Abdominal obesity and/or a high intake of fructose may cause hypertension. K+ channels, Na/K-ATPase, and voltage-gated Ca2+ channels are crucial determinants of resistance artery tone and thus the control of blood pressure. Limited information is available on the role of K+ transporters in long-term diet-induced hypertension in rats. We hypothesized that a 28-week diet rich in fat, fructose, or both, will lead to changes in K+ transporter expression and function, which is associated with increased blood pressure and decreased arterial function. Male Sprague–Dawley (SD) rats received a diet containing normal chow (Control), high-fat chow (High Fat), high-fructose in drinking water (High Fructose), or a combination of high-fat and high-fructose diet (High Fat/Fruc) for 28 weeks from the age of 4 weeks. Measurements included body weight (BW), systolic blood pressure (SBP), mRNA expression of vascular K+ transporters, and vessel myography in small mesenteric arteries (SMAs). BW was increased in the High Fat and High Fat/Fruc groups, and SBP was increased in the High Fat/Fruc group. mRNA expression of small conductance calcium-activated K+ channel (SKCa), intermediate conductance calcium-activated K+ (IKCa), and Kir2.1 inward rectifier K+ channels were reduced in the High Fat/Fruc group. Reduced endothelium-derived hyperpolarization (EDH)-type relaxation to acetylcholine (ACh) was seen in the High Fat and High Fat/Fruc groups. Ba2+-sensitive dilatation to extracellular K+ was impaired in all the experimental diet groups. In conclusion, reduced expression and function of SKCa, IKCa, and Kir2.1 channels are associated with elevated blood pressure in rats fed a long-term High Fat/Fruc. Rats fed a 28-week High Fat/Fruc provide a relevant model of diet-induced hypertension.

Introduction

Hypertension is associated with a markedly increased risk of cardiovascular mortality and morbidity in the form of congestive heart failure, coronary artery disease, renal failure, vascular dementia, or stroke. One of the hallmarks of hypertension is an increase in the total peripheral resistance (TPR) mainly caused by an increased tone in small systemic arteries and arterioles [1]. K+ channels control the resting membrane potential in vascular endothelial cells (ECs) and vascular smooth muscle cells (VSMCs) [2]. The membrane potential in turn controls the activity of voltage-dependent Ca2+ channels (mainly L-type) and the intracellular Ca2+ concentration, which determines the degree of contraction of VSMCs in situ by regulating the phosphorylation state of the 20-kDa subunit of the myosin light chain. Consequently, the expression level and functional state of small artery K+ channels are of critical importance for setting TPR and mean arterial blood pressure (MAP). A variety of different subtypes of K+ channels are expressed in ECs and/or VSMCs of small arteries and arterioles including KCa (Ca2+-activated), Kir (‘classical’ inward rectifier), KATP (ATP-dependent), and KV (voltage-dependent) channels [2,3]. Previous studies suggested that the expression and/or function of small artery K+ channels were changed in experimental models of hypertension, obesity, and diabetes. However, the degree and nature of the changes varied between different models and vascular beds [4–11].

Abdominal or visceral obesity has been linked to several pathological conditions including type-2 diabetes, ischemic heart disease, myocardial infarction, chronic renal failure, and cerebrovascular diseases [12–19]. The consumption of high amounts of sugar (e.g. corn syrup in soft drinks) has increased significantly in parallel with the global ‘ obesity epidemic’. Interestingly, studies have shown that a high intake of fructose can cause hypertension independent of obesity. One possible explanation for this is that the metabolism of fructose ultimately leads to increased production of uric acid and reactive oxygen species that in turn cause endothelial dysfunction and increased blood pressure [20–22]. Thus, both abdominal obesity and excess fructose ingestion are highly relevant for the public health management of cardiovascular disease. Commonly used rat models of obesity and hypertension are based on breeding for certain genetic traits. Examples include Zucker Obese and Zucker Diabetic Fatty rats that develop central leptin deficiency leading to hyperphagia and obesity, or spontaneously hypertensive rats that develop sustained hypertension at the age of 2–3 months. However, such models may not reflect the true complexity and multifactorial facets in development of obesity and hypertension in humans. It is plausible that human obesity-related hypertension is better reflected by rats that develop diet-induced obesity by eating an energy-rich diet during an extended period of time.

In the present study, we therefore decided to evaluate outbred Sprague–Dawley (SD) rats exposed to a diet rich in fat and/or fructose as potential models of diet-induced hypertension. We furthermore aimed to mimic the chronic aspect of the disease by maintaining the diets for a more extended duration of 28 weeks [23–25], contrary to many previous studies using shorter diet durations (8–16 weeks) [26–32]. Our experiments were guided by the hypothesis that chronic diet-induced hypertension is associated with alterations in the expression and/or function of K+ channels in small arteries, which leads to deleterious changes in vascular function in small resistance-sized arteries and an increased TPR. Experiments included measurements of systolic blood pressure (SBP) as an alternative to MAP, quantitation of K+ channel, L-type channel, and Na/K-ATPase transcript levels, as well as endothelial- and smooth muscle-dependent vasomotor responses in small mesenteric arteries (SMAs). Our results indicated that increased blood pressure follows a diet rich in fat and fructose, but not increased body weight (BW) per se, and that a reduced expression and impaired function of small conductance calcium-activated K+ channel (SKCa), intermediate conductance calcium-activated K+ channel (IKCa), and Kir2.1 inward rectifier K+ channels may serve to explain diet-induced hypertension.

Methods

Animals and diets

All experiments and care of animals were approved by the Animal Experiments Inspectorate of the Danish Ministry of Justice. A total of 85 male, SD rats (Taconic, L. Skensved, Denmark) entered the study. Young (4 weeks) rats were randomly divided into six groups, of which three were exposed to experimental diets and the remaining three served as age-matched controls (Control; n=31). The first diet group (High Fat; n=18) received a high-fat chow (60 kcal/100 kcal saturated fat, D12492, Research Diets, New Brunswick, U.S.A.) and drinking water. The second diet group (High Fructose; n=18) was fed normal rat chow (13 kcal/100 kcal saturated fat, Altromin 1319, Brogaarden, Lynge, Denmark) and drinking water, to which 10% fructose was added (F0127, Sigma–Aldrich, Brøndby, Denmark). The third diet group (High Fat/Fruc; n=18) received both the high-fat diet and 10% fructose in the drinking water. To avoid bacterial growth, citric acid was added to the water for all groups. The diets were maintained for a total of 28 weeks, beginning at age of 4 weeks until the age 32 weeks. Each diet group was compared with a corresponding age-matched Control group fed normal chow and drinking water, and both water and chow were given ad libitum to all the groups. The diet and Control groups were kept in cages adjacent to each other and received simultaneous feeding and cleaning procedures to minimize handling bias. An extra age-matched Control group (32 weeks; n=8) was added to the study to perform additional pressure myograph experiments (flow-mediated and K+-induced dilatations).

SBP and BW

BW was measured weekly, and SBP was measured every 2 weeks using the tail-cuff method. For SBP determinations, the High Fructose group (n=10) was matched with Control group 1 (n=8), the High Fat group (n=10) was matched with Control group 2 (n=7), and the High Fat/Fructose group (n=10) was matched with Control group 3 (n=8). For all other determinations, Control rats were pooled. For SBP measurements, rats were placed in a restrainer and maintained at constant ambient temperature (32°C) (Model 303SC, IITC Inc., Woodland Hills, CA). A tail-cuff, which consisted of a metal tube lined with a thin, inflatable rubber bladder, a light source, and a photocell sensor, was placed at the base of the tail. The tail-cuff was connected to a cuff pump (Model 31, IITC Inc.) and a semiautomatic blood pressure analyzer. The cuff was inflated to a pressure exceeding expected SBP (approx. 210 mmHg), and was subsequently deflated over 30 s. Recordings of the blood pressure pulsations during this 30-s period was stored on a PC for later offline analysis. The SBP was determined as the blood pressure at which pulsations returned during cuff deflation. Rats were accustomed to these SBP measurements from the first diet week in order to minimize the influence of stress on the SBP recordings.

Tissue preparation and pressure myography

At study’s end, rats were anesthetized with isoflurane and subsequently killed by cervical dislocation. The small intestine was excised and transferred to a dissection dish filled with cold (4°C) dissection buffer containing (in mM): NaCl 135, KCl 5, MgSO4 1, HEPES 10, CaCl2 1, glucose 5, and BSA (5 g/l), pH adjusted to 7.4. SMAs (second and third order) supplying the ileum were dissected free from fat and connective tissue, mounted in a pressure myograph (Model 120 CP, Danish Myotechnology A/S (DMT), Aarhus, Denmark), and superfused with Krebs’ buffer at 37°C containing (in mM): NaCl 118, KCl 4.7, MgSO4 1.2, CaCl2 2, NaHCO3 25, and KH2PO4 1.2. All myography buffers contained 5 mM glucose and were aerated with 95% O2 and 5% CO2 to keep a constant pH at 7.4 (as validated by in situ measurements in the myograph chamber). The intraluminal perfusate for pressure myograph experiments was prepared from aerated Krebs’ buffer to which 1% low-endotoxin BSA (Sigma–Aldrich) was added. The vessels were tied on to the microcannulas using 11-0 nylon suture, an intraluminal pressure of 30 mmHg was initially applied, and the myograph was placed on the stage of an inverted Olympus IX71 microscope (Olympus Danmark A/S, Ballerup, Denmark). The vessels were visualized through a high-quality quartz objective (UPlanFL N, 4X/0.13, Olympus) and the lumen (inner) plus vessel (outer) diameters were measured using a USB camera and Myoview II software (both DMT). To avoid bending, vessels were gently stretched at pressures of 30, 50, and 70 mmHg while maintaining a longitudinal force measurement between 0.1 and 0.35 mN. In order to avoid leakage, it was ensured that the difference between inlet and outlet pressures did not exceed 1–2 mmHg under no-flow conditions at 70 mmHg. The pressure was then lowered to 60 mmHg, the intraluminal flow was again enabled, and the vessels were constricted with high KCl buffer (K75) containing (in mM): NaCl 49, KCl 73.7, MgSO4 1.2, CaCl2 2, NaHCO3 25, and KH2PO4 1.2 for 5 min to check their viability. Only vessels without leakage and with a uniform constriction of at least 50% of the passive diameter were included in the study. Vessels were then preconstricted by cumulative addition of the TXA2 mimetic U46619 until a steady constriction of 30–50% was attained. Under this preconstriction, a flow-mediated vasodilatation (FMVD) response was elicited by creating a longitudinal pressure gradient (ΔP) of 20 mmHg, while keeping the mean transmural pressure in the vessel constant at 60 mmHg. This was accomplished by simultaneously applying a steady inlet and outlet pressure of 50 and 70 mmHg, respectively [33]. The intraluminal flow was elicited three times for 3 min, and the flow periods (70/50 mm Hg) were each separated by 3 min without flow (60/60 mmHg). After the third flow period, NS309 (1 µM) was added to the myograph chamber in order to evaluate the effect of activation of the SKCa and IKCa channels. Finally, the effect of an endothelium-dependent vasodilator, acetylcholine (ACh; 10 µM), was evaluated in the presence of NS309. At the end of the protocol, the passive diameter (DMax) was determined at 60 mmHg after superfusion with chelated Ca2+-free Krebs buffer, containing (in mM): NaCl 118, KCl 4.7, MgSO4 1.2, EGTA 2, NaHCO3 25, and KH2PO4 1.2, for 20 min. In parallel pressure myograph experiments, using SMAs from the same rats as for FMVD experiments, we evaluated the smooth muscle-dependent responses at 60 mmHg transmural pressure under no-flow conditions. These experiments were conducted using a customized culture pressure myograph (Model 202CM, DMT, Aarhus, Denmark) fitted on to the heated stage of an inverted Zeiss Axiovert S-100 microscope. Here, we evaluated the responses to (i) K75, (ii) the specific α1-adrenergic agonist phenylephrine (PE; concentration-response curves and EC50 values), (iii) the KV7 channel blocker XE-991 (10 µM), (iv) and the dilatation to 9.5 and 12 mM extracellular [K+] under preconstriction with a half-maximal [PE]. Finally, the passive diameter at 60 mmHg was measured as described above. Buffer compositions, temperature, gas equilibration, and pH were similar in all experiments.

Wire myography

We used wire myography for determination of endothelium-derived hyperpolarization (EDH) responses to increasing concentrations of ACh in the presence of l-NAME and indomethacin. Third-order SMAs were cut into 2-mm pieces and threaded on to two stainless steel wires (Ø 40 µm). The vessels were transferred to a preheated (37°C) myograph chamber (DMT, Aarhus, Denmark) containing a bicarbonate-buffered physiological saline solution (PSS) (in mM): NaCl 130, NaHCO3 14.9, KCl 4.7, MgSO4 1.17, KH2PO4 1.18, glucose 5.5, CaCl2 1.6, EDTA 0.026 aerated with 95% O2 and 5% CO2, resulting in a pH of 7.4. The period between vessel isolation and the start of experiments was less than 2 h. The vessels were normalized to 90% of the tension found at a transmural pressure equivalent to 100 mmHg [34]. All protocols were initiated by two successive exposures to PSS containing 61.18 mM K+ (KPSS) and 10 µM norepinephrine (NE) serving as viability test and reference (maximal) contractions. KPSS contained (in mM): NaCl 74.7, NaHCO3 14.9, KCl 60, MgSO4 1.17, KH2PO4 1.18, glucose 5.5, CaCl2 1.6, EDTA 0.026. Next, the vessels were incubated for 30 min with PSS containing l-NAME (300 µM) and indomethacin (3 µM) to inhibit production of NO and PGI2, respectively, and then preconstricted with NE (1 µM). Finally, cumulative concentration-response curves to ACh (5, 10, 50, 100, 500, and 1000 nM) were constructed for all diet groups, constituting the EDH response.

Quantitative real-time PCR

Four to six second- and third-order branches of SMA from each rat were gently dissected and stored in RNAlater® (Sigma) at 4°C until used. Extraction of total RNA was performed using a TissueLyzer® homogenizer and RNEasy Micro® kit (Qiagen) according to the manufacturer’s instructions. cDNA was produced from freshly extracted total RNA using a Promega kit according to the manufacturer’s instructions. Both RT+ and RT– samples were prepared for each rat. cDNA from rat whole brain was prepared in the same way and used as a calibrator sample. Primer pairs (see Table 1) were picked and blasted using Primer Blast. A Blast search confirmed that the primers did not contain perfect matches to unintended targets. Quantitative real-time PCR (Q-PCR) was performed using a LightCycler 480® apparatus (Roche) and SYBR® Green PCR Master Mix. The standard Q-PCR cycle protocol was: annealing at 60°C for 10 s and elongation at 72°C for 20 s. The melting temperature was 95°C. For Kcnn4 primer pair, the annealing/elongation protocol was however 62°C/10 s and 72°C/12 s. Production of a standard curve for each primer pair using calibrator cDNA showed efficiencies in the range (1.89–2.06), melting curve analyses with single peaks, only, and slopes in the range (–3.19 to –3.62). For each primer pair, the amplified product was of the expected size. RT– and H2O-loaded negative controls did not reveal any amplification products, or alternatively a crushing point (CT) at least 20 cycles higher than for the RT+ samples. The expression of the reference gene β-actin (ActB) did not vary substantially between samples (data not shown). Q-PCR data were reported as the normalized relative ratio [35] calculated by the formula: Normalized relative ratio = 2−ΔΔCT, where ΔCT = CT (target) – CT (ActB), and ΔΔCT = ΔCT (sample) – ΔCT (calibrator).

Table 1
List of primer set sequences used for Q-PCR
Gene nameForward primer (5′–3′)Reverse primer (5′–3′)Product size (bp)Accession number
Actb CCTCTATGCCAACACAGTGCTGTCT GCTCAGGAGGAGCAATGATCTTGA 128 NM_031144 
Kcnj2 AGAGGAAGAGGACAGTGAGAAC TCGCCTGGTTGTGGAGATC 83 NM_017296 
Kcnj8 AGCTGGCTGCTCTTCGCTATCA CCCTCCAAACCCAATGGTCACT 189 NM_017099 
Kcnma1 AAACAAGTAATTCCATCAAGCTGGTG CGTAAGTGCCTGGTTGTTTTGG 137 NM_031828 
Kcnn4 CGGGACACCTCACAGACACA GCAGACAATCTTGCCCCATAG 101 NM_023021 
Kcnn3 TAGCAAGCTCTTCACGGATGCCTCA GCTGAACACCAGCAGCACCGT 127 NM_019315 
Kcna2 TGTGACGGGACTGAGCTGCCTA GTGAGTTGGAGTCACAGCCTCCTT 112 NM_012970 
Kcna5 GATCAATGGCAGCGTCTCTGGAGC AGGCAAAGAAGCGCACGAGCA 146 NM_012972 
Kcnq4 CCCCGCTGCTCTACTGAG ATGACATCATCCACCGTGAG 86 XM_233477 
Cacna1C GATTGTTGTGGGTAGCATTGTTGAT CACTCATAGAGGGAGAGCATTGG 83 NM_012517.2 
Atp1a1 GGCGCTCTTAAAGTGCATCG TGCCGTGGAGGAGGATAGAA 215 NM_012504.1 
Atp1a2 GCTGTTCTGAGAGCCCCATT TTCAGGACAAGCAAGGCGAT 115 NM_012505.2 
Gene nameForward primer (5′–3′)Reverse primer (5′–3′)Product size (bp)Accession number
Actb CCTCTATGCCAACACAGTGCTGTCT GCTCAGGAGGAGCAATGATCTTGA 128 NM_031144 
Kcnj2 AGAGGAAGAGGACAGTGAGAAC TCGCCTGGTTGTGGAGATC 83 NM_017296 
Kcnj8 AGCTGGCTGCTCTTCGCTATCA CCCTCCAAACCCAATGGTCACT 189 NM_017099 
Kcnma1 AAACAAGTAATTCCATCAAGCTGGTG CGTAAGTGCCTGGTTGTTTTGG 137 NM_031828 
Kcnn4 CGGGACACCTCACAGACACA GCAGACAATCTTGCCCCATAG 101 NM_023021 
Kcnn3 TAGCAAGCTCTTCACGGATGCCTCA GCTGAACACCAGCAGCACCGT 127 NM_019315 
Kcna2 TGTGACGGGACTGAGCTGCCTA GTGAGTTGGAGTCACAGCCTCCTT 112 NM_012970 
Kcna5 GATCAATGGCAGCGTCTCTGGAGC AGGCAAAGAAGCGCACGAGCA 146 NM_012972 
Kcnq4 CCCCGCTGCTCTACTGAG ATGACATCATCCACCGTGAG 86 XM_233477 
Cacna1C GATTGTTGTGGGTAGCATTGTTGAT CACTCATAGAGGGAGAGCATTGG 83 NM_012517.2 
Atp1a1 GGCGCTCTTAAAGTGCATCG TGCCGTGGAGGAGGATAGAA 215 NM_012504.1 
Atp1a2 GCTGTTCTGAGAGCCCCATT TTCAGGACAAGCAAGGCGAT 115 NM_012505.2 

Solutions and chemicals

Drugs for myograph experiments were prepared as stock solutions in water or DMSO (≤0.1% in final solution) and diluted in buffer to reach their final bath concentrations: ACh 10 µM; indomethacin 3 µM; l-NAME 300 µM; NS309 1 µM; XE991 10 µM; BaCl2 50 µM; and Ouabain 100 µM. U46619 was dissolved in DMSO and added from a stock solution of 0.5 mM to reach a final concentration of 40 ± 23 nM (n=31).

Data analysis and statistics

The SBP values (mean ± S.E.M.) were evaluated with 2-week interval in diet weeks 11–28 and used for statistical comparisons using two-way ANOVA with Bonferroni’s post hoc test. The final BW at study end was evaluated for statistical comparisons. Statistics for Q-PCR were done by Kruskal–Wallis test with Dunn’s post-test for multiple comparisons between individual diet groups. In FMVD experiments, a response to flow was determined by comparing the averaged lumen diameter during a 30-s period before starting flow (Dbaseline) with that of a 30-s period immediately before stopping flow (D), relative to the passive lumen diameter (DMax) measured at the end of the experiment. Percent dilatation (% FMVD) was calculated as ΔD/ΔDmax × 100, where ΔD = D – Dbaseline and ΔDmax = Dmax – Dbaseline. Percent (%) constriction was calculated as (Dmax – D)/Dmax × 100. Two-way ANOVA was used for comparing concentration-response curves (to ACh and PE), for K+ dilatations (inhibitor or diet effects), and for factor analyses of BW, FMVD, NS309, EDH, XE991, and vasomotion data. A Bonferroni’s post test was used for multiple comparisons where relevant. In all analyses, a P-value less than 0.05 were considered statistically significant.

Results

We first aimed to clarify the effect of the experimental diets on BW and SBP. Pooled BW data from all the control groups were compared with the individual diet groups using factor analysis, and showed highly significant effects of High Fat compared with Normal Fat (i.e. normal chow) both in the presence and absence of fructose in the drinking water (Figure 1A). The SBP was significantly increased in the High Fat/Fruc group compared with its own Control group (P<0.001, main effect of diet; Figure 1D), whereas there were no significant effects on blood pressure in the High-Fructose or High-Fat groups compared with their respective control groups (Figure 1B,C).

Body weight at diet week 28 and systolic blood pressure measurements from diet week 11 to 28

Figure 1
Body weight at diet week 28 and systolic blood pressure measurements from diet week 11 to 28

(A) BW measured at study end and shown by diet factor(the number of rats for each group is shown in the column bar). (B) SBP (mmHg) measured at fixed time intervals from diet week 11–28 in the High Fructose group compared with Control group 1. (C) SBP plotted over time in the High Fat group compared with Control group 2. (D) SBP plotted over time in the High Fat/Fructose group compared with Control group 3 (P<0.001 comapred with Control; two-way ANOVA, main effect of diet).

Figure 1
Body weight at diet week 28 and systolic blood pressure measurements from diet week 11 to 28

(A) BW measured at study end and shown by diet factor(the number of rats for each group is shown in the column bar). (B) SBP (mmHg) measured at fixed time intervals from diet week 11–28 in the High Fructose group compared with Control group 1. (C) SBP plotted over time in the High Fat group compared with Control group 2. (D) SBP plotted over time in the High Fat/Fructose group compared with Control group 3 (P<0.001 comapred with Control; two-way ANOVA, main effect of diet).

Next, we analyzed the mRNA expression of eight different K+ channels as well as the L-type Ca2+ channel and two Na/K-ATPase isoforms abundantly expressed in small arteries. We aimed to clarify whether transcriptional changes in these target genes were consistent with the increased blood pressure in the High Fat/Fruc group. As shown in Table 2, the mRNA expression of the small and intermediate conductance Ca2+-activated K+ channels (Kcnn3/SKCa and Kcnn4/IKCa) was significantly decreased in the High Fat/Fruc group compared with the Control group. In addition, we found that the transcript level of the ‘classical’ inward rectifier K+ channel (Kcnj2/Kir2.1) was significantly reduced in the High Fat/Fruc group compared with the High Fat group, only. There were no significant transcriptional changes observed in the High Fructose group. We hypothesized that down-regulation of SKCa and IKCa channels would lead to a decline in EDH-type response in the High Fat/Fruc group, which might partially explain the observed increase in blood pressure. Furthermore, a reduced expression and function of the Kir2.1 channels in the High Fat/Fruc group would also serve to explain that the blood pressure in that group was increased.

Table 2
Normalized relative mRNA expression in SMAs by diet group
Gene ( protein)Control (n=18)High Fat (n=10)High Fruc (n=7)High Fat/Fruc (n=7)
Kcnj2 (Kir2.1) 0.13 ± 0.012 0.16 ± 0.012 0.16 ± 0.027 0.10 ± 0.005 
Kcnj8 (Kir6.1/KATP) 1.13 ± 0.056 1.32 ± 0.085 1.11 ± 0.118 1.10 ± 0.122 
Kcnma1 (BKCa) 0.32 ± 0.019 0.37 ± 0.053 0.32 ± 0.037 0.38 ± 0.026 
Kcnn4 (SK4/IKCa) 5.25 ± 0.60 4.69 ± 0.54 5.60 ± 1.77 2.74 ± 0.33* 
Kcnn3 (SK3/SKCa) 0.50 ± 0.033 0.47 ± 0.039 0.40 ± 0.078 0.30 ± 0.023* 
Kcna2 (KV1.2) 0.033 ± 0.0023 0.040 ± 0.0034 0.034 ± 0.0041 0.037 ± 0.0052 
Kcna5 (KV1.5) 4.33 ± 0.28 5.34 ± 0.66 3.84 ± 0.51 4.68 ± 0.81 
Kcnq4 (KV7.4) 2.44 ± 0.14 3.06 ± 0.25 2.47 ± 0.37 2.75 ± 0.28 
Cacna1C (CaV1.2) 0.27 ± 0.013 0.30 ± 0.030 0.27 ± 0.022 0.28 ± 0.033 
Atp1a1 (Na/K-α1) 0.025 ± 0.0033 0.020 ± 0.0017 0.024 ± 0.0062 0.029 ± 0.011 
Atp1a2 (Na/K-α2) 0.013 ± 0.0005 0.011 ± 0.0012 0.014 ± 0.0018 0.021 ± 0.0082 
Gene ( protein)Control (n=18)High Fat (n=10)High Fruc (n=7)High Fat/Fruc (n=7)
Kcnj2 (Kir2.1) 0.13 ± 0.012 0.16 ± 0.012 0.16 ± 0.027 0.10 ± 0.005 
Kcnj8 (Kir6.1/KATP) 1.13 ± 0.056 1.32 ± 0.085 1.11 ± 0.118 1.10 ± 0.122 
Kcnma1 (BKCa) 0.32 ± 0.019 0.37 ± 0.053 0.32 ± 0.037 0.38 ± 0.026 
Kcnn4 (SK4/IKCa) 5.25 ± 0.60 4.69 ± 0.54 5.60 ± 1.77 2.74 ± 0.33* 
Kcnn3 (SK3/SKCa) 0.50 ± 0.033 0.47 ± 0.039 0.40 ± 0.078 0.30 ± 0.023* 
Kcna2 (KV1.2) 0.033 ± 0.0023 0.040 ± 0.0034 0.034 ± 0.0041 0.037 ± 0.0052 
Kcna5 (KV1.5) 4.33 ± 0.28 5.34 ± 0.66 3.84 ± 0.51 4.68 ± 0.81 
Kcnq4 (KV7.4) 2.44 ± 0.14 3.06 ± 0.25 2.47 ± 0.37 2.75 ± 0.28 
Cacna1C (CaV1.2) 0.27 ± 0.013 0.30 ± 0.030 0.27 ± 0.022 0.28 ± 0.033 
Atp1a1 (Na/K-α1) 0.025 ± 0.0033 0.020 ± 0.0017 0.024 ± 0.0062 0.029 ± 0.011 
Atp1a2 (Na/K-α2) 0.013 ± 0.0005 0.011 ± 0.0012 0.014 ± 0.0018 0.021 ± 0.0082 

* P<0.05 vs. Control group. P<0.01 vs. High Fat group.

To further investigate these possibilities, we tested the smooth muscle- and endothelium-dependent vasomotor responses in isolated, pressurized SMAs from a new 28-week diet experiment including eight rats in each diet group, and seven rats in the Control group. We first focussed on the clinically relevant endothelium-dependent vasodilatations to shear stress (FMVD). Here, an additional eight age-matched Control rats were included in the study. A typical experiment is shown in Figure 2A, in which repetitive and reversible vasodilator responses are evoked by abrupt on/off changes in flow in an SMA from a Control rat. Factor analysis revealed a tendency of High Fructose to reduce the FMVD responses, but this did not reach statistical significance (Figure 2B). In the following experiment, we investigated the dilatation to pharmacological activation of SKCa and IKCa channels using 1 µmol/l NS309. A typical recording in Figure 2C demonstrates a robust peak and plateau dilatation to direct application of the drug. In order to test any remaining dilatory capacity, we added a maximal concentration of the endothelium-dependent vasodilator ACh (10 µmol/l) after reaching the plateau of the NS309 dilatation. As shown in the factor analysis in Figure 2D the NS309 responses were similar in the respective diet groups, and so were the responses to ACh in the presence of NS309 (data not shown). We speculated that any diet-induced differences in the endothelial function might be masked by the action of nitric oxide and prostacyclin release from the endothelium, and therefore we performed ACh concentration-response curves by wire myography in the presence of l-NAME (300 µmol/l) and indomethacin (3 µmol/l) and calculated the efficacy of ACh using the negative log10 of its EC50 value (pEC50), and the total area under curve (AUC). These experiments showed a rightward shift in the concentration-response curve in the High Fat and High Fat/Fruc groups (Figure 2E), and this corresponded to a significant effect of High Fat in the factor analysis of the pEC50 values (Figure 2F) and the AUC values (Figure 2G). These data show that a diet consisting of High Fat with or without High Fructose reduces the EDH-type responses.

Vasodilatation induced by application of shear stress or acetylcholine in isolated rat SMAs

Figure 2
Vasodilatation induced by application of shear stress or acetylcholine in isolated rat SMAs

(A) Original recording of FMVD in an isolated rat SMA from a Control rat at a mean intraluminal pressure of 60 mmHg. An upward deflection in the trace denotes an increase in diameter. Intraluminal flow was induced (Flow On) by imposing a longitudinal pressure gradient (ΔP) of 20 mmHg. This was followed by a period in the absence of a longitudinal pressure gradient (ΔP = 0 mmHg; Flow Off). (B) Summary of FMVD responses by diet factor (including extra age-matched Control rats). (C) Original recording of vasodilation to abluminal application of the SK/IK activator NS309 (1 µmol/l) to SMAs preconstricted with the TXA2 mimetic U46619. At steady-state NS309-induced dilatation ACh (10 µmol/l) was added to verify the presence of an intact endothelium. An upward deflection in the trace denotes an increase in diameter. (D) Summary of NS309 induced vasodilatation by diet factor. (E) Concentration-response curves by diet group for relaxation to ACh in the presence of l-NAME and indomethacin in SMAs precontracted with 1 µmol/l noradrenaline. (F) Summary of ACh efficacy by diet group evaluated as the pEC50 values estimated for the experiments shown in (E). (G) Summary of ACh efficacy by diet group evaluated as the AUC. The number of rats for each group are shown in the column bars.

Figure 2
Vasodilatation induced by application of shear stress or acetylcholine in isolated rat SMAs

(A) Original recording of FMVD in an isolated rat SMA from a Control rat at a mean intraluminal pressure of 60 mmHg. An upward deflection in the trace denotes an increase in diameter. Intraluminal flow was induced (Flow On) by imposing a longitudinal pressure gradient (ΔP) of 20 mmHg. This was followed by a period in the absence of a longitudinal pressure gradient (ΔP = 0 mmHg; Flow Off). (B) Summary of FMVD responses by diet factor (including extra age-matched Control rats). (C) Original recording of vasodilation to abluminal application of the SK/IK activator NS309 (1 µmol/l) to SMAs preconstricted with the TXA2 mimetic U46619. At steady-state NS309-induced dilatation ACh (10 µmol/l) was added to verify the presence of an intact endothelium. An upward deflection in the trace denotes an increase in diameter. (D) Summary of NS309 induced vasodilatation by diet factor. (E) Concentration-response curves by diet group for relaxation to ACh in the presence of l-NAME and indomethacin in SMAs precontracted with 1 µmol/l noradrenaline. (F) Summary of ACh efficacy by diet group evaluated as the pEC50 values estimated for the experiments shown in (E). (G) Summary of ACh efficacy by diet group evaluated as the AUC. The number of rats for each group are shown in the column bars.

The smooth muscle-dependent constrictions to high KCl were similar in all diet groups (data not shown). Due to a recent implication of KV7.4 channels in vascular tone regulation [3,36], we tested the effect of pharmacological inhibition of KV7 channels using XE991 (10 µmol/l). A typical constriction to bath application of XE991 is shown in Figure 3A. Figure 3B shows that there were no significant differences in the acute XE991 effects between the respective diet groups. We next tested the concentration-response curves of the α1-adrenergic agonist PE both before and after addition of XE991 (10 µmol/l) in order to investigate if there was an increased adrenergic vasoconstriction in SMAs depolarized by inhibiting KV7 channels. However, the concentration-response curves for PE were similar in all diet groups both with and without XE991 (Figure 3C,D). Furthermore, the increase in sensitivity to PE in the presence of XE991 (ΔlogEC50) was similar for all diet groups (Figure 3E). During the PE exposures we noted a shift in the pattern of spontaneous vasomotion in the presence of XE991, and we decided to evaluate if there was a differential effect of diet. Figure 3F shows a typical trace of spontaneous vasomotion in a pressurized SMA from a Control rat in the presence of half-maximal PE concentration with and without XE991. Based on such traces, we evaluated the vasomotion amplitude and frequency in all diet groups (Figure 3G–J). We found that the amplitude was highly significantly increased (P<0.0001) in the High Fat compared with Normal Fat groups before addition of XE991. There was also a significant main effect on amplitude (P<0.05) of High Fructose compared with No Fructose before XE991. In the presence of XE991, there were no diet-induced differences in the vasomotion amplitude or frequency.

Vasoconstrictor responses to KV7 channel inhibition and phenylephrine in pressurized rat SMAs

Figure 3
Vasoconstrictor responses to KV7 channel inhibition and phenylephrine in pressurized rat SMAs

(A) Original trace depicting vasoconstriction of pressurized SMAs (at 60 mmHg) to direct abluminal application of the pan KV7 channel blocker XE991 (10 µmol/l). A downward deflection denotes vasoconstriction. (B) Summary of acute vasoconstriction to XE991 application by diet group. (C) Concentration-response curves by diet group for constriction to abluminal application of PE in naïve-pressurized SMAs. (D) Concentration-response curves by diet group for constriction to abluminal application of PE in the presence of 10 µmol/l XE991. (E) Increase in PE sensitivity in the presence of XE991 by diet group evaluated as the difference (Δ) in log(EC50) values. (F) Original trace depicting spontaneous vasomotion before and after XE991 addition in the presence of half-maximal PE-induced constriction in a pressurized SMA (at 60 mmHg) from a Control rat. Downward deflection denotes vasoconstriction. (G) Vasomotion frequency evaluated by diet factor before addition of XE991. (H) Vasomotion frequency evaluated by diet factor in the presence of 10 µM XE991. (I) Vasomotion amplitude evaluated by diet factor before addition of XE991. Significant main effects (Two-way ANOVA) of High Fat compared with Normal Fat (P<0.0001), and of High Fructose compared with No Fructose (P<0.05). (J) Vasomotion amplitude evaluated by diet factor in the presence of 10 µM XE991. The number of rats for each group are shown in the column bars.

Figure 3
Vasoconstrictor responses to KV7 channel inhibition and phenylephrine in pressurized rat SMAs

(A) Original trace depicting vasoconstriction of pressurized SMAs (at 60 mmHg) to direct abluminal application of the pan KV7 channel blocker XE991 (10 µmol/l). A downward deflection denotes vasoconstriction. (B) Summary of acute vasoconstriction to XE991 application by diet group. (C) Concentration-response curves by diet group for constriction to abluminal application of PE in naïve-pressurized SMAs. (D) Concentration-response curves by diet group for constriction to abluminal application of PE in the presence of 10 µmol/l XE991. (E) Increase in PE sensitivity in the presence of XE991 by diet group evaluated as the difference (Δ) in log(EC50) values. (F) Original trace depicting spontaneous vasomotion before and after XE991 addition in the presence of half-maximal PE-induced constriction in a pressurized SMA (at 60 mmHg) from a Control rat. Downward deflection denotes vasoconstriction. (G) Vasomotion frequency evaluated by diet factor before addition of XE991. (H) Vasomotion frequency evaluated by diet factor in the presence of 10 µM XE991. (I) Vasomotion amplitude evaluated by diet factor before addition of XE991. Significant main effects (Two-way ANOVA) of High Fat compared with Normal Fat (P<0.0001), and of High Fructose compared with No Fructose (P<0.05). (J) Vasomotion amplitude evaluated by diet factor in the presence of 10 µM XE991. The number of rats for each group are shown in the column bars.

Finally we aimed to test the potential role of Kir2.1 channels in diet-induced vascular dysfunction, and this was done by raising extracellular [KCl] to 9.5 and 12 mmol/l in SMAs preconstricted using a half-maximal [PE]. Figure 4A shows a typical example of dilatation to 9.5 mmol/l followed by 12 mmol/l K+, in which vasomotion is also present. In parallel experiments in age-matched Control rats, we tested the effect of Ba2+ (50 µmol/l) and Ouabain (100 µmol/l) because the two drugs, at these concentrations, are relatively specific for Kir channels and the α2-isoform of the Na/K-ATPase, respectively. These data showed a significant effect of Ba2+ with or without Ouabain, but no significant effect of Ouabain alone (Figure 4B). These results confirm that our protocol primarily measures the activation of Kir channels during K+-induced dilatations. Finally, Figure 4C shows that the K+ induced dilatations were significantly reduced in all the diet groups, indicating that long-term high fat and/or high fructose ingestion reduces the functional role of Kir channels. In the High Fat group, this impairment was partially prevented by increasing [K+] from 9.5 to 12 mmol/l (Figure 4C).

KCl-induced vasodilatation in pressurized rat SMAs

Figure 4
KCl-induced vasodilatation in pressurized rat SMAs

(A) Original recording of vasodilation to increasing extracellular [K+] to 9.5 and 12 mmol/l in a pressurized SMA (at 60 mmHg) from a Control rat preconstricted using half-maximal concentration of PE. Vasomotion was often present when the extracellular [K+] was increased. An upward deflection in the trace denotes an increase in diameter. (B) K+-induced dilatations in pressurized SMAs from age-matched Control rats and exposed to the Kir channel blocker Ba2+ (50 µmol/l) in the presence or absence of the Na/K-ATPase inhibitor ouabain (100 µmol/l). (C) Summary of K+-induced dilatations by diet group.

Figure 4
KCl-induced vasodilatation in pressurized rat SMAs

(A) Original recording of vasodilation to increasing extracellular [K+] to 9.5 and 12 mmol/l in a pressurized SMA (at 60 mmHg) from a Control rat preconstricted using half-maximal concentration of PE. Vasomotion was often present when the extracellular [K+] was increased. An upward deflection in the trace denotes an increase in diameter. (B) K+-induced dilatations in pressurized SMAs from age-matched Control rats and exposed to the Kir channel blocker Ba2+ (50 µmol/l) in the presence or absence of the Na/K-ATPase inhibitor ouabain (100 µmol/l). (C) Summary of K+-induced dilatations by diet group.

Discussion

The present study highlighted several potentially important points regarding the role of diet-induced changes in K+ channel expression and function in the development of hypertension. First of all, a diet rich in fat and fructose was associated with an increase in blood pressure, whereas an increase in BW per se was not associated with increased blood pressure. The eight different K+ channel subtypes, along with the L-type channel and Na/K-ATPase isoforms, were selected for the mRNA expression study based on their potential relevance for regulation of vascular tone and blood pressure, as suggested in previous studies [3,10,36–41]. The reduced mRNA expression of SKCa and IKCa K+ channels in SMAs from the High Fat/Fruc group was consistent with a decrease in the efficacy of ACh to induce dilatation in the presence of nitric oxide and prostacyclin production inhibitors. This confirms that the SKCa and IKCa channels were important for EDH-type vasodilatation, and suggests that a reduction in SKCa and IKCa channel expression played a role in the increased blood pressure in the High Fat/Fruc group. The reduced EDH response due to High Fat alone also indicates a reduced endothelial function, but this was not dependent on a reduction in SKCa or IKCa channel mRNA expression, and was not associated with an increased blood pressure. These results highlight the importance of SKCa and IKCa channel expression in long-term, diet-induced hypertension. We did not observe any functional changes in KV7 channel contribution to vascular function in the respective diet groups. However, we did find an effect of High Fat compared with Normal Fat to increase vasomotion amplitude to PE before addition of the KV7 channel inhibitor XE991. This might be related to a reduced negative feedback from endothelium-dependent responses in high fat-fed animals during PE-induced vasomotion. Furthermore, the Ba2+-sensitive K+ dilatations were significantly impaired in the High Fat, High Fructose, and High Fat/Fruc groups, indicating a loss of Kir channel function as a possible contributor to diet-induced hypertension or to its cardiovascular complications. The Kir2.1 channel transcript was only reduced in the High Fat/Fruc group compared with High Fat, which might partially explain why the impairment of K+-induced dilatation was less pronounced in the High Fat group (cf. Figure 4C). On the other hand, functional inhibition of Kir2.1 channels, or other Kir channel subtypes, might explain why all the diet groups showed a reduced K+-induced dilatation. Overall, our study indicated that impaired vasodilator mechanisms involving SKCa, IKCa, and Kir2.1 channels are associated with diet-induced hypertension, whereas vasoconstrictor responses were unchanged.

Kir2.1 channels were previously shown to mediate the inward rectifier currents crucial for the K+-induced dilatation in rat and mouse small arteries, and to be down-regulated in stroke-prone hypertensive rats [42–44]. In SMAs, the Kir2.1 channel mRNA expression was down-regulated in hypertensive mice compared with normotensive controls, and Ba2+-sensitive whole-cell currents in VSMCs were also reduced. Nevertheless, the contractile responses to BaCl2 was not significantly altered in hypertensive mice, most likely because a smaller depolarization was required to elicit contraction in VSMCs of hypertensive origin [45]. Furthermore, Kir2.1 channel mRNA expression was not altered in aortic or renal preglomerular microvascular smooth muscle cells of streptozotocin-induced diabetic rats [46,47]. Thus, our finding of impaired Kir channel expression and function in diet-induced hypertension is new. Since Kir channels have been linked with neurovascular coupling and vascular conducted responses in the brain [48–50], as well as with metabolic activity and hyperemic responses in skeletal muscle [51,52], it would be interesting to address these aspects of vascular Kir channel function in future studies of the metabolic syndrome.

The specificity of NS309 and XE991 used to probe the functional roles of SK/IK channels and KV7 channels in rat SMAs is important. In HEK293 cells, NS309 activated human IKCa and SKCa channels with a half-maximal concentration of 10 and 20–40 nmol/l, respectively. No effects were shown on BKCa-type channels at up to 10 µmol/L NS309 [53]. Although NS309 could induce blockade of L-type Ca2+ channels at higher micromolar concentrations, it was a potent and specific activator of SKCa and IKCa currents in freshly isolated urinary bladder myocytes with an EC50 value in the nanomolar range [54]. Finally, application of the SKCa and IKCa blockers apamin (300 nmol/l) and Tram-34 (10 µmol/l) abolished the increased cortical cerebral blood flow to cranial superfusion with NS309 (10 µmol/l) in anesthetized mice [55]. These data indicate that a concentration of 1 µmol/l NS309 as used in the present study is specific for activation of SKCa and IKCa channels in native tissue. KCNQ4 (KV7.4) channels expressed in HEK293 cells were blocked by XE991 with an IC50 value of 5.5 µmol/l in a voltage-independent manner [56]. Furthermore, in mouse mesenteric artery myocytes, the inhibitory effects of XE991 on KV currents were similar in KV1.5 knockout and wild-type mice, and there were no effects of 30 µmol/l XE991 on iberiotoxin-sensitive BKCa currents [57]. Thus the pan-KV7 (KV7.1–KV7.5) blocker is an effective inhibitor of KV7.4 channels at the concentration used in our study, and does not seem to inhibit other major K+ conductance in mesenteric myocytes.

The comparison of the effects of High Fructose and/or High Fat diet on the vascular reactivity at different study durations must take into account the difference between species, vascular beds, gender, and the amount of fructose and/or fat in the respective diets. A recent study investigating the effect of High Fructose (25%) and/or High Fat (21.4%) in male rats with a diet duration of 8 months (25 weeks) almost similar to our study (28 weeks), reported a decreased (EDH-type) ACh relaxation in main superior mesenteric arteries in the presence of nitric oxide and prostacyclin inhibitors in the High Fat and High Fat/High Fructose groups, with no effect in the High Fructose group [58]. These effects are very similar to what we found in the present study (Figure 2F,G).

Several previous studies investigated the effects of a High Fat diet in rat mesenteric arteries. A High Fat (30%) diet for 16–20 weeks in male rats caused a reduction in the ACh-mediated VSMC hyperpolarization and vasodilatation in pressurized fourth order mesenteric arteries (199–221 µm) [8]. In another study, a High Fat (45%) diet in male rats reduced the ACh-mediated vasodilatation in pressurized mesenteric arteries (114–121 µm) after 32 weeks but not after 8 weeks on the diet [23]. After 7 weeks on a High Fat (33.5%) diet, the basal NO-release and neuronal nitric oxide synthase expression in isolated first order mesenteric arteries from male rats were reduced [59]. Six weeks on a High Fat (60%) diet in male rats, reduced the ACh-mediated vasodilatation in pressurized fifth order mesenteric arteries (80–120 μm) [60]. Thus, whereas a High Fat diet may lead to impairment of EDH-type vasodilatation to ACh after 16 weeks, the basal NO release and ACh-mediated vasodilatation may be affected from 6–7 weeks on the High Fat diet.

Several studies have investigated the impact of fructose ingestion on mesenteric artery function. In male rats fed chow with 66% fructose, the ACh-mediated relaxation in third order pressurized mesenteric arteries was impaired as early as after 3 weeks on the High Fructose diet [61]. A 10% fructose drinking solution given for 40 days (approx. 6 weeks) to male rats reduced the ACh-mediated decrease in the perfusion pressure in the isolated perfused mesenteric bed. This effect was mimicked by perfusion with a High Fructose (40 mM) buffer in lean control rats [62]. In a 40-week High Fructose (60%) diet study, the ACh-mediated vasodilatation was reduced in pressurized mesenteric arteries (200–300 µm) in the presence of a nitric oxide inhibitor [25]. These effects of High Fructose are in contrast with the lack of an effect on EDH-type ACh-mediated vasodilatation in rats fed a High Fructose diet (10–25%) for a period of 25–28 weeks, as observed in the present study and by others [58]. This might be explained by the higher concentration of fructose administered in the diets, the different diet durations, or the difference between isolated vessel preparations and the perfused mesenteric bed.

With respect to effects on α-adrenoceptor-mediated contractility, a study in isolated first order mesenteric arteries from male rats showed lack of effect of a High Fat diet (33.5% fat for 7 weeks) on the contractility to noradrenaline [59]. This is in general agreement with our finding that the High Fat and/or High Fructose diets did not affect the PE-mediated vasoconstriction after 28 weeks. However, in another study in male rats on a High Fat (32%) diet for 11 weeks, the PE contractility was enhanced in spiral strips of fourth order mesenteric arteries in obesity-prone individuals, but not in the obesity-resistant phenotype [63]. Whether the latter discrepancy from our study is due to an alternative choice of contractility measurement or due to the phenotypic selection of obesity-prone individuals for vascular studies is not known.

In our previous paper, we did not find difference between young (2–4 months) and mature adult (7–13 months) mice regarding endothelium-dependent vasodilatation (ACh- and FMVD) [33]. In another study using rat mesenteric arteries, it was reported that aged rats (>24 months) had a reduced endothelial function but there was no difference between young (3–6 months) and adult rats (10–12 months) [64]. Finally, since the rats in the respective diet groups in the present study were carefully age matched (32 weeks), we do not consider that age would have influenced the results significantly.

The tail-cuff method for SBP measurement was chosen because invasive telemetry cannot be used for such long-term studies. We found similar increases in blood pressure using telemetry recordings in a simultaneous 14-week study in rats using the same High Fat/Fruc diet [31], and we therefore reasoned that it is acceptable to use the tail-cuff SBP measurements as an estimate of blood pressure when telemetry recordings are not an option. The level of mRNA expression and the in vivo function of a certain protein might be difficult to correlate for several reasons. The protein abundance in the tissues may be weakly correlated to the mRNA expression level since there might be further regulation occurring at the post-transcriptional, translational, and post-translational level, which can affect the protein abundance and in vivo function. Especially the protein turnover rates and the degree of post-translational modification might have crucial impact on the functional role of an expressed protein [65]. Nevertheless, we recently reported a consistency between age-dependent down-regulation of CaV3.1 T-type Ca2+ channel mRNA and protein expression in mouse mesenteric arteries [33]. Therefore, we attempted to link the changes in mRNA expression level with the functional effects in isolated rat mesenteric arteries in the respective diet groups. In terms of SKCa and IKCa channel expression, we found a consistency between the mRNA down-regulation in the High Fat/Fruc group and the relative impairment of the EDH-type response in the isolated vessels. Furthermore, the reduced Kir2.1 mRNA expression in the High Fat/Fruc group is consistent with impairment of K+-induced vasodilatation and reduced blood pressure in that diet group as well.

The current study is limited by the fact that only one vascular bed, SMAs, was examined. Thus it is possible that the results may not be generalized to all vascular beds. Nevertheless, the diet-induced elevation in blood pressure is in accord with a general effect of similar nature in other vascular beds. Furthermore, the mRNA expression levels should in future studies be verified by measuring protein expression levels by Western blotting, and it would also be informative to study the post-translational regulation that may have caused the impairment of Kir channel function in the High Fat, High Fructose, and High Fat/Fruc groups, respectively. Future studies should also be directed toward creating more specific and vascular-selective pharmacological modulators of Kir2.1 channels for potential therapeutic use. In summary, we found that a diet rich in both fat and fructose leads to elevated SBP. On the other hand, increased BW by itself did not seem to affect SBP. A possible role for down-regulation of endothelial calcium-activated K+ channels in this process was indicated by a significantly lower mRNA expression of these channels in mesenteric vessels emanating from the High Fat/Fruc group, and this was consistent with an impairment of EDH-dependent vasodilation in this diet group. Furthermore, the study clearly pointed to a role of reduced Kir channel function in K+-induced vasodilatation, which might also contribute to elevated blood pressure and disturbances in organ blood flow. Thus, the current study utilizing an animal model mirroring the development of diet-induced hypertension in humans indicates a K+ channel-mediated role for impaired vasodilator function in small arteries.

Clinical perspectives

  • We investigated whether a long-term (28 weeks) diet rich in fat, fructose, or both fat and fructose would lead to changes in K+ transporter expression, and whether this was associated with increased blood pressure and decreased arterial function.

  • In the present study, we detected a reduced mRNA expression of SKCa, IKCa, and Kir2.1 K+ channels in rats fed a diet with High Fat and High Fructose, and this was associated with increased SBP, reduced EDH-type relaxation, and reduced K+-induced dilatation in small arteries.

  • Our data point to a role of SKCa, IKCa, and Kir2.1 K+ channels in diet-induced hypertension, and indicate that rats fed a long-term diet consisting of High Fat and Fructose may be a valuable model for studying hypertension induced by the diet.

We thank Ms. Cecilia Vallin and Ms. Nadia Jensen Soori for technical assistance with animal and tissue handling, SBP measurements, and wire myography. We also thank Ms. Vibeke G. Christensen and Ms. Christina T. Kjempff for their assistance with Q-PCR measurements; and Ms. Vibeke G. Christensen for her expert assistance in pressure myography.

Competing interests

The authors declare that there are no competing interests associated with the manuscript.

Funding

This work was supported by The Danish Medical Research Council; The Lundbeck Foundation; The Novo Nordisk Foundation; The A.P. Møller Foundation for the Advancement of Medical Sciences; and The Danish Heart Foundation.

Author contribution

M.S., C.M.S., N.-H.H.-R., and L.J.J. were responsible for the conception and design of research. M.S., N.-H.H.-R., and L.J.J. secured funding for research. A.K.J.G., M.S., C.M.S., and L.J.J. performed the experiments. A.K.J.G., M.S., C.M.S., N.-H.H.-R., and L.J.J. interpreted the results. A.K.J.G. and L.J.J. drafted the manuscript. A.K.J.G., M.S., C.M.S., N.-H.H.-R., and L.J.J. were responsible for editing, revising, and final approval of manuscript.

Abbreviations

     
  • ACh

    acetylcholine

  •  
  • ActB

    β-actin reference gene

  •  
  • AUC

    area under curve

  •  
  • BKCa

    big conductance calcium-activated K+ channel

  •  
  • BW

    body weight

  •  
  • EC

    endothelial cell

  •  
  • EC50

    half-maximal effective concentration

  •  
  • EDH

    endothelium-derived hyperpolarization

  •  
  • FMVD

    flow-mediated vasodilatation

  •  
  • IKCa

    intermediate conductance calcium-activated K+ channel

  •  
  • Kir2.1

    inward rectifier K+ channel subtype 2.1

  •  
  • L-NAME

    Nω-Nitro-L-arginine methyl ester hydrochloride

  •  
  • MAP

    mean arterial blood pressure

  •  
  • NE

    norepinephrine

  •  
  • NO

    nitric oxide

  •  
  • PE

    phenylephrine

  •  
  • PSS

    physiological saline solution

  •  
  • PGI2

    prostacyclin

  •  
  • Q-PCR

    quantitative real-time PCR

  •  
  • SBP

    systolic blood pressure

  •  
  • SD

    Sprague–Dawley

  •  
  • SKCa

    small conductance calcium-activated K+ channel

  •  
  • SMA

    small mesenteric artery

  •  
  • TPR

    total peripheral resistance

  •  
  • VSMC

    vascular smooth muscle cell

References

References
1
Mayet
J.
and
Hughes
A.
(
2003
)
Cardiac and vascular pathophysiology in hypertension
.
Heart
89
,
1104
1109
[PubMed]
2
Jackson
W.F.
(
2005
)
Potassium channels in the peripheral microcirculation
.
Microcirculation
12
,
113
127
[PubMed]
3
Sorensen
C.M.
,
Braunstein
T.H.
,
Holstein-Rathlou
N.H.
and
Salomonsson
M.
(
2012
)
Role of vascular potassium channels in the regulation of renal hemodynamics
.
Am. J. Physiol. Renal Physiol.
302
,
F505
F518
[PubMed]
4
Nieves-Cintron
M.
,
Nystoriak
M.A.
,
Prada
M.P.
,
Johnson
K.
,
Fayer
W.
,
Dell’acqua
M.L.
et al
(
2015
)
Selective down-regulation of KV2.1 function contributes to enhanced arterial tone during diabetes
.
J. Biol. Chem.
290
,
7918
7929
[PubMed]
5
Schach
C.
,
Resch
M.
,
Schmid
P.M.
,
Riegger
G.A.
and
Endemann
D.H.
(
2014
)
Type 2 diabetes: increased expression and contribution of IKCa channels to vasodilation in small mesenteric arteries of ZDF rats
.
Am. J. Physiol. Heart Circ. Physiol.
307
,
H1093
H1102
[PubMed]
6
Nystoriak
M.A.
,
Nieves-Cintron
M.
,
Nygren
P.J.
,
Hinke
S.A.
,
Nichols
C.B.
,
Chen
C.Y.
et al
(
2014
)
AKAP150 contributes to enhanced vascular tone by facilitating large-conductance Ca2+-activated K+ channel remodeling in hyperglycemia and diabetes mellitus
.
Circ. Res.
114
,
607
615
[PubMed]
7
Howitt
L.
,
Grayson
T.H.
,
Morris
M.J.
,
Sandow
S.L.
and
Murphy
T.V.
(
2012
)
Dietary obesity increases NO and inhibits BKCa-mediated, endothelium-dependent dilation in rat cremaster muscle artery: association with caveolins and caveolae
.
Am. J. Physiol. Heart Circ. Physiol.
302
,
H2464
H2476
[PubMed]
8
Haddock
R.E.
,
Grayson
T.H.
,
Morris
M.J.
,
Howitt
L.
,
Chadha
P.S.
and
Sandow
S.L.
(
2011
)
Diet-induced obesity impairs endothelium-derived hyperpolarization via altered potassium channel signaling mechanisms
.
PLoS ONE
6
,
e16423
[PubMed]
9
Chadha
P.S.
,
Haddock
R.E.
,
Howitt
L.
,
Morris
M.J.
,
Murphy
T.V.
,
Grayson
T.H.
et al
(
2010
)
Obesity up-regulates intermediate conductance calcium-activated potassium channels and myoendothelial gap junctions to maintain endothelial vasodilator function
.
J. Pharmacol. Exp. Ther.
335
,
284
293
[PubMed]
10
Sobey
C.G.
(
2001
)
Potassium channel function in vascular disease
.
Arterioscler. Thromb. Vasc. Biol.
21
,
28
38
[PubMed]
11
Borbouse
L.
,
Dick
G.M.
,
Asano
S.
,
Bender
S.B.
,
Dincer
U.D.
,
Payne
G.A.
et al
(
2009
)
Impaired function of coronary BK(Ca) channels in metabolic syndrome
.
Am. J. Physiol. Heart Circ. Physiol.
297
,
H1629
H1637
[PubMed]
12
Jahangir
E.
,
De Schutter
A.
and
Lavie
C.J.
(
2014
)
The relationship between obesity and coronary artery disease
.
Transl. Res.
164
,
336
344
[PubMed]
13
Bastien
M.
,
Poirier
P.
,
Lemieux
I.
and
Despres
J.P.
(
2014
)
Overview of epidemiology and contribution of obesity to cardiovascular disease
.
Prog. Cardiovasc. Dis.
56
,
369
381
[PubMed]
14
Lim
S.
and
Meigs
J.B.
(
2013
)
Ectopic fat and cardiometabolic and vascular risk
.
Int. J. Cardiol.
169
,
166
176
[PubMed]
15
Yates
K.F.
,
Sweat
V.
,
Yau
P.L.
,
Turchiano
M.M.
and
Convit
A.
(
2012
)
Impact of metabolic syndrome on cognition and brain: a selected review of the literature
.
Arterioscler. Thromb. Vasc. Biol.
32
,
2060
2067
[PubMed]
16
Odermatt
A.
(
2011
)
The Western-style diet: a major risk factor for impaired kidney function and chronic kidney disease
.
Am. J. Physiol. Renal Physiol.
301
,
F919
F931
[PubMed]
17
Savica
V.
,
Bellinghieri
G.
and
Kopple
J.D.
(
2010
)
The effect of nutrition on blood pressure
.
Annu. Rev. Nutr.
30
,
365
401
[PubMed]
18
Despres
J.P.
and
Lemieux
I.
(
2006
)
Abdominal obesity and metabolic syndrome
.
Nature
444
,
881
887
[PubMed]
19
Abbasi
F.
,
Brown
B.W.
Jr
,
Lamendola
C.
,
McLaughlin
T.
and
Reaven
G.M.
(
2002
)
Relationship between obesity, insulin resistance, and coronary heart disease risk
.
J. Am. Coll. Cardiol.
40
,
937
943
[PubMed]
20
Klein
A.V.
and
Kiat
H.
(
2015
)
The mechanisms underlying fructose-induced hypertension: a review
.
J. Hypertens.
33
,
912
920
[PubMed]
21
Lanaspa
M.A.
,
Tapia
E.
,
Soto
V.
,
Sautin
Y.
and
Sanchez-Lozada
L.G.
(
2011
)
Uric acid and fructose: potential biological mechanisms
.
Semin. Nephrol.
31
,
426
432
[PubMed]
22
Tran
L.T.
,
Yuen
V.G.
and
McNeill
J.H.
(
2009
)
The fructose-fed rat: a review on the mechanisms of fructose-induced insulin resistance and hypertension
.
Mol. Cell. Biochem.
332
,
145
159
[PubMed]
23
Kleinschmidt
T.L.
and
Oltman
C.L.
(
2014
)
Progression and reversal of coronary and mesenteric vascular dysfunction associated with obesity
.
Obesity (Silver Spring)
22
,
2193
2200
[PubMed]
24
Axelsen
L.N.
,
Lademann
J.B.
,
Petersen
J.S.
,
Holstein-Rathlou
N.H.
,
Ploug
T.
,
Prats
C.
et al
(
2010
)
Cardiac and metabolic changes in long-term high fructose-fat fed rats with severe obesity and extensive intramyocardial lipid accumulation
.
Am. J. Physiol. Regul. Integr. Comp. Physiol.
298
,
R1560
R1570
[PubMed]
25
Takagawa
Y.
,
Berger
M.E.
,
Hori
M.T.
,
Tuck
M.L.
and
Golub
M.S.
(
2001
)
Long-term fructose feeding impairs vascular relaxation in rat mesenteric arteries
.
Am. J. Hypertens.
14
,
811
817
[PubMed]
26
D’Angelo
G.
,
Elmarakby
A.A.
,
Pollock
D.M.
and
Stepp
D.W.
(
2005
)
Fructose feeding increases insulin resistance but not blood pressure in Sprague-Dawley rats
.
Hypertension
46
,
806
811
[PubMed]
27
Khan
S.A.
,
Sattar
M.Z.
,
Abdullah
N.A.
,
Rathore
H.A.
,
Abdulla
M.H.
,
Ahmad
A.
et al
(
2015
)
Obesity depresses baroreflex control of renal sympathetic nerve activity and heart rate in Sprague Dawley rats: role of the renal innervation
.
Acta Physiol. (Oxf.)
214
,
390
401
[PubMed]
28
Akar
F.
,
Uludag
O.
,
Aydin
A.
,
Aytekin
Y.A.
,
Elbeg
S.
,
Tuzcu
M.
et al
(
2012
)
High-fructose corn syrup causes vascular dysfunction associated with metabolic disturbance in rats: protective effect of resveratrol
.
Food Chem. Toxicol.
50
,
2135
2141
[PubMed]
29
Dobrian
A.D.
,
Davies
M.J.
,
Prewitt
R.L.
and
Lauterio
T.J.
(
2000
)
Development of hypertension in a rat model of diet-induced obesity
.
Hypertension
35
,
1009
1015
[PubMed]
30
Dobrian
A.D.
,
Schriver
S.D.
,
Khraibi
A.A.
and
Prewitt
R.L.
(
2004
)
Pioglitazone prevents hypertension and reduces oxidative stress in diet-induced obesity
.
Hypertension
43
,
48
56
[PubMed]
31
Lund
M.T.
,
Salomonsson
M.
,
Jonassen
T.E.N.
and
Holstein-Rathlou
N.H.
(
2017
)
A method for assessment of the dynamic response of the arterial baroreflex
.
Acta Physiol. (Oxf.)
,
32
Panchal
S.K.
,
Poudyal
H.
,
Iyer
A.
,
Nazer
R.
,
Alam
M.A.
,
Diwan
V.
et al
(
2011
)
High-carbohydrate, high-fat diet-induced metabolic syndrome and cardiovascular remodeling in rats
.
J. Cardiovasc. Pharmacol.
57
,
611
624
[PubMed]
33
Mikkelsen
M.F.
,
Bjorling
K.
and
Jensen
L.J.
(
2016
)
Age-dependent impact of CaV 3.2 T-type calcium channel deletion on myogenic tone and flow-mediated vasodilatation in small arteries
.
J. Physiol.
594
,
5881
5898
[PubMed]
34
Mulvany
M.J.
and
Halpern
W.
(
1977
)
Contractile properties of small arterial resistance vessels in spontaneously hypertensive and normotensive rats
.
Circ. Res.
41
,
19
26
[PubMed]
35
Livak
K.J.
and
Schmittgen
T.D.
(
2001
)
Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) method
.
Methods
25
,
402
408
36
Zhong
X.Z.
,
Harhun
M.I.
,
Olesen
S.P.
,
Ohya
S.
,
Moffatt
J.D.
,
Cole
W.C.
et al
(
2010
)
Participation of KCNQ (Kv7) potassium channels in myogenic control of cerebral arterial diameter
.
J. Physiol.
588
,
3277
3293
[PubMed]
37
Blaustein
M.P.
,
Zhang
J.
,
Chen
L.
and
Hamilton
B.P.
(
2006
)
How does salt retention raise blood pressure?
Am. J. Physiol. Regul. Integr. Comp. Physiol.
290
,
R514
R523
[PubMed]
38
Hald
B.O.
,
Jacobsen
J.C.
,
Braunstein
T.H.
,
Inoue
R.
,
Ito
Y.
,
Sorensen
P.G.
et al
(
2012
)
BKCa and KV channels limit conducted vasomotor responses in rat mesenteric terminal arterioles
.
Pflugers Arch.
463
,
279
295
[PubMed]
39
Kerr
P.M.
,
Clement-Chomienne
O.
,
Thorneloe
K.S.
,
Chen
T.T.
,
Ishii
K.
,
Sontag
D.P.
et al
(
2001
)
Heteromultimeric Kv1.2-Kv1.5 channels underlie 4-aminopyridine-sensitive delayed rectifier K(+) current of rabbit vascular myocytes
.
Circ. Res.
89
,
1038
1044
[PubMed]
40
Moosmang
S.
,
Schulla
V.
,
Welling
A.
,
Feil
R.
,
Feil
S.
,
Wegener
J.W.
et al
(
2003
)
Dominant role of smooth muscle L-type calcium channel Cav1.2 for blood pressure regulation
.
EMBO J.
22
,
6027
6034
[PubMed]
41
Quayle
J.M.
,
Nelson
M.T.
and
Standen
N.B.
(
1997
)
ATP-sensitive and inwardly rectifying potassium channels in smooth muscle
.
Physiol. Rev.
77
,
1165
1232
[PubMed]
42
Zaritsky
J.J.
,
Eckman
D.M.
,
Wellman
G.C.
,
Nelson
M.T.
and
Schwarz
T.L.
(
2000
)
Targeted disruption of Kir2.1 and Kir2.2 genes reveals the essential role of the inwardly rectifying K(+) current in K(+)-mediated vasodilation
.
Circ. Res.
87
,
160
166
[PubMed]
43
Bradley
K.K.
,
Jaggar
J.H.
,
Bonev
A.D.
,
Heppner
T.J.
,
Flynn
E.R.
,
Nelson
M.T.
et al
(
1999
)
Kir2.1 encodes the inward rectifier potassium channel in rat arterial smooth muscle cells
.
J. Physiol.
515
,
639
651
[PubMed]
44
McCarron
J.G.
and
Halpern
W.
(
1990
)
Impaired potassium-induced dilation in hypertensive rat cerebral arteries does not reflect altered Na+,K(+)-ATPase dilation
.
Circ. Res.
67
,
1035
1039
[PubMed]
45
Tajada
S.
,
Cidad
P.
,
Moreno-Dominguez
A.
,
Perez-Garcia
M.T.
and
Lopez-Lopez
J.R.
(
2012
)
High blood pressure associates with the remodelling of inward rectifier K+ channels in mice mesenteric vascular smooth muscle cells
.
J. Physiol.
590
,
6075
6091
[PubMed]
46
Ren
Y.
,
Xu
X.
and
Wang
X.
(
2003
)
Altered mRNA expression of ATP-sensitive and inward rectifier potassium channel subunits in streptozotocin-induced diabetic rat heart and aorta
.
J. Pharmacol. Sci.
93
,
478
483
[PubMed]
47
Troncoso Brindeiro
C.M.
,
Lane
P.H.
and
Carmines
P.K.
(
2012
)
Tempol prevents altered K(+) channel regulation of afferent arteriolar tone in diabetic rat kidney
.
Hypertension
59
,
657
664
[PubMed]
48
Jensen
L.J.
and
Holstein-Rathlou
N.H.
(
2013
)
The vascular conducted response in cerebral blood flow regulation
.
J. Cereb. Blood Flow Metab.
33
,
649
656
[PubMed]
49
Longden
T.A.
and
Nelson
M.T.
(
2015
)
Vascular inward rectifier K+ channels as external K+ sensors in the control of cerebral blood flow
.
Microcirculation
22
,
183
196
[PubMed]
50
Vetri
F.
,
Xu
H.
,
Paisansathan
C.
and
Pelligrino
D.A.
(
2012
)
Impairment of neurovascular coupling in type 1 diabetes mellitus in rats is linked to PKC modulation of BK(Ca) and Kir channels
.
Am. J. Physiol. Heart Circ. Physiol.
302
,
H1274
H1284
[PubMed]
51
Crecelius
A.R.
,
Richards
J.C.
,
Luckasen
G.J.
,
Larson
D.G.
and
Dinenno
F.A.
(
2013
)
Reactive hyperemia occurs via activation of inwardly rectifying potassium channels and Na+/K+-ATPase in humans
.
Circ. Res.
113
,
1023
1032
[PubMed]
52
Jin
C.Z.
,
Kim
H.S.
,
Seo
E.Y.
,
Shin
D.H.
,
Park
K.S.
,
Chun
Y.S.
et al
(
2011
)
Exercise training increases inwardly rectifying K(+) current and augments K(+)-mediated vasodilatation in deep femoral artery of rats
.
Cardiovasc. Res.
91
,
142
150
[PubMed]
53
Strobaek
D.
,
Teuber
L.
,
Jorgensen
T.D.
,
Ahring
P.K.
,
Kjaer
K.
,
Hansen
R.S.
et al
(
2004
)
Activation of human IK and SK Ca2+ -activated K+ channels by NS309 (6,7-dichloro-1H-indole-2,3-dione 3-oxime)
.
Biochim. Biophys. Acta
1665
,
1
5
[PubMed]
54
Morimura
K.
,
Yamamura
H.
,
Ohya
S.
and
Imaizumi
Y.
(
2006
)
Voltage-dependent Ca2+-channel block by openers of intermediate and small conductance Ca2+-activated K+ channels in urinary bladder smooth muscle cells
.
J. Pharmacol. Sci.
100
,
237
241
[PubMed]
55
Hannah
R.M.
,
Dunn
K.M.
,
Bonev
A.D.
and
Nelson
M.T.
(
2011
)
Endothelial SK(Ca) and IK(Ca) channels regulate brain parenchymal arteriolar diameter and cortical cerebral blood flow
.
J. Cereb. Blood Flow Metab.
31
,
1175
1186
[PubMed]
56
Sogaard
R.
,
Ljungstrom
T.
,
Pedersen
K.A.
,
Olesen
S.P.
and
Jensen
B.S.
(
2001
)
KCNQ4 channels expressed in mammalian cells: functional characteristics and pharmacology
.
Am. J. Physiol. Cell Physiol.
280
,
C859
C866
[PubMed]
57
Tsvetkov
D.
,
Tano
J.Y.
,
Kassmann
M.
,
Wang
N.
,
Schubert
R.
and
Gollasch
M.
(
2016
)
The role of DPO-1 and XE991-sensitive potassium channels in perivascular adipose tissue-mediated regulation of vascular tone
.
Front. Physiol.
7
,
335
[PubMed]
58
Lozano
I.
,
Van der Werf
R.
,
Bietiger
W.
,
Seyfritz
E.
,
Peronet
C.
,
Pinget
M.
et al
(
2016
)
High-fructose and high-fat diet-induced disorders in rats: impact on diabetes risk, hepatic and vascular complications
.
Nutr. Metab. (Lond.)
13
,
15
[PubMed]
59
Blanco-Rivero
J.
,
de las
H.N.
,
Martin-Fernandez
B.
,
Cachofeiro
V.
,
Lahera
V.
and
Balfagon
G.
(
2011
)
Rosuvastatin restored adrenergic and nitrergic function in mesenteric arteries from obese rats
.
Br. J. Pharmacol.
162
,
271
285
[PubMed]
60
Sweazea
K.L.
,
Lekic
M.
and
Walker
B.R.
(
2010
)
Comparison of mechanisms involved in impaired vascular reactivity between high sucrose and high fat diets in rats
.
Nutr. Metab. (Lond.)
7
,
48
[PubMed]
61
Katakam
P.V.
,
Ujhelyi
M.R.
,
Hoenig
M.E.
and
Miller
A.W.
(
1998
)
Endothelial dysfunction precedes hypertension in diet-induced insulin resistance
.
Am. J. Physiol.
275
,
R788
R792
[PubMed]
62
Richey
J.M.
,
Si
X.
,
Halter
J.B.
and
Webb
R.C.
(
1998
)
Fructose perfusion in rat mesenteric arteries impairs endothelium-dependent vasodilation
.
Life Sci.
62
,
L55
L62
63
Boustany-Kari
C.M.
,
Gong
M.
,
Akers
W.S.
,
Guo
Z.
and
Cassis
L.A.
(
2007
)
Enhanced vascular contractility and diminished coronary artery flow in rats made hypertensive from diet-induced obesity
.
Int. J. Obes. (Lond.)
31
,
1652
1659
[PubMed]
64
Zhou
E.
,
Qing
D.
and
Li
J.
(
2010
)
Age-associated endothelial dysfunction in rat mesenteric arteries: roles of calcium-activated K(+) channels (K(ca))
.
Physiol. Res.
59
,
499
508
[PubMed]
65
Greenbaum
D.
,
Colangelo
C.
,
Williams
K.
and
Gerstein
M.
(
2003
)
Comparing protein abundance and mRNA expression levels on a genomic scale
.
Genome Biol.
4
,
117
[PubMed]

Author notes

*

These authors contributed equally to this work.