Transient receptor potential channel 5 (TrpC5) is a member of the TrpC subgroup, and it forms a receptor-activated, non-selective Ca2+ channel. The architecture of the TrpC5 channel is poorly understood. In the present study, we report that TrpC5 is a key factor in regulating differentiation in colorectal cancer (CRC). Through a study of specimens from a large cohort of patients with CRC, we found that TrpC5 was highly expressed and its cellular level correlated with tumour grade. We showed further that up-regulated TrpC5 caused a robust rise in intracellular calcium concentration [Ca2+]i, increased Wnt5a expression and the nuclear translocation of β-catenin, leading to a reduction in cancer differentiation and an increase in cancer cell stemness. Notably, patients with tumours that expressed high levels of TrpC5 showed significantly poorer disease-free and overall survival. Therefore, our findings suggest that TrpC5 is an independent adverse prognostic factor for death in CRC, reducing differentiation through the Ca2+/Wnt5a signalling pathway.

CLINICAL PERSPECTIVES

  • To achieve better therapeutic outcomes and improve the survival of colorectal cancer patients, it is essential to understand the underlying mechanisms and definition of key molecules involved in the development of colorectal cancer is important for understanding the detailed process.

  • The findings described here shed light on the unconventional and poorly-understood mechanism of Ca2+-permeable TrpC5 ion channels in the regulation of tumor differentiation and how an ion channel can have important consequences for the therapeutic outcome and patient survival in colorectal cancer.

  • These data may be worthwhile to further explore the potential of using TrpC5-Wnt5a as a prognostic factor in colorectal cancer.

INTRODUCTION

Colorectal cancer (CRC) is one of the most common forms of malignancy [1], which can partly affect the metastases of its parent tumour [2]. To date, the tumour, node, metastasis (TNM) staging system is regarded as the standard criterion by which to discriminate patients with CRC and different prognoses, and serves as the basis for treatment choice [3,4]. Recently, molecular subtypes have been associated with prognosis in breast cancer [5], providing important evidence for breast cancer treatment. Despite the development of combined treatment models and increased understanding of the CRC mechanism, patients still face a high risk of death. Thus, it is urgent to explore new molecular pathways underlying CRC and develop new therapies.

Calcium ions have effects that promote differentiation on diverse normal and malignant epithelial cells, including gastrointestinal tract cells [6]. Compelling experimental and epidemiological evidence has demonstrated an inverse correlation between the dietary intake of Ca2+ and the risk of CRC [710]. Although such findings strongly imply that extracellular Ca2+ regulates the growth and differentiation of colon epithelium, the mechanisms by which CRC occurs remain unclear.

Transient receptor potential (Trp) channels are a group of ion channels localized to the plasma membrane [11,12] and play key roles in a variety of physiological processes [1315]. Several isoforms of Trp, including TrpC5, TrpV1, TRPV6, TrpM1 and TrpM8, are known to take part in cancer pathogenesis [16,17]. As these Trp channels are all Ca2+ permeable [11], their role in cancer may involve changes in the intracellular Ca2+ concentration ([Ca2+]i) [17].

TrpC5 is a non-selective cation channel with Ca2+ permeability [18]; functionally it is a mediator of excitation in smooth muscle and an inhibitor of neuronal growth-cone extension. Several studies have confirmed that TrpC5 channels not only regulate the multidrug transporter P-glycoprotein [19], but are also involved in microvesicle formation and release [20]. However, the impact of TrpC5 channels on tumour differentiation has not been explored. In the present study, we describe evidence that TrpC5 regulates differentiation of colon epithelium through the Ca2+/Wnt5a signalling pathway and that the expression of TrpC5 is an independent adverse prognostic factor for death in CRC, which can be used as a reliable marker and may be a therapeutic target in CRC.

MATERIALS AND METHODS

Ethics statement

All animal experiments were performed in accordance with the laboratory animal guidelines and the approval of the Animal Experimentation Ethics Committees of the Chinese University of Hong Kong and Jiangnan University. Clinical specimens were collected from the Affiliated Hospital, Jiangnan University. All patients were informed of the purpose of the study and gave written informed consent. All experimental protocols were approved by the Jiangnan University Ethics Committee. The methods were carried out in accordance with the 1975 Declaration of Helsinki. Clinical information on patients was obtained from medical records and pathology reports. We confirmed that written informed consent was obtained from all participants.

Patients

From June 2006 to December 2008, 377 patients with CRC who received both radical surgery and subsequent adjuvant chemotherapy at the Affiliated Hospital of Jiangnan University were enrolled in the present study. Complete pathological and clinical information, which included age, sex, tumour location, tumour grade, 7th AJCC (American Joint Committee on Cancer) substage and adjuvant chemotherapy history for the 377 patients, were recorded. The date of the last follow-up was October 2013. Overall survival was defined as the time interval from the date of surgery to the date of death.

Cells and cell culture

All cells were obtained from the American Type Culture Collection (ATCC). The SW620 cells were cultured in Dulbecco's modified Eagle's medium (DMEM). The RKO and Caco-2 cells were cultured in minimum essential medium (MEM). The HT29 cells were cultured in McCoy's 5A modified medium. The SW480, HCE8693, DLD-1 and LoVo cells were maintained in RPMI 1640. All cells were supplemented with 10% FBS, 100 μg/ml of penicillin and 100 units/ml of streptomycin at 37°C in 5% CO2 humidified air.

Antibodies, siRNA and plasmids

The specific antibodies against TrpC5 (ab63151), Wnt5a (ab110073), c-myc (ab32072), cyclin D1 (ab40754), β-catenin (ab6301) and CD44 (ab6124) were obtained from Abcam, and anti-β-actin (MA5-11869) was from Invitrogen. The secondary antibodies, Alexa Fluor 488-donkey anti-mouse IgG and Alexa Fluor 568-donkey anti-rabbit IgG, used in immunofluorescence experiments were from Invitrogen. TrpC5-siRNA (BLOCK-iT in vivo siRNA, sequence: sense strand, CCA AUG GAC UGA ACC AGC UUU ACU U; anti-sense strand, AAG UAA AGC UGG UUC AGU CCA UUG G) was also from Invitrogen. The pcDNA3.1-TrpC5 plasmid was constructed in our laboratory.

Immunohistochemical staining

Tissue slides were de-paraffinized with xylene and rehydrated through a graded alcohol series. Citric acid was used to retrieve antigen and 3% H2O2 to block the endogenous peroxidase activity. After incubation with 10% BSA, the slides were incubated with the primary antibody (TrpC5 1:2000 and Wnt5a 1:400, v/v) overnight at 4°C in a humidified chamber and subsequently with the second antibody. The results of immunostaining were assessed separately by three pathologists on five visual fields selected from each slide. The results were judged according to the German semi-quantitative scoring system (no staining=0, weak staining=1, moderate staining=2, strong staining=3) and the percentage of stained cells (0%=0, 1–24%=1, 25–49%=2, 50–74%=3, 75–100%=4). The final immunoreactive score was determined by multiplying the intensity score by the percentage score, ranging from 0 to 12.

RT-PCR

To determine mRNA expression, cDNAs were synthesized using the mRNA reverse transcriptase M-MLV (RNase H-) kit (TaKaRa). Reverse transcription (RT)-PCR was performed using a Super Script first-strand synthesis system (Invitrogen). β-Actin was used as an endogenous control. The primer sequences were: TrpC1: forward ATTGTGCTTACCAAACTGCTGGTG, reverse GCATCTTCTGTCTCATGGAAGTCAAGT; TrpC3: forward GCGAATTGTTAACTTTCCCAAATGCAG, reverse ATTCACATCTCAGCATGCTGGGATT; TrpC4: forward AG-ACATAACATAAGCAATGGCTCTGC, reverse TCTCTGA-CTTGAATGGACACACTCTC; TrpC5: forward AGACTTGC-CATGGGCCACCTCTCATCAGAA, reverse GAGGCGAGT-TGTAACTTGTTCTTCCTGTCC; TrpC6: forward ATTGTGC-TTACCAAACTGCTGGTG, reverse CTCCTTATCTATCTGGGCCTGCAGTACATA; Wnt1: forward AGTGCAAGTGCCA-CGGGATGT, reverse GAAGGTGCAGTTGCAGCGCT; Wnt2: forward GGGCGATTATCTCTGGAGGAAGTAC, reverse GGAACTTACACCCACACTTGGTCA; Wnt3: forward CCATCGGTGACTTCCTCAAGGA, reverse ACGTAGCAGCACCAGTGGAAGA; Wnt4: forward GGAGAAGTTTGATGGTGCCACT, reverse CACTTGACGAAGCAGCACCAGT; Wnt6: forward AAGCTGCCTCCATTTCGCGAG, reverse AGTTC-TCTTCGAGCTGCACGCTCT; Wnt11: forward GCGCCTC-TCTGGAAATGAAGTGT, reverse ACATAAGGTCGCAGCT-GTCGCTTC; Wnt3a: forward CCTCAAGGACAAGTACGA-CAGCGC, reverse GACGTAGCAGCACCAGTGGAACA; Wnt5a: forward CTTCAACTCGCCCACCACACAAGA, reve-rse CACACAAACTGGTCCACGATCTCC; Wnt7a: forward GGCTACGTGCTCAAGGACAAGTAC, reverse GGAACTT-ACAGTTGCACTGCCACA; Wnt8a: forward AAATGGATAAGCGGCAGCTGAGAG, reverse TACTTGCTCACCACATGCCTACAC; Wnt9a: forward TTTCCATGAGGTGGGCAAGCAT, reverse ATAGCAGCACCAACGCACCTGG; Wnt10a: forward TGAAGGCCTGTGGCTGTGATG, reve-rse CACTTGCACTTCCGCCGCAT; Wnt2B: forward AGA-TTTCCGCCGCACAGGTGATTAC, reverse GGACGTCCAC-AGTATTTCTGCATTCC; Wnt5b: forward CAAAGGATCAGA-GGAGCAGGGC, reverse TCTCGTTGCGCAGGCAGTAGTC; Wnt7b: forward CCACCTTCCTGCGCATCAAAC, reverse TGGCCTCACTTGCAGGTGAAGA; NFATC1: forward GAG-AAGCAGAGCACGGACAGCTA, reverse CGGTTAGAAAGATGGCGTTACCGT; FZD2: forward CACCATCATGAAGCACGACG, reverse GCTGTTGGTGAGGCGAGTGTA; Alp1: forward CTTCAGAAGCTCAACACCAACGTG, reverse GTCACAATGCCCACAGATTTCCCA; Klf4: forward GAGCTCTCCCACATGAAGCGACTT, reverse TCCGGAGGATGGGTCAGCGAATT; villin 1: forward AGCCAGATCACTGCTGAGGT, reverse TGGACAGGTGTTCCTCCTTC; c-myc: forward CCTCAACGTTAGCTTCACCAACAG, reverse TCCACATACAGTCCTGGATGATGAT; cyclin D1: forward GCTGCTGCAAATGGAGCTGCTCCT, reverse GGTCACACTTGATCACTCTGGAGAGG; and β-actin: forward TGGAGTCCACTGGCGTCTTC, reverse GCTTGACAAAGTGGTCGTTGAG. The samples were coded and PCR was performed in a blinded fashion.

Western blots

The CRC specimens were homogenized in a radioimmunoprecipitation assay (RIPA) lysis buffer and equal protein concentrations were achieved using a BCA protein assay kit from Biotime. Samples were separated on an SDS/PAGE gel and transferred to PVDF membranes. The membrane was incubated overnight with primary antibodies (anti-TrpC5 and anti-β-actin) at 4°C, followed by horseradish peroxidase-conjugated secondary antibody (1:1000, v/v, dilution) for 2 h at room temperature. Then the protein bands were visualized with ECL kits.

Cytosolic Ca2+ measurement

Briefly, cultured cells were loaded with 10 μM Fluo-4/AM and 0.02% pluronic F-127 for 30 min in the dark at 37°C in physiological saline containing 140 mM NaCl, 5 mM KCl, 1 mM CaCl2, 1 mM MgCl2, 10 mM glucose and 5 mM Hepes (pH 7.4). Changes in cytosolic Ca2+ were displayed as fluorescence intensity relative to the value before carbachol application (100 μM; F1/F0). The fluorescent signal was measured using confocal microscopy (Leica TCS SP8). Experiments were performed at room temperature.

Immunostaining

Cells grown on chamber slides were fixed in 4% paraformaldehyde, washed with PBS and incubated for 30 min with 5% BSA in PBS. They were then exposed to primary antibodies (anti-TrpC5 1:500, anti-Wnt5a 1:200, anti-c-myc 1:100, anti-cyclin D1 1:100, anti-β-catenin 1:100 or anti-CD44 1:100, all v/v) diluted in PBS containing 5% BSA overnight at 4°C. After washing three times with PBS, the second antibody (Alexa Fluor 488-donkey anti-mouse 1:200 or Alexa Fluor 568-donkey anti-rabbit secondary antibody 1:200, v/v) diluted in PBS was added and incubated for 1 h at room temperature. Slides were mounted in medium containing DAPI. Images were collected using the confocal microscope (Leica TCS SP8).

ELISA assay

The Wnt5a content in the serum of patients with CRC was analysed using a Wnt5a ELISA kit. Serum and standard dilutions were added to test wells, and the membrane sealed and incubated for 60 min at 37°C with gentle shaking. After washing the wells, chromogen solutions A and B were added to each well and incubated for 10 min at 37°C in the dark. The reaction was stopped with stop solution, and then the absorbance was measured at 450 nm.

Sphere formation

The cells were digested with trypsin, washed with Ca2+/Mg2+-free PBS, then suspended in DMEM/F12 (1:1, v/v) supplemented with B27 (Invitrogen, Life Technologies Inc.), 25 ng/ml of basic fibroblast growth factor and 20 ng/ml of epidermal growth factor (Sigma), and seeded in ultra-low-attachment, six-well plates (Corning) at 5000 cells/well. The cells were cultivated for 10–14 days (depending on the cell type), and counted under a light microscope.

Flow cytometry

Flow cytometry (fluorescence-activated cell sorting or FACS) was used to detect CD133 on the surfaces of the cells, according to the protocol provided by the manufacturer (MACS Miltenyi Biotec). The cell suspension was washed and re-suspended in D-Hank's solution. Then, 10 μl of the CD133/1 (AC133)-APC antibodies and human or mouse IgG1 isotype control antibodies were added per 100 μl of suspension. The suspension was incubated for 25 min in the dark at 4°C. After washes, the cell pellet was re-suspended in a suitable amount of buffer for analysis by FACS.

In vivo tumour formation

CD133+ cells were isolated using a CD133 MicroBead Kit (MACS Miltenyi Biotec). The cells were subcutaneously injected into BALB/C nude mice (1×104/animal) and allowed to propagate for 3–4 weeks. All mice were housed in air-filtered, pathogen-free conditions. Tumour growth was monitored with digital callipers every day. Tumour volumes were estimated using the formula: volume (mm3)=[(width)2×length]/2 [21]. Tumour growth was plotted against time. On resection of each tumour, the size was measured, and then the tumours were immediately immersed in 4% polyformaldehyde.

Statistical analyses

The most appropriate cut-off value of the TrpC5 score was obtained using Cox's hazard proportional model. The relationships between TrpC5 expression levels and various pathological and clinical factors were analysed using the Mann–Whitney U-test. Factors that were deemed potentially important on univariate analyses (P<0.05) were included in the multivariate analyses. Multivariate analysis was performed using Cox's regression method in order to search for independent prognostic factors. The Kaplan–Meier method was used to plot overall survival curves and the log-rank test was used to determine significance. Other results are presented as means±S.E.M.s. Statistical differences were determined using Student's t-test. We performed statistical analyses using Graphpad Prism 5.0 software. All statistical tests were two tailed, and a value of P<0.05 was considered to be statistically significant.

RESULTS

TrpC5 cellular level correlates positively with tumour grading and negatively with tumour differentiation in CRC

To determine whether TrpC5 plays a clinical role in the development of CRC, CRC samples and matched samples of adjacent normal tissue from 31 patients were collected (see Supplementary Table S1). When the mRNA levels of TrpC1, TrpC3, TrpC4, TrpC5 and TrpC6, in the cancer and the normal tissues, were compared, the data showed that TrpC5 mRNA expression was significantly up-regulated in the cancer samples (Figure 1A), whereas TrpC1, TrpC3, TrpC4 and TrpC6 did not change (see Supplementary Figure S1). TrpC5 expression in these samples was validated by Western blotting with an antibody to TrpC5, the specificity of which we first confirmed (see Supplementary Figure S2). The expression level of TrpC5 in cancer samples was significantly higher than in normal samples (Figure 1B). These results provided initial evidence that TrpC5 plays a role in the development of CRC.

TrpC5 cellular level correlates positively with tumour grading and negatively with tumour differentiation in CRC

Figure 1
TrpC5 cellular level correlates positively with tumour grading and negatively with tumour differentiation in CRC

(A) Quantitative RT-PCR analysis of TrpC5 mRNA levels in CRC and matched normal control tissue from 31 patients. (B) Western blot analysis of TrpC5 expression in each carcinoma and adjacent samples from 11 patients (Student's t-test; means±S.E.M.s); a, adjacent tissue; c, carcinoma. (C) Representative images (left) of immunohistochemical staining for TrpC5 expression in different histological grades (1–3), and box plot (right) of TrpC5 expression in tumours with different histological grades. Scale bars=100 μm. One-way ANOVA with the Games–Howell correction.

Figure 1
TrpC5 cellular level correlates positively with tumour grading and negatively with tumour differentiation in CRC

(A) Quantitative RT-PCR analysis of TrpC5 mRNA levels in CRC and matched normal control tissue from 31 patients. (B) Western blot analysis of TrpC5 expression in each carcinoma and adjacent samples from 11 patients (Student's t-test; means±S.E.M.s); a, adjacent tissue; c, carcinoma. (C) Representative images (left) of immunohistochemical staining for TrpC5 expression in different histological grades (1–3), and box plot (right) of TrpC5 expression in tumours with different histological grades. Scale bars=100 μm. One-way ANOVA with the Games–Howell correction.

To investigate the potential clinical role of TrpC5 further, CRC samples from 346 patients were collected (see Supplementary Table S2). The Mann–Whitney U-test showed that the level of TrpC5 expression positively correlated with tumour grading (P=7.3×10−5; see Supplementary Table S3).

For a better understanding of the correlation between TrpC5 and tumour grading/differentiation, three groups were divided based on TrpC5 expression scores in the CRC samples; it was found that TrpC5 expression was higher in high-grade than in low-grade tumours (Figure 1C). These results suggested that the TrpC5 cellular level correlates positively with tumour grading and negatively with tumour differentiation in CRC.

TrpC5 is functional in human CRC cells in primary culture where it correlates with Ca2+

Primary cultures of human CRC cells were divided into groups on the basis of differentiation, and the TrpC5 expression was validated by immunostaining (Figures 2A and 2B). The functional presence of TrpC5 was determined by measurement of [Ca2+]i. Carbachol is known to potentiate TrpC5 activity, and its application elicited a rise in [Ca2+]i in the poorly differentiated group (Figure 2B), but not in the well-differentiated group (Figure 2A). This carbachol-elicited [Ca2+]i rise was reduced by TrpC5-specific siRNA, which confirmed the involvement of functional TrpC5 (Figure 2B). These results revealed that the elevated TrpC5 in poorly differentiated CRC cells in primary culture is functional and correlates with Ca2+.

TrpC5 is functional in human CRC cells in primary culture where it correlates with Ca2+

Figure 2
TrpC5 is functional in human CRC cells in primary culture where it correlates with Ca2+

[Ca2+]i measurements using Fluo-4, showing that TrpC5 is functional in human CRC cells in primary culture. Representative images (middle panels) and summary time-course data (right panels) of [Ca2+]i changes in response to carbachol (100 μM). Human CRC cells in primary culture were treated with TrpC5-siRNA (40 pmol, scrambled siRNA as control). Tumour grading was verified by immunohistochemical staining (IHC) and TrpC5 expression was verified by immunostaining (left panels). (A) Patients with grade 1; (B) patients with grade 3. Values are means±S.E.M.s. Scale bars=20 μm.

Figure 2
TrpC5 is functional in human CRC cells in primary culture where it correlates with Ca2+

[Ca2+]i measurements using Fluo-4, showing that TrpC5 is functional in human CRC cells in primary culture. Representative images (middle panels) and summary time-course data (right panels) of [Ca2+]i changes in response to carbachol (100 μM). Human CRC cells in primary culture were treated with TrpC5-siRNA (40 pmol, scrambled siRNA as control). Tumour grading was verified by immunohistochemical staining (IHC) and TrpC5 expression was verified by immunostaining (left panels). (A) Patients with grade 1; (B) patients with grade 3. Values are means±S.E.M.s. Scale bars=20 μm.

TrpC5 regulates Wnt5a secretion positively and cancer cell differentiation negatively through the Ca2+/Wnt5a signalling pathway in CRC cells

[Ca2+]i is an important signal for differentiation, whereas TrpC5 is a Ca2+-permeable channel with substantial expression in poorly differentiated CRC cells (see Figure 1C). Thus, we tested further whether TrpC5 is involved in the regulation of differentiation. TrpC5 expression was initially measured in eight human CRC cell lines with different degrees of differentiation. Two well-differentiated lines, LoVo and Caco-2 [2224], showed low TrpC5 expression (Figure 3A and see Supplementary Figure S3). However, six poorly differentiated lines–SW480, HCE8693, HT29, SW620, DLD-1 and RKO [2224]–showed high TrpC5 expression (Figure 3A and see Supplementary Figure S3). The degree of differentiation of these cell lines was confirmed with the colorectal cell differentiation markers ALP1, Klf4 and villin 1 [25,26] (see Supplementary Figure S4). Next, we investigated the expression of molecules known to regulate Ca2+-sensitive Wnt signalling. No difference was found in the transcription of Wnt1, Wnt 2, Wnt2b, Wnt3, Wnt4, Wnt5b, Wnt6, Wnt7a, Wnt7b, Wnt8a, Wnt9a, Wnt10a, Wnt11, NFATC1 and FZD2, but significantly higher Wnt5a mRNA expression was detected in poorly differentiated than in well-differentiated cells (Figure 3B and see Supplementary Figure S5).

TrpC5 regulates Wnt5a secretion positively and cancer cell differentiation negatively through the Ca2+/Wnt5a signalling pathway in CRC

Figure 3
TrpC5 regulates Wnt5a secretion positively and cancer cell differentiation negatively through the Ca2+/Wnt5a signalling pathway in CRC

(A) RT-PCR assays showing TrpC5 expression in eight human CRC cell lines: LoVo, Caco-2, SW480, HCE8693, HT29, SW620, DLD-1 and RKO. The degree of differentiation of these lines was confirmed with the colorectal cell differentiation markers ALP1, Klf4 and villin 1. (B) Heat map of transcripts associated with Ca2+-sensitive Wnt signalling (left panel) and correlation of TrpC5 and Wnt5a (right panel) in the eight human CRC cell lines. Expression data were log2-transformed and mean-centred by subtracting the mean of each gene between different cells so that the mean of each row was zero. (C) Function of TrpC5 measured by [Ca2+]i in SW480 cells stably transfected with TrpC5-specfic siRNA and LoVo cells stably expressing TrpC5. Carbachol, 100 μM. (D) Decreasing and increasing TrpC5 biosynthesis regulate Wnt5a expression and nuclear translocation of β-catenin, cyclin D1 and c-myc expression, as shown by immunostaining in SW480 cells stably transfected with TrpC5-specfic siRNA, and LoVo cells stably expressing TrpC5. Nuclei are stained with DAPI (blue). Scale bars=20 μm. (E) Decreasing and increasing TrpC5 biosynthesis regulate Wnt5a secretion. (F) Decreasing and increasing TrpC5 biosynthesis regulate differentiation in SW480 cells stably transfected with TrpC5-specific siRNA, and LoVo cells stably expressing TrpC5 as measured by semi-quantitative RT-PCR. *P < 0.05.

Figure 3
TrpC5 regulates Wnt5a secretion positively and cancer cell differentiation negatively through the Ca2+/Wnt5a signalling pathway in CRC

(A) RT-PCR assays showing TrpC5 expression in eight human CRC cell lines: LoVo, Caco-2, SW480, HCE8693, HT29, SW620, DLD-1 and RKO. The degree of differentiation of these lines was confirmed with the colorectal cell differentiation markers ALP1, Klf4 and villin 1. (B) Heat map of transcripts associated with Ca2+-sensitive Wnt signalling (left panel) and correlation of TrpC5 and Wnt5a (right panel) in the eight human CRC cell lines. Expression data were log2-transformed and mean-centred by subtracting the mean of each gene between different cells so that the mean of each row was zero. (C) Function of TrpC5 measured by [Ca2+]i in SW480 cells stably transfected with TrpC5-specfic siRNA and LoVo cells stably expressing TrpC5. Carbachol, 100 μM. (D) Decreasing and increasing TrpC5 biosynthesis regulate Wnt5a expression and nuclear translocation of β-catenin, cyclin D1 and c-myc expression, as shown by immunostaining in SW480 cells stably transfected with TrpC5-specfic siRNA, and LoVo cells stably expressing TrpC5. Nuclei are stained with DAPI (blue). Scale bars=20 μm. (E) Decreasing and increasing TrpC5 biosynthesis regulate Wnt5a secretion. (F) Decreasing and increasing TrpC5 biosynthesis regulate differentiation in SW480 cells stably transfected with TrpC5-specific siRNA, and LoVo cells stably expressing TrpC5 as measured by semi-quantitative RT-PCR. *P < 0.05.

For further investigation of the role of TrpC5 in the regulation of Wnt5a secretion and differentiation, the effect of decreasing and increasing TrpC5 biosynthesis was analysed using TrpC5-specific siRNA in the poorly differentiated SW480 line, or a TrpC5 plasmid in the well-differentiated LoVo line. The presence of functional TrpC5 was detected by measurement of [Ca2+]i (Figure 3C). TrpC5 overexpression in LoVo cells caused a robust rise in [Ca2+]i, and enhanced Wnt5a expression and the nuclear translocation of β-catenin, as well as cyclin D1 and c-myc expression (Figures 3C and 3D). In contrast, all these increases were clearly blocked on knock down of TrpC5 in SW480 cells (Figures 3C and 3D). In addition, TrpC5 knockdown in poorly differentiated human CRC cells reduced Wnt5a secretion and improved the degree of differentiation, whereas TrpC5 overexpression in well-differentiated human CRC cells resulted in decreased Wnt5a secretion and poor differentiation (Figures 3E and 3F). These results indicated that TrpC5 regulates Wnt5a secretion positively and cancer cell differentiation negatively in CRC.

TrpC5 enhances CRC cell stemness in vitro and in vivo

Given the above evidence that TrpC5 regulates differentiation in CRC, we set out to determine whether this mechanism influences CRC cell stemness in vitro and in vivo. In most cases, cancer stem cells have been identified based on their expression of specific surface markers, such as CD133, CD44 and aldehyde dehydrogenase 1 [27]. We therefore investigated whether the expression of CD44 and CD133 changes in TrpC5-knockdown or -overexpressing cells. TrpC5 knockdown in SW480 cells decreased CD44 and CD133 expression, whereas overexpressed TrpC5 in LoVo cells up-regulated CD44 and CD133 expression compared with controls (Figure 4A). FACS further confirmed the CD133 expression in both SW480 and LoVo cells (Figure 4B). Moreover, the TrpC5-overexpressing LoVo cells formed more and larger spheres than control cells, although administration of TrpC5 siRNA significantly reduced sphere formation in SW480 cells (Figure 4C).

TrpC5 enhances CRC cell stemness in vitro and in vivo

Figure 4
TrpC5 enhances CRC cell stemness in vitro and in vivo

(A) Immunofluorescence showing the expression of CD44 and CD133 while decreasing and increasing TrpC5 expression in SW480 and LoVo cells. Scale bars=20 μm. (B) FACS showing a prominent shift in CD133 immunofluorescence while decreasing and increasing TrpC5 expression in SW480 and LoVo cells. (C) TrpC5 induced stem cell-like self-renewal properties. Sphere sizes are shown above and the numbers of spheres below. (D) Representative images (left panel) of tumours formed after injection of BALB/C nude mice with TrpC5-overexpressing LoVo CD133+ cells or TrpC5-knockdown SW480 CD133+ cells, and the corresponding tumour growth curves (right panel) measured at the indicated time points. (E) Expression of TrpC5, villin 1 and Wnt5a detected by immunohistochemistry in harvested tumour xenografts. Scale bars=100 μm.

Figure 4
TrpC5 enhances CRC cell stemness in vitro and in vivo

(A) Immunofluorescence showing the expression of CD44 and CD133 while decreasing and increasing TrpC5 expression in SW480 and LoVo cells. Scale bars=20 μm. (B) FACS showing a prominent shift in CD133 immunofluorescence while decreasing and increasing TrpC5 expression in SW480 and LoVo cells. (C) TrpC5 induced stem cell-like self-renewal properties. Sphere sizes are shown above and the numbers of spheres below. (D) Representative images (left panel) of tumours formed after injection of BALB/C nude mice with TrpC5-overexpressing LoVo CD133+ cells or TrpC5-knockdown SW480 CD133+ cells, and the corresponding tumour growth curves (right panel) measured at the indicated time points. (E) Expression of TrpC5, villin 1 and Wnt5a detected by immunohistochemistry in harvested tumour xenografts. Scale bars=100 μm.

To explore the effects of TrpC5 on the tumorigenicity of CRC cell lines, the CD133± cells were isolated using a CD133 microbead kit and then injected into BALB/C nude mice (1×104/animal). The data showed that the tumours formed by TrpC5-overexpressing LoVo cells were larger than those in the group injected with vector control cells, and the growth rates of the TrpC5-overexpressing tumours were slightly higher than those of controls (Figure 4D). In contrast, tumours formed by TrpC5-knockdown SW480 cells were smaller than those from injection with control cells, and injection of TrpC5-siRNA reduced tumour growth (Figure 4D). Furthermore, we surveyed the expression levels of TrpC5, villin 1 and Wnt5a using immunohistochemistry, and found higher expression of all three in the TrpC5-overexpressing tumours than in control tumours (Figure 4E), whereas TrpC5-knockdown tumours had lower expression of all three than control tumours (Figure 4E). It is interesting that the correlation between TrpC5 and the degree of differentiation was further confirmed in human CRC samples. We found that, in poorly differentiated tumours, expression of both TrpC5 and CD133/CD44 was higher than in well-differentiated tumours (see Supplementary Figure S6). Therefore, we concluded that TrpC5 regulates differentiation and enhances stemness in CRC cells through the Wnt5a signalling pathway.

TrpC5 is an independent adverse prognostic factor for death in CRC patients

To investigate the potential clinical role of TrpC5 and Wnt5a in CRC, we next carried out Pearson's correlation analysis of TrpC5 and Wnt5a expression and secretion in CRC samples from 31 patients. The results showed that TrpC5 had a significant positive correlation with Wnt5a expression (Figure 5A). We also found a positive correlation of TrpC5 expression with serum Wnt5a in 11 patients (Figure 5B). These results indicate that TrpC5 has a correlation with Wnt5a in cancer patients.

TrpC5 is an independent adverse prognostic factor for death in patients with CRC

Figure 5
TrpC5 is an independent adverse prognostic factor for death in patients with CRC

(A) Representative images of (left) immunohistochemical staining for Wnt5a and TrpC5 expression in tumours of different histological grades (1 and 3) and (right) the correlation of TrpC5 and Wnt5a expression in patients with CRC. Scale bars=100 μm. (B) Correlation of TrpC5 expression and Wnt5a secretion (right) in samples from patients. (C) Kaplan–Meier estimates of disease-free survival of all 346 CRC patients according to TrpC5 expression. (D) Kaplan–Meier estimates of overall survival of all 346 CRC patients according to TrpC5 expression. Marks on the graph indicate censored samples. P value refers to two-sided log-rank (Mantel–Cox) tests. (E) Schematic model of CRC differentiation executed by TrpC5 through the Ca2+/Wnt5a signalling pathway. Overexpression of TrpC5 causes a robust rise in [Ca2+]i, enhanced Wnt5a expression and nuclear translocation of β-catenin, leading to a decrease in cancer differentiation and enhancement of cancer cell stemness.

Figure 5
TrpC5 is an independent adverse prognostic factor for death in patients with CRC

(A) Representative images of (left) immunohistochemical staining for Wnt5a and TrpC5 expression in tumours of different histological grades (1 and 3) and (right) the correlation of TrpC5 and Wnt5a expression in patients with CRC. Scale bars=100 μm. (B) Correlation of TrpC5 expression and Wnt5a secretion (right) in samples from patients. (C) Kaplan–Meier estimates of disease-free survival of all 346 CRC patients according to TrpC5 expression. (D) Kaplan–Meier estimates of overall survival of all 346 CRC patients according to TrpC5 expression. Marks on the graph indicate censored samples. P value refers to two-sided log-rank (Mantel–Cox) tests. (E) Schematic model of CRC differentiation executed by TrpC5 through the Ca2+/Wnt5a signalling pathway. Overexpression of TrpC5 causes a robust rise in [Ca2+]i, enhanced Wnt5a expression and nuclear translocation of β-catenin, leading to a decrease in cancer differentiation and enhancement of cancer cell stemness.

Furthermore, to assess the clinical relevance of TrpC5 up-regulation, the survival follow-up information on 346 patients was analysed, and 5.8 and 10.8 were selected as the appropriate cut-off values of the TrpC5 score (see Supplementary Table S4). A score of <5.8 was defined as low expression (n=175) and a score of ≥10.8 was defined as high expression (n=26); other scores were defined as moderate expression (n=145). The patients with moderate expression showed a statistically shorter overall survival than those with low expression (P=0.013) and longer overall survival than those with high expression (P=0.020) (Figure 5C; see Supplementary Tables S5 and S6). In addition, patients with tumours that expressed high levels showed significantly poorer disease-free survival than those with tumours with moderate and low TrpC5 expression (Figure 5D; see Supplementary Tables S5 and S6). Together, these results provided initial evidence that TrpC5 acts through the Wnt5a signalling pathway and is an independent adverse prognostic factor for death in patients with CRC.

DISCUSSION

To achieve better therapeutic outcomes and improve the survival of patients with CRC, it is essential to understand the underlying mechanisms and define reliable indicators for tumour differentiation. The findings described in the present study shed light on an unconventional and poorly understood mechanism of Ca2+-permeable ion channels functioning in the regulation of tumour differentiation, and on possibilities that modulation of these channels’ function acts to improve therapeutic outcome and CRC patient survival. In particular, we have shown that TrpC5, highly expressed in CRC, caused a robust rise in [Ca2+]i, Wnt5a expression, the nuclear translocation of β-catenin and subsequent reduction of cancer differentiation. Patients with tumours that expressed high levels of TrpC5 had a high potential for relapse. To the best of our knowledge, this is the first study investigating an ion channel that regulates tumour differentiation.

Calcium ions are ubiquitous and multifunctional signalling molecules, capable of converting a lot of extracellular stimuli into markedly different intracellular actions, ranging from contraction to secretion, and from proliferation to cell death [2830]. The key to this pleiotropic role is the complex spatiotemporal organization of the [Ca2+]i rise evoked by extracellular agonists, which allows selected effectors to be recruited and specific actions to be initiated [31]. Trp channels are sensitive to a diverse array of stimuli and have low conductance, so they can operate over prolonged time-scales without overloading the cell with Ca2+ [32]. Members of the Trp family, such as TrpC5, are particularly important in controlling slow cellular processes such as smooth-muscle contractility and proliferation [33]. In the present study, we found that TrpC5 was highly expressed in CRC and the up-regulated TrpC5 channels allowed the influx of extracellular Ca2+. TrpC5 channels and the subsequent rise in [Ca2+]i activated the Wnt5a/β-catenin pathway, an inducer of differentiation in CRC cells. [Ca2+]i has a complex impact on TrpC5, including a permissive role for other activators, as well as inhibition at high concentrations [34]. It is therefore reasonable to suggest that TrpC5 controls slow cellular processes, including differentiation.

It has recently been reported that Wnt5a mobilizes [Ca2+]i, followed by β-catenin translocation into the nucleus in various tumour cells [35], which is in line with our data on CRC cells, but the molecular mechanism is as yet unknown. In the present study, we showed that TrpC5 is responsible for the Ca2+ influx into CRC cells. TrpC5 overexpression caused a robust rise in [Ca]i, Wnt5a expression, nuclear distribution of β-catenin, expression of cyclin D1 and c-myc, and subsequent reduction of CRC differentiation. Thus, we have identified the molecular components that regulate CRC cell differentiation. In addition, tumour recurrence after curative surgery might also partly result from the existence of cancer stem cells, which could be responsible for tumour generation, progression and chemoresistance [36,37]. Therefore, we made an effort to determine whether the modulation of differentiation by TrpC5 influences CRC cell stemness. We demonstrated that TrpC5 induced a stem cell-like state, as evidenced by an enhanced self-renewal capacity, increased the expression of specific stem cell surface markers, and increased size and growth rates of tumour xenografts. Furthermore, among the molecules associated with the prognosis of CRC, SIRT1 has been associated with a good prognosis [38], whereas CALU and CDH11 are also candidates for stromal biomarkers with prognostic significance in CRC [39]. In the present study, we showed that the expression and secretion of Wnt5a correlated positively with differentiation, but negatively with therapeutic outcome and patient survival, indicating its potential clinical relevance.

CRC comprises different histological types in terms of differentiation status, including tubular adenocarcinoma, papillary carcinoma, mucinous adenocarcinoma, signet-ring cell carcinoma and undifferentiated carcinoma. The differentiation status provides insights into the degree of malignancy and the prognosis. We found that TrpC5 was weakly expressed in low-grade CRC and strongly expressed in high-grade CRC. Importantly, patients with tumours that had high TrpC5 expression showed significantly poorer disease-free survival and overall survival than those with tumours having low TrpC5 expression, indicating that TrpC5 expression is an independent prognostic marker for low survival in CRC.

It has been reported that the expression of TrpC5 is closely associated with the progression of cancer due to the development of chemoresistance [40]. So far, in the course of cancer treatment, the effective inhibition or reversal of drug resistance is still difficult. However, a TrpC5-based approach may provide a new direction for dealing with cancer chemotherapy resistance. Inhibiting TrpC5 with siRNA, the TrpC5-specific blocking antibody T5E3 and the pharmacological TrpC5 antagonist aminoethoxydiphenyl borate reduces chemoresistance in breast cancers in vitro and in vivo [41]. These findings suggest that TrpC5-based therapy, combined with other antineoplastic agents in CRC, may provide a new direction for treatment.

Collectively, our data suggest that up-regulated TrpC5 causes a robust rise in [Ca2+]i, enhanced Wnt5a expression and nuclear translocation of β-catenin, leading to reduced differentiation and enhanced cancer cell stemness. Notably, we found a striking negative association between the expression of TrpC5 and therapeutic outcome and survival in CRC patients. Although there is no reason to think that these effects are limited to TrpC5, assessment of the TrpC5/Wnt5a pathway may enable the monitoring of differentiation and therapeutic outcome. Thus, it may be worthwhile exploring the potential of using TrpC5/Wnt5a further as a prognostic factor in CRC.

AUTHOR CONTRIBUTION

Z. Chen, C. Tan, Y. Zhu, M. Xie, D. He, P. Zhang, T. Wang, Q. Pan, L. Jin and Y. Zhu performed experiments, including immunohistochemistry, RT-PCR, Western blotting, immunostaining and ELISA assays. Z. Chen, T. Wang, L. Jin and X. Qi, under the supervision of D. Hua, provided technical assistance, obtained clinical samples and did the immunohistochemical analyses. X. Ma, Z. Chen, D. Hua, X. Yao and J. Jin designed the experiments. Z. Chen, T. Wang, D. He and Y. Zhu did the statistical analysis. X. Ma, D. He, Z. Chen and X. Yao wrote the manuscript. Z. Chen, C. Tang and Y. Zhu contributed equally to this work. X. Ma and J. Jin are the corresponding authors.

We thank Professors I.C. Bruce, F. Leung Chan and Q. Li for critical reading of the manuscript, and Professors B. Jiang, J. Xu, K.-Y. Lu in the State Key Laboratory of Food Science and Technology, Jiangnan University, for insightful comments and technical assistance.

FUNDING

This work was supported by the National Natural Science Foundation of China [81572940, 81622007 and 91439131 to X. Ma; 31550006 to D. He; and 21305051 to C. Tan], the Natural Science Foundation for Distinguished Young Scholars of Jiangsu Province [BK20140004 to X. Ma], the Program for New Century Excellent Talents in University of the Ministry of Education of China [NCET-12-0880 to X. Ma], the National High Technology Research and Development Program (863 Program) of China [SQ2015AA020948 to X. Ma], and the Research Innovation Program for College Graduates of Jiangsu Province [KYLX_1173 to Z. Chen].

Abbreviations

     
  • [Ca2+]i

    intracellular calcium concentration

  •  
  • CRC

    colorectal cancer

  •  
  • DMEM

    Dulbecco's modified Eagle's medium

  •  
  • FACS

    fluorescence-activated cell sorting

  •  
  • RT-PCR

    reverse transcription PCR

  •  
  • TNM

    tumour node metastasis

  •  
  • TrpC5

    transient receptor potential channel 5

References

References
1
Jemal
A.
Bray
F.
Center
M.M.
Ferlay
J.
Ward
E.
Forman
D.
Global cancer statistics
CA Cancer J. Clin.
2011
, vol. 
61
 (pg. 
69
-
90
)
[PubMed]
2
Park
S.H.
Lee
D.H.
Kim
J.L.
Kim
B.R.
Na
Y.J.
Jo
M.J.
Jeong
Y.A.
Lee
S.Y.
Lee
S.I.
Lee
Y.Y.
, et al. 
Metformin enhances TRAIL-induced apoptosis by Mcl-1 degradation via Mule in colorectal cancer cells
Oncotarget
2016
, vol. 
7
 (pg. 
59503
-
59518
)
3
Zhang
M.
Zhao
Q.C.
Liu
Y.P.
Yang
L.
Zhu
H.M.
Chhetri
J.K.
Prognostic analysis and comparison of colon cancer in Han and Hui patients
World J. Gastroenterol.
2014
, vol. 
20
 (pg. 
5082
-
5086
)
[PubMed]
4
Bruun
J.
Kolberg
M.
Nesland
J.M.
Svindland
A.
Nesbakken
A.
Lothe
R.A.
Prognostic significance of beta-catenin, E-cadherin, and SOX9 in colorectal cancer: results from a large population-representative series
Front. Oncol.
2014
, vol. 
4
 pg. 
118
 
[PubMed]
5
Rakha
E.A.
Reis-Filho
J.S.
Ellis
I.O.
Combinatorial biomarker expression in breast cancer
Breast Cancer Res. Tr.
2010
, vol. 
120
 (pg. 
293
-
308
)
6
Lamprechtand
S.A.
Lipkin
M.
Chemoprevention of colon cancer by calcium, vitamin D and folate: molecular mechanisms
Nat. Rev. Cancer
2003
, vol. 
3
 (pg. 
601
-
614
)
[PubMed]
7
Sellers
T.A.
Bazyk
A.E.
Bostick
R.M.
Kushi
L.H.
Olson
J.E.
Anderson
K.E.
Lazovich
D.
Folsom
A.R.
Diet and risk of colon cancer in a large prospective study of older women: an analysis stratified on family history (Iowa, United States)
Cancer Causes Control
1998
, vol. 
9
 (pg. 
357
-
367
)
[PubMed]
8
Baron
J.A.
Beach
M.
Mandel
J.S.
van Stolk
R.U.
Haile
R.W.
Sandler
R.S.
Rothstein
R.
Summers
R.W.
Snover
D.C.
Beck
G.J.
, et al. 
Calcium supplements for the prevention of colorectal adenomas. Calcium Polyp Prevention Study Group
N. Engl. J. Med.
1999
, vol. 
340
 (pg. 
101
-
107
)
[PubMed]
9
Lipkin
M.
Preclinical and early human studies of calcium and colon cancer prevention
Ann. N.Y. Acad. Sci.
1999
, vol. 
889
 (pg. 
120
-
127
)
[PubMed]
10
Wu
K.
Willett
W.C.
Fuchs
C.S.
Colditz
G.A.
Giovannucci
E.L.
Calcium intake and risk of colon cancer in women and men
J. Natl. Cancer Inst.
2002
, vol. 
94
 (pg. 
437
-
446
)
[PubMed]
11
Venkatachalamand
K.
Montell
C.
TRP channels
Annu. Rev. Biochem.
2007
, vol. 
76
 (pg. 
387
-
417
)
[PubMed]
12
Bezzerides
V.J.
Ramsey
I.S.
Kotecha
S.
Greka
A.
Clapham
D.E.
Rapid vesicular translocation and insertion of TRP channels
Nat. Cell Biol.
2004
, vol. 
6
 (pg. 
709
-
720
)
[PubMed]
13
Greka
A.
Navarro
B.
Oancea
E.
Duggan
A.
Clapham
D.E.
TRPC5 is a regulator of hippocampal neurite length and growth cone morphology
Nat. Neurosci.
2003
, vol. 
6
 (pg. 
837
-
845
)
[PubMed]
14
Xu
S.Z.
Sukumar
P.
Zeng
F.
Li
J.
Jairaman
A.
English
A.
Naylor
J.
Ciurtin
C.
Majeed
Y.
Milligan
C.J.
, et al. 
TRPC channel activation by extracellular thioredoxin
Nature
2008
, vol. 
451
 (pg. 
69
-
72
)
[PubMed]
15
Voets
T.
Owsianik
G.
Janssens
A.
Talavera
K.
Nilius
B.
TRPM8 voltage sensor mutants reveal a mechanism for integrating thermal and chemical stimuli
Nat. Chem. Biol.
2007
, vol. 
3
 (pg. 
174
-
182
)
[PubMed]
16
Voets
T.
Droogmans
G.
Wissenbach
U.
Janssens
A.
Flockerzi
V.
Nilius
B.
The principle of temperature-dependent gating in cold- and heat-sensitive TRP channels
Nature
2004
, vol. 
430
 (pg. 
748
-
754
)
[PubMed]
17
Lehen'kyiand
V.
Prevarskaya
N.
Oncogenic TRP channels
Adv. Exp. Med. Biol.
2011
, vol. 
704
 (pg. 
929
-
945
)
[PubMed]
18
Richter
J.M.
Schaefer
M.
Hill
K.
Clemizole hydrochloride is a novel and potent inhibitor of transient receptor potential channel TRPC5
Mol. Pharmacol.
2014
, vol. 
86
 (pg. 
514
-
521
)
[PubMed]
19
Ma
X.
Cai
Y.
He
D.
Zou
C.
Zhang
P.
Lo
C.Y.
Xu
Z.
Chan
F.L.
Yu
S.
Chen
Y.
, et al. 
Transient receptor potential channel TRPC5 is essential for P-glycoprotein induction in drug-resistant cancer cells
Proc. Natl. Acad. Sci. U.S.A.
2012
, vol. 
109
 (pg. 
16282
-
16287
)
[PubMed]
20
Ma
X.
Chen
Z.
Hua
D.
He
D.
Wang
L.
Zhang
P.
Wang
J.
Cai
Y.
Gao
C.
Zhang
X.
, et al. 
Essential role for TrpC5-containing extracellular vesicles in breast cancer with chemotherapeutic resistance
Proc. Natl. Acad. Sci. U.S.A.
2014
, vol. 
111
 (pg. 
6389
-
6394
)
[PubMed]
21
Euhus
D.M.
Hudd
C.
LaRegina
M.C.
Johnson
F.E.
Tumor measurement in the nude mouse
J. Surg. Oncol.
1986
, vol. 
31
 (pg. 
229
-
234
)
[PubMed]
22
Botchkina
I.L.
Rowehl
R.A.
Rivadeneira
D.E.
Karpeh
M.S.
Jr
Crawford
H.
Dufour
A.
Ju
J.
Wang
Y.
Leyfman
Y.
Botchkina
G.I.
Phenotypic subpopulations of metastatic colon cancer stem cells: genomic analysis
Cancer Genomics Proteomics
2009
, vol. 
6
 (pg. 
19
-
29
)
[PubMed]
23
Yeung
T.M.
Gandhi
S.C.
Wilding
J.L.
Muschel
R.
Bodmer
W.F.
Cancer stem cells from colorectal cancer-derived cell lines
Proc. Natl. Acad. Sci. U.S.A.
2010
, vol. 
107
 (pg. 
3722
-
3727
)
[PubMed]
24
Aung
C.S.
Kruger
W.A.
Poronnik
P.
Roberts-Thomson
S.J.
Monteith
G.R.
Plasma membrane Ca2+-ATPase expression during colon cancer cell line differentiation
Biochem. Biophys. Res. Commun.
2007
, vol. 
355
 (pg. 
932
-
936
)
[PubMed]
25
Arango
D.
Al-Obaidi
S.
Williams
D.S.
Dopeso
H.
Mazzolini
R.
Corner
G.
Byun
D.S.
Carr
A.A.
Murone
C.
Tögel
L.
, et al. 
Villin expression is frequently lost in poorly differentiated colon cancer
Am. J. Pathol.
2012
, vol. 
180
 (pg. 
1509
-
1521
)
[PubMed]
26
Hu
R.
Zuo
Y.
Zuo
L.
Liu
C.
Zhang
S.
Wu
Q.
Zhou
Q.
Gui
S.
Wei
W.
Wang
Y.
KLF4 expression correlates with the degree of differentiation in colorectal cancer
Gut Live.
2011
, vol. 
5
 (pg. 
154
-
159
)
27
Saigusa
S.
Tanaka
K.
Toiyama
Y.
Yokoe
T.
Okugawa
Y.
Ioue
Y.
Miki
C.
Kusunoki
M.
Correlation of CD133, OCT4, and SOX2 in rectal cancer and their association with distant recurrence after chemoradiotherapy
Ann. Surg. Oncol.
2009
, vol. 
16
 (pg. 
3488
-
3498
)
[PubMed]
28
Rich
T.C.
Fagan
K.A.
Tse
T.E.
Schaack
J.
Cooper
D.M.
Karpen
J.W.
A uniform extracellular stimulus triggers distinct cAMP signals in different compartments of a simple cell
Proc. Natl. Acad. Sci. U.S.A.
2001
, vol. 
98
 (pg. 
13049
-
13054
)
[PubMed]
29
Dolfi
F.
Garcia-Guzman
M.
Ojaniemi
M.
Nakamura
H.
Matsuda
M.
Vuori
K.
The adaptor protein Crk connects multiple cellular stimuli to the JNK signaling pathway
Proc. Natl. Acad. Sci. U.S.A.
1998
, vol. 
95
 (pg. 
15394
-
15399
)
[PubMed]
30
Kupzig
S.
Walker
S.A.
Cullen
P.J.
The frequencies of calcium oscillations are optimized for efficient calcium-mediated activation of Ras and the ERK/MAPK cascade
Proc. Natl. Acad. Sci. U.S.A.
2005
, vol. 
102
 (pg. 
7577
-
7582
)
[PubMed]
31
Rizzuto
R.
Pozzan
T.
Microdomains of intracellular Ca2+: molecular determinants and functional consequences
Physiol. Rev.
2006
, vol. 
86
 (pg. 
369
-
408
)
[PubMed]
32
Voets
T.
Droogmans
G.
Wissenbach
U.
Janssens
A.
Flockerzi
V.
Nilius
B.
The principle of temperature-dependent gating in cold- and heat-sensitive TRP channels
Nature
2004
, vol. 
430
 (pg. 
748
-
754
)
[PubMed]
33
Berridge
M.J.
Bootman
M.D.
Roderick
H.L.
Calcium signalling: dynamics, homeostasis and remodelling
Nat. Rev. Mol. Cell Biol.
2003
, vol. 
4
 (pg. 
517
-
529
)
[PubMed]
34
Beech
D.J.
Canonical transient receptor potential 5
Handb. Exp. Pharmacol.
2007
, vol. 
179
 (pg. 
109
-
123
)
35
Thrasivoulou
C.
Millar
M.
Ahmed
A.
Activation of intracellular calcium by multiple Wnt ligands and translocation of β-catenin into the nucleus: a convergent model of Wnt/Ca2+ and Wnt/β-catenin pathways
J. Biol. Chem.
2013
, vol. 
288
 (pg. 
35651
-
35659
)
[PubMed]
36
Gerger
A.
Zhang
W.
Yang
D.
Bohanes
P.
Ning
Y.
Winder
T.
LaBonte
M.J.
Wilson
P.M.
Benhaim
L.
Paez
D.
, et al. 
Common cancer stem cell gene variants predict colon cancer recurrence
Clin. Cancer Res.
2011
, vol. 
17
 (pg. 
6934
-
6943
)
[PubMed]
37
Zeki
S.S.
Graham
T.A.
Wright
N.A.
Stem cells and their implications for colorectal cancer
Nat. Rev. Gastroenterol. Hepatol.
2011
, vol. 
8
 (pg. 
90
-
100
)
[PubMed]
38
Jung
W.
Hong
K.D.
Jung
W.Y.
Lee
E.
Shin
B.K.
Kim
H.K.
Kim
A.
Kim
B.H.
SIRT1 expression is associated with good prognosis in colorectal cancer
Korean J. Pathol.
2013
, vol. 
47
 (pg. 
332
-
339
)
[PubMed]
39
Torres
S.
Bartolomé
R.A.
Mendes
M.
Barderas
R.
Fernandez-Acenero
M.J.
Pelaez-Garcia
A.
Peña
C.
Lopez-Lucendo
M.
Villar-Vázquez
R.
de Herreros
A.G.
, et al. 
Proteome profiling of cancer-associated fibroblasts identifies novel proinflammatory signatures and prognostic markers for colorectal cancer
Clin. Cancer Res.
2013
, vol. 
19
 (pg. 
6006
-
6019
)
[PubMed]
40
He
D.X.
Ma
X.
Transient receptor potential channel C5 in cancer chemoresistance
Acta Pharmacol. Sin.
2016
, vol. 
37
 (pg. 
19
-
24
)
[PubMed]
41
Nilius
B.
Owsianik
G.
Voets
T.
Peters
J.A.
Transient receptor potential cation channels in disease
Physiol. Rev.
2007
, vol. 
87
 (pg. 
165
-
217
)
[PubMed]

Supplementary data