Abstract

The long non-coding RNA (lncRNA) PTENP1 is a pseudogene of phosphatase and tensin homologue deleted on chromosome ten (PTEN), has been implicated in smooth muscle cell (SMC) proliferation and apoptosis. PTENP1 is the pseudogene of PTEN. However, it is unclear whether and how PTENP1 functions in the proliferation and apoptosis of human aortic SMCs (HASMCs). Here, we hypothesised that PTENP1 inhibits HASMC proliferation and enhances apoptosis by promoting PTEN expression. PCR analysis and Western blot assays respectively showed that both PTENP1 and PTEN were up-regulated in human aortic dissection (AD) samples. PTENP1 overexpression significantly increased the protein expression of PTEN, promoted apoptosis and inhibited the proliferation of HASMCs. PTENP1 silencing exhibited the opposite effects and mitigated H2O2-induced apoptosis of HASMCs. In an angiotensin II (Ang II)-induced mouse aortic aneurysm (AA) model, PTENP1 overexpression potentiated aortic SMC apoptosis, exacerbated aneurysm formation. Mechanistically, RNA pull-down assay and a series of luciferase reporter assays using miR-21 mimics or inhibitors identified PTENP1 as a molecular sponge for miR-21 to endogenously compete for the binding between miR-21 and the PTEN transcript, releasing PTEN expression. This finding was further supported by in vitro immunofluorescent evidence showing decreased cell apoptosis upon miR-21 mimic administration under baseline PTENP1 overexpression. Ex vivo rescue of PTEN significantly mitigated the SMC apoptosis induced by PTENP1 overexpression. Finally, Western blot assays showed substantially reduced Akt phosphorylation and cyclin D1 and cyclin E levels with up-regulated PTENP1 in HASMCs. Our study identified PTENP1 as a mediator of HASMC homeostasis and suggests that PTENP1 is a potential target in AD or AA intervention.

Introduction

Current research has confirmed the crucial roles of long non-coding RNAs (lncRNAs) in the proliferation, apoptosis and differentiation of smooth muscle cells (SMCs) [1], which are key processes during aortic dissection (AD) [2] and aortic aneurysm (AA) formation [3]. LncRNAs are believed to affect AD and AA formation by modulating SMC function. This hypothesis was recently supported by an in vivo study showing that lncRNA H19 promotes SMC apoptosis and induces AA formation [4]. Pseudogenes of lncRNAs belong to the lncRNA group [5,6]. Evidence shows that this type of lncRNA has important functions in cell proliferation and apoptosis; for example TUSC2P [7], pseudogene of PTEN (PTENP1) [8,9], and PTTG3P [10] have well-studied roles in regulating tumour cell proliferation and apoptosis.

LncRNAs of this category are characterised by specific and potent mediation of their parental coding genes, enabling both molecules to be key in various biological or pathogenic contexts. If a parental coding gene affects cell proliferation and apoptosis, their lncRNA pseudogenes, in theory, should also be key participants in these processes. This hypothesis has been strongly supported by studies of the proliferation and apoptosis of tumour cells, as mentioned above. Thus, lncRNA pseudogenes have the potential to regulate SMC proliferation and apoptosis by influencing their parental coding genes, which are known to have a role in SMC proliferation and apoptosis. However, this hypothesis has not been confirmed.

The lncRNA PTENP1 is a pseudogene of the tumour suppressor gene phosphatase and tensin homologue deleted on chromosome ten (PTEN) [11,12]; the latter has been shown to potently modulate cell proliferation and apoptosis [6,13,14]. PTENP1 shares nucleotide homology with PTEN that is as high as over 95% [15,16]. Ex vivo evidence from studies of multiple tumours, such as hepatocellular carcinoma [17], breast cancer [9,18], renal carcinoma [14], and gastric cancer [19], has revealed the role of PTENP1/PTEN in cell proliferation and apoptosis. PTEN is a well-studied gene whose encoded protein crucially affects SMC apoptosis and proliferation [13,20,21]. More importantly, in vivo studies revealed that PTEN participates in AA dilation by impairing vascular integrity through the inhibition of SMC proliferation and the promotion of SMC apoptosis. These findings indicate a possible yet undetermined role of PTENP1 in SMC proliferation and apoptosis and even in AD and AA formation induced by PTEN overexpression.

In the current study, we hypothesised that PTENP1 inhibits SMC proliferation and promotes SMC apoptosis by protecting PTEN expression. We studied PTENP1 expression in human AD samples and human aortic SMCs (HASMCs). In addition, using virus-mediated dysregulation of PTENP1, we investigated the corresponding PTEN expression and alterations in HASMC proliferation and apoptosis. We also explored how PTENP1 overexpression affected AA formation and SMC apoptosis in angiotensin II (Ang II)-induced mice. Finally, we explored the molecular mechanisms underlying this effect.

Materials and methods

Patient samples and ethics statement

The study protocol was approved by the Research Ethics Committees of Zhongshan Hospital, Sun Yat-sen University and Guangzhou General Hospital of Guangzhou Military Region. All subjects provided written informed consent. Seven human AD tissues and adjacent aortic tissue specimens were obtained from the hospital mentioned above. The AD diagnosis was confirmed by computed tomography angiography. A portion of the sample was quickly transferred to liquid nitrogen and stored at −80°C for RNA extraction. The remaining sample was fixed with 4% paraformaldehyde for Haematoxylin and Eosin (H&E) and immunohistochemical staining.

H&E staining, immunohistochemistry analysis, and in situ hybridisation

Human AD specimens were fixed in 4% paraformaldehyde for histological analysis. Paraffin-embedded specimens were then cut into 4-µm-thick sections. Paraffin sections were subjected to H&E staining, immunohistochemical staining and in situ hybridisation (ISH). For histological analysis, the sections were stained with H&E and observed by light microscopy (Olympus BX51, Tokyo, Japan). For immunohistochemistry, the samples were deparaffinised, and endogenous peroxidase activity was blocked by 3% (vol/vol) hydrogen peroxide (H2O2); then, the samples were preincubated with bovine serum (10%) to block the non-specific binding sites [22]. Slides were incubated at 4°C overnight with primary antibodies (1:100) and a biotinylated secondary antibody (1:200), followed by a horseradish peroxidase-labelled streptavidin solution. Finally, Diaminobenzidine and Haematoxylin staining was performed on the area of interest. Immunohistochemical staining was performed as described previously [22] using the following primary antibodies: goat anti-α-SMA (anti-α smooth muscle actin) antibody (ab21027, Abcam; 1:100), anti-SM22 (smooth muscle 22) antibody (ab14106, Abcam; 1:100) or anti-MYH11 (myosin-11) antibody (ab53219, Abcam; 1:100). For negative controls, the primary antibody was replaced with IgG. Five different fields of view were randomly selected from each section under a high-power field, and histopathological parameters (α-SMA, SM22, and MYH11 expression) were quantitatively analysed. For positive tan granules, the average integrated optical density (Iod) and the positive area (Area) of each field were determined by Image-Pro Plus 6.0 software, and the ratio of Iod/Area was calculated. ISH was implemented to detect PTENP1 content and distribution in the human AD. After conventional dewaxing in water, paraffin sections were treated with Triton X-100 to enhance probe penetration. The slides were washed with PBS and fixed again in 4% paraformaldehyde. After digestion with proteinase K, an oligonucleotide probe hybridisation solution against PTENP1 with digoxigenin-labelled was added dropwise and incubated overnight at 55°C. The next day, the aortic tissue sections were washed with different concentrations of saline sodium citrate at 50°C. After adding a blocking solution composed of sheep serum at 37°C for 1 h, the slides were incubated with anti-digoxigenin-alkaline phosphatase antibody (Roche, Berlin, Germany) overnight at 4°C. Finally, after washing with Tris-NaCl buffer, the cytoplasm was stained with NBT/BCIP in the dark, and the ISH signal of PTENP1 was identified as a blue-violet spot. The sections were observed at different magnifications with an optical microscope (Olympus BX51, Tokyo, Japan) and imaged, and five different fields of view of each section were randomly examined. The RNA oligonucleotide probe of PTENP1 was TTGGATGGTTTGTGTTTTTATTTAGTTTTAACTGTCCCTTATCAGATACA.

Cell culture

HASMCs were purchased from CellBio Company (Shanghai). The SMC line was cultured in DMEM (HyClone, UT) containing 10% foetal bovine serum (Gibco), 100 U/ml penicillin (Sigma), and 100 μg/ml streptomycin (Sigma). HASMCs were maintained at 37°C in a humidified atmosphere containing 5% CO2. Cells were grown to 70–80% confluence before being treated with different agents in all the experiments.

Fibroblasts were isolated from 1-day-old C57BL/6J mice, purchased from the Laboratory Animal Center of Southern Medical University. Neonatal mice were killed by 2% isoflurane inhalation and cervical dislocation. Then, the heart of the neonatal mice were separated and cut into pieces, and digested in 0.25% trypsin (Gibco, CA) overnight at 4°C. Digestion was performed two more times using BSA (Sigma, Darmstadt, Germany) and collagenase type II (Gibco) in PBS for 15 min at 37°C under constant stirring. Digestion was performed at room temperature in 15-min steps, and the supernatant was collected with foetal bovine serum after each step. The collected supernatant was centrifuged to harvest the cells, which were resuspended in DMEM (HyClone, UT) supplemented with 10% foetal bovine serum, 100 U/ml penicillin (Sigma), and 100 mg/ml streptomycin (Sigma). The collected cells were seeded on to 100-mm plastic dishes for 2 h at 37°C in a humidified atmosphere of 5% CO2. After the fibroblasts attached, the supernatant was removed, and the cells were washed with PBS and cultured in DMEM containing 10% foetal bovine serum, 100 U/ml penicillin, and 100 μg/ml streptomycin.

Preparation and transduction of overexpression plasmids, recombinant adenovirus vectors, and small interfering RNAs

Construction of the overexpression plasmids GV314-GFP and GV314-GFP-PTENP1 and the recombinant adenovirus vectors Ad-GFP-PTENP1 and Ad-GFP were synthesised by GeneChem Co., Ltd. (Shanghai, China). To examine the consequences of PTENP1 down-regulation, we designed small interfering RNA (siRNA) (Ribobio, Guangzhou, China) to specifically target sequences in PTENP1 (si-PTENP1) and PTEN (si-PTEN). The si-scr-RNA was used as a negative control. The mRNA expression levels of the two molecules after interference were then separately detected by quantitative reverse transcription-PCR (qRT-PCR) before use in subsequent experiments. HASMCs were randomly transfected with one of the vectors or siRNA using Lipofectamine 2000 (Life Technologies) [23]. For adenovirus infection, a 96-well plate of HASMCs was mixed with virus at a multiplicity of infection (MOI) of 50. Conventional solution changes and passaging were performed at 8 h after infection.

Transfection of miRNA mimics or inhibitors

The miRNA mimics and inhibitors (antagomirs) were purchased from Vigene Biosciences (Jinan, Shandong, China). To determine the effects of miR-21 on the cultured cells, the miRNA negative control mimic and the miR-21 mimic were transfected separately into cultured cells using Lipofectamine 2000 reagent (Invitrogen). Similarly, miRNA negative control inhibitors and miR-21 inhibitors were transfected separately into HASMCs. Forty-eight hours after transfection, the cells were harvested, and the RNA levels of different genes were analysed by qRT-PCR. The sequence of the miR-21 mimic was 5′-UAGCUUAUCAGACUGAUGUUGA-3′, and the sequence of the miR-21 inhibitor was 5′-UCAACAUCAGUCUGAUAAGCUA-3′.

RNA isolation and quantiticative reverse transcription-PCR

Total RNA was isolated from the indicated cell lines and human AD tissues using the RNeasy Mini Kit (Qiagen) according to the manufacturer’s protocol. Total RNA (500 ng) was used to synthesise first-strand cDNA with random primers and Superscript II reverse transcriptase (Invitrogen) following the manufacturer’s protocol. Appropriate dilutions of each single-stranded cDNA were prepared for subsequent PCR with β-actin as a quantitative control. All experiments were performed as three independent experiments in triplicate [24].

Western blot analysis

Proteins were analysed by Western blot. HASMCs were harvested and lysed in RIPA buffer containing the protease inhibitor phenylmethanesulfonyl fluoride (PMSF) (Beyotime, P0013B). The protein concentration was determined using an Enhanced BCA Protein Assay Kit (Beyotime, P0010). The proteins were denatured at 100°C for 10 min, electrophoretically separated (50 μg per lane) on 12% SDS/PAGE gels (Sangon Biotech, SD6013) and then transferred on to a nitrocellulose Western blot membrane. The membrane was blocked in 5% skim milk at room temperature for 30 min and incubated with a monoclonal primary antibody at 4°C overnight. After being washed three times for 15  min each, the membrane was incubated with a secondary antibody for 1  h at room temperature, washed three times for 15 min, and incubated with Immobilon™ Western chemiluminescent HRP substrate (Merck Millipore, WBKLS0100) for 2 min at room temperature. β-actin was used as a loading control. Finally, the membrane was exposed to Kodak film in a dark room to evaluate protein expression. The Western blot bands were scanned to quantify their density using Quantity One software (Version 4.4.1). All experiments were performed as five independent experiments.

RNA pull-down assay

Biotin-labelled PTENP1 probes (sense and antisense) were obtained by in vitro transcription and mixed the biotin RNA labelling. Prewashed beads were incubated with the probes at 4°C overnight. Then the mixture was centrifuged and the supernatant was removed. Finally, HASMCs lysate was added and cells were incubated at room temperature for 1 h. The RNA were then immobilised on the streptavidin dynabeads and analysed by qRT-PCR. The sequence of the PTENP1 sense probes were Forward: TAATACGACTCACTATAGGGGAGGAGCCGTCAAATCCAGAGG, Reverse: TCGTCAATGTGTGAGGTTCCAGTT. The sequence of the PTENP1 antisense probes were Forward: TAATACGACTCACTATAGGGTCGTCAATGTGTGAGGTTCCAGTT, Reverse: GAGGAGCCGTCAAATCCAGAGG.

Luciferase reporter assays

PTENP1 3′ untranslated regions (UTRs) containing the binding site of miR-21 [25] and an identical sequence with a mutation in the miR-21 seed sequence were inserted between the restriction sites XhoI and BglIII of the luciferase reporter vector and validated by sequencing. The luciferase reporter vectors PGL3-PTENP1-WILD-TYPE (PTENP1-WT), PGL3-PTENP1-MUTATED (PTENP1-MT), PGL3-PTEN-WILD-TYPE (PTEN-WT), PGL3- PTEN-MUTATED (PTEN-MT) and PGL3-negative control (UTR-NC) were constructed as described above. Cells were seeded in 24-well plates and transfected with UTR-NC, PTENP1-WT, PTENP1-MT or PTEN-WT, PTEN-MT reporter vectors and miR-NC, miR-21 mimic, or miR-21 inhibitor. Twenty-four hours after transfection, firefly and Renilla luciferase activities were consecutively measured according to the Dual-Luciferase Assay Manual (Promega). The Renilla luciferase signal was normalised to the firefly luciferase signal for each individual analysis.

Cell apoptotic assays and analysis

HASMCs were transfected with the overexpression recombinant adenovirus Ad-GFP-PTENP1 or the control vector Ad-GFP for 48 h, and the infection status of the cells was observed with a fluorescence microscope at different time points. The cells were then fixed, and apoptotic cells were detected using an in situ cell death detection kit (TMR red) (Roche, Switzerland). DAPI staining reagent (Beyotime, China) was used for TUNEL staining. Six visual fields were selected from each group to calculate the positive TUNEL-stained cells. Apoptotic cells are expressed as percentages (cell count with positive TUNEL staining/cell count with positive DAPI staining) and were compared and analysed. Images were collected by fluorescence confocal microscopy.

Simultaneously, each group of cells was collected and centrifuged according to the instructions of the cell apoptosis detection kit (KeyGen Biotech. Co., Ltd., China). The cells were washed twice with PBS, resuspended in Binding Buffer, mixed evenly with Annexin V-FITC, combined with propidium iodide (PI), and incubated at room temperature for 10 min in the dark. Then, apoptosis analysis was performed by flow cytometry within 1 h.

For further analysis of HASMC apoptosis, 100 μmol/l of 30% H2O2 was added to the HASMC medium after transfection with si-PTENP1 for 6 h [26]. This experiment was divided into three groups: the control group; the H2O2 group; and the H2O2+si-PTENP1 group. Apoptotic cells were then detected by flow cytometry using an apoptosis kit following the procedures described above.

All procedures were performed separately.

Cell proliferation assay and cell cycle analysis

For the proliferation assay, HASMCs were transfected with the plasmid si-PTENP1 or the control plasmid si-scr for 48 h. Immunofluorescence staining was then performed to detect HASMC proliferation. The cells were incubated in 4% polyoxymethylene, permeabilised with 0.2% Triton X-100, and blocked with 3% BSA. A primary antibody for SMA (ab21027, Abcam; 1:100), Ki-67 (ab15580, Abcam; 1:100), or phospho-H3 (ab47297, Abcam; 1:100) was applied after washings with 10% PBS and conventional immunohistochemical dilutions [27,28]. Then, the cells were incubated with the secondary antibody for 1 h at room temperature in the dark. The secondary antibodies were goat anti-mouse antibodies labelled with Alexa Fluor dye with a maximum excitation at 488 nm (green). Polyclonal rabbit ki-67 and phospho-H3 primary antibodies were detected with a goat anti-rabbit secondary antibody labelled with Alexa Fluor 594 (red, Invitrogen). Finally, the sections were examined using a Leica SP5 laser scanning confocal microscope. The relative percentage of proliferating SMCs was defined as the ratio of the number of positive cells to the total number of cells (DAPI-stained cells) in each population. Positive cells were counted from five randomly selected fields in non-consecutive sections of five independent experiments.

For cell cycle distribution analysis, HASMCs were seeded in six-well plates for 48 h. Logarithmic-phase cells were harvested and seeded in six-well plates (1 × 106 cells/ml). After PTENP1 overexpression for 48 h, the cells were collected by centrifugation, washed with PBS, and fixed with ice-cold 75% ethanol overnight. After centrifugation, the cells were washed twice with PBS and labelled with PI by incubating with PI solution and RNase A and then incubated at 4°C for 30 min in the dark. Cell cycle analysis was performed by flow cytometry (Beckman Coulter, CytoFlex, U.S.A.) after treatment. All procedures were performed in accordance with the Cell Cycle Kit instructions (KeyGen Biotech. Co., Ltd., China), and each experiment was repeated three times.

Methods of gene transfection and AngII infusion AA model

Protocols followed the guidelines approved by the Institutional Animal Care and Use Committee of Southern Medical University. All animal care and experimental protocols were in accordance with the National Institutes of Health Guidelines for the Care and Use of Laboratory Animals. The present study was approved by the Ethics Committee of the Southern Medical University of Guangzhou, China. All animal experiments were conducted at the State Key Laboratory of Cardiovascular Organ Failure Research, Southern Hospital of Southern Medical University. Male C57BL/6J mice with normal lipid metabolism were supplied by the Laboratory Animal Center of Southern Medical University. All mice in the study were kept in pathogen-free conditions with a normal chow diet and water, under 22°C temperature, with 60–65% humidity and a light/dark cycle every 12 h (lights on at 08:00 a.m.).

AAV serotype-9 was used in the present study, which is capable of transfecting blood vessels and adult aorta. Vigene Biosciences (Jinan, Shandong, China) constructed green fluorescent protein (GFP) containing AAV-GFP-PTENP1 and AAV-GFP. C57BL/6J mice were randomly divided into AAV-GFP-PTENP1 and AAV-GFP groups, according to body weight, through the tail vein injection of AAV-GFP-PTENP1 or AAV-GFP (1 × 1012 pfu/kg). At 30 days after transfection, osmotic mini-pumps (Alzet, Model 2004, DURECT Corporation, Cupertino, CA, U.S.A.) containing Ang II (1 μg/kg/min, A9525, Sigma, St. Louis, MO, U.S.A.) were implanted in 12- to 16-week-old male C57BL/6J mice for AA model [29]. After 28 days of Ang II infusion, the mice were killed, and the abdominal aorta was obtained for immunohistochemical staining and other analyses were performed.

Aortic diameter measurements

All surviving mice were killed after the scheduled date by the intraperitoneal injection of sodium pentobarbital (40 mg.kg−1), and a ventral incision was performed to confirm the formation of AA. Under a general anatomical microscope, the abdominal aorta was separated from below the free renal artery to above the bifurcation of the iliac artery, and the aorta was separated from the root of the aorta to the end of the abdominal aorta. The aorta shape was observed on a background plate, and Vernier callipers were used to measure the maximum outer diameter of the superior aorta of the kidney. A digital camera was used to record the findings. The relative distance between the camera and the blood vessel was fixed, the imaging parameters were kept consistent, and a general image of the blood vessels was captured; measurements were independently performed using Image-Pro Plus 6.0 (Media Cybernetics), and the maximum diameter was obtained for statistical analysis. We used the established definition of human abdominal AA (AAA) to define the maximum width of the abdominal aorta over 50% of the width of the suprarenal artery of normal mice as an aneurysm [30]. Aortic rupture was identified by a blood clot in the thoracic cavity (bronchial aorta rupture) or the retroperitoneal cavity (abdominal aortic rupture). According to the experimental needs, the artery was placed in 4% paraformaldehyde perfusion; fixed, dehydrated, and paraffin embedded; or placed in a cryotube liquid nitrogen tank. Aneurysmal tissue was categorised independently by two blinded observers.

Histology and staining for elastin

After the mice were killed, each intact mouse aorta was perfused with saline and fixed with 4% paraformaldehyde for 5 min for histological analysis. Sections from the ascending aorta to the entrances of the two radial arteries were separated for macroscopic analysis. The aortic samples were fixed for 24 h and embedded in paraffin. Histological cross-sections (5 μm each) were examined at intervals of approximately 500 μm. At least ten sections were analysed per mouse. The slices were flatly fixed on a glass slide, and the fixed segments were placed at an angle of 45°C for 30 min and baked in an oven at 60–62°C for 30–60 min for elastin Verhoeff-Van Gieson (VVG) staining. The staining was scored according to the previously established elastin degradation scoring standard [20] as follows: score 1, good degradation of elastin, thin layer of elastin tissue; score 2, mild elastin degradation, laminar disruption or fracture; score 3, moderate elastin degradation, multiple interruptions or breaks in the lamina; and score 4, severe elastin fragmentation or loss or aortic rupture.

Statistical analysis

The data were analysed using SPSS v.19.0 (SPSS Inc., Chicago, IL, U.S.A.) and are presented as the mean ± SD or as the median and interquartile range (IQR, for elastin degradation score). Normality tests were assessed via Shapiro–Wilk statistics. The normally distributed data were compared by t tests for two independent groups, while differences among groups were determined using one-way analysis of variance (ANOVA) followed by the least significant difference (LSD) post hoc test. The analyses of aneurysm incidence were assessed via Fisher’s exact test. A P-value <0.05 was considered significant (the statistical approaches used in the study are shown in Supplementary Table 2).

Results

PTENP1 and PTEN expression and pathological features are altered in human aortic tissues

H&E staining showed that normal aortic tissues, including the intima, media, and adventitia, exhibited intact and continuous aortic structures. The AD specimens showed an anatomic abruption between the intima and media, which formed a thrombus (Supplementary Figure S1A). Immunohistochemical staining of SMC biomarkers MYH11 and SM22 showed that the SMCs in the normal aortic tissue were neat and tightly arranged, while the AD specimens showed low expression of these markers, and the SMCs were abruptly arranged (Supplementary Figure S1B,C). To determine whether PTENP1 is aberrantly regulated in AD, we examined PTENP1 expression in seven human AD tissues and the adjacent aortic tissues. RT-qPCR, ISH, and Western blot analyses showed that the RNA and protein expression levels of PTENP1 and PTEN, respectively, were dramatically higher in the AD samples than the normal tissue samples (Figure 1A–C). The aberrant expression patterns indicated that PTENP1 and PTEN may play pivotal regulatory roles in the development of AD. Another SMC biomarker, α-SMA, was also significantly reduced in AD samples (Figure 1D). Of note, PTENP1 expression correlated with SMC distribution. Negative control experiments for staining of PTENP1 (Supplementary Figures S2 and S6A) and SMC markers (Supplementary Figures S3–S5 and S6B) were included.

PTENP1 and PTEN are significantly up-regulated in human AD tissues

Figure 1
PTENP1 and PTEN are significantly up-regulated in human AD tissues

Seven human AD tissue and adjacent aortic tissue specimens were obtained and used in the analyses. (A) Relative expression levels of PTENP1 in human AD tissues and adjacent normal tissues as determined via qRT-PCR; the normalisation gene was β-actin. (B) Relative expression levels of PTEN in AD tissues as determined via Western blot. Western blot data were obtained from five independent culture experiments in triplicate. (C) ISH of PTENP1 (blue-violet) (scale bars, 50 μm). (D) Immunohistochemistry staining and quantification of SMC α-actin (α-SMA, brown). Five different fields of view were randomly selected from each section, and histopathological parameters (α-SMA expression) were quantitatively analysed. For positive tan granules, the ratio of Iod/Area was calculated (the rest of the results are shown in the Supplementary Figures) (scale bars, 200 and 50 µm). The data are presented as the mean ± SD; *P<0.05.

Figure 1
PTENP1 and PTEN are significantly up-regulated in human AD tissues

Seven human AD tissue and adjacent aortic tissue specimens were obtained and used in the analyses. (A) Relative expression levels of PTENP1 in human AD tissues and adjacent normal tissues as determined via qRT-PCR; the normalisation gene was β-actin. (B) Relative expression levels of PTEN in AD tissues as determined via Western blot. Western blot data were obtained from five independent culture experiments in triplicate. (C) ISH of PTENP1 (blue-violet) (scale bars, 50 μm). (D) Immunohistochemistry staining and quantification of SMC α-actin (α-SMA, brown). Five different fields of view were randomly selected from each section, and histopathological parameters (α-SMA expression) were quantitatively analysed. For positive tan granules, the ratio of Iod/Area was calculated (the rest of the results are shown in the Supplementary Figures) (scale bars, 200 and 50 µm). The data are presented as the mean ± SD; *P<0.05.

PTENP1 promotes HASMC apoptosis

SMC loss is a typical pathological feature of AD, and apoptosis is the key physiological mechanism leading to this loss. Therefore, we investigated the role of PTENP1 in HASMC apoptosis. Recombinant adenovirus vectors carrying Ad-GFP-PTENP1 (PTENP1) or Ad-GFP (vector) were transfected into HASMCs and were compatible with the cells (Supplementary Figure S7A). The overexpression plasmid (PTENP1) and siRNA (si-PTENP1) of PTENP1 were separately transfected into HASMCs, and the efficiency of both was verified by qRT-PCR (Supplementary Figure S7B,C). Through the vectors, PTENP1 overexpression was successfully induced in HASMCs and confirmed by PCR analysis (Supplementary Figure S7B). TUNEL results showed that HASMC apoptosis was obviously increased as PTENP1 was up-regulated (Figure 2A). Annexin V-FITC/PI staining and flow cytometry further confirmed that PTENP1 dramatically induced cell death, predominantly in the form of apoptosis, including early-phase and late-phase apoptosis (Figure 2B). Then, cultured HASMCs were treated with H2O2 to mimic oxidative stress. Annexin V-FITC/PI staining and flow cytometry showed that H2O2 treatment decreased HASMC viability, which was reversed by si-PTENP1, indicating that PTENP1 knockdown could mitigate H2O2-induced HASMC apoptosis (Figure 2C). Cleaved-caspase 3 (cleaved-casp3), a known key factor in the apoptotic machinery, was activated when PTENP1 was overexpressed (Figure 2D). Therefore, the above results suggested that PTENP1 promotes HASMC apoptosis.

Effects of PTENP1 modulation on HASMC apoptosis

Figure 2
Effects of PTENP1 modulation on HASMC apoptosis

HASMCs at 70–80% confluence were transfected with either Ad-GFP-PTENP1 (PTENP1) or Ad-GFP (vector) or left untreated (control) and were incubated for 48 h. (A) Immunofluorescence staining of DAPI (blue), SMC α-actin (α-SMA, green) and TUNEL (red) (scale bars: 100 µm, magnified images). The numbers of TUNEL+ cells were quantified from six random fields of five independent culture experiments and divided by the total number of cells (DAPI+ cells) to yield the percentage of specific positive cells. (B,C) HASMC apoptosis was evaluated by Annexin V-FITC/PI double staining and flow cytometry 48 h after (B) PTENP1 overexpression or (C) H2O2 administration and knockdown of PTENP1 (si-PTENP1). The data are from three independent culture experiments. (D) Protein expression levels of cleaved-casp3 and caspase 3 via Western blot after PTENP1 overexpression for 48 h in HASMCs. The Western blot data were from five independent culture experiments in duplicate. The data are presented as the mean ± SD; *P<0.05.

Figure 2
Effects of PTENP1 modulation on HASMC apoptosis

HASMCs at 70–80% confluence were transfected with either Ad-GFP-PTENP1 (PTENP1) or Ad-GFP (vector) or left untreated (control) and were incubated for 48 h. (A) Immunofluorescence staining of DAPI (blue), SMC α-actin (α-SMA, green) and TUNEL (red) (scale bars: 100 µm, magnified images). The numbers of TUNEL+ cells were quantified from six random fields of five independent culture experiments and divided by the total number of cells (DAPI+ cells) to yield the percentage of specific positive cells. (B,C) HASMC apoptosis was evaluated by Annexin V-FITC/PI double staining and flow cytometry 48 h after (B) PTENP1 overexpression or (C) H2O2 administration and knockdown of PTENP1 (si-PTENP1). The data are from three independent culture experiments. (D) Protein expression levels of cleaved-casp3 and caspase 3 via Western blot after PTENP1 overexpression for 48 h in HASMCs. The Western blot data were from five independent culture experiments in duplicate. The data are presented as the mean ± SD; *P<0.05.

PTENP1 knockdown promotes HASMC proliferation

Inadequate proliferation is one of the pivotal causes of HASMC loss during the formation and progression of AD. Therefore, we knocked down PTENP1 in HASMCs to investigate its role in cell proliferation. si-PTENP1 increased the fraction of phospho-H3 and Ki-67-positive HASMCs from 2.3 to 4.9% (P<0.05) and from 23.5 to 52.6% (P<0.05), respectively (Figure 3A,B), which indicates that down-regulated PTENP1 increased HASMC viability. Thus, our experiments demonstrated that PTENP1 knockdown promotes HASMC proliferation.

Effects of PTENP1 modulation on HASMC proliferation

Figure 3
Effects of PTENP1 modulation on HASMC proliferation

HASMCs at 70–80% confluence were transfected with either si-PTENP1-RNA (si-PTENP1) or si-scr-RNA (si-scr) or left untreated (control) and were incubated for 48 h. (A,B) Immunofluorescence staining of DAPI (blue), α-SMA (green), phospho-H3 (red, A) and Ki-67 (red, B) in HASMCs. The numbers of Ki-67+ or phospho-H3+ cells were quantified from five random fields and divided by the total number of cells (DAPI+ cells) to yield the percentage of specific positive cells. The data are presented as the mean ± SD from five independent culture experiments. *P<0.05.

Figure 3
Effects of PTENP1 modulation on HASMC proliferation

HASMCs at 70–80% confluence were transfected with either si-PTENP1-RNA (si-PTENP1) or si-scr-RNA (si-scr) or left untreated (control) and were incubated for 48 h. (A,B) Immunofluorescence staining of DAPI (blue), α-SMA (green), phospho-H3 (red, A) and Ki-67 (red, B) in HASMCs. The numbers of Ki-67+ or phospho-H3+ cells were quantified from five random fields and divided by the total number of cells (DAPI+ cells) to yield the percentage of specific positive cells. The data are presented as the mean ± SD from five independent culture experiments. *P<0.05.

Targeting PTENP1 influences the development of AAA

To further examine whether there is a causal relationship between PTENP1 overexpression and AAA development, we performed a PTENP1 gain-of-function study in Ang II-infused C57BL/6J mice. First, 1 × 1012 viral genome particles of AAV-GFP-PTENP1 or AAV-GFP in 100 μl of saline were randomly injected through the tail vein to C57BL/6J mice. At 30 days after transfection, the PCR results showed that the aortic expression level of PTENP1 in the AAV-GFP-PTENP1 group of mice was significantly higher than that in the AAV-GFP group (Figure 4A). After 28 days of Ang II infusion, the AAA formation rate and aortic diameter were measured in mice after euthanasia (Figure 4B–D). The results showed that the maximum diameter of the AAA in the AAV-GFP-PTENP1 group was significantly higher than that in the AAV-GFP group (Figure 4C) and that AAA formation was significantly enhanced in the AAV- GFP-PTENP1 mice (8 out of 25, 32%) compared with AAV-GFP mice (2 out of 25, 8%, P<0.05; Figure 4D). VVG staining showed that fibrin degradation was significantly increased in AAV-PTENP1 mice compared with AAV-GFP mice (Figure 4E). Immunohistochemistry results indicated that α-SMA expression decreased significantly in AAV-GFP-PTENP1 group mice compared with those in the AAV-GFP group (Figure 4F). The TUNEL experiment showed an increase in apoptosis in the AAV-GFP-PTENP1 group compared with the AAV-GFP group (Figure 4G). In summary, our results indicated that PTENP1 overexpression promoted HASMC apoptosis and exacerbated AAA formation in mice.

PTENP1 overexpression induces AAA formation in Ang II-treated C57BL/6J mice

Figure 4
PTENP1 overexpression induces AAA formation in Ang II-treated C57BL/6J mice

Male C57BL/6J mice were transfected with AAV-GFP or AAV-GFP-PTENP1 (n=25 in each group). Thirty days later, they were infused with Ang II for an additional 28 days. (A) Relative PTENP1 expression after transfection in each group (n=25 per group). (B) Representative images of macroscopic features of the aorta. (C) Maximal aortic diameter in the abdominal region (n=12 per group). (D) Statistical analysis of AAA incidence in mice (n=25 per group). (E) Representative staining of elastin and elastin degradation scores in aortas (n=12 per group). Images show the location where the most severe elastin degradation occurred (scale bars: 100 µm; magnified images). (F) Representative immunohistochemical staining and statistical analysis of aortic α-SMA expression (n=5 in each group; scale bars: 50 µm; magnified images). (G) Immunofluorescence staining of DAPI (blue), α-SMA (green) and TUNEL (red) in mice aorta (scale bars: 100 µm, magnified images). The data are presented as the mean ± SD or as the median and IQR (for elastin degradation score); *P<0.05, **P<0.01.

Figure 4
PTENP1 overexpression induces AAA formation in Ang II-treated C57BL/6J mice

Male C57BL/6J mice were transfected with AAV-GFP or AAV-GFP-PTENP1 (n=25 in each group). Thirty days later, they were infused with Ang II for an additional 28 days. (A) Relative PTENP1 expression after transfection in each group (n=25 per group). (B) Representative images of macroscopic features of the aorta. (C) Maximal aortic diameter in the abdominal region (n=12 per group). (D) Statistical analysis of AAA incidence in mice (n=25 per group). (E) Representative staining of elastin and elastin degradation scores in aortas (n=12 per group). Images show the location where the most severe elastin degradation occurred (scale bars: 100 µm; magnified images). (F) Representative immunohistochemical staining and statistical analysis of aortic α-SMA expression (n=5 in each group; scale bars: 50 µm; magnified images). (G) Immunofluorescence staining of DAPI (blue), α-SMA (green) and TUNEL (red) in mice aorta (scale bars: 100 µm, magnified images). The data are presented as the mean ± SD or as the median and IQR (for elastin degradation score); *P<0.05, **P<0.01.

PTENP1 acts as a competing endogenous RNA that positively regulates PTEN expression by targeting miR-21 in HASMCs

Previous studies have confirmed that miR-21 negatively regulates PTEN at the post-transcriptional level by binding to the 3′ UTR region of PTEN, reducing PTEN protein abundance [31–33]. We found a site for miR-21 to bind to the 3′UTR of PTENP1 or PTEN [14,25]. RNA pull-down assays with the biotin-labelled PTENP1 sense and antisense oligonucleotide probe were implemented, and the analysis showed that miR-21 bound to PTENP1 directly (Figure 5A, **P<0.05). To further determine whether PTEN and PTENP1 are direct targets of miR-21, we constructed reporter plasmids by cloning the wild-type or mutant 3′UTR of PTEN or PTENP1 downstream of a luciferase gene (Figure 5B). We co-transfected miR-21 and PTEN-WT 3′UTR or PTEN-MT 3′UTR reporter plasmids or miR-21 and PTENP1-WT 3′UTR or PTENP1-MT 3′UTR reporter plasmids into HASMCs and detected the luciferase signal. In the PTENP1-WT 3′UTR group, the luciferase signal was significantly reduced, whereas the luciferase signal of the 3′UTR mutant of the PTENP1 or PTEN reporter plasmid was not affected by the addition of miR-21 or miR-NC (Figure 5C, miR-21+PTEN-WT vs miR-NC+ UTR-NC, miR-NC+PTEN-WT, miR-NC+PTEN-MT, UTR-NC+miR-21, PTEN-MT+miR-21, *P<0.05; miR-21+PTENP1-WT vs miR-NC+UTR-NC, miR-NC+PTENP1-WT, miR-NC+PTENP1-MT, UTR-NC+miR-21, PTENP1-MT+miR-21, *P<0.05). Furthermore, in the PTENP1-WT and PTEN-WT groups, when HASMCs were co-transfected with an miR-21 inhibitor, the luciferase signal was up-regulated. As expected. transfection with the miR-21 inhibitor had no effect on the luciferase signal in the PTENP1-MT or PTEN-MT group (Figure 5D, inhibitor-miR-21+PTEN-WT vs inhibitor-miR-NC+UTR-NC, inhibitor-miR-NC+PTEN-WT, inhibitor-miR-NC+PTEN-MT, UTR-NC+inhibitor-miR-21, PTEN-MT+inhibitor-miR-21, *P<0.05; inhibitor-miR-21+PTENP1-WT vs inhibitor-miR-NC+UTR-NC, inhibitor-miR-NC+PTENP1-WT, inhibitor-miR- NC+PTENP1-MT, UTR-NC+inhibitor-miR-21, PTENP1-MT +inhibitor-miR-21, *P<0.05). These results indicate that miR-21 can directly target the predicted 3′UTR of PTENP1 and PTEN.

PTENP1 regulates PTEN by binding to miR-21 as a competing endogenous RNA

Figure 5
PTENP1 regulates PTEN by binding to miR-21 as a competing endogenous RNA

(A) Results of the RNA pull-down assays. (B) The binding sequence between miR-21 and PTENP1-WT 3′UTR and between miR-21 and PTEN-WT 3′UTR and the constructed mutant binding sites. (C) Results of the dual-luciferase reporter gene assay. HASMCs were transiently transfected with a functional miR-21 analogue (miR-21) or an invalid miR-21 analogue (miR-NC) and then transfected with a luciferase reporter containing PTEN-WT or PTEN-MT, PTENP1-WT or PTENP1-MT. Luciferase activity was analysed after 24 h. (D) Results of the dual-luciferase reporter gene assay. HASMCs were transiently transfected with a functional miR-21 inhibitor (inhibitor-miR-21) or an invalid miR-21 inhibitor (inhibitor-miR-NC) and then transfected with a luciferase reporter containing PTEN-WT or PTEN-MT, PTENP1-WT or PTENP1-MT. Luciferase activity was analysed after 24 h. (E) Immunofluorescence staining of DAPI (blue), α-SMA (green), and TUNEL (red) upon miR-21 modulation. (F) Quantitative analysis of TUNEL-positive cells. The data above represent the mean ± SD of three independent culture experiments. (G) Western blot and (H) quantitative analysis of PTEN protein expression in each group. The Western blot data are from five independent culture experiments. The data are presented as the mean ± SD; *P<0.05.

Figure 5
PTENP1 regulates PTEN by binding to miR-21 as a competing endogenous RNA

(A) Results of the RNA pull-down assays. (B) The binding sequence between miR-21 and PTENP1-WT 3′UTR and between miR-21 and PTEN-WT 3′UTR and the constructed mutant binding sites. (C) Results of the dual-luciferase reporter gene assay. HASMCs were transiently transfected with a functional miR-21 analogue (miR-21) or an invalid miR-21 analogue (miR-NC) and then transfected with a luciferase reporter containing PTEN-WT or PTEN-MT, PTENP1-WT or PTENP1-MT. Luciferase activity was analysed after 24 h. (D) Results of the dual-luciferase reporter gene assay. HASMCs were transiently transfected with a functional miR-21 inhibitor (inhibitor-miR-21) or an invalid miR-21 inhibitor (inhibitor-miR-NC) and then transfected with a luciferase reporter containing PTEN-WT or PTEN-MT, PTENP1-WT or PTENP1-MT. Luciferase activity was analysed after 24 h. (E) Immunofluorescence staining of DAPI (blue), α-SMA (green), and TUNEL (red) upon miR-21 modulation. (F) Quantitative analysis of TUNEL-positive cells. The data above represent the mean ± SD of three independent culture experiments. (G) Western blot and (H) quantitative analysis of PTEN protein expression in each group. The Western blot data are from five independent culture experiments. The data are presented as the mean ± SD; *P<0.05.

TUNEL staining and quantitative analysis were also performed to investigate the apoptosis of HASMCs transfected with PTENP1, PTENP1, and miR-NC (PTENP1+miR-NC), PTENP1 and miR-21 (PTENP1+miR-21), or HASMCs left untreated for 48 h as a control. PTENP1 overexpression resulted in dramatically enhanced apoptosis of HASMCs compared with that of the control group. Compared with the PTENP1+miR-21 group, the PTENP1+miR-NC group showed increased levels of HASMC apoptosis (Figure 5E,F, red dots). Furthermore, Western blot and PCR results revealed the regulatory effects of PTENP1 and miR-21 on PTEN expression (Figure 5G,H). PTENP1 overexpression increased the level of PTEN protein, and the PTENP1+miR-21 group had a significantly lower PTEN protein level than the PTENP1+miR-NC group (Figure 5G,H). We also explored whether miR-21 expression was influenced by PTENP1. We found that there was no significant difference of miR-21 expression in response to PTENP1 overexpression both in HASMCs and fibroblasts (Supplementary Figure S7E,F). In summary, the above results demonstrated that PTENP1 acts as a competing endogenous RNA (ceRNA) to target miR-21 in HASMCs and release PTEN expression.

PTEN is indispensable for PTENP1-regulated HASMC apoptosis

Because we found that PTENP1 promotes apoptosis in HASMCs and identified the PTENP1/miR-21/PTEN ceRNA mechanism by luciferase reporter analysis, we next explored whether the pro-apoptotic effect of PTENP1 was mediated by PTEN. Accordingly, we performed a PTEN rescue experiment. HASMCs were transfected with the siRNA (si-PTEN) of PTEN, and the efficiency was first verified by qRT-PCR (Supplementary Figure S7D). Then, we transfected HASMCs with Ad-GFP (control), Ad-GFP-PTENP1 (PTENP1), or Ad-GFP-PTENP1+si-PTEN (PTENP1+si-PTEN) and confirmed the PTEN interference efficiencies by Western blot and qRT-PCR results (Figure 6A,B). TUNEL experiments were performed 48 h later. The results showed that PTENP1 overexpression promoted apoptosis of HASMCs and that this effect was partially reversed by si-PTEN (Figure 6C,D). The PTEN rescue experiment proved that PTEN is an essential intermediate for PTENP1 to regulate HASMC apoptosis/proliferation.

PTENP1 regulates cell apoptosis via PTEN, and PTENP1 suppresses Akt phosphorylation, cyclin expression and arrests the cell cycle

Figure 6
PTENP1 regulates cell apoptosis via PTEN, and PTENP1 suppresses Akt phosphorylation, cyclin expression and arrests the cell cycle

(AD) HASMCs were transfected with Ad-GFP-PTENP1 (PTENP1), Ad-GFP-PTENP1 and si-PTEN-RNA (si-PTEN), or left untreated (control) and incubated for 48 h. (A) Western blot and (B) quantificative analysis of PTEN protein expression in each group. (C) Immunofluorescence staining of DAPI (blue), α-SMA (green), and TUNEL (red) in HASMCs. (D) Quantificative analysis of TUNEL-positive cells. The data above are from five independent culture experiments. (E,F), HASMCs were transfected with Ad-GFP-PTENP1 (PTENP1) or Ad-GFP (vector), transfected with si-PTENP1-RNA (si-PTENP1) or si-scr-RNA (si-scr), or left untreated (control) and incubated for 48 h. Western blot results and statistical analyses showing the protein levels of PTEN, phosphorylated Akt and total Akt upon PTENP1 (E), or si-PTENP1 (F) modulation. (G) Flow cytometry analysis and percentages of HASMCs in different phases of the cell cycle after the overexpression of PTENP1 for 48 h. The flow cytometry data are from three independent culture experiments. (H) Western blot and quantificative analysis of cyclin D1 and cyclin E in each group. The Western blot data are from five independent culture experiments in duplicate. The data are presented as the mean ± SD. *P<0.05.

Figure 6
PTENP1 regulates cell apoptosis via PTEN, and PTENP1 suppresses Akt phosphorylation, cyclin expression and arrests the cell cycle

(AD) HASMCs were transfected with Ad-GFP-PTENP1 (PTENP1), Ad-GFP-PTENP1 and si-PTEN-RNA (si-PTEN), or left untreated (control) and incubated for 48 h. (A) Western blot and (B) quantificative analysis of PTEN protein expression in each group. (C) Immunofluorescence staining of DAPI (blue), α-SMA (green), and TUNEL (red) in HASMCs. (D) Quantificative analysis of TUNEL-positive cells. The data above are from five independent culture experiments. (E,F), HASMCs were transfected with Ad-GFP-PTENP1 (PTENP1) or Ad-GFP (vector), transfected with si-PTENP1-RNA (si-PTENP1) or si-scr-RNA (si-scr), or left untreated (control) and incubated for 48 h. Western blot results and statistical analyses showing the protein levels of PTEN, phosphorylated Akt and total Akt upon PTENP1 (E), or si-PTENP1 (F) modulation. (G) Flow cytometry analysis and percentages of HASMCs in different phases of the cell cycle after the overexpression of PTENP1 for 48 h. The flow cytometry data are from three independent culture experiments. (H) Western blot and quantificative analysis of cyclin D1 and cyclin E in each group. The Western blot data are from five independent culture experiments in duplicate. The data are presented as the mean ± SD. *P<0.05.

PTENP1 regulates PTEN expression and Akt phosphorylation to affect the cell cycle distribution of HASMCs

PTEN can inhibit the phosphatidylinositol 3 kinase/threonine kinase (PI3K/Akt) pathway by inhibiting Akt activation [34,35]. Other evidence showed that inhibition of Akt retards cell proliferation by causing G1 arrest that correlates with cyclin D1 and cyclin E down-regulation [36,37]. Recent experiments have shown that PTEN negatively regulates the saphenous vein SMC proliferation accompanied by decreased cyclin E [38]. Therefore, we hypothesised that PTENP1 inhibits HASMC proliferation and regulates cyclins via PTEN-mediated Akt reduction. Western blot analysis showed that PTENP1 overexpression strongly enhanced PTEN protein and decreased Akt phosphorylation without significantly changing total Akt levels when compared with the control group or the vector group (Figure 6E); meanwhile, PTENP1 knockdown decreased PTEN protein levels. However, Akt phosphorylation levels were strongly enhanced without significant changes in total Akt content (Figure 6F). As shown by flow cytometry analysis, compared with the control group or the vector group, the PTENP1-overexpression group was arrested at G0/G1, and the number of cells entering the S phase and G2/M phase was significantly reduced (Figure 6G, Supplementary Figure S7, and Supplementary Table 1). At the same time, the cell cycle regulators cyclin D1 and cyclin E were significantly reduced (Figure 6H and Supplementary Figure S7G). Based on these results, we conclude that PTENP1 inhibited Akt phosphorylation, reduced the expression of cyclin D1 and cyclin E, and arrested the cell cycle, ultimately inhibiting SMC proliferation, which is consistent with the results of previous studies.

Table 1
Primer sequences for qRT-PCR
Gene  Primer sequences (5′–3′) 
PTENP1 Forward primer TTCGTCTTCTCCCCATTCCG 
 Reverse primer TGCAGGATGGAAATGGCTCT 
PTEN Forward primer CCTTCTCCATCTCCTGTGTAATCAA 
 Reverse primer GTTGACTGATGTAGGTACTAACAGCAT 
Cyclin D1 Forward primer CAAGAGTGTGGAGGCTGACG 
 Reverse primer CAACGGTAGCAGCGCAATAA 
Cyclin E Forward primer ATGCCATTCTCCTGCCTCAG 
 Reverse primer CATCCTGGCTAACACGGTGA 
GAPDH Forward primer ACGGATTTGGTCGTATTGGG 
 Reverse primer TGATTTTGGAGGGATCTTGC 
Gene  Primer sequences (5′–3′) 
PTENP1 Forward primer TTCGTCTTCTCCCCATTCCG 
 Reverse primer TGCAGGATGGAAATGGCTCT 
PTEN Forward primer CCTTCTCCATCTCCTGTGTAATCAA 
 Reverse primer GTTGACTGATGTAGGTACTAACAGCAT 
Cyclin D1 Forward primer CAAGAGTGTGGAGGCTGACG 
 Reverse primer CAACGGTAGCAGCGCAATAA 
Cyclin E Forward primer ATGCCATTCTCCTGCCTCAG 
 Reverse primer CATCCTGGCTAACACGGTGA 
GAPDH Forward primer ACGGATTTGGTCGTATTGGG 
 Reverse primer TGATTTTGGAGGGATCTTGC 

Discussion

We found that PTENP1 and PTEN were up-regulated and correlated in both human AD samples and HASMCs. Overexpression of PTENP1 in HASMCs facilitated PTEN expression, promoted cell apoptosis and inhibited cell proliferation, and PTENP1 knockdown exerted the opposite effects. PTENP1 overexpression in the C57BL/6J mouse remarkably exacerbated Ang II-induced SMC apoptosis and AA formation. Mechanistically, PTENP1 releases PTEN expression through endogenous competition with PTEN to bind miR-21, relieving the miR-21-induced suppression of PTEN, which further inhibits downstream Akt signalling and reduces cyclin D1 and cyclin E expression. Thus, our work elucidates a vital function of PTENP1 in mediating HASMC apoptosis and proliferation.

In the current study, we elucidated the contribution of PTENP1 to AD or AA formation. ISH results showed significantly up-regulated PTENP1 in human AD samples compared with healthy adjacent aorta samples, suggesting that this pseudogene is involved in AA formation. Furthermore, we demonstrated that PTENP1 suppresses HASMC proliferation and promotes apoptosis. PTENP1 overexpression substantially increased TUNEL-positive cells, suggesting an increase in HASMC apoptosis, while the cell apoptosis-associated cleaved-casp3 protein was dramatically up-regulated. In addition, PTENP1 knockdown alleviated H2O2-induced HASMC apoptosis and increased intracellular proliferation-associated factors, such as phospho-H3 and Ki-67. The above findings showed that PTENP1 inhibits HASMC proliferation and promotes apoptosis. Furthermore, PTENP1 gain- and loss-of-function experiments revealed that PTEN is a crucial mediator in SMC regulation, which is consistent with the finding that pseudogenes regulate their parental genes [39]. Given the impact of PTEN during SMC apoptosis, which largely contributes to AD or AA formation, and the PTENP1 promotion of PTEN expression, PTENP1 likely fine-tunes SMC apoptosis and proliferation via enhanced PTEN levels and may even instigate AD or AA formation. Thus, PTENP1 may be a potential target in AD or AA therapy. Of note, in the Ang II-induced mouse AA model, PTENP1 overexpression remarkably potentiated SMC apoptosis, promoted elastin degradation, and exacerbated aneurysm formation, which highlights the possibility of PTENP1 intervention in AD and AA therapy.

As an important apoptosis- and proliferation-regulating protein, PTEN is widespread in a variety of tissues and cells [6]. This non-specificity hampers the accurate artificial interference of PTEN expression. In contrast, as an lncRNA, PTENP1 is distributed in a tissue- and cell-specific manner [40], indicating this molecule may be utilised for accurate disease diagnosis with minimal off-target effects. Moreover, compared with PTEN mRNA or protein, lncRNA PTENP1 has a low abundance [41]. Thus, detection of any copies may suffice to show function, which in theory allows the use of low doses and may have few side effects. These lncRNA properties indicate that PTENP1 may have clinical significance in future treatment target selection.

We further investigated the mechanism of how PTENP1 regulates HASMC PTEN. Our results suggest that PTENP1 regulates PTEN levels by endogenously competing for the binding sites between PTEN and miR-21. To verify this hypothesis, we first analysed the binding sites of PTENP1 with miR-21 and miR-21 with PTENP1. Next, through RNA pull-down assay and a series of luciferase reporter assays, we confirmed the binding of PTENP1 to miR-21: increased PTENP1 could act as a bait to decoy miR-21, promoting the release of PTEN by reducing the interaction between miR-21 and PTEN. Correspondingly, PTENP1 knockdown led to the enhanced suppression of miR-21 on PTEN bioactivity. Moreover, our results showed that interference with miR-21 promoted PTEN expression, while interference with PTENP1 reversed this effect. Our finding that PTENP1 regulates its homologous gene PTEN in HASMCs by acting as a sponge for miR-21 is supported by a clear-cell renal cell carcinoma model, where PTENP1 suppresses cancer progression through a ceRNA mechanism [14]. Thus, our findings highlight the potential of PTENP1 suppression in protecting against or decreasing SMC apoptosis through repressing PTEN expression. Given the established evidence that (i) PTEN promotes SMC apoptosis and (ii) miR-21 regulates SMC PTEN content in combination with (iii) the potential regulation of pseudogenes on their parental genes, our study reveals the PTENP1/miR-21 regulation of PTEN expression. With regard to interference with PTENP1, the majority of studies have indicated that PTENP1 merely functions within the PTEN pathway [14,17,42–44], possibly due to the high (over 95%) homology in the 3′UTR between PTENP1 and PTEN. This specificity indicates that PTENP1 may have value in clinical settings, especially in disease treatment.

The current study has some limitations. First, given the participation of lncRNAs in various biological and pathological conditions, such as their role as scaffolding regulatory proteins and promoting or inhibiting gene transcription and translation [45,46], determination of whether PTENP1 directly regulates PTEN expression regardless of the intermediate miR-21 will enrich our understanding of the effects of PTENP1/PTEN on SMC function. Third, considering that the pseudogene and its corresponding coding gene could interact mutually, it is important to determine whether human PTENP1 is also regulated by PTEN when exploring the source of elevated PTENP1, which will further elucidate the pseudogene/parental gene interaction.

In summary, we identified the up-regulation of PTENP1 and PTEN in human AD tissues and confirmed that the pseudogene PTENP1 facilitates PTEN expression in HASMCs via competitively sponging miR-21. Enhanced PTEN further suppresses the Akt level and decreases cyclin D1 and cyclin E expression levels, eventually promoting HASMC proliferation and alleviating apoptosis and the formation of an aneurysm. Our work supports more detailed future studies by providing a novel molecular basis underlying AD or AA formation and progression.

Clinical perspectives

  • Current studies revealed that PTEN participates in AA dilation through inhibition of SMC proliferation and promotion of SMC apoptosis. PTENP1 is the pseudogene of PTEN. However, it is unclear whether and how PTENP1 functions in the HASMCs.

  • The expression of PTENP1 and PTEN were up-regulated in human AD tissues. PTENP1 facilitates PTEN expression in HASMCs via competitively sponging miR-21, suppressesing the PI3K/Akt pathway and decreasesing cyclin D1 and cyclin E, eventually alleviating HASMC proliferation and promoting apoptosis. In an Ang II-induced mouse AA model, PTENP1 overexpression potentiated aortic SMC apoptosis and exacerbated aneurysm formation.

  • Our study identified PTENP1 as a mediator of HASMC homeostasis and suggests that PTENP1 is a potential target in AD or AA intervention.

Competing Interests

The authors declare that there are no competing interests associated with the manuscript.

Funding

This work was supported by the National Natural Science Foundation of China [grant numbers 81771857, 81571698 (to Jianping Bin)].

Author Contribution

Yanxian Lai, Jianyong Li and Jianping Bin designed the study. Lintao Zhong, Xiang He and Xiaoyun Si acquired the data. Jianyong Li and Yanmei Chen analysed the data. Yanxian Lai, Lintao Zhong, Xiang He, Yinlan Hu and Bing Lia provided technical or material support. Cheng Liu, Jiayuan Zhong, Wangjun Liao and Yulin Liao performed the statistical analysis. Yanxian Lai, Lintao Zhong and Yili Sun drafted the manuscript. Jianping Bin and Jiancheng Xiu obtained the funding.

Abbreviations

     
  • AA

    aortic aneurysm

  •  
  • AAA

    abdominal AA

  •  
  • AD

    aortic dissection

  •  
  • Ang II

    angiotensin II

  •  
  • Area

    positive area

  •  
  • ceRNA

    competing endogenous RNA

  •  
  • cleaved-casp3

    cleaved-caspase 3

  •  
  • GFP

    green fluorescent protein

  •  
  • HASMC

    human aortic smooth muscle cell

  •  
  • H&E

    Haematoxylin and Eosin

  •  
  • H2O2

    hydrogen peroxide

  •  
  • Iod

    integrated optical density

  •  
  • ISH

    in situ hybridisation

  •  
  • lncRNA

    long non-coding RNA

  •  
  • MYH11

    myosin-11

  •  
  • PI

    propidium iodide

  •  
  • PI3K/Akt

    phosphatidylinositol 3 kinase/threonine kinase

  •  
  • PTEN

    phosphatase and tensin homologue deleted on chromosome ten

  •  
  • PTENP1

    pseudogene of PTEN

  •  
  • qRT-PCR

    quantitative reverse transcription-PCR

  •  
  • siRNA

    small interfering RNA

  •  
  • SMC

    smooth muscle cell

  •  
  • SM22

    smooth muscle 22

  •  
  • UTR

    untranslated region

  •  
  • VVG

    Verhoeff-Van Gieson

  •  
  • α-SMA

    α-smooth muscle actin

References

References
1.
Leeper
N.J.
and
Maegdefessel
L.
(
2018
)
Non-coding RNAs: key regulators of smooth muscle cell fate in vascular disease
.
Cardiovasc. Res.
114
,
611
621
[PubMed]
2.
Owens
G.K.
,
Kumar
M.S.
and
Wamhoff
B.R.
(
2004
)
Molecular regulation of vascular smooth muscle cell differentiation in development and disease
.
Physiol. Rev.
84
,
767
801
[PubMed]
3.
Rowe
V.L.
,
Stevens
S.L.
,
Reddick
T.T.
,
Freeman
M.B.
,
Donnell
R.
,
Carroll
R.C.
et al. .
(
2000
)
Vascular smooth muscle cell apoptosis in aneurysmal, occlusive, and normal human aortas
.
J. Vasc. Surg.
31
,
567
576
[PubMed]
4.
Li
D.Y.
,
Busch
A.
,
Jin
H.
,
Chernogubova
E.
,
Pelisek
J.
,
Karlsson
J.
et al. .
(
2018
)
H19 induces abdominal aortic aneurysm development and progression
.
Circulation
138
,
1551
1568
5.
Shi
X.
,
Sun
M.
,
Liu
H.
,
Yao
Y.
and
Song
Y.
(
2013
)
Long non-coding RNAs: a new frontier in the study of human diseases
.
Cancer Lett.
339
,
159
166
[PubMed]
6.
Johnsson
P.
,
Ackley
A.
,
Vidarsdottir
L.
,
Lui
W.O.
,
Corcoran
M.
,
Grander
D.
et al. .
(
2013
)
A pseudogene long-noncoding-RNA network regulates PTEN transcription and translation in human cells
.
Nat. Struct. Mol. Biol.
20
,
440
446
[PubMed]
7.
Rutnam
Z.J.
,
Du
W.W.
,
Yang
W.
,
Yang
X.
and
Yang
B.B.
(
2014
)
The pseudogene TUSC2P promotes TUSC2 function by binding multiple microRNAs
.
Nat. Commun.
5
,
2914
[PubMed]
8.
Gong
T.
,
Zheng
S.
,
Huang
S.
,
Fu
S.
,
Zhang
X.
,
Pan
S.
et al. .
(
2017
)
PTENP1 inhibits the growth of esophageal squamous cell carcinoma by regulating SOCS6 expression and correlates with disease prognosis
.
Mol. Carcinog.
56
,
2610
2619
[PubMed]
9.
Yndestad
S.
,
Austreid
E.
,
Skaftnesmo
K.O.
,
Lonning
P.E.
and
Eikesdal
H.P.
(
2018
)
Divergent activity of the pseudogene PTENP1 in ER-positive and negative breast cancer
.
Mol. Cancer Res.
16
,
78
89
[PubMed]
10.
Weng
W.
,
Ni
S.
,
Wang
Y.
,
Xu
M.
,
Zhang
Q.
,
Yang
Y.
et al. .
(
2017
)
PTTG3P promotes gastric tumour cell proliferation and invasion and is an indicator of poor prognosis
.
J. Cell. Mol. Med.
21
,
3360
3371
[PubMed]
11.
Poliseno
L.
,
Haimovic
A.
,
Christos
P.J.
,
Vega
Y.S.d.M.E.C.
,
Shapiro
R.
,
Pavlick
A.
et al. .
(
2011
)
Deletion of PTENP1 pseudogene in human melanoma
.
J. Invest. Dermatol.
131
,
2497
2500
[PubMed]
12.
Poliseno
L.
,
Salmena
L.
,
Zhang
J.
,
Carver
B.
,
Haveman
W.J.
and
Pandolfi
P.P.
(
2010
)
A coding-independent function of gene and pseudogene mRNAs regulates tumour biology
.
Nature
465
,
1033
1038
[PubMed]
13.
Maegdefessel
L.
,
Azuma
J.
,
Toh
R.
,
Deng
A.
,
Merk
D.R.
,
Raiesdana
A.
et al. .
(
2012
)
MicroRNA-21 blocks abdominal aortic aneurysm development and nicotine-augmented expansion
.
Sci. Transl. Med.
4
,
122ra22
[PubMed]
14.
Yu
G.
,
Yao
W.
,
Gumireddy
K.
,
Li
A.
,
Wang
J.
,
Xiao
W.
et al. .
(
2014
)
Pseudogene PTENP1 functions as a competing endogenous RNA to suppress clear-cell renal cell carcinoma progression
.
Mol. Cancer Ther.
13
,
3086
3097
[PubMed]
15.
Fujii
G.H.
,
Morimoto
A.M.
,
Berson
A.E.
and
Bolen
J.B.
(
1999
)
Transcriptional analysis of the PTEN/MMAC1 pseudogene, psiPTEN
.
Oncogene
18
,
1765
1769
[PubMed]
16.
Dahia
P.L.
,
FitzGerald
M.G.
,
Zhang
X.
,
Marsh
D.J.
,
Zheng
Z.
,
Pietsch
T.
et al. .
(
1998
)
A highly conserved processed PTEN pseudogene is located on chromosome band 9p21
.
Oncogene
16
,
2403
2406
[PubMed]
17.
Chen
C.L.
,
Tseng
Y.W.
,
Wu
J.C.
,
Chen
G.Y.
,
Lin
K.C.
,
Hwang
S.M.
et al. .
(
2015
)
Suppression of hepatocellular carcinoma by baculovirus-mediated expression of long non-coding RNA PTENP1 and MicroRNA regulation
.
Biomaterials
44
,
71
81
[PubMed]
18.
Chen
S.
,
Wang
Y.
,
Zhang
J.H.
,
Xia
Q.J.
,
Sun
Q.
,
Li
Z.K.
et al. .
(
2017
)
Long non-coding RNA PTENP1 inhibits proliferation and migration of breast cancer cells via AKT and MAPK signaling pathways
.
Oncol. Lett.
14
,
4659
4662
[PubMed]
19.
Guo
X.
,
Deng
L.
,
Deng
K.
,
Wang
H.
,
Shan
T.
,
Zhou
H.
et al. .
(
2016
)
Pseudogene PTENP1 suppresses gastric cancer progression by modulating PTEN
.
Anticancer Agents Med. Chem.
16
,
456
464
[PubMed]
20.
Garl
P.J.
,
Wenzlau
J.M.
,
Walker
H.A.
,
Whitelock
J.M.
,
Costell
M.
and
Weiser-Evans
M.C.
(
2004
)
Perlecan-induced suppression of smooth muscle cell proliferation is mediated through increased activity of the tumor suppressor PTEN
.
Circ. Res.
94
,
175
183
[PubMed]
21.
Ravi
Y.
,
Selvendiran
K.
,
Naidu
S.K.
,
Meduru
S.
,
Citro
L.A.
,
Bognar
B.
et al. .
(
2013
)
Pulmonary hypertension secondary to left-heart failure involves peroxynitrite-induced downregulation of PTEN in the lung
.
Hypertension
61
,
593
601
[PubMed]
22.
Guo
S.
,
Shen
S.
,
Wang
J.
,
Wang
H.
,
Li
M.
,
Liu
Y.
et al. .
(
2015
)
Detection of high-risk atherosclerotic plaques with ultrasound molecular imaging of glycoprotein IIb/IIIa receptor on activated platelets
.
Theranostics
5
,
418
430
[PubMed]
23.
Li
X.
,
He
X.
,
Wang
H.
,
Li
M.
,
Huang
S.
,
Chen
G.
et al. .
(
2018
)
Loss of AZIN2 splice varian facilitates endogenous cardiac regeneration
.
Cardiovasc. Res.
144
,
1642
1655
24.
Emeto
T.I.
,
Moxon
J.V.
,
Biros
E.
,
Rush
C.M.
,
Clancy
P.
,
Woodward
L.
et al. .
(
2014
)
Urocortin 2 is associated with abdominal aortic aneurysm and mediates anti-proliferative effects on vascular smooth muscle cells via corticotrophin releasing factor receptor 2
.
Clin. Sci. (Lond.)
126
,
517
527
[PubMed]
25.
Gao
L.
,
Ren
W.
,
Zhang
L.
,
Li
S.
,
Kong
X.
,
Zhang
H.
et al. .
(
2017
)
PTENp1, a natural sponge of miR-21, mediates PTEN expression to inhibit the proliferation of oral squamous cell carcinoma
.
Mol. Carcinog.
56
,
1322
1334
[PubMed]
26.
Wang
Y.N.
,
Shan
K.
,
Yao
M.D.
,
Yao
J.
,
Wang
J.J.
,
Li
X.
et al. .
(
2016
)
Long noncoding RNA-GAS5: a novel regulator of hypertension-induced vascular remodeling
.
Hypertension
68
,
736
748
[PubMed]
27.
Cafueri
G.
,
Parodi
F.
,
Pistorio
A.
,
Bertolotto
M.
,
Ventura
F.
,
Gambini
C.
et al. .
(
2012
)
Endothelial and smooth muscle cells from abdominal aortic aneurysm have increased oxidative stress and telomere attrition
.
PLoS ONE
7
,
e35312
[PubMed]
28.
Ryer
E.J.
,
Garvin
R.P.
,
Schworer
C.M.
,
Bernard-Eckroth
K.R.
,
Tromp
G.
,
Franklin
D.P.
et al. .
(
2015
)
Proinflammatory role of stem cells in abdominal aortic aneurysms
.
J. Vasc. Surg.
62
,
1303
1311.e4
29.
Trivedi
D.B.
,
Loftin
C.D.
,
Clark
J.
,
Myers
P.
,
DeGraff
L.M.
,
Cheng
J.
et al. .
(
2013
)
beta-Arrestin-2 deficiency attenuates abdominal aortic aneurysm formation in mice
.
Circ. Res.
112
,
1219
1229
[PubMed]
30.
Vieira
G.L.T.
,
Lossie
A.C.
,
Lay
D.C.
Jr
,
Radcliffe
J.S.
and
Garner
J.P.
(
2017
)
Preventing, treating, and predicting barbering: A fundamental role for biomarkers of oxidative stress in a mouse model of Trichotillomania
.
PLoS ONE
12
,
e0175222
[PubMed]
31.
Meng
F.
,
Henson
R.
,
Wehbe-Janek
H.
,
Ghoshal
K.
,
Jacob
S.T.
and
Patel
T.
(
2007
)
MicroRNA-21 regulates expression of the PTEN tumor suppressor gene in human hepatocellular cancer
.
Gastroenterology
133
,
647
658
[PubMed]
32.
Ji
R.
,
Cheng
Y.
,
Yue
J.
,
Yang
J.
,
Liu
X.
,
Chen
H.
et al. .
(
2007
)
MicroRNA expression signature and antisense-mediated depletion reveal an essential role of MicroRNA in vascular neointimal lesion formation
.
Circ. Res.
100
,
1579
1588
[PubMed]
33.
Li
W.
,
Zhang
T.
,
Guo
L.
and
Huang
L.
(
2018
)
Regulation of PTEN expression by noncoding RNAs
.
J. Exp. Clin. Cancer Res.
37
,
223
[PubMed]
34.
Haddadi
N.
,
Lin
Y.
,
Travis
G.
,
Simpson
A.M.
,
Nassif
N.T.
and
McGowan
E.M.
(
2018
)
PTEN/PTENP1: ‘Regulating the regulator of RTK-dependent PI3K/Akt signalling’, new targets for cancer therapy
.
Mol. Cancer
17
,
37
[PubMed]
35.
Manning
B.D.
and
Toker
A.
(
2017
)
AKT/PKB signaling: navigating the network
.
Cell
169
,
381
405
[PubMed]
36.
Kunter
I.
,
Erdal
E.
,
Nart
D.
,
Yilmaz
F.
,
Karademir
S.
,
Sagol
O.
et al. .
(
2014
)
Active form of AKT controls cell proliferation and response to apoptosis in hepatocellular carcinoma
.
Oncol. Rep.
31
,
573
580
[PubMed]
37.
Dan
S.
,
Yoshimi
H.
,
Okamura
M.
,
Mukai
Y.
and
Yamori
T.
(
2009
)
Inhibition of PI3K by ZSTK474 suppressed tumor growth not via apoptosis but G0/G1 arrest
.
Biochem. Biophys. Res. Commun.
379
,
104
109
[PubMed]
38.
Jia
G.
,
Mitra
A.K.
,
Gangahar
D.M.
and
Agrawal
D.K.
(
2009
)
Regulation of cell cycle entry by PTEN in smooth muscle cell proliferation of human coronary artery bypass conduits
.
J. Cell. Mol. Med.
13
,
547
554
[PubMed]
39.
Xiao-Jie
L.
,
Ai-Mei
G.
,
Li-Juan
J.
and
Jiang
X.
(
2015
)
Pseudogene in cancer: real functions and promising signature
.
J. Med. Genet.
52
,
17
24
[PubMed]
40.
Bristow
J.
,
Gitelman
S.E.
,
Tee
M.K.
,
Staels
B.
and
Miller
W.L.
(
1993
)
Abundant adrenal-specific transcription of the human P450c21A ‘pseudogene’
.
J. Biol. Chem.
268
,
12919
12924
[PubMed]
41.
Guo
X.
,
Lin
M.
,
Rockowitz
S.
,
Lachman
H.M.
and
Zheng
D.
(
2014
)
Characterization of human pseudogene-derived non-coding RNAs for functional potential
.
PLoS ONE
9
,
e93972
[PubMed]
42.
Qian
Y.Y.
,
Li
K.
,
Liu
Q.Y.
and
Liu
Z.S.
(
2017
)
Long non-coding RNA PTENP1 interacts with miR-193a-3p to suppress cell migration and invasion through the PTEN pathway in hepatocellular carcinoma
.
Oncotarget
8
,
107859
107869
[PubMed]
43.
Zhang
R.
,
Guo
Y.
,
Ma
Z.
,
Ma
G.
,
Xue
Q.
,
Li
F.
et al. .
(
2017
)
Long non-coding RNA PTENP1 functions as a ceRNA to modulate PTEN level by decoying miR-106b and miR-93 in gastric cancer
.
Oncotarget
8
,
26079
26089
[PubMed]
44.
Wang
L.
,
Zhang
N.
,
Wang
Z.
,
Ai
D.M.
,
Cao
Z.Y.
and
Pan
H.P.
(
2016
)
Pseudogene PTENP1 functions as a competing endogenous RNA (ceRNA) to regulate PTEN expression by sponging miR-499-5p
.
Biochemistry (Mosc.)
81
,
739
747
[PubMed]
45.
Batista
P.J.
and
Chang
H.Y.
(
2013
)
Long noncoding RNAs: cellular address codes in development and disease
.
Cell
152
,
1298
1307
[PubMed]
46.
Engreitz
J.M.
,
Ollikainen
N.
and
Guttman
M.
(
2016
)
Long non-coding RNAs: spatial amplifiers that control nuclear structure and gene expression
.
Nat. Rev. Mol. Cell Biol.
17
,
756
770
[PubMed]

Author notes

*

Co-authors (these authors contributed equally to this work).