essential oils from Eucalyptus and of selected components against multidrug-resistant bacterial pathogens
Pharm. Biol.
2011
, vol. 
49
 (pg. 
893
-
899
)
[PubMed]
12
Inoue
K.
Takano
H.
Shiga
A.
Fujita
Y.
Makino
H.
Yanagisawa
R.
Ichinose
T.
Kato
Y.
Yamada
T.
Yoshikawa
T.
Effects of volatile constituents of a rosemary extract on allergic airway inflammation related to house dust mite allergen in mice
Int. J. Mol. Med.
2005
, vol. 
16
 (pg. 
315
-
319
)
[PubMed]
13
Bastos
V.P.
Gomes
A.S.
Lima
F.J.
Brito
T.S.
Soares
P.M.
Pinho
J.P.
Silva
C.S.
Santos
A.A.
Souza
M.H.
Magalhães
P.J.
Inhaled 1,8-cineole reduces inflammatory parameters in airways of ovalbumin-challenged guinea pigs
Basic Clin. Pharmacol. Toxicol.
2011
, vol. 
108
 (pg. 
34
-
39
)
[PubMed]
14
Zhao
C.
Sun
J.
Fang
C.
Tang
F.
1,8-cineol attenuates LPS-induced acute pulmonary inflammation in mice
Inflammation
2014
, vol. 
37
 (pg. 
566
-
572
)
[PubMed]
15
Kehrl
W.
Sonnemann
U.
Dethlefsen
U.
Therapy for acute nonpurulent rhinosinusitis with cineole: results of a double-blind, randomized, placebo-controlled trial
Laryngoscope
2004
, vol. 
114
 (pg. 
738
-
742
)
[PubMed]
16
Worth
H.
Schacher
C.
Dethlefsen
U.
Concomitant therapy with cineole (Eucalyptole) reduces exacerbations in COPD: a placebo-controlled double-blind trial
Respir. Res.
2009
, vol. 
10
 pg. 
69
 
[PubMed]
17
Juergens
U.R.
Dethlefsen
U.
Steinkamp
G.
Gillissen
A.
Repges
R.
Vetter
H.
Anti-inflammatory activity of 1.8-cineol (eucalyptol) in bronchial asthma: a double-blind placebo-controlled trial
Respir. Med.
2003
, vol. 
97
 (pg. 
250
-
256
)
[PubMed]
18
Juergens
U.R.
Anti-inflammatory properties of the monoterpene 1.8-cineole: current evidence for co-medication in inflammatory airway diseases
Drug Res. (Stuttg.)
2014
, vol. 
64
 (pg. 
638
-
646
)
[PubMed]
19
Juergens
U.R.
Stober
M.
Vetter
H.
Inhibition of cytokine production and arachidonic acid metabolism by eucalyptol (1,8-cineole) in human blood monocytes in vitro
Eur. J. Med. Res.
1998
, vol. 
3
 (pg. 
508
-
510
)
[PubMed]
20
Greiner
J.F.
Muller
J.
Zeuner
M.T.
Hauser
S.
Seidel
T.
Klenke
C.
Grunwald
L.M.
Schomann
T.
Widera
D.
Sudhoff
H.
, et al. 
1,8-Cineol inhibits nuclear translocation of NF-kappaB p65 and NF-kappaB-dependent transcriptional activity
Biochim. Biophys. Acta
2013
, vol. 
1833
 (pg. 
2866
-
2878
)
[PubMed]
21
Guillot
L.
Le Goffic
R.
Bloch
S.
Escriou
N.
Akira
S.
Chignard
M.
Si-Tahar
M.
Involvement of toll-like receptor 3 in the immune response of lung epithelial cells to double-stranded RNA and influenza A virus
J. Biol. Chem.
2005
, vol. 
280
 (pg. 
5571
-
5580
)
[PubMed]
22
Kumar
A.
Zhang
J.
Yu
F.S.
Toll-like receptor 3 agonist poly(I:C)-induced antiviral response in human corneal epithelial cells
Immunology
2006
, vol. 
117
 (pg. 
11
-
21
)
[PubMed]
23
Stowell
N.C.
Seideman
J.
Raymond
H.A.
Smalley
K.A.
Lamb
R.J.
Egenolf
D.D.
Bugelski
P.J.
Murray
L.A.
Marsters
P.A.
Bunting
R.A.
, et al. 
Long-term activation of TLR3 by poly(I:C) induces inflammation and impairs lung function in mice
Respir. Res.
2009
, vol. 
10
 pg. 
43
 
[PubMed]
24
Alexopoulou
L.
Holt
A.C.
Medzhitov
R.
Flavell
R.A.
Recognition of double-stranded RNA and activation of NF-kappaB by Toll-like receptor 3
Nature
2001
, vol. 
413
 (pg. 
732
-
738
)
[PubMed]
25
Itoh
K.
Watanabe
A.
Funami
K.
Seya
T.
Matsumoto
M.
The clathrin-mediated endocytic pathway participates in dsRNA-induced IFN-beta production
J. Immunol.
2008
, vol. 
181
 (pg. 
5522
-
5529
)
[PubMed]
26
Wang
Q.
Nagarkar
D.R.
Bowman
E.R.
Schneider
D.
Gosangi
B.
Lei
J.
Zhao
Y.
McHenry
C.L.
Burgens
R.V.
Miller
D.J.
, et al. 
Role of double-stranded RNA pattern recognition receptors in rhinovirus-induced airway epithelial cell responses
J. Immunol.
2009
, vol. 
183
 (pg. 
6989
-
6997
)
[PubMed]
27
Hauser
S.
Widera
D.
Qunneis
F.
Muller
J.
Zander
C.
Greiner
J.
Strauss
C.
Lüningschrör
P.
Heimann
P.
Schwarze
H.
, et al. 
Isolation of novel multipotent neural crest-derived stem cells from adult human inferior turbinate
Stem Cells Devel.
2012
, vol. 
21
 (pg. 
742
-
756
)
28
Greiner
J.
Hauser
S.
Widera
D.
Müller
J.
Qunneis
F.
Zander
C.
Martin
I.
Mallah
J.
Prante
C.
Schwarze
H.
Prohaska
W.
, et al. 
Efficient animal-serum free 3D cultivation method for adult human neural crest-derived stem cell therapeutics
Eur. Cells Mater.
2011
, vol. 
22
 (pg. 
403
-
419
)
[PubMed]
29
Sudhoff
H.
Klenke
C.
Greiner
J.F.
Muller
J.
Brotzmann
V.
Ebmeyer
J.
Kaltschmidt
B.
Kaltschmidt
C.
1,8-Cineol reduces mucus-production in a novel human ex vivo model of late rhinosinusitis
PLoS One
2015
, vol. 
10
 
7
pg. 
e0133040
 
[PubMed]
30
Bachelerie
F.
Alcami
J.
Arenzana-Seisdedos
F.
Virelizier
J.L.
HIV enhancer activity perpetuated by NF-kappa B induction on infection of monocytes
Nature
1991
, vol. 
350
 (pg. 
709
-
712
)
[PubMed]
31
Schindelin
J.
Arganda-Carreras
I.
Frise
E.
Kaynig
V.
Longair
M.
Pietzsch
T.
Preibisch
S.
Rueden
C.
Saalfeld
S.
Schmid
B.
, et al. 
Fiji: an open-source platform for biological-image analysis
Nat. Methods
2012
, vol. 
9
 (pg. 
676
-
682
)
[PubMed]
32
Lopez-Souza
N.
Dolganov
G.
Dubin
R.
Sachs
L.A.
Sassina
L.
Sporer
H.
Schnurr
D.
Boushey
H.A.
Widdicombe
J.H.
Resistance of differentiated human airway epithelium to infection by rhinovirus
Am. J. Physiol. Lung Cell. Mol. Physiol.
2004
, vol. 
286
 (pg. 
L373
-
L381
)
[PubMed]
33
Müller
J.
Ossig
C.
Greiner
J.F.
Hauser
S.
Fauser
M.
Widera
D.
Kaltschmidt
C.
Storch
A.
Kaltschmidt
B.
Intrastriatal transplantation of adult human neural crest-derived stem cells improves functional outcome in parkinsonian rats
Stem Cells Transl. Med.
2014
, vol. 
4
 (pg. 
31
-
43
)
[PubMed]
34
Hellings
P.W.
Kasran
A.
Liu
Z.
Vandekerckhove
P.
Wuyts
A.
Overbergh
L.
Mathieu
C.
Ceuppens
J.L.
Interleukin-17 orchestrates the granulocyte influx into airways after allergen inhalation in a mouse model of allergic asthma
Am. J. Respir. Cell Mol. Biol.
2003
, vol. 
28
 (pg. 
42
-
50
)
[PubMed]
35
Cavlar
T.
Deimling
T.
Ablasser
A.
Hopfner
K.P.
Hornung
V.
Species-specific detection of the antiviral small-molecule compound CMA by STING
EMBO J.
2013
, vol. 
32
 (pg. 
1440
-
150
)
[PubMed]
36
Switalla
S.
Lauenstein
L.
Prenzler
F.
Knothe
S.
Förster
C.
Fieguth
H.G.
Pfennig
O.
Schaummann
F.
Martin
C.
Guzman
C.A.
, et al. 
Natural innate cytokine response to immunomodulators and adjuvants in human precision-cut lung slices
Toxicol. Appl. Pharmacol.
2010
, vol. 
246
 (pg. 
107
-
115
)
[PubMed]
37
Wu
W.
Booth
J.L.
Duggan
E.S.
Wu
S.
Patel
K.B.
Coggeshall
K.M.
Metcalf
J.P.
Innate immune response to H3N2 and H1N1 influenza virus infection in a human lung organ culture model
Virology
2010
, vol. 
396
 (pg. 
178
-
88
)
[PubMed]
38
Neuhaus
V.
Schwarz
K.
Klee
A.
Seehase
S.
Forster
C.
Pfennig
O.
Jonigk
D.
Fieguth
H.-G.
Koch
W.
Warnecke
G.
, et al. 
Functional testing of an inhalable nanoparticle based influenza vaccine using a human precision cut lung slice technique
PLoS One
2013
, vol. 
8
 
8
pg. 
e71728
 
[PubMed]
39
Arruda
E.
Boyle
T.R.
Winther
B.
Pevear
D.C.
Gwaltney
J.M.
Jr
Hayden
F.G.
Localization of human rhinovirus replication in the upper respiratory tract by in situ hybridization
J. Infect. Dis.
1995
, vol. 
171
 (pg. 
1329
-
1333
)
[PubMed]
40
Demoulins
T.
Baron
M.L.
Kettaf
N.
Abdallah
A.
Sharif-Askari
E.
Sekaly
R.P.
Poly(I:C) induced immune response in lymphoid tissues involves three sequential waves of type I IFN expression
Virology
2009
, vol. 
386
 (pg. 
225
-
236
)
[PubMed]
41
Sun
I.C.
Kashiwada
Y.
Morris-Natschke
S.L.
Lee
K.H.
Plant-derived terpenoids and analogues as anti-HIV agents
Curr. Top. Med. Chem.
2003
, vol. 
3
 (pg. 
155
-
169
)
[PubMed]
42
Astani
A.
Reichling
J.
Schnitzler
P.
Comparative study on the antiviral activity of selected monoterpenes derived from essential oils
Phytother. Res.
2010
, vol. 
24
 (pg. 
673
-
679
)
[PubMed]
43
Chiang
L.C.
Ng
L.T.
Cheng
P.W.
Chiang
W.
Lin
C.C.
Antiviral activities of extracts and selected pure constituents of Ocimum basilicum
Clin. Exp. Pharmacol. Physiol.
2005
, vol. 
32
 (pg. 
811
-
816
)
[PubMed]
44
Kim
D.H.
Jeon
E.J.
Park
S.N.
Park
K.H.
Park
Y.S.
Yeo
S.W.
Effects of a tumor necrosis factor-alpha antagonist on experimentally induced rhinosinusitis
J. Biomed. Biotechnol.
2011
, vol. 
2011
 pg. 
360457
 
[PubMed]
45
Salminen
A.
Lehtonen
M.
Suuronen
T.
Kaarniranta
K.
Huuskonen
J.
Terpenoids: natural inhibitors of NF-kappaB signaling with anti-inflammatory and anticancer potential
Cell Mol. Life Sci.
2008
, vol. 
65
 (pg. 
2979
-
2999
)
[PubMed]
46
Fitzgerald
K.A.
Rowe
D.C.
Barnes
B.J.
Caffrey
D.R.
Visintin
A.
Latz
E.
Monks
B.
Pitha
P.M.
Golenbock
D.T.
LPS-TLR4 signaling to IRF-3/7 and NF-kappaB involves the toll adapters TRAM and TRIF
J. Exp. Med.
2003
, vol. 
198
 (pg. 
1043
-
1055
)
[PubMed]
47
Bartlett
N.W.
Slater
L.
Glanville
N.
Haas
J.J.
Caramori
G.
Casolari
P.
Clarke
D.L.
Message
S.D.
Aniscenko
J.
Kebadze
T.
, et al. 
Defining critical roles for NF-kappaB p65 and type I interferon in innate immunity to rhinovirus
EMBO Mol. Med.
2012
, vol. 
4
 (pg. 
1244
-
1260
)
[PubMed]
48
Papi
A.
Contoli
M.
Adcock
I.M.
Bellettato
C.
Padovani
A.
Casolari
P.
Stanciu
L.A.
Barnes
P.J.
Johnston
S.L.
Ito
K.
, et al. 
Rhinovirus infection causes steroid resistance in airway epithelium through nuclear factor kappaB and c-Jun N-terminal kinase activation
J. Allergy Clin. Immunol.
2013
, vol. 
132
 (pg. 
1075
-
1085
)
[PubMed]

Supplementary data