A sexual dimorphism in liver inflammation and repair was previously demonstrated. Its cellular dissection in the course of acute liver injury (ALI) was explored. BALB/c mice were treated with carbon tetrachloride (CCl4) by intraperitoneal injection and killed after 3, 5, and 8 days. Histological and hepatic cell population analyses were performed. The correlation between androgen receptor (AR) expression and liver recruited inflammatory cells was investigated by treatment with the AR antagonist flutamide. Additionally, patients with a diagnosis of drug induced liver injury (DILI) were included in the study, with a particular focus on gender dimorphism in circulating monocytes. A delayed resolution of necrotic damage and a higher expression of proinflammatory cytokines were apparent in male mice along with a slower recruitment of inflammatory monocytes. F4/80+CD11b+ macrophages and CD11bhighGr-1high monocytes expressed AR and were recruited later in male compared with female livers after CCl4 treatment. Moreover, CD11bhighAR+Gr-1high recruitment was negatively modulated by flutamide in males. Analysis of DILI patients showed overall a significant reduction in circulating mature monocytes compared with healthy subjects. More interestingly, male patients had higher numbers of immature monocytes compared with female patients.

A stronger cytotoxic tissue response was correlated with an impaired recruitment of CD11bhighAR+Gr-1high cells and F4/80+CD11b+ macrophages in the early inflammatory phase under AR signaling. During DILI, a dimorphic immune response was apparent, characterized by a massive recruitment of monocytes to the liver both in males and females, but only in males was this recruitment sustained by a turnover of immature monocytes.

Introduction

Liver regeneration is a physiological process that allows the recovery from even substantial hepatic damage caused by either toxins or viral infection [1]. This process requires a coordinated response of immune cells, including macrophages [2], T cells and eosinophils [3], mobilization of liver growth factors, matrix remodeling, and a rapid but tightly controlled hepatocyte hyperplasia to achieve restitution of liver mass [4].

Originating in response to stress conditions [5], hepatic inflammation is a complex process that modulates the outcome of acute liver damage that can exert both hepatoprotective and detrimental effects. A mild inflammatory response contributes to tissue repair promoting the re-establishment of homeostasis, while excessive and permanent inflammation causes a massive loss of hepatocytes, exacerbating the severity of hepatic parenchymal damage [6] and an irreversible decline of liver functions [7]. Strictly controlled at a cellular level, the inflammatory process involves distinct liver-resident cells and circulating immune cells that are specifically recruited to the liver in response to bioactive molecules such as cytokines, chemokines, lipid messengers, and pro-oxidants [5].

The liver is a gender dimorphic organ in mammals, exhibiting sex differences in the profile of steroid and drug metabolism [8], the number of hepatocytes and Kupffer cells [9], and regeneration rate [10,11]. Indeed, experimental studies have shown that tissue repair exhibits a gender dimorphic pattern due to an interaction between the immune and endocrine systems [1215]. In particular, sex hormones regulate the maturation and selection of thymocytes, lymphocyte proliferation, and the production of cytokines by immune cells [16]. Furthermore, Grossman suggested that estrogens potentiate immunity mediated by B cells and suppress some mechanisms dependent on T cells [15]. Apart from nongenomic mechanisms mediated by cell surface receptors [17], the biological activity of sex hormones involves nuclear receptors such as those for estrogens (ER-α and ER-β) and androgen receptors (AR) activating the expression of target genes [18]. The increased susceptibility to acute response complications in males has been suggested in some pathological conditions to depend on immunosuppression [19] or the modulation by androgens of the Th1 and Th2 cell-mediated immune responses [20]. Moreover, recent studies with androgen receptor knockout mice (ARKO) have demonstrated that androgen/AR signaling regulates the development of several lineages of immune cell types including neutrophils, macrophages, and lymphocytes [2125].

It has been reported that the initial inflammatory phase of acute liver injury is controlled by myeloid-derived macrophages and that they play a crucial role during the course of injury [26]. Due to an increased hepatic level of the chemokine CCL2 (also known as MCP-1) after acute injury, the migration of myeloid suppressor cells (CCR2+) is promoted from the bone marrow to the liver involving predominantly inflammatory Gr-1high cells [26]. In a mouse model of wound healing, the analysis of monocyte populations (CD11b+F4/80+) demonstrated a reduced migration of CD11b+F4/80+Gr-1+ cells in ARKO mice compared with wild-type (WT) animals suggesting that AR might specifically increase the inflammatory monocyte pool in the peripheral blood. In contrast, the resident monocyte subset of CD11b+F4/80+Gr-1 cells was similar in WT and ARKO mice, suggesting no modulation in the local response by AR. Moreover, CCR2, a key chemokine receptor that regulates the liver infiltration by immune cells after damage, was shown to be transcriptionally regulated by AR [22].

After CCl4-mediated damage, macrophages play a pivotal role during tissue repair affecting the kinetics of the inflammatory process and liver recovery [27]. However, the involvement of AR in acute liver damage is not clearly defined and it remains unknown how androgen/AR signaling modulates immune responses following chemical toxicity.

Idiosyncratic drug induced acute liver injury (DILI) is a rare adverse drug reaction that affects only susceptible individuals, leading to massive liver injury with consequent liver failure, and even death. Antimicrobials, herbal, and dietary supplements are among the most common therapeutic classes to cause DILI in the Western world. A recent study of Moore et al. [28] demonstrated that severe DILI is associated with profound changes in the peripheral blood cells, particularly in monocytes.

In the present study, gender differences in the monocyte-macrophage compartment in a CCl4-induced mouse model of acute liver injury were explored, with a specific focus on the infiltrating monocyte subset of CD11bhighGr-1high macrophages and the cytokine profile. Moreover, circulating monocytes in patients with DILI were investigated to extend our in vivo findings and substantiate the hypothesis of a gender dimorphic immune recruitment as one of the key factors affecting liver regeneration.

Methods

Animals and experimental groups

All animal studies were carried out in accordance with the guidelines of the National Institutes of Health and with a protocol approved by the Ethics Committee of the University of Padua (Italy) (CEASA, protocol 108288/2013) and animals received humane care. They were housed under standard conditions in open cages without filter lids, in a 12-h light–dark cycle with a standard rodent chow diet (Mucedola s.r.l., Milan, Italy) and bottled water ad libitum.

Acute liver injury was induced in male (n=45) and female (n=45) BALB/c mice (8 weeks old, weighing 18–23 g) with a single intraperitoneal (i.p.) dose of CCl4 (Sigma Aldrich s.r.l. Milan, Italy) (0.75 ml/kg body weight), dissolved (1:1) in sunflower oil (Sigma-Aldrich) during the light cycle and without fasting. The control mice received the same volumetric dose of oil as an i.p. injection.

At different time points (days 3, 5, and 8) after CCl4 or oil administration, five animals/group were killed by cervical dislocation and livers were removed for histological, flow cytometric (FCM), and gene cytokine expression analysis.

As a preliminary study, we assessed a further animal model of pharmacological antagonism of the androgen receptor caused by flutamide. In this animal model, 2 days after CCl4 injection, five males and five females were randomly selected for i.p. injection (every 2 days) with flutamide (50 mg/kg body weight, Sigma-Aldrich), prepared in sunflower oil (CCl4 + flutamide group).

Histological analysis

Following random sampling, liver tissue was fixed overnight in 10% formalin solution, washed, and embedded in paraffin wax (Bioptica S.p.a., Milan, Italy). Sections of 4–5 µm thickness were stained with hematoxylin–eosin according to standard protocols.

Quantification of necrotic areas was performed by manual morphometric analysis using Leica Application Suite (Leica Microsystems s.r.l., Italy) and data were expressed as % of sum of all necrotic areas of the section versus total section area.

Deposition of extracellular matrix was analyzed by Masson trichrome staining (Sigma-Aldrich) according to the manufacturer’s instructions.

Serological parameters

Liver function was monitored by measuring ALT and AST in the serum of animals at T = 0 and at 3, 5, and 8 days after CCl4 injection by laboratory routine assays conducted in the Laboratories of Istituto Zooprofilattico Sperimentale delle Venezie (IZSVe, Legnaro, Padova, Italy), according to the manufacturer’s instructions.

Immunohistochemical evaluation

After deparaffinization and antigen unmasking, sections were incubated with one of the following primary antibodies: rabbit anti-phospho histone H3 Ab (pH3, Ser10; Cell Signaling Technology, Leiden, The Netherlands) diluted 1:200 in antibody buffer (2.5% goat serum in 0.1% TBST) overnight at 4°C; mouse anti-α smooth muscle actin (α-SMA, clone 1A4, Sigma-Aldrich) diluted 1:2000 in PBS overnight at 4°C; rabbit anti pan-cytokeratin (pan-CK, DAKO-Agilent Technologies, Santa Clara, CA, U.S.A.) diluted 1:2000 in PBS overnight at 4°C; mouse anti-CD68 (ED1, Abcam Cambridge, U.K.) diluted 1:200 in PBS overnight at 4°C.

After incubation with biotinylated secondary antibodies (E0432 and E0433 DAKO-Agilent; BA-1000, Vector Laboratories, Burlingame, U.S.A), for signal detection, the enzymatic reaction was developed using diaminobenzidine (DAB) solution as substrate (Vector Laboratories) for 4 min. Nuclei were counterstained with hematoxylin (Diapath, Bergamo, Italy).

Signal quantification

pH3 quantification was performed as follows: for each sample, six high-power fields (HPF) (×400) were scored using an integrated grid on a Leica microscope. The proliferation index was calculated as % ratio of nuclei pH3+/(nuclei pH3+)+(nuclei pH3).

For α-SMA and pan-CK, quantification was performed as follows: for each sample, data were expressed as % of sum of all positive areas of the section/total section area.

CD68 quantification was performed as follows: for each sample total, the number of CD68+ agglomerates was counted in the total area of the slide. Single positive cells were not considered.

Isolation of hepatic cells

Livers were perfused with PBS, minced with scissors, and then digested for 30 min at 37°C with 0.05% (w/v) collagenase D (Sigma-Aldrich), 0.002% (w/v) protease (Calbiochem, Darmstadt, Germany), and 3.07 U/ml DNAse I (Sigma-Aldrich) in PBS. Tissue extracts were then pressed through 40 µm cell strainers (BD Biosciences, Franklin Lakes, NJ, U.S.A.) to create single-cell suspensions. After washing with 0.5% BSA in PBS, cells were centrifuged at 250 g for 5 min at room temperature (RT) and the supernatant discarded.

Flow cytometric analysis

PE rat anti-mouse F4/80 (BioLegend, San Diego, CA, U.S.A.), FITC rat anti-mouse CD11b (BD Biosciences), PECy7 rat anti-mouse Ly6G (Gr-1) (BD Biosciences), and all corresponding isotype antibody controls were used. Samples were incubated with primary antibodies for 15 min at RT in the dark. Subsequently, cells were fixed with BD CytofixTM solution (BD Biosciences) following the manufacturer’s instructions. For intracellular staining, cells were permeabilized using Fixation/PermeabilizationTM solution (BD Biosciences) and then incubated with the primary antibody, rabbit anti-mouse AR (Santa Cruz Biotechnology, Dallas, TX, U.S.A.). The detection of immunoreactive sites was performed using a secondary antibody, PE anti-rabbit (Santa Cruz Biotechnology). The analyses were performed using a FACSCanto II Flow Cytometer and FACSDivaTM software v6.1.3 (both from BD Biosciences). Multiparametric analysis was performed to detect the expression of AR and Gr-1 in the subset of activated CD11b+F4/80+ cells. Data were expressed as percentage of positive cells and the expression level in control mice was used as the reference value.

Tissue homogenization and RNA extraction

All mouse liver specimens were cut into small pieces, immediately snap frozen in liquid nitrogen, then stored at −80°C. Livers (10–20 mg) were homogenized by means of Polytron (KINEMATICA AG, Luzern, Switzerland) in 1 ml of TRIzol (Life Technologies Corporation, Carlsbad, U.S.A.) and total RNA was subsequently extracted according to the manufacturer’s instructions. RNA concentrations were quantified spectrophotometrically by means of Nanodrop 2000 (Thermo Scientific, Wilmington, Delaware, U.S.A.). The quality of the RNA isolated was assessed using the RNA 6000 Nano Assay and the Agilent 2100 bioanalyzer (Agilent Technologies, Palo Alto, CA, U.S.A.).

Reverse transcription

For the synthesis of complementary DNA (cDNA), 1 μg of total RNA was reverse transcribed in a final volume of 20 μl with ThermoScriptTM RT-PCR System (Life Technologies).

In a set of experiments, 500 ng of RNA was reverse transcribed in a final volume of 20 μl in the presence of SuperScript™ IV VILO™ Master Mix (Thermo Scientific) or SuperScript™ IV VILO™ Master Mix “No RT” control which was used as blank. The annealing of primers was performed at 25°C for 10 min; the reverse transcription of RNA was performed at 50°C for  10 min with a final step of enzyme inactivation at 85°C for  5 min. The instrument used was a Perkin Elmer GeneAmp PCR System 2400. The cDNA was stored at −20°C.

Real-time PCR

Quantitative real-time polymerase chain reaction (qrt-PCR) for TNF-α, IL-6, IFN-γ, IL-5, and IL-4 was performed in a LightCycler® Instrument (Roche Pleasanton, CA, U.S.A.) and using Platinum® SYBR® Green qPCR SuperMix-UDG (Life Technologies) according to the manufacturer’s instructions. After amplification, relative quantification was performed using the ΔΔCt method normalizing to murine β-actin mRNA. Relative expression levels of target genes were normalized by setting at 1, the value detected in control male mice (primers are listed in Table 1).

Table 1
Sequence of primers used for qrtPCR
Gene Forward Reverse 
β-actin CTAAGGCCAACCGTGAAAAG ACCAGAGGCATACAGGGACA 
IL-4 TGGTGTTCTTCGTTGCTGTG TGGTGTTCTTCGTTGCTGTG 
IL-5 AAGAGAAGTGTGGCGAGGAG CAGTTTTGTGGGGTTTTTGC 
IL-6 ACCAAACTGGATAATCAGGA CCAGGTAGCTATGGTACTCCA 
IFN-γ ATCTGGAGGAACTGGCAAAA TTCAAGACTTCAAAGAGTCTGAGG 
TNF-α TCTTCTCATTCCTGCTTGTGG GGTCTGGGCCATAGAACTGA 
ER-α TGGGCTTACTGACCAACCTG CCTGATCATGGAGGGTCAAA 
Gene Forward Reverse 
β-actin CTAAGGCCAACCGTGAAAAG ACCAGAGGCATACAGGGACA 
IL-4 TGGTGTTCTTCGTTGCTGTG TGGTGTTCTTCGTTGCTGTG 
IL-5 AAGAGAAGTGTGGCGAGGAG CAGTTTTGTGGGGTTTTTGC 
IL-6 ACCAAACTGGATAATCAGGA CCAGGTAGCTATGGTACTCCA 
IFN-γ ATCTGGAGGAACTGGCAAAA TTCAAGACTTCAAAGAGTCTGAGG 
TNF-α TCTTCTCATTCCTGCTTGTGG GGTCTGGGCCATAGAACTGA 
ER-α TGGGCTTACTGACCAACCTG CCTGATCATGGAGGGTCAAA 

Quantitative real-time polymerase chain reaction for CxCL9 and IL-12β was conducted in an ABI 7900 HT Sequence Detection System (Applied Biosystems, Foster City, CA, U.S.A.) using a Taqman Fast Advanced Master Mix (Thermo Scientific). The reaction was performed in 96-well plates, in a 20 μl final volume containing 1 μl of Taqman gene expression assay, 10 μl of Taqman Fast Advanced Master Mix, 5 μl of RNase free water, and 4 μl of 2.5 ng/μl cDNA template. Samples in which the cDNA was omitted were used as negative controls. After one 2 min step at 50°C and a second step at 95°C for 10 min, samples underwent 45 cycles of 15 s at 95°C and then 1 min at 60°C. For the determination of the relative concentration, gene expression was normalized to GAPDH calculated by the change-in-cycling-threshold method as 2−dΔC(t). All tests were performed in duplicate for each sample. Results are presented relative to those of mRNA of oil-treated male mice, set as 1. FAM-MGB Taqman gene expression assays (Thermo Scientific) for mouse CxCL9 (assay ID: Mm00434946_m1), IL-12β (assay ID: Mm01288989_m1), and GAPDH (assay ID: Mm99999915_g1) were chosen. The length of amplicons was, respectively, 64, 63, and 109 bp.

Patients

Ten patients (6 females and 4 males) admitted to the Multivisceral Transplant Unit of the University Hospital of Padova from March 2015 to August 2017 with a diagnosis of DILI were enrolled in the study. Causality of DILI was assessed by the Roussel Uclaf Causality Assessment Method (RUCAM) score [29]. The study was approved by the Ethics Committee for Experimentation of Azienda Ospedaliera Padova (protocol number: 3312/A0/14, last modification June 30, 2016). Participants provided their written informed consent for the study. Enrollment in the study occurred within 14 days after the onset of symptoms. Median age of patients was 47.4 and the drugs involved in DILI were 50% antimicrobials and 50% herbal and dietary supplements, equally distributed between genders. Five healthy subjects were also included as controls (median age 33.1, 60% female).

Isolation of peripheral blood mononuclear cells

Whole blood was collected into K2EDTA tubes (BD Biosciences) from patients and controls at the moment of admission. Samples were kept at 4°C until cell isolation and within 4 h peripheral blood mononuclear cells (PBMCs) were isolated by density centrifugation on Ficoll-Hypaque® gradients (Sigma-Aldrich, Italy). Briefly, blood samples were diluted 1:1 in PBS and gently layered on Ficoll-Hypaque. After centrifugation (20 min at 800 g), the PBMC layer was collected and washed in PBS (300 g for 10 min). Cells were then processed for flow cytometry analysis.

Flow cytometric analyses

A total of 5 × 106 cells/ml were incubated with PeCy5 anti-CD11b (Beckman Coulter, Brea, CA, U.S.A.), PeCy7 anti-human HLA-DR (Becton Dickinson, Milan, Italy), and Alexa 750 anti-human CD33 (Beckman Coulter) for 30 min in the dark at room temperature. Samples were analyzed on a Navios Flow cytometer (Beckman Coulter) by setting appropriate gates and different populations were considered to characterize each sample. In particular, the percentage and maturation degree of monocytes was considered according to Lambert et al. [30]. The analysis was performed by gating CD33+ cells and plotting HLA-DR against CD11b. Unlabeled cells for each patient and controls were first acquired to ensure labeling specificity.

Statistics

The statistical difference among experimental groups was calculated using Student’s t-test after verifying normality of the distribution and the equality of variances. To evaluate the difference between genders at each respective time point, two-way ANOVA was performed. Differences were considered statistically significant for P<0.05. Data are expressed as means ± SD.

Results

The timing of resolution of acute liver damage differs between male and female mice

Intraperitoneal administration of 0.75 ml/kg of CCl4 induced large areas of centrilobular coagulative submassive necrosis in all mice. Morphometric analysis revealed that the damaged areas at day 3 were comparable between male and female animals, 43.3% and 38.9% of parenchyma affected respectively (Figure 1B). Significant differences between gender were visible at day 5 after damage induction: the necrotic area in males occupied 31.27% of the parenchyma, while it was significantly reduced in females to 17.2% of the parenchyma (P<0.05). A conspicuous inflammatory infiltrate was also detectable in both genders (Figure 1A).

Histological analysis and morphometric quantification

Figure 1
Histological analysis and morphometric quantification

(A) Photomicrographs after H&E staining; magnification: ×50. Insets represent higher power images, ×200. (B) Necrosis quantification (%/total area). (C) AST and ALT (U/l) serum determination in mice before CCl4 injection (T0) and after 3, 5, and 8 days from ALI. (D) Quantification of CD68+ macrophage agglomerates/slide; *: P value <0.05, **: P value <0.01 between male and females at the same experimental time point.

Figure 1
Histological analysis and morphometric quantification

(A) Photomicrographs after H&E staining; magnification: ×50. Insets represent higher power images, ×200. (B) Necrosis quantification (%/total area). (C) AST and ALT (U/l) serum determination in mice before CCl4 injection (T0) and after 3, 5, and 8 days from ALI. (D) Quantification of CD68+ macrophage agglomerates/slide; *: P value <0.05, **: P value <0.01 between male and females at the same experimental time point.

Notably in male mice livers at day 8, numerous cell clusters were visible: these cells were CD68 positive and endowed with phagocytic activity as previously demonstrated by our group [27]. These clusters were visible only in male livers and were identified as clusters of macrophage giant cells and Kupffer cells. On the contrary, females at day 8 had a liver histology indistinguishable from the normal one (Figure 1A) while no parenchymal abnormalities were detected in control mice treated with vehicle oil (data not shown). Two-way ANOVA (considering time and gender) revealed the significant influence of time (P<0.001) but not gender (P=0.078) on necrosis. On the contrary, both time and gender were significant factors for CD68 clusters (P<0.001).

AST and ALT were measured in sera of female and male mice, both at T0 and at 3, 5, and 8 days after the induction of ALI. Male mice showed higher values of both AST and ALT, in comparison with female mice at day 3 (P=0.023 and P=0.03 for AST and ALT respectively).

In ALI parenchymal regeneration is not affected by gender

To identify which cell populations were responsible for this gender dimorphism in the liver healing rate, immunohistochemical assays for cell proliferation (pH3), activated stellate cells (α-SMA), and liver progenitor cells (pan-CK) were performed.

The percentage of hepatocytes pH3+ nuclei was evaluated. Overall, the numbers of pH3+ nuclei were lower than 3% in both male and female treated mice. No proliferating hepatocytes were observed in female mice both in the control group and after 3 days of CCl4 injection, but 2% of hepatocytes were positive in males at 3 days. Five days after CCl4 injection, 2% of hepatocytes were pH3+ in males while this figure in females was 2.6%.

Activation of stellate cells was detectable at day 5 both in male and female livers without a significant difference between genders. At day 8, α-SMA+ areas decreased in both with a trend to be higher in males compared with females (Figure 2B). Analysis of pan-CK expression showed no activation of progenitor cells in either sex after ALI (Figure 2C). As expected after a single dose of CCl4, Masson trichrome staining demonstrated no deposition of collagen fibers in the livers of both treated male and female mice (Figure 2D). Two-way ANOVA revealed significant time (P<0.001) but not gender (P=0.59) influences for the activation of stellate cells. Time and gender were not significant factors for progenitor cell activation.

Immunohistochemistry analysis and collagen deposition analysis

Figure 2
Immunohistochemistry analysis and collagen deposition analysis

(A) Left: Representative images of pH3+ hepatocytes (indicated by arrows) in CCl4 treated male and female mice at day 5; magnification: HPF 400×. Right: Quantification of % of pH3+ hepatocytes in control animals and in treated animals at days 3, 5, and 8 from CCl4 injection. (B) α-SMA IHC analysis. Representative images of day 5 are shown. The histogram represents the percentage of α-SMA+ areas of the section/total section area. Immunoreactive sites from vascular regions were excluded. (C) pan-Cytokeratin IHC analysis. Representative images of day 5 are shown. The histogram represents the percentage of sum of pan-CK+ areas of the section/total section area. (D) Collagen deposition analysis. Masson trichrome stain was performed. Representative images of day 5 are shown. No collagen deposition was detected in the sections.

Figure 2
Immunohistochemistry analysis and collagen deposition analysis

(A) Left: Representative images of pH3+ hepatocytes (indicated by arrows) in CCl4 treated male and female mice at day 5; magnification: HPF 400×. Right: Quantification of % of pH3+ hepatocytes in control animals and in treated animals at days 3, 5, and 8 from CCl4 injection. (B) α-SMA IHC analysis. Representative images of day 5 are shown. The histogram represents the percentage of α-SMA+ areas of the section/total section area. Immunoreactive sites from vascular regions were excluded. (C) pan-Cytokeratin IHC analysis. Representative images of day 5 are shown. The histogram represents the percentage of sum of pan-CK+ areas of the section/total section area. (D) Collagen deposition analysis. Masson trichrome stain was performed. Representative images of day 5 are shown. No collagen deposition was detected in the sections.

Gender differences in the inflammatory response to CCl4 injection

In order to evaluate if the infiltrating immune cells could have a role in the differential recovery in male and female CCl4 treated mice, qrt-PCR analysis was performed on total liver RNA homogenates. The expression of TNF-α, IFN-γ, IL-6, IL-5, and IL-4 was evaluated in total liver homogenates of control and CCl4 treated male and female mice. IFN-γ and IL-6 were more highly expressed in control female mice compared with control male mice, 3.4- and 2.3-fold respectively. No gender differences were found in controls for the other cytokines. Moreover, no differences were found in expression of all the cytokines at the three time points in control mice.

In CCl4 treated mice, a prompt up-regulation of IL-6 was observed in female mice at day 3, while no changes were found in male mice at this time. At day 5 there were major differences between genders, with a significant up-regulation of TNF-α (P<0.01) and IL-5 (P<0.01) in male mice, while a significant up-regulation of IL-6 (P<0.05) and IFN-γ (P<0.01) was found in female mice. At day 8 qrt-PCR analysis of female livers revealed a return to basal levels of all the cytokines studied, but there was a significant up-regulation of IL-4 in male livers at this time (Figure 3A). Two-way ANOVA revealed significant gender (P<0.001) and time (P<0.001) differences for the expression of TNF-α, IFN-γ, IL-6, IL-5, and IL-4.

Quantitative real-time PCR

Figure 3
Quantitative real-time PCR

(A) Evaluation of TNF-α, IL-6, IFN-γ, IL-5, and IL-4 mRNA modulation during ALI. Data are expressed as fold changes (2−∆∆Ct) in mRNA expression of target genes normalized to β-actin. Relative expression levels of target genes were normalized by setting at 1 the value detected in control male mice. No significant differences were found among control mice of the three time points. (B) Evaluation of CxCL9 and IL-12β mRNA modulation during ALI. Quantitative RT-PCR analysis on CxCl9 and IL-12β mRNAs performed on total liver homogenates. Results were normalized to those of mRNA encoding GAPDH (calculated by the change-in-cycling-threshold method as 2−dΔC(t)) and are presented relative to those of control male mice, set as 1. Data are presented as mean (± s.d.). *: P value <0.05, **: P value <0.01 between male and females at the same experimental time point.

Figure 3
Quantitative real-time PCR

(A) Evaluation of TNF-α, IL-6, IFN-γ, IL-5, and IL-4 mRNA modulation during ALI. Data are expressed as fold changes (2−∆∆Ct) in mRNA expression of target genes normalized to β-actin. Relative expression levels of target genes were normalized by setting at 1 the value detected in control male mice. No significant differences were found among control mice of the three time points. (B) Evaluation of CxCL9 and IL-12β mRNA modulation during ALI. Quantitative RT-PCR analysis on CxCl9 and IL-12β mRNAs performed on total liver homogenates. Results were normalized to those of mRNA encoding GAPDH (calculated by the change-in-cycling-threshold method as 2−dΔC(t)) and are presented relative to those of control male mice, set as 1. Data are presented as mean (± s.d.). *: P value <0.05, **: P value <0.01 between male and females at the same experimental time point.

The abundance of both CxCL9 and IL-12β mRNA was lower in the livers of males compared with females. As illustrated in Figure 3B, normalizing to the CxCL9 mRNA level found at baseline in control male mice, CxCL9 mRNA progressively decreased in treated male and progressively increased in treated female mice. IL-12β mRNA was found down-regulated by almost 350% at 5 days after CCl4 in female mice compared with control females, reaching levels comparable to those of control male mice; at day 8 females showed a massive up-regulation of the transcript of up to 600%, compared with levels on day 5. Following CCl4 injection, male mice showed a moderate but progressive down-regulation of the IL-12β transcripts.

Influence of sexual hormones in acute liver injury

As the role of AR in an inflamed liver microenvironment is not clear, the expression of AR was investigated by qrt-PCR and Western blot in the total liver of CCl4 treated and control animals. A basal expression of AR mRNA was observed in all animals, with a higher expression in male control mice. The treatment with CCl4 induced a significant increase (P<0.01) in AR only in male mice at day 8 (Figure 4A). Western blot analyses of total liver protein extracts confirmed the up-regulation of the mature protein at day 8 post injection in male mice (Figure 4B).

Evaluation of the expression of the androgen and estrogen receptor in total liver

Figure 4
Evaluation of the expression of the androgen and estrogen receptor in total liver

(A) Quantitative Real-Time PCR for androgen receptor (AR). Data are expressed as fold changes (2−∆∆Ct) in mRNA expression of target genes normalized to β-actin. Relative expression levels of target genes were normalized by setting at 1 the value detected in control male mice. *: P value <0.05 between male and females at the same experimental time point. (B) Western blot of AR. Representative blot at day 8 is shown. Blot with α-GAPDH antibody was used as a control for equal loading. (C) Quantitative Real-Time PCR for estrogen receptor (ER)-α. Data are expressed as fold changes (2−∆∆Ct) in mRNA expression of target genes normalized to β-actin. Relative expression levels of target genes were normalized by setting at 1 the value detected in control male mice.

Figure 4
Evaluation of the expression of the androgen and estrogen receptor in total liver

(A) Quantitative Real-Time PCR for androgen receptor (AR). Data are expressed as fold changes (2−∆∆Ct) in mRNA expression of target genes normalized to β-actin. Relative expression levels of target genes were normalized by setting at 1 the value detected in control male mice. *: P value <0.05 between male and females at the same experimental time point. (B) Western blot of AR. Representative blot at day 8 is shown. Blot with α-GAPDH antibody was used as a control for equal loading. (C) Quantitative Real-Time PCR for estrogen receptor (ER)-α. Data are expressed as fold changes (2−∆∆Ct) in mRNA expression of target genes normalized to β-actin. Relative expression levels of target genes were normalized by setting at 1 the value detected in control male mice.

Quantitative real time PCR for ER-α mRNA showed the expected higher expression of ER in control female mice. The expression of ER-α mRNA was not influenced by CCl4 treatment in either male or female livers (Figure 4C). Two-way ANOVA revealed significant gender (P<0.001) and time (P<0.001) differences for AR expression while no significant change was observed in estrogen receptor (ER) expression.

Infiltrating macrophages are responsible for AR expression

To elucidate the influence of gender on monocyte infiltration following acute injury, total liver cells were extracted by enzymatic digestion and screened by FCM analysis for the myeloid marker CD11b and the F4/80 macrophage antigen. As shown in Figure 5, distinct subsets of intrahepatic monocytes/macrophages were identified: CD11bF4/80high (R1), CD11bF4/80low (R2, resident macrophages), and CD11b+F4/80high (R3, monocyte-derived macrophages). The population CD11bF4/80 (R4) represented all the isolated liver cells not expressing the myeloid/macrophage markers, such as lymphocytes, stellate cells, cholangiocytes, endothelial cells, and dendritic cells.

Characterization of hepatic macrophage phenotype

Figure 5
Characterization of hepatic macrophage phenotype

(A) Flow cytometric detection of CD11b and F4/80 expression on isolated liver cells. Data are reported as percent positive cells normalized to isotype control samples. (B) Quantitative real time PCR on F4/80+CD11b+ and F4/80CD11b sorted cells for AR, TNF-α, IL-5, IL-6, and INF-γ. Data are expressed as fold changes (2−∆∆Ct) in mRNA expression of target genes normalized to β-actin. Relative expression levels of target genes were normalized by setting at 1 the value detected in control male mice. *: P value <0.05, **: P value <0.01 between male and females at the same experimental time point.

Figure 5
Characterization of hepatic macrophage phenotype

(A) Flow cytometric detection of CD11b and F4/80 expression on isolated liver cells. Data are reported as percent positive cells normalized to isotype control samples. (B) Quantitative real time PCR on F4/80+CD11b+ and F4/80CD11b sorted cells for AR, TNF-α, IL-5, IL-6, and INF-γ. Data are expressed as fold changes (2−∆∆Ct) in mRNA expression of target genes normalized to β-actin. Relative expression levels of target genes were normalized by setting at 1 the value detected in control male mice. *: P value <0.05, **: P value <0.01 between male and females at the same experimental time point.

Interestingly, both at days 5 and 8, the infiltration of CD11b+F4/80high cells was different (P<0.05) in males compared with females. These cells, identified as new monocyte-derived macrophages, were more numerous in female livers treated with CCl4, (15.02 ± 1.02% vs 11.13 ± 0.81% in male livers) at day 5, while, in male mice, they were more numerous at day 8 (18.80 ± 1.32% vs 7.33 ± 0.65% in female livers). In both male and female CCl4 treated mice, the resident macrophages (CD11bF4/80high and CD11bF4/80low) decreased compared with control mice and were replaced by monocyte-derived macrophages.

The CD11b+F4/80+ and the CD11bF4/80 populations were isolated by sorting and total RNA was extracted and reverse transcribed. The principal difference that was highlighted by qrt-PCR was that at day 5 the CD11bF4/80 population, isolated from female mice, showed a high expression of IFN-γ and IL-6, while in male livers the most expressed cytokine was IL-5, produced both by CD11b+F4/80+ and CD11b/F4/80 cells. Only at day 8 did the CD11b+F4/80+ monocyte-derived macrophages in male livers express IFN-γ. Moreover, qrt-PCR analysis showed a significantly higher expression of AR after 5 and 8 days in male mice compared with females and controls, and this expression was most notable in the CD11b+F4/80+ population (Figure 5B).

AR signaling regulates the recruitment of Gr-1high monocytes

To further elucidate the influence of AR on monocyte infiltration, total liver cells extracted by enzymatic digestion were screened by FCM analysis for two typical markers of migratory monocytes usually recruited in damaged tissues: Gr1 and CD11b. As shown in Figure 6A, the expression of AR was detected in the fraction of CD11bhighGr-1low/high cells recruited to the liver at day 5 in females and at day 8 in males. The administration of flutamide, an AR antagonist after CCl4 damage, induced in male mice the recruitment of CD11bhighGr1lowAR+ cells at day 3 and the suppression of the recruitment of CD11bhighAR+Gr1high cells. In flutamide treated female mice, no significant differences were detected in CD11bhighAR+Gr1low/high recruitment, although the population was less abundant in flutamide + CCl4 treated females compared with only CCl4 treated mice (Figure 6B).

Flow cytometry analysis of Gr-1+ monocytes

Figure 6
Flow cytometry analysis of Gr-1+ monocytes

FCM analysis of Gr-1 expression in the CD11b+ AR+ subset (R1) in liver cells from BALB/c mice administered with CCl4 alone (A) and in combination with flutamide (B). The expression level of control mice was used as a reference value. * and ** represent Gr-1low and Gr-1high populations respectively. Blue color indicates the subset of CD11bhighAR+/−Gr1high/low. CD11bhighAR+Gr1high were detected at day 5 in liver of treated female mice and at day 8 in male mice. With flutamide, the recruitment of CD11bhighGr1high cells was suppressed in male mice. No significant differences were detected in CD11bhighAR+Gr1high cell recruitment in CCl4 + flutamide treated females compared with only CCl4 treated females, although the population was less abundant. A CD11bhighGr1lowAR+ population was detected at day 3 in male mice, and at day 8 in females; FSC, forward scatter parameter.

Figure 6
Flow cytometry analysis of Gr-1+ monocytes

FCM analysis of Gr-1 expression in the CD11b+ AR+ subset (R1) in liver cells from BALB/c mice administered with CCl4 alone (A) and in combination with flutamide (B). The expression level of control mice was used as a reference value. * and ** represent Gr-1low and Gr-1high populations respectively. Blue color indicates the subset of CD11bhighAR+/−Gr1high/low. CD11bhighAR+Gr1high were detected at day 5 in liver of treated female mice and at day 8 in male mice. With flutamide, the recruitment of CD11bhighGr1high cells was suppressed in male mice. No significant differences were detected in CD11bhighAR+Gr1high cell recruitment in CCl4 + flutamide treated females compared with only CCl4 treated females, although the population was less abundant. A CD11bhighGr1lowAR+ population was detected at day 3 in male mice, and at day 8 in females; FSC, forward scatter parameter.

Monocyte characterization in human DILI

To analyze if gender was correlated to some extent with the circulating monocyte population in patients affected by DILI, PBMCs were isolated by gradient centrifugation and screened for myeloid markers by FCM. The pattern of maturation from monocytic progenitors to mature end-stage cells of the monocytic lineage was characterized. The analysis was performed by gating CD33+ cells and plotting HLA-DR against CD11b. Relative percentages of different populations were calculated based on CD33+ gated cells. Monocytic cells sequentially differentiate from progenitors (CD33+HLA-DR+CD11b) to promonocytes (CD33+HLA-DR+CD11b±) and subsequently into mature monocytes (CD33+HLA-DR+CD11bhigh (Figure 7A). DILI patients compared with healthy controls showed a significant reduction in mature monocytes (Figure 7B). Moreover, comparing male and female DILI patients, a significantly higher number of monocytic progenitors and promonocytes were found in male patients (Figure 7C), while no differences were found in mature monocytes. Of note, 50% of enrolled male patients underwent liver transplantation.

Flow cytometry analysis of human PBMCs

Figure 7
Flow cytometry analysis of human PBMCs

(A) Exemplificative plot of analysis of maturation pattern of the monocytic lineage. The analyses were performed gating CD33+ cells and plotting HLA-DR against CD11b. Monocytic cells sequentially differentiate from progenitors (a) to promonocytes (b) and subsequently into mature monocytes (c). Relative percentages of the different populations were calculated based on CD33+ gated cells. (B) DILI patients compared with healthy controls showed a significant reduction in mature monocytes; no significant differences were detected between gender. (C) Comparing males and females affected by DILI, a significantly higher number of monocyte progenitors and promonocytes were found in male patients.

Figure 7
Flow cytometry analysis of human PBMCs

(A) Exemplificative plot of analysis of maturation pattern of the monocytic lineage. The analyses were performed gating CD33+ cells and plotting HLA-DR against CD11b. Monocytic cells sequentially differentiate from progenitors (a) to promonocytes (b) and subsequently into mature monocytes (c). Relative percentages of the different populations were calculated based on CD33+ gated cells. (B) DILI patients compared with healthy controls showed a significant reduction in mature monocytes; no significant differences were detected between gender. (C) Comparing males and females affected by DILI, a significantly higher number of monocyte progenitors and promonocytes were found in male patients.

Discussion

Liver regeneration after extensive injury is a very complex and well-orchestrated phenomenon. It is carried out by the involvement of all mature liver cell types and the recruitment and activation of immune cells [4]. The liver is recognized as a gender dimorphic organ in mammals, exhibiting sex differences in the profile of steroid and drug metabolism [8], number of hepatocytes and Kuppfer cells [9], and regeneration rate [10,11]. However, the underlying mechanisms are still debated.

In the present study, new evidence emerged on gender differences existing in the innate immune response evoked by acute hepatic injury. We found that the necrotic damage induced by CCl4 is resolved earlier in females compared with males, with evidence that reparative mechanisms are regulated by gender-dependent immune processes.

In the experimental setting of ALI, male mice showed significant alterations of hepatic functionality parameters with higher levels of both AST and ALT when compared with treated female mice. However, with seemingly no difference in hepatocyte proliferation, stellate cells and progenitor cell activation and observing the presence of CD68-positive macrophage giant cells only in male livers, we shifted our attention to the immune system and in particular to the infiltrating monocyte population. Previous data have reported that inflammation could be regulated by sex hormones by modulating the expression of pro- and anti-inflammatory signaling pathways [31,32]. Despite experimental and clinical studies demonstrating that estrogens exert a protective role in the liver, reducing the inflammation and improving hepatic regeneration, in the present study the treatment with CCl4 did not induce alterations in the mRNA expression for the estrogen receptor in male and female livers. Thus, it seems that ER does not have a role in the resolution of liver damage, but further analysis on the localization of ER should be performed.

During liver inflammation, Kupffer cells and resident liver macrophages exert distinctive roles in the initiation, propagation and resolution of acute liver injury. During the initial inflammatory stages, their involvement is crucial for phagocytosing necrotic cells, secreting cytokines/growth factors, and recruiting inflammatory cells [33]. Furthermore, macrophages participate in the reparative phase, promoting hepatic remodeling, and the return to homeostasis [34]. However, if the tissue is severely damaged, residual Kupffer cells and parenchymal cells are activated, stimulating endothelial cells to express adhesion molecules that induce the recruitment from blood into tissue, of effector immune cells, including lymphocytes, neutrophils, and monocytes [35]. In particular, monocytes with their remarkable multipotency in different inflammatory environments, mature into macrophages over a period of 2–3 days and ultimately replace dead Kupffer cells [36].

Upon CCl4 injury, several lines of evidence have demonstrated that extrahepatic inflammatory monocytes (CD11bhighGr-1high) are recruited during the early phase of liver repair to orchestrate the tissue response through CCR2, a specific receptor for the CCL2 ligand, a chemokine released by injured hepatocytes, activated Kupffer cells, hepatic stellate cells, and liver sinusoidal endothelial cells [37,38]. Several studies report that Gr-1high cells exert a pivotal role in shaping the outcome of the immunological response to acute hepatic injury by regulating hepatic macrophage-mediated responses.

Recently, Wang et al. [39] identified a rapid pathway of macrophage recruitment into an injured organ via a nonvascular route requiring no maturation from monocytes. They found that a reservoir of fully mature F4/80highCD11bhighGATA6+ macrophages resident in the peritoneal cavity could rapidly invade the CCl4 damaged liver, via direct recruitment across the mesothelium. Moreover, they demonstrated that without the recruitment of these cells (experimentally depleted by treatment with clodronate) the liver remained injured, unable to repair. These observations suggest that peritoneal macrophages have restorative effects on CCl4 induced liver injury.

In our animal model, we found that F4/80highCD11b+ cells, namely monocyte-derived macrophages, are recruited earlier in the damaged female liver compared with males. We hypothesize that these cells could derive from the peritoneal cavity, although further characterization is ongoing. Moreover, we demonstrated that both monocytes and F4/80highCD11b+ cells expressed and were regulated by AR. Lai et al. [22] found that stimulation of androgen receptors induced an increase in the number of infiltrating monocytes and consequently a higher expression of TNF-α. In their animal model, a high level of TNF-α induced a delay in wound healing. Although we found a higher expression of TNF-α in male livers, like Lai et al., our results suggest that a faster recruitment of monocytes and macrophages is responsible for the faster resolution of damage in females. Indeed, we found that F4/80+CD11b+ macrophages express AR and are recruited at day 5 in the female livers while this recruitment was delayed in male livers. Similarly, we demonstrated that inflammatory Gr-1high monocytes expressed androgen receptors and their infiltration into injured liver was under the direct control of AR signaling in males, based on the fact that the recruitment of CD11bhighAR+Gr-1high cells was suppressed in male mice when AR inhibition was induced with flutamide. In contrast, the infiltration of CD11bhighAR+Gr-1high cells was not significantly affected by flutamide in females.

In experimental models of ALI, the progression from the early hepatotoxic stage to a late regenerative stage is dictated by the balance between pro- and anti-inflammatory mediators, locally released following the activation of immune cells [40]. Liver regeneration involves a highly complex interplay of signals deriving from the networks of cytokines, growth factors, and metabolites. Among the cytokines, TNF-α and IL-6 reflect the liver inflammatory status acting as initiators of liver regeneration [34]. During liver injury caused by hepatotoxins, higher levels of TNF-α are commonly associated with more severe liver injury, while the increased expression of IL-6 is reported to stimulate rescue factors, to reduce/inhibit proinjury factors, and to control the activation state of stellate cells [41]. In our model, the predominant TNF-α response observed in CCl4 treated male mice is clearly indicative of an impaired control of liver regeneration, suggesting that a cytotoxic subset of immune cells is predominant in males in comparison with females and could negatively regulate the activation of cells that aid regeneration, as previously reported [42]. Moreover, the greater expression of IL-5 and IL-4 in males suggested a significant contribution of eosinophils and Th2 lymphocytes as effector cells in the liver’s response. On the contrary, female mice expressed more IL-6, even in controls. This suggests that the female liver is already primed to respond to acute damage, promptly triggering all the phases of liver regeneration. The qrt-PCR analysis performed on sorted CD11b+F4/80+ and the CD11bF4/80 populations supports this hypothesis. Indeed, at day 5 the CD11bF4/80 population, representing parenchymal cells, isolated from female mice, showed a high expression of the proresolution cytokines IFN-γ and IL-6. This suggests that parenchymal cells and Th1 lymphocytes of female mice are able to promptly start the regeneration process. On the contrary, in male livers, IL-5 was the most abundant cytokine expressed by the CD11bF4/80 population and only at day 8 did CD11b+ F4/80+ monocyte-derived macrophages express IFN-γ, presumably promoting regeneration.

Considering TLR4-responsive genes, exemplified by the monokine induced by IFN-γ (Mig/CxCL9), a Th1 cell chemoattractant, a progressive and gradual accumulation of CxCL9 mRNA in female mice after CCl4-induced hepatic injury with an opposite trend in treated male mice was observed. The particular finding in male mice, despite the presence of an important TNF-α response, as suggested by qrt-PCR data, may be explained in the light of a recent paper by Donlin and colleagues [43], in which it was demonstrated that an opposite microenvironment counterpart, namely fibroblasts, simultaneously suppress expression of IFN-inducible genes such as CxCL9, part of the classic activation (M1) phenotype, partially shifting the polarization pattern of macrophages toward an M2 phenotype. Mixed macrophage phenotypes simultaneously expressing subsets of M1 and M2 genes are common in complex inflammatory settings in vivo, and this could have happened in our treated male mice. Of course, further experiments are needed to confirm this hypothesis.

In the presence of TLR ligands and IFN-γ, as observed at the mRNA level in our ALI model, particularly at day 5, the literature suggests that macrophages adopt a “M1-like” profile with high expression levels of proinflammatory cytokines, including IL-12 and IL-23 [44]. Our data on IL-12β mRNA (Figure 3B), showing its increase in treated female mice from days 5 to 8 after ALI, are suggestive of the presence of activated M1-like macrophages which accumulate over time. Our observation that control females showed an higher abundance of IL-12β mRNA compared with treated females at day 5 may be explained by the fact that the vehicle itself could have had a slight proinflammatory affect providing a stimulus for macrophage activation. Treated male mice were characterized by a progressive decrease over time in IL-12β mRNA, while control male mice, compared with female control mice, showed less expression of IL-12β mRNA. Overall, these data suggest a reduced population of activated macrophages in males at 5 to 8 days after ALI establishment.

Scotland et al. [45] demonstrated that the number of leukocytes occupying the naive peritoneal and pleural cavities is higher in female mice and rats than in males. On the other hand, female mice and rats have an increased population of resident anti-inflammatory T lymphocytes that selectively prevent excessive macrophage-derived cytokine production without affecting phagocytosis. These characteristics induce in female mice a more efficient immune response to different inflammatory stimuli. This theory fits with our results but further experiments should be performed to confirm this. To understand what happens outside the injured liver, at the time when maximal macrophage activity is required for resolution of damage, we turned our attention to the circulation. Indeed, to expand our in vivo murine model observations, we analyzed circulating monocytes in patients with DILI. Preliminary evidence from the DILI study showed that although female patients have a greater risk of developing the disease, male patients seem to have the worst prognosis (with 50% of male patients requiring liver transplantation). Analysis of PBMCs in DILI patients showed a significant reduction of mature monocytes (monocytopenia) in comparison with healthy subjects, both in males and females, in accordance with data published by Moore et al. [28]. These changes are seemingly due to an avid monocyte recruitment into the liver. This hypothesis is supported by the demonstration that a significant increase in monocyte numbers is observed in livers removed after emergency transplantation in patients with paracetamol-induced DILI [46]. The same study demonstrated that this massive leukocyte infiltration of the injured liver corresponds to depletion and dysfunction of immune cells in the circulation. Indeed, an inverse correlation between the number of monocytes in the blood and the severity of liver damage was observed.

Severe inflammation and stress stimulate the production of monocytes in the BM and when this is substantial, premature release of immature cells into the bloodstream occurs [47,48]. This dysfunction in monocyte maturation and release is probably mediated by TNF [49]. Moreover, it was demonstrated that these immature monocytes produce more inflammatory cytokines, exacerbating the inflammation [49]. In the cohort of patients affected by DILI reported in our study and dissected according to gender, a significantly higher number of monocyte progenitors and promonocytes were found in males, while no differences in mature monocytes were seen, suggesting a higher turnover and a dysfunction in monocyte maturation in males. Our hypothesis is that male DILI patients have more inflamed livers than females, sustained by a higher release of proinflammatory immature monocytes. Unfortunately, we cannot test our hypothesis by studying liver biopsies, since this procedure is not performed routinely in Padova Hospital in the evaluation of DILI. An alternative strategy to substantiate our hypothesis is under evaluation.

Conclusion

As in most other organs, mild inflammation in the liver is designed to protect hepatocytes from injury, to favor the repair of tissue damage, and to promote the re-establishment of homeostasis; excessive inflammation on the other hand may exacerbate the severity of damage and the balance in this cytokine storm is strictly dependent upon microenvironmental cues emanating from the injured liver.

Altogether, data in the present study indicate that a different immune response (in terms of the composition and maturation status of the cells involved) in males and females influences liver regeneration. We found that after an acute liver injury both monocytes and F4/80highCD11bhigh cells were recruited to damaged tissue and that both expressed and were regulated by AR. The recruitment of these cell populations was more rapid in females and we found that the delay in male mice was directly controlled by AR. Indeed, by blocking AR with flutamide, a recruitment rate comparable with female animals was found in male mice. Moreover, when considering the role of the microenvironment in contributing to regeneration, we found a higher expression of TNF-α and cytotoxic mediators in male livers that might exacerbate the tissue damage, while in female mice the higher expression of IL-6 and IFN-γ might indicate a proresolutive environment.

Evidence from patients with DILI extend these observations suggesting that males are disadvantaged with respect to acute liver injury, possibly related to a maturation shift in monocytes. Such cells could be potential targets for novel therapeutic approaches, with implications for the management of liver pathology in clinical practice.

Clinical perspectives

  • The increased susceptibility to acute response in males has been suggested in some pathological conditions to depend on immunosuppression or the modulation by androgens of the Th1 and Th2 cell-mediated immune responses. Moreover, recent studies with androgen receptor (AR) knockout mice (ARKO) have demonstrated that androgen/AR signaling regulates the development of several lineages of immune cell types including neutrophils, macrophages, and lymphocytes.

  • We explored gender differences in the pathophysiology of acute liver injury (ALI), both in mice and in patients diagnosed with drug induced liver injury (DILI), with implications for the treatment of this pathology in clinical practice and identifying the essential role of liver macrophages in tissue homeostasis, suggesting them as prime targets for novel therapeutic approaches.

Authors are grateful to Marina Minnaja Foundation for co-funding Dr Marika Crescenzi PhD and Dr Debora Bizzaro post-doctoral fellowship.

Competing Interests

The authors declare that there are no competing interests associated with the manuscript.

Funding

This work was supported by Ex 60% grants, Athenaeum Project 2008 (CPDA089273/08) and 2014 (CPDA141459/14), from the Padova University.

Author Contribution

F.P.R.: conception and design of the study; generation, assembly, analysis, and interpretation of data; drafting, revision, and final approval of the manuscript; D.B., R.D.L., and M.C.: writing the manuscript; M.C and D.B.: revision of the manuscript; D.B., M.C. V.A.: animal experiments, generation, assembly, and analysis of histological data; T.B, R.D.L., and A.T.: generation, collection, and assembly of FCM data on mice samples; A.C., D.A., and M.C.: collection and assembly of WB and qPCR data; G.G: recruitment of DILI patients; D.B., C.F., and G.B.: generation, collection, and assembly of FCM data on human PBMCs; M.T.C: generation, collection, assembly, analysis, and interpretation of histology data; P.P.P.: approval of the final version of the manuscript; M.R.A.: substantial revision of the manuscript and approval of the final version; P.B. and M.T.C.: revision of the manuscript and approval of the final version of the manuscript. A.S. and V.B.: generation of serological data on mice samples.

Abbreviations

     
  • α-SMA

    α-smooth muscle actin

  •  
  • ALI

    acute liver injury

  •  
  • ANOVA

    analysis of variance

  •  
  • AR

    androgen receptor

  •  
  • ARKO

    androgen receptor knockout mice

  •  
  • BSA

    bovine serum albumin

  •  
  • CCl4

    carbon tetrachloride

  •  
  • CCL2

    chemokine, CC motif, ligand 2 (also known as MCP-1)

  •  
  • CCR2

    chemokine, CC motif, receptor 2

  •  
  • CD

    cluster of differentiation

  •  
  • DILI

    drug induced liver injury

  •  
  • ER

    estrogen receptor

  •  
  • FACS

    fluorescence-activated cell sorting

  •  
  • FCM

    flow cytometry

  •  
  • FITC

    fluorescein isothiocyanate

  •  
  • HPF

    high-power fields

  •  
  • IFN-γ

    interferon-γ

  •  
  • IL

    interleukin

  •  
  • i.p.

    intraperitoneal

  •  
  • PAS-D

    periodic acid–Schiff-diastase

  •  
  • PBS

    phosphate-buffered saline

  •  
  • PBMC

    peripheral blood mononuclear cells

  •  
  • PE

    phycoerythrin

  •  
  • PE-Cy

    phycoerythrin-cyanine

  •  
  • pH3

    phospho-histone H3

  •  
  • qrt-PCR

    quantitative real-time PCR

  •  
  • RT

    room temperature

  •  
  • RUCAM

    Roussel Uclaf Causality Assessment Method

  •  
  • SD

    standard deviation

  •  
  • TNF-α

    tumor necrosis factor-α

  •  
  • WT

    wild-type

References

References
1
Forbes
S.J.
and
Rosenthal
N.
(
2014
)
Preparing the ground for tissue regeneration: from mechanism to therapy
.
Nat. Med.
20
,
857
869
[PubMed]
2
Boulton
R.A.
,
Alison
M.R.
,
Golding
M.
,
Selden
C.
and
Hodgson
H.J.
(
1998
)
Augmentation of the early phase of liver regeneration after 70% partial hepatectomy in rats following selective Kupffer cell depletion
.
J. Hepatol.
29
,
271
280
[PubMed]
3
Goh
Y.P.
,
Henderson
N.C.
,
Heredia
J.E.
,
Red Eagle
A.
,
Odegaard
J.I.
,
Lehwald
N.
et al. 
(
2013
)
Eosinophils secrete IL-4 to facilitate liver regeneration
.
Proc. Natl. Acad. Sci. U.S.A.
110
,
9914
9919
4
Michalopoulos
G.K.
and
DeFrances
M.C.
(
1997
)
Liver regeneration
.
Science
276
,
60
66
[PubMed]
5
Kubes
P.
and
Mehal
W.Z.
(
2012
)
Sterile Inflammation in the Liver
.
Gastroenterology
143
,
1158
1172
[PubMed]
6
Schattenberg
J.M.
,
Galle
P.R.
and
Schuchmann
M.
(
2006
)
Apoptosis in liver disease
.
Liver Int.
26
,
904
911
[PubMed]
7
Iwaisako
K.
,
Brenner
D.A.
and
Kisseleva
T.
(
2012
)
What's new in liver fibrosis? The origin of myofibroblasts in liver fibrosis
J. Gastroenterol. Hepatol.
27
,
65
68
[PubMed]
8
Yates
F.E.
,
Herbst
A.L.
and
Urquhart
J.
(
1958
)
Sex difference in rate of ring A reduction of delta 4-3-keto-steroids in vitro by rat liver
.
Endocrinology
63
,
887
902
[PubMed]
9
Marcos
R.
,
Lopes
C.
,
Malhão
F.
,
Correia-Gomes
C.
,
Fonseca
S.
,
Lima
M.
et al. 
(
2016
)
Stereological assessment of sexual dimorphism in the rat liver reveals differences in hepatocytes and Kupffer cells but not hepatic stellate cells
.
J. Anat.
228
,
996
1005
[PubMed]
10
Tsukamoto
I.
and
Kojo
S.
(
1990
)
The sex difference in the regulation of liver regeneration after partial hepatectomy in the rat
.
Biochim. Biophys. Acta
1033
,
287
290
[PubMed]
11
Imamura
H.
,
Shimada
R.
,
Kubota
M.
,
Matsuyama
Y.
,
Nakayama
A.
,
Miyagawa
S.
et al. 
(
1999
)
Preoperative portal vein embolization: an audit of 84 patients
.
Hepatology
29
,
1099
1105
[PubMed]
12
Choudhry
M.A.
,
Schwacha
M.G.
,
Hubbard
W.J.
,
Kerby
J.D.
,
Rue
L.W.
,
Bland
K.I.
et al. 
(
2005
)
Gender differences in acute response to trauma-hemorrhage
.
Shock
24
,
101
106
[PubMed]
13
Gilliver
S.C.
,
Wu
F.
and
Ashcroft
G.S.
(
2003
)
Regulatory roles of androgens in cutaneous wound healing
.
Thromb. Haemost.
90
,
978
985
[PubMed]
14
Gilliver
S.C.
,
Ruckshanthi
J.P.D.
,
Hardman
M.J.
,
Nakayama
T.
and
Ashcroft
G.S.
(
2008
)
Sex dimorphism in wound healing: the roles of sex steroids and macrophage migration inhibitory factor
.
Endocrinology
149
,
5747
5757
[PubMed]
15
Grossman
C.
(
1989
)
Possible underlying mechanisms of sexual dimorphism in the immune response, fact and hypothesis
.
J. Steroid Biochem.
34
,
241
251
[PubMed]
16
Olsen
N.J.
and
Kovacs
W.J.
(
1996
)
Gonadal steroids and immunity
.
Endocr. Rev.
17
,
369
384
[PubMed]
17
Falkenstein
E.
,
Tillmann
H.C.
,
Christ
M.
,
Feuring
M.
and
Wehling
M.
(
2000
)
Multiple actions of steroid hormones–a focus on rapid, nongenomic effects
.
Pharmacol. Rev.
52
,
513
556
[PubMed]
18
Beato
M.
(
1989
)
Gene regulation by steroid hormones
.
Cell
56
,
335
344
[PubMed]
19
Wichmann
M.W.
,
Angele
M.K.
,
Ayala
A.
,
Cioffi
W.G.
and
Chaudry
I.H.
(
1997
)
Flutamide: a novel agent for restoring the depressed cell-mediated immunity following soft-tissue trauma and hemorrhagic shock
.
Shock
8
,
242
248
[PubMed]
20
Whitacre
C.C.
,
Reingold
S.C.
and
O’Looney
P.A.
(
1999
)
A gender gap in autoimmunity
.
Science
283
,
1277
1278
[PubMed]
21
Chuang
K.H.
,
Altuwaijri
S.
,
Li
G.
,
Lai
J.J.
,
Chu
C.Y.
,
Lai
K.P.
et al. 
(
2009
)
Neutropenia with impaired host defense against microbial infection in mice lacking androgen receptor
.
J. Exp. Med.
206
,
1181
1199
[PubMed]
22
Lai
J.J.
,
Lai
K.P.
,
Chuang
K.H.
,
Chang
P.
,
Yu
I.C.
,
Lin
W.J.
et al. 
(
2009
)
Monocyte/macrophage androgen receptor suppresses cutaneous wound healing in mice by enhancing local TNF-alpha expression
.
J. Clin. Invest.
119
,
3739
3751
[PubMed]
23
Francavilla
A.
,
Eagon
P.K.
,
DiLeo
A.
,
Polimeno
L.
,
Panella
C.
,
Aquilino
A.M.
et al. 
(
1986
)
Sex hormone-related functions in regenerating male rat liver
.
Gastroenterology
91
,
1263
1270
[PubMed]
24
Yamaguchi
M.
,
Yu
L.
,
Nazmy El-Assal
O.
,
Satoh
T.
,
Kumar Dhar
D.
,
Yamanoi
A.
et al. 
(
2001
)
Androgen metabolism in regenerating liver of male rats: evidence for active uptake and utilization of testosterone
.
Hepatol. Res.
20
,
114
127
[PubMed]
25
Kamal
M.M.
and
Omran
O.M.
(
2013
)
The role of heat shock protein 70 induced by geranylgeranylacetone in carbon tetrachloride-exposed adult rat testes
.
Pathophysiology
20
,
139
146
[PubMed]
26
Saima
Y.
and
Friedman
S.L.
(
2012
)
The role of chemokines in acute liver injury
.
Front. Physiol.
3
,
213
[PubMed]
27
Burra
P.
,
Arcidiacono
D.
,
Bizzaro
D.
,
Chioato
T.
,
Di Liddo
R.
,
Banerjee
A.
et al. 
(
2012
)
Systemic administration of a novel human umbilical cord mesenchymal stem cells population accelerates the resolution of acute liver injury
.
BMC Gastroenterol.
12
,
88
[PubMed]
28
Moore
J.K.
,
MacKinnon
A.C.
,
Man
T.Y.
,
Manning
J.R.
,
Forbes
S.J.
and
Simpson
K.J.
(
2017
)
Patients with the worst outcomes after paracetamol (acetaminophen)-induced liver failure have an early monocytopenia
.
Aliment. Pharmacol. Ther.
45
,
443
454
[PubMed]
29
Danan
G.
and
Benichou
C.
(
1993
)
Causality assessment of adverse reactions to drugs-I. A novel method based on the conclusions of International Consensus Meeting: application to drug-induced liver injuries
.
J. Clin. Epidemiol.
46
,
1323
1330
[PubMed]
30
Lambert
C.
,
Preijers
F.W.M.B.
,
Yanikkaya Demirel
G.
and
Sack
U.
(
2017
)
Monocytes and macrophages in flow: an ESCCA initiative on advanced analyses of monocyte lineage using flow cytometry
.
Cytometry B Clin. Cytom.
92
,
180
188
[PubMed]
31
Lan
T.J.
(
2004
)
Estrogen as an immunomodulator
.
Clin. Immunol.
113
,
224
230
[PubMed]
32
Olsen
N.J.
and
Kovacs
W.J.
(
2001
)
Effects of androgens on T and B lymphocyte development
.
Immunol. Res.
23
,
281
288
[PubMed]
33
Gabrilovich
D.I.
and
Nagaraj
S.
(
2009
)
Myeloid-derived suppressor cells as regulators of the immune system
.
Nat. Rev. Immunol.
9
,
162
174
[PubMed]
34
Duffield
J.S.
,
Forbes
S.J.
,
Constandinou
C.M.
,
Clay
S.
,
Partolina
M.
,
Vuthoori
S.
et al. 
(
2005
)
Selective depletion of macrophages reveals distinct, opposing roles during liver injury and repair
.
J. Clin. Invest.
115
,
56
65
[PubMed]
35
Kim
N.D.
and
Luster
A.D.
(
2015
)
The role of tissue resident cells in neutrophil recruitment
.
Trends Immunol.
36
,
547
555
[PubMed]
36
Blériot
C.
,
Dupuis
T.
,
Jouvion
G.
,
Eberl
G.
,
Disson
O.
and
Lecuit
M.
(
2015
)
Liver-resident macrophage necroptosis orchestrates type 1 microbicidal inflammation and type-2-mediated tissue repair during bacterial infection
.
Immunity
42
,
145
158
[PubMed]
37
Saiman
Y.
and
Friedman
S.L.
(
2012
)
The role of chemokines in acute liver injury
.
Front. Physiol.
3
,
21
[PubMed]
38
Zimmermann
H.W.
,
Trautwein
C.
and
Tacke
F.
(
2012
)
Functional role of monocytes and macrophages for the inflammatory response in acute liver injury
.
Front. Physiol.
3
,
56
[PubMed]
39
Wang
J.
and
Kubes
P.
(
2016
)
A reservoir of mature cavity macrophages that can rapidly invade visceral organs to affect tissue repair
.
Cell
16
,
668
678
40
Antoniades
C.G.
,
Berry
P.A.
,
Wendon
J.A.
and
Vergani
D.
(
2008
)
The importance of immune dysfunction in determining outcome in acute liver failure
.
J. Hepatol.
49
,
845
861
[PubMed]
41
Galun
E.
and
Axelrod
J.H.
(
2002
)
The role of cytokines in liver failure and regeneration: potential new molecular therapies
.
Biochim. Biophys. Acta – Mol. Cell. Res.
1592
,
345
358
42
Zganiacz
A.
,
Santosuosso
M.
,
Wang
J.
,
Yang
T.
,
Chen
L.
,
Anzulovic
M.
et al. 
(
2004
)
TNF-alpha is a critical negative regulator of type 1 immune activation during intracellular bacterial infection
.
J. Clin. Invest.
113
,
401
413
[PubMed]
43
Donlin
L.T.
,
Jayatilleke
A.
,
Giannopoulou
E.G.
,
Kalliolias
G.D.
and
Ivashkiv
L.B.
(
2014
)
Modulation of TNF-induced macrophage polarization by synovial fibroblasts
.
J Immunol.
193
,
2373
2383
[PubMed]
44
Possamai
L.A.
,
Thursz
M.R.
,
Wendon
J.A.
and
Antoniades
C.G.
(
2014
)
Modulation of monocyte/macrophage function: A therapeutic strategy in the treatment of acute liver failure
.
J. Hepatol.
61
,
439
445
[PubMed]
45
Scotland
R.S.
,
Stables
M.J.
,
Madalli
S.
,
Watson
P.
and
Gilroy
D.W.
(
2011
)
Sex differences in resident immune cell phenotype underlie more efficient acute inflammatory responses in female mice
.
Blood
24
,
5918
5927
46
Antoniades
C.
,
Quaglia
A.
,
Taams
L.S.
,
Mitry
R.R.
,
Hussain
M.
,
Abeles
R.
et al. 
(
2012
)
Source and characterization of hepatic macrophages in acetaminophen-induced acute liver failure in humans
.
Hepatology
56
,
735
746
[PubMed]
47
Sunderkötter
C.
,
Nikolic
T.
,
Dillon
M.J.
,
Van Rooijen
N.
,
Stehling
M.
,
Drevets
D.A.
et al. 
(
2004
)
Subpopulations of mouse blood monocytes differ in maturation stage and inflammatory response
.
J. Immunol.
172
,
4410
4417
[PubMed]
48
Powell
N.D.
,
Sloan
E.K.
,
Bailey
M.T.
,
Arevalo
J.M.
,
Miller
G.E.
,
Chen
E.
et al. 
(
2013
)
Social stress up-regulates inflammatory gene expression in the leukocyte transcriptome via β-adrenergic induction of myelopoiesis
.
Proc. Natl. Acad. Sci. U.S.A.
110
,
16574
16579
49
Puchta
A.
,
Naidoo
A.
,
Verschoor
C.P.
,
Loukov
D.
,
Thevaranjan
N.
,
Mandur
T.S.
et al. 
(
2016
)
TNF drives monocyte dysfunction with age and results in impaired anti-pneumococcal immunity
.
PLoS Pathog.
12
,
e1005368
[PubMed]

Author notes

*

These authors contributed equally to this work.