Abstract

Acute kidney injury (AKI) is a destructive clinical condition induced by multiple insults including ischemic reperfusion, nephrotoxic drugs and sepsis. It is characterized by a sudden decline in renal function, in addition to excessive inflammation, oxidative stress and programmed cell death of renal tubular epithelial cells. RIPK1-mediated necroptosis plays an important role in AKI. In the present study, we evaluated the treatment effects of Compound-71 (Cpd-71), a novel RIPK1 inhibitor, by comparing with Necrostatin-1 (Nec-1), a classic RIPK1 inhibitor, which has several drawbacks like the narrow structure–activity relationship (SAR) profile, moderate potency and non-ideal pharmacokinetic properties, in vivo and in vitro. Our results showed that pretreatment of Cpd-71 attenuated cisplatin-induced renal injury, restored renal function and suppressed renal inflammation, oxidative stress and cell necroptosis. In addition, Cpd-71 inhibited renal damage while reducing the up-regulated serum creatinine (Cr) and blood urea nitrogen (BUN) levels in established AKI mice model. Consistently, we confirmed that Cpd-71 exhibited more effectively suppressive effect on cisplatin-induced renal tubular cell necroptosis than Nec-1, by physically binding to the allosteric type III ligand binding site of RIPK1, thereby reduced RIPK1 kinase activity, RIPK1/RIPK3 complex formation and phosphor-MLKL membrane translocation by molecular docking, Western blot, co-immunoprecipitation and cellular thermal shift assay (CETSA). Taken together, we currently showed that targeting RIPK1 with Cpd-71 may serve as a promising clinical candidate for AKI treatment.

Introduction

Acute kidney injury (AKI), characterized by an abrupt loss of kidney function, is a devastating clinical condition induced by insults like ischemic reperfusion, nephrotoxic drugs and sepsis [1,2]. As one of the most common complications in hospitalized patients, AKI shows a rapidly increasing incidence specially in the elderly with high morbidity and mortality, which it accounts for approximately 2 million deaths per year worldwide [3–5]. Despite a certain percentage of renal repair and recovery, severe or repeated AKI may transit into chronic kidney disease (CKD) or even end-stage renal disease [6,7]. In this regard, potential biomarkers and effective therapy are urgently needed for the treatment of AKI.

Many types of resident and infiltrated cells are involved in pathophysiology of AKI [2]. In response to ischemic or nephrotoxic insults, tubular cells often undergo a series of intracellular changes involving oxidative stress [8], mitochondrial dysfunction [9] and programmed cell death [10–12]. Necroptosis is a type of programmed cell death mediated by RIPK/MLKL signaling. As the key molecule for initiating necroptosis, RIPK1 forms the complex I with type 1 TNF receptor 1 (TNFR1), TNFR1-associated death domain protein (TRADD) and TNFR-associated factor 2 (TRAF-2) via death domain, thereby induces necroptosis by forming RIPK1/RIPK3/MLKL necrosome in absence of caspase 8 [13,14]. Necroptosis plays a significant role in different types of diseases like stroke [15], myocardial infarction [16], ischemia–reperfusion (I/R) injury [17,18], atherosclerosis [19], drug-induced liver injury [20], extran sulfate sodium-induced colitis [21] etc.

Previous studies showed that necroptosis played critical roles in inducing damage in multiple renal disease models, and knockout or pharmacologically blockade of necroptosis regulatory molecules like RIPK1, RIPK3 and MLKL alleviated renal injury [22–25]. Necrostatin-1 (Nec-1), a classic RIPK1 inhibitor, prevents RIPK1 activation with high kinase selectivity by directly binding to an allosteric pocket next to the kinase active site [26]. However, Nec-1 failed to be applied in clinic due to several drawbacks like poor metabolic stability and a narrow structure–activity relationship (SAR) profile [27–29], although it showed merits in animal models of AKI [30–32]. In our recent work, we focused on exploring novel RIPK1 inhibitors with high efficiency and safety. A very recent study published in top journal of medicinal chemistry identified a compound, termed as compound 71 (Cpd-71), showed a stronger affinity for RIPK1 compared with Nec-1 and inhibited TNF-induced necroptosis both in vitro and in TNF-induced systemic inflammatory response syndrome model [28]. However, whether Cpd-71 is a renoprotective agent and promising therapeutic molecule for AKI has been unexplored. We currently tested the anti-necroptotic effect of Cpd-71 in cisplatin-induced tubular epithelial cells while determining its protective effect on inflammation and oxidative stress compared with Nec-1. More importantly, we evaluated the effects of Cpd-71 using different dose and time administration protocols of this compound in cisplatin-treated mice.

Materials and methods

Reagents and materials

Compound-71(N-(4-((4-((5-methyl-1H-pyrazol-3-yl)amino)-6-morpholinopyrimidin-2-yl)amino)phenyl)cyclopropanecarboxamide, (Cpd-71)), a derivative of the Aurora kinase inhibitor tozasertib, was discovered by Augustyns et al. through optimization of tozasertib to increase the inhibitory activity of RIPK1 meanwhile to decrease the effect on Aurora kinase [28]. Cpd-71, used for the present study, was synthesized according to the procedures in the literature. Briefly, starting from 2,4,6-trichloropyrimidines, 5-methyl-1H-pyrazol-3-yl)amino was introduced to the 4-position of pyrimidine, followed by reaction with morpholine at 6-position of pyrimidine in the presence of piperidine. Subsequently, the intermediate was reacted with N-(4-aminophenyl)cyclopropanecarboxamide to give the crude product. Finally, the crude product was further purified by flash-column chromatography to give the title compound Cpd-71. The chemical structure of synthesized Cpd-71 was confirmed by 1H-nuclear magnetic resonance (NMR) and high resolution mass spectrometry (HRMS), which was consistent with the original literature [28]. The purity of Cpd-71 was more than 95% which was determined by HPLC.

The antibodies specific for RIPK1, RIPK3, TNF-α, KIM1 and β-actin were purchased from Santa Cruz Biotechnology (Santa Cruz, CA, U.S.A.). Anti-Nox4 was purchased from BiossBiotechnology (Bioss, Beijing, China). According to the manufacturer’s instructions and our preliminary experiment, anti-KIM1 (1:200), anti-TNF-α (1:200) and anti-RIPK1 (1:200) were diluted in 1% BSA/PBS solution and then used in IHC and immunofluorescence (IF) staining, respectively. Rabbit anti-p-MLKL was obtained from Cell Signaling Technology (CST, Danvers, MA, U.S.A.). Lipofectamine 2000 was purchased from SciencBio Technology (Invitrogen, Carlsbad, CA, U.S.A.). Cisplatin was purchased from Sigma–Aldrich (Sigma, CA, U.S.A.). Nec-1 was obtained from Santa Cruz Biotechnology (Santa Cruz, CA, U.S.A.). Recombinant human TNF-α and zVAD-fmk (herein referred to as zVAD) were purchased from R&D System (Minneapolis, MN, U.S.A.). Protein Assay Kit was bought from Beyotime Institute of Biotechnology (Jiangsu, China). Periodic acid–Schiff (PAS), Cell Malondialdehyde (MDA) assay kit (Colorimetric method), reduced glutathione (GSH) assay kit, Creatinine (Cr) Assay kit and blood urea nitrogen (BUN) assay kit were obtained from Jiancheng Bioengineering Institute (Nanjing, China). Reactive Oxygen Species Assay (DCF Assay) Kit and Dihydroethidium (DHE) were purchased from Beyotime Institute of Biotechnology (Jiangsu, China).

Model of cisplatin-induced AKI

Male C57BL/6J mice (approximately 20–22 g) were provided by the Experimental Animal Center, Anhui Medical University. All animal procedures were approved by the Animal Experimentation Ethics Committee from Anhui Medical University, Anhui, China. All animal experiments were conducted at Anhui Medical University. Mice were intraperitoneally injected with a single dose of cisplatin at 20 mg/kg. In protocol I, Cpd-71, concentrations of 0.825, 1.65 and 3.3 mg/kg, were given via intraperitoneal injection 12 h before cisplatin administration and then injected once daily. In protocol II, Cpd-71 was intraperitoneally injected 24 h after cisplatin injection and then injected once daily. Mice were killed under anesthesia 3 days after cisplatin injection. The kidney tissues and blood were collected for further analysis. Blood was collected for BUN and Cr measurements according to the manufacturer’s instructions. Kidneys were harvested for paraffin embedding, molecular analysis and electron microscopy studies. Paraffin sections (4 μm) were stained with PAS Staining kit (Fuzhou Maixin Biotech. Co., Ltd.). At least six independent experiments were performed throughout the study.

Cell culture

Human kidney tubular epithelial cells (HK2) were cultured in DMEM-F12 (5% FBS). Cells were pretreated respectively with Cpd-71 (0.1, 0.2 and 0.4 μM) for 12 h before being exposed to cisplatin (20 μM) for 24 h. At least three independent experiments were performed throughout the study.

Cell viability assay

Cell viability was determined by MTT assay. According to a purple formazan product produced by mitochondrial dehydrogenase of viable cells, HK2 cells were seeded in 96-well plates and cultured with a set of concentrations of Cpd-71 (arranged from 0.1 to 12.8 μM) for 24 h with or without administration of cisplatin (20 μM), respectively. Then 5 mg/ml MTT solution was added to each well and incubated at 37°C for 4 h. After supernatant was removed, 150 μl of DMSO was used to dissolve formazan crystals. Optical density (OD) detection was performed at 492-nm wavelength (Multiskan MK3, Thermo, U.S.A.).

Determination of MDA and GSH

The levels of MDA and GSH in cell or in mouse serum were measured with a commercial kit (Jiancheng Co., Nanjing, China) according to the manufacturer’s instructions. Thiobarbituric acid reacts with MDA, degradation product of lipid peroxidation in, to generate red compound which has maximum absorbance at 532 nm wavelength. 5,5-dithiobis-2-nitrobenzoic acid (DTNB) reacts with sulfhydryl compounds to generate a yellow compound, whose absorption peaks at 405 nm wavelength. GSH concentration was determined based on the absorbance of yellow compound.

Reactive oxygen species determination

The level of intracellular reactive oxygen species (ROS) was measured using a fluorescent dye 2′,7′-dichlorofluorescein diacetate (DCFH-DA). Briefly, cells were incubated with DCFH-DA (10 μl/l) for 20 min at 37°C. After washing with serum-free medium, cells were imaged on a fluorescence microscope at 488 nm (Leica, Bensheim, Germany). The oxidation of DHE, ethidium bound to DNA and fluorescent red, was also used to estimate intracellular ROS levels. Cells were incubated with 5 mM freshly prepared DHE solution (Beyotime, Jiangsu, China) for 30 min at 37°C. After washing with serum-free medium then measured under fluorescence microscopy.

Cellular thermal shift assay

Cellular thermal shift assay (CETSA) was conducted according to the protocol as previously described [33]. Mice were intraperitoneally injected with Cpd-71 or vehicle control. One hour after drug administration, mice were killed under anesthesia and kidney tissues were collected. The samples were added to RIPA lysis buffer, and were homogenized with tissue breaker (Tissue-prp, Shanghai, China) using 3.0 mm zirconium under chilled conditions. Total protein adjusted with the same concentration was quantified by Protein Assay Kit (Beyotime, Jiangsu, China). Then, it was distributed equally into different PCR tubes and denatured the samples at various temperatures for 8 min on PCR instrument (Eppendorf, Germany), and freeze-thawed the samples three times using liquid nitrogen. Samples were centrifuged and the supernatants were analyzed by Western blot.

Molecular docking

Molecular docking study was performed using Discovery Studio 2017 R2 (DS, BIOVIA Software, Inc., San Diego, CA, United States) to gain an insight into the possible binding interaction between Cpd-71 and RIPK1. Crystal structure of RIPK1 kinase (PDB 6HHOco-crystallized with G4W) was obtained from the Protein Data Bank. The structure of RIPK1 kinase derived from the complex 6HHO was prepared through the Protein Preparation protocol. And the hydrogen atoms and CHARMm force fields were then added. The entire RIPK1 kinase was defined as a receptor. The binding site was specified by the center of co-crystallized ligand G4W. Molecular Cpd-71 energy minimization was used the Minimize Ligands protocol and docking program was performed by CDOCKER module. Other parameters were set as default.

Western blot analysis

Proteins were separated from pulverized tissue or cells from six-well plates in ice-cold RIPA Buffer (Beyotime, Jiangsu, China) containing PMSF. The protein concentration was determined by using a BCA protein quantitative kit (Beyotime, Jiangsu, China). Samples were subjected to 10% SDS/PAGE and transferred to nitrocellulose membranes. After blocking, membranes were incubated with rabbit anti-KIM1 (1:500), anti-RIPK1 (1:800), anti-RIPK3 (1:800), anti-Nox4 (1:500) and mouse anti-β-actin (1:500) overnight at 4°C, and then incubated with IRDye800–conjugated secondary antibody for 1.5 h at room temperature. Signals were detected with Licor/Odyssey infrared image system (Li-COR Biosciences, Lincoln, NE, U.S.A.) and the intensities of bands were quantified by using the ImageJ software (NIH, Bethesda, MD, U.S.A).

IF

HK2 cells were cultured in eight-chamber glass slides and then fixed in acetone and incubated overnight with the antibodies detecting KIM1 or p-MLKL (1:200). Cells were washed with PBS and incubated with goat anti-rabbit IgG-rhodamine (BiossBiotechnology, Beijing, China) for 2 h at room temperature. Cells were counterstained with DAPI and visualized using fluorescence microscopy (Leica, Bensheim, Germany).

Immunoprecipitation

For immunoprecipitation analysis, cells were washed three times with ice-cold PBS solution and were lysed in NP-40 buffer. The samples were precipitated with the indicated antibodies (1 μg) and protein A/G-agarose beads (Santa Cruz, CA, U.S.A.) by incubating at 4°C overnight. Beads were washed three times with 1 ml NP-40 buffer, and the bound proteins were removed by boiling in SDS buffer and resolved in 4–20% SDS/polyacrylamide gels for Western blot analysis.

RNA extraction and real-time PCR

Total RNA obtained from fresh kidney homogenate or cultured HK2 cells by RNA-iso reagent (Qiagen, Valencia, CA, U.S.A.). NanoDrop 2000 Spectrophotometer (Thermo Scientific, U.S.A.) was applied for the quantitative RNA concentration [34]. The levels of KIM1, IL-1β, IL-6, TNF-α, MCP-1, Nox4 and β-actin were determined by SYBR-Green I Real time quantitative PCR in a CFX96 Real-time RT-PCR detection system (Bio-Rad, U.S.A.). The ratio for the mRNA of interest was normalized to β-actin and presented as the mean ± S.E.M. Primers sequences used in the present study were listed in Table 1.

Table 1
Primer sequences used in real-time PCR
Genes Forward primer (5′–3′) Reverse primer (5′–3′) 
A) Mouse   
TNF-α CATCTTCTCAAAATTCGAGTGACAA TGGGAGTAGACAAGGTACAACCC 
IL-6 GAGGATACCACTCCCAACAGACC AAGTGCATCATCGTTGTTCATACA 
MCP-1 CTTCTGGGCCTGCTGTTCA CCAGCCTACTCATTGGGATCA 
Nox4 ACTTTTCATTGGGCGTCCTC AGAACTGGGTCCACAGCAGA 
β-actin CATTGCTGACAGGATGCAGAA ATGGTGCTAGGAGCCAGAGC 
B) Human   
TNF-α CATCTTCTCAAAATTCGAGTGACAA TGGGAGTAGACAAGGTACAACCC 
IL-1β CAACCAACAAGTGATATTCTCCATG GATCCACACTCTCCAGCTGCA 
IL-6 CGGGAACGAAAGAGAAGCTCTA GAGCAGCCCCAGGGAGAA 
KIM1 CTGCAGGGAGCAATAAGGAG TCCAAAGGCCATCTGAAGAC 
Nox4 GGATCACAGAAGGTCCCTAGCAG GCGGCTACATGCACACCTGAGAA 
β-actin CGCCGCCAGCTCACCATG CACGATGGAGGGGAAGAC 
Genes Forward primer (5′–3′) Reverse primer (5′–3′) 
A) Mouse   
TNF-α CATCTTCTCAAAATTCGAGTGACAA TGGGAGTAGACAAGGTACAACCC 
IL-6 GAGGATACCACTCCCAACAGACC AAGTGCATCATCGTTGTTCATACA 
MCP-1 CTTCTGGGCCTGCTGTTCA CCAGCCTACTCATTGGGATCA 
Nox4 ACTTTTCATTGGGCGTCCTC AGAACTGGGTCCACAGCAGA 
β-actin CATTGCTGACAGGATGCAGAA ATGGTGCTAGGAGCCAGAGC 
B) Human   
TNF-α CATCTTCTCAAAATTCGAGTGACAA TGGGAGTAGACAAGGTACAACCC 
IL-1β CAACCAACAAGTGATATTCTCCATG GATCCACACTCTCCAGCTGCA 
IL-6 CGGGAACGAAAGAGAAGCTCTA GAGCAGCCCCAGGGAGAA 
KIM1 CTGCAGGGAGCAATAAGGAG TCCAAAGGCCATCTGAAGAC 
Nox4 GGATCACAGAAGGTCCCTAGCAG GCGGCTACATGCACACCTGAGAA 
β-actin CGCCGCCAGCTCACCATG CACGATGGAGGGGAAGAC 

Transmission electron microscopy

Kidney tissue or cultured HK2 cells was immersed in 2.5% glutaraldehyde in 0.1 mol/l sodium cacodylate (pH 7.4) at 4°C overnight, and postfixed for 4 h in buffered 1% osmium tetroxide on ice. After rinsing with 0.1 mol/l sodium cacodylate (pH 7.4), specimens were dehydrated in a graded series of ethanol and embedded in LR White resin (London Resin Company, Reading, U.K.). Polymerization was achieved in gelatin capsules at 60°C for 48 h. Specimens were then detected by a transmission electron microscope (H-7700, Tokyo, Japan).

Histology, immunohistochemistry and morphological assessment

Kidneys were collected and fixed in 4% paraformaldehyde overnight. Fixed kidney samples were embedded in paraffin and sectioned at 4 μm. To evaluate the histological damage, PAS staining was performed with the ‘PAS Kit’ according to routine protocols. The degree of tubular damage including tubular dilation, tubular atrophy and cast formation was scored by three experienced renal pathologists without knowing the group. The rating criteria were as follows: 0 = normal; 1 = 10%; 2 = 10–25%; 3 = 26–50%; 4 = 51–75%; 5 = 75–95%; 6 = more than 96%. For immunohistochemistry, the kidney sections was treated with 0.01 M sodium citrate buffer (pH 6.0) by a microwave-based antigen retrieval technique for 20 min at 95°C was used followed by 10 min of 3% H2O2 to block endogenous peroxidase activity, incubated with rabbit anti- TNF-α, anti-RIPK1 and anti-KIM1 antibodies for 24 h at 4°C and secondary antibodies for 30 min at 37°C. After staining with DAB, the slides were visualized with microscope (Leica, Bensheim, Germany).

Plasma concentration of Cpd-71-time profiles

Rats were given with a single dose of Cpd-71 (5 mg/kg) in PEG400-ethanol-saline (40:20:40, v/v/v) intravenously. Then, the whole blood (approximately 120 μl) was collected from the vein of animals into heparinized tubes at 0 (pro-drug), 5, 15 and 30 min, and 1, 2, 4, 6, 8, 24 h, respectively after administration. These blood samples were immediately centrifuged at 2000 r/min for 10 min, and the plasma sample (50 μl) was precisely collected and stored at −80°C until analysis. All plasma samples were then processed with the procedures as described in the literature [35].

Statistical analyses

Data are expressed as the mean ± S.E.M. Statistical significance was analyzed using one-way analysis of variance (ANOVA), followed by Tukey’s post hoc tests using GraphPad Prism 5 software (GraphPad, La Jolla, CA, U.S.A.).

Results

Cpd-71 attenuated cisplatin-induced cell damage in HK2 cells

The molecular structure of Cpd-71 was shown in Figure 1A. We first evaluated the effect of Cpd-71 on HK2 cells viability, MTT results showed Cpd-71 at concentrations lower than 0.8 μM had limited effect on the cell growth of HK2 cells (Figure 1B). Then we further determined the effects of Cpd-71 on cisplatin-induced cell damage. MTT results showed cisplatin prevented cell growth, but Cpd-71 at concentrations of 0.1, 0.2 and 0.4 μM restored cell viability in a concentration-dependent manner (Figure 1C). We also analyzed mRNA level and protein expression of KIM1, a marker evaluating tubular damage. Western blot and real-time PCR results showed cisplatin up-regulated KIM1 level, but Cpd-71 (0.1, 0.2 and 0.4 μM) suppressed KIM1 expression in HK2 cells (Figure 2A,B). Pretreatment with Cpd-71 (0.4 μM) had better suppressive effects on KIM1 expression than Nec-1 (50 μM), a necroptosis inhibitor. The suppressive effect of Cpd-71 on KIM1 was further confirmed by IF analyses (Figure 2C).

Effect of different concentrations of Cpd-71 on HK2 cell viability with or without cisplatin inducement

Figure 1
Effect of different concentrations of Cpd-71 on HK2 cell viability with or without cisplatin inducement

(A) Molecular structural formula of Cpd-71. (B) Effect of different concentrations of Cpd-71 on viability of HK2 cells by MTT assay; (C) Cpd-71 restored cell viability in cisplatin-treated HK2 cells (MTT assay). Data represent the mean ± S.E.M. for at least three to four independent experiments. *, P<0.05; ***, P<0.001 compared with the control. ###, P<0.001 compared with the cisplatin-treated group. Abbreviation: Cis, cisplatin.

Figure 1
Effect of different concentrations of Cpd-71 on HK2 cell viability with or without cisplatin inducement

(A) Molecular structural formula of Cpd-71. (B) Effect of different concentrations of Cpd-71 on viability of HK2 cells by MTT assay; (C) Cpd-71 restored cell viability in cisplatin-treated HK2 cells (MTT assay). Data represent the mean ± S.E.M. for at least three to four independent experiments. *, P<0.05; ***, P<0.001 compared with the control. ###, P<0.001 compared with the cisplatin-treated group. Abbreviation: Cis, cisplatin.

Effects of Cpd-71 on cisplatin-induced cell injury

Figure 2
Effects of Cpd-71 on cisplatin-induced cell injury

(A) Western blot analysis of KIM1 in HK2 cells; (B) real-time PCR analyses of renal KIM1 mRNA level; (C) IF and quantification of KIM1 in HK2 cells. Cpd-71 reduced KIM1 protein level in response to cisplatin. Data represent the mean ± S.E.M. for three to four independent experiments. *, P<0.05; ***, P<0.001 compared with the control. ###, P<0.001 compared with the cisplatin-treated group. Scale bars = 100 μm. Abbreviation: Cis, cisplatin.

Figure 2
Effects of Cpd-71 on cisplatin-induced cell injury

(A) Western blot analysis of KIM1 in HK2 cells; (B) real-time PCR analyses of renal KIM1 mRNA level; (C) IF and quantification of KIM1 in HK2 cells. Cpd-71 reduced KIM1 protein level in response to cisplatin. Data represent the mean ± S.E.M. for three to four independent experiments. *, P<0.05; ***, P<0.001 compared with the control. ###, P<0.001 compared with the cisplatin-treated group. Scale bars = 100 μm. Abbreviation: Cis, cisplatin.

Cpd-71 reduced inflammatory response and oxidative stress in cisplatin-induced HK2 cells

In cisplatin-induced HK2 cells, inflammatory factors including TNF-α, IL-1β and IL-6 were markedly inhibited by Cpd-71, and the anti-inflammatory effect of Cpd-71 (0.4 μM) was comparable with Nec-1 (50 μM) (Figure 3A). Next, we evaluated the antioxidant effect of Cpd-71. Result of DHE staining and DCF staining showed that ROS generation was increased in cisplatin-induced HK2 cells, however, ROS was significantly reduced when cisplatin-induced HK2 cells following Cpd-71 or Nec-1 treatment (Figure 3B,C). In addition, Western blot analyses revealed that Cpd-71 shows more suppressive effect on Nox4, a main member of Nox family in kidney, than Nec-1 treatment group, this result was further confirmed by real-time PCR (Figure 3D,E).

Effects of Cpd-71 on cisplatin-induced cell inflammation and oxidative stress

Figure 3
Effects of Cpd-71 on cisplatin-induced cell inflammation and oxidative stress

(A) Real-time PCR analyses of renal TNF-α, IL-1β and IL-6 mRNA levels; (B) DCF Assay of ROS; (C) DHE staining of intracellular ROS levels. Results of DCF and DHE assay shown that Cpd-71 reduced cisplatin-induced ROS generation. (D) Western blot and quantitative analysis of Nox4. (E) Real-time PCR analyses of Nox4 mRNA level. Data represent the mean ± S.E.M. for three to four independent experiments. *, P<0.05; ***, P<0.001 compared with the control. ##, P<0.01; ###, P<0.001 compared with the cisplatin-treated group. Scale bars = 100 Abbreviation: μm. Cis, cisplatin.

Figure 3
Effects of Cpd-71 on cisplatin-induced cell inflammation and oxidative stress

(A) Real-time PCR analyses of renal TNF-α, IL-1β and IL-6 mRNA levels; (B) DCF Assay of ROS; (C) DHE staining of intracellular ROS levels. Results of DCF and DHE assay shown that Cpd-71 reduced cisplatin-induced ROS generation. (D) Western blot and quantitative analysis of Nox4. (E) Real-time PCR analyses of Nox4 mRNA level. Data represent the mean ± S.E.M. for three to four independent experiments. *, P<0.05; ***, P<0.001 compared with the control. ##, P<0.01; ###, P<0.001 compared with the cisplatin-treated group. Scale bars = 100 Abbreviation: μm. Cis, cisplatin.

Effect of Cpd-71 on necroptosis of cisplatin-induced HK2 cells

Next, electron microscopy showed that cisplatin-induced HK2 cells exhibited plasma membrane rupture, organelle swelling and loss of cell organelle contents, these effects were alleviated in Cpd-71 treatment group (Figure 4A). Consistently, IF analyses showed the suppressive effect of Cpd-71 on phosphorylation and membrane translocation of MLKL was better than Nec-1 (Figure 4B). We then further detected the mechanisms by which Cpd-71 suppressed necroptosis in two cell necrosis models. RIPK1 and RIPK3 are activated when HK2 cells are exposed to TNF-α and zVAD [25,36] and we found that Cpd-71 had a suppressive effect on RIPK1/RIPK3 signaling (Figure 5A), which was further confirmed in cisplatin-induced cell model (Figure 5B). Importantly, the suppressive effect of Cpd-71 was more significant than Nec-1. Moreover, co-immunoprecipitation revealed RIPK1 interacted with RIPK3 to mediate necroptosis in cisplatin-treated group, but Cpd-71 decreased the formation of RIPK1/RIPK3 complex (Figure 5C). In addition, a docking experiment was performed to propose a possible binding mode for Cpd-71 in RIPK1. Cpd-71 was docked into a cocrystal structure 6HHO of RIPK1 complexed with a pyrimidine analog G4W. The proposed binding mode was illustrated in Figure 5D. Similar to Nec-1, Cpd-71 locates in an allosteric pocket next to the ATP binding site, termed astype III ligand binding site [37]. The amide carbonyl of Cpd-71 formed two H-bond with backbone of residues Val91 and Met92. Another H-bone occurred between the nitrogen atom of pyrimidine ring of Cpd-71 and residue Asp156. Moreover, the cyclopropyl group of Cpd-71 located in a hydrophobic region surrounded by hydrophobic residues of Val31, Lys45 and Leu157.

Cpd-71 protected against cisplatin-induced HK-2 cells necroptosis

Figure 4
Cpd-71 protected against cisplatin-induced HK-2 cells necroptosis

(A) Representative electron micrographs of necrotic HK2 cells are shown. (B) IF images shown that Cpd-71 decreased phosphorylation and membrane translocation of MLKL in cisplatin-induced HK2 cells. Data represent the mean ± S.E.M. for three to four independent experiments. *, P<0.05; ***, P<0.001 compared with the control. ###, P<0.001 compared with the cisplatin-treated group. Scale bars = 100 μm. Abbreviation: Cis, cisplatin.

Figure 4
Cpd-71 protected against cisplatin-induced HK-2 cells necroptosis

(A) Representative electron micrographs of necrotic HK2 cells are shown. (B) IF images shown that Cpd-71 decreased phosphorylation and membrane translocation of MLKL in cisplatin-induced HK2 cells. Data represent the mean ± S.E.M. for three to four independent experiments. *, P<0.05; ***, P<0.001 compared with the control. ###, P<0.001 compared with the cisplatin-treated group. Scale bars = 100 μm. Abbreviation: Cis, cisplatin.

Effect of Cpd-71 on RIPK signaling in HK2 cells

Figure 5
Effect of Cpd-71 on RIPK signaling in HK2 cells

(A) Western blot and quantitative analysis in HK2 cells were pretreated with Cpd-71 and Nec-1 followed by stimulatation with 100 ng/ml TNF-α + 25 μM zVAD; (B) Western blot and quantitative analysis of programmed cell death regulatory signaling in HK2 cells treated with Cisplatin. Cpd-71 decreased RIPK1 and RIPK3 activation in two in vitro model of necroptosis. (C) Co-IP assay detects the reduction in RIPK1 and RIPK3 interactions after Cpd-71 pretreatment. (D) Molecular docking showed Cpd-71 physically bound to the allosteric type III ligand binding site of RIPK1. Data represent the mean ± S.E.M. for three to four independent experiments. *, P<0.05; **, P<0.01; ***, P<0.001 compared with the control. ##, P<0.01; ###, P<0.001 compared with the cisplatin-treated group. Abbreviations: Cis, cisplatin; TZ, TNF-α + z-VAD.

Figure 5
Effect of Cpd-71 on RIPK signaling in HK2 cells

(A) Western blot and quantitative analysis in HK2 cells were pretreated with Cpd-71 and Nec-1 followed by stimulatation with 100 ng/ml TNF-α + 25 μM zVAD; (B) Western blot and quantitative analysis of programmed cell death regulatory signaling in HK2 cells treated with Cisplatin. Cpd-71 decreased RIPK1 and RIPK3 activation in two in vitro model of necroptosis. (C) Co-IP assay detects the reduction in RIPK1 and RIPK3 interactions after Cpd-71 pretreatment. (D) Molecular docking showed Cpd-71 physically bound to the allosteric type III ligand binding site of RIPK1. Data represent the mean ± S.E.M. for three to four independent experiments. *, P<0.05; **, P<0.01; ***, P<0.001 compared with the control. ##, P<0.01; ###, P<0.001 compared with the cisplatin-treated group. Abbreviations: Cis, cisplatin; TZ, TNF-α + z-VAD.

Cpd-71 attenuated cisplatin-induced AKI, inflammation and oxidative stress in mice

We then assessed the treatment effect of Cpd-71 in cisplatin nephropathy. In protocol I, mice were respectively pretreated with Cpd-71 (0.825, 1.65 and 3.3 mg/kg) and 1.65 mg/kg Nec-1 as positive control 12 h before cisplatin injection. PAS staining showed mice displayed severe pathological damage after exposure to cisplatin, which is characterized by the dilation of renal tubules, loss of brush border, cytoplasmic vacuoles. Interestingly, kidney damage induced by cisplatin was alleviated after pretreatment of Cpd-71. Notably, Cpd-71 has better protective effects compared with Nec-1 in the same concentration (1.65 mg/kg) (Figure 6A). Pharmacokinetics studies revealed that the pharmacokinetic properties of Cpd-71 were similar to Nec-1 without obvious advantage (Supplementary Table S1). Considering the more effective potency of Cpd-71 than that of Nec-1 in AKI mice model, we think that Cpd-71 may exert stronger inhibition than Nec-1 against RIPK1. Renoprotective effect of Cpd-71 was further confirmed by detecting serum Cr and BUN which indicated renal function (Figure 6B,C). Additionally, Western blot and immunohistochemistry analyses results showed Cpd-71 significantly reduced KIM1 expression (Figure 7A,B). Besides, we evaluated the anti-inflammatory effect of Cpd-71 in cisplatin-induced mice. Immunohistochemistry showed Cpd-71 reduced macrophage infiltration and TNF-α positive signal in injured kidney (Figure 8A,B). Consistently, pro-inflammatory cytokines and chemokines TNF-α, IL-6 and MCP-1 were down-regulated following Cpd-71 treatment (Figure 8C). We further found that GSH, an important endogenous antioxidant, was significantly decreased in cisplatin-induced mice but restored after Cpd-71 pretreatment, this is in line with the finding that Cpd-71 suppressed MDA level in mice exposed to cisplatin (Figure 9A,B). As shown in Figure 9C,D, Cpd-71 treatment reduced cisplatin-induced Nox4 protein expression. This was further validated at mRNA levels by real-time PCR.

Cpd-71 attenuated renal injury in cisplatin-induced AKI

Figure 6
Cpd-71 attenuated renal injury in cisplatin-induced AKI

(A) Representative images and score of PAS-stained kidney sections; (B) BUN assay; (C) serum Cr assay. Results of BUN and serum Cr showed that treatment of Cpd-71 preserved renal function in cisplatin nephropathy. Data represent the mean ± S.E.M. for six mice. *, P<0.05; **, P<0.01; ***, P<0.001 compared with the control. ##, P<0.01; ###, P<0.001 compared with the model. Scale bars = 100 μm. Abbreviation: Cis, cisplatin.

Figure 6
Cpd-71 attenuated renal injury in cisplatin-induced AKI

(A) Representative images and score of PAS-stained kidney sections; (B) BUN assay; (C) serum Cr assay. Results of BUN and serum Cr showed that treatment of Cpd-71 preserved renal function in cisplatin nephropathy. Data represent the mean ± S.E.M. for six mice. *, P<0.05; **, P<0.01; ***, P<0.001 compared with the control. ##, P<0.01; ###, P<0.001 compared with the model. Scale bars = 100 μm. Abbreviation: Cis, cisplatin.

Cpd-71 down-regulated KIM1 level in cisplatin nephropathy

Figure 7
Cpd-71 down-regulated KIM1 level in cisplatin nephropathy

(A) Western blot and quantitative analysis of KIM1. (B) Immunohistochemistry of KIM1. Results indicated that treatment of Cpd-71 in a set of concentrations substantially inhibited cisplatin-induced KIM1 expression. Data represent the mean ± S.E.M. for six mice. , P<0.05; **, P<0.01; ***, P<0.001 compared with the control. ##, P<0.01; ###, P<0.001 compared with the model. Scale bars = 100 μm. Abbreviation: Cis, cisplatin.

Figure 7
Cpd-71 down-regulated KIM1 level in cisplatin nephropathy

(A) Western blot and quantitative analysis of KIM1. (B) Immunohistochemistry of KIM1. Results indicated that treatment of Cpd-71 in a set of concentrations substantially inhibited cisplatin-induced KIM1 expression. Data represent the mean ± S.E.M. for six mice. , P<0.05; **, P<0.01; ***, P<0.001 compared with the control. ##, P<0.01; ###, P<0.001 compared with the model. Scale bars = 100 μm. Abbreviation: Cis, cisplatin.

Cpd-71 attenuated renal inflammation and oxidative stress in cisplatin nephropathy

Figure 8
Cpd-71 attenuated renal inflammation and oxidative stress in cisplatin nephropathy

(A) Immunohistochemistry of F4/80 + macrophages. Scale bars = 50 μm. (B) Immunohistochemistry of TNF-α. Scale bars = 100 μm. Cpd-71 attenuated inflammatory response, including recruitment macrophages and secretion of TNF-α. (C) Real-time PCR analyses of renal TNF-α, MCP-1 and IL-6 mRNA levels. Data represent the mean ± S.E.M. for six mice. *, P<0.05; **, P<0.01; ***, P<0.001 compared with the control. #, P<0.05; ##, P<0.01; ###, P<0.001 compared with the model. Abbreviation: Cis, cisplatin.

Figure 8
Cpd-71 attenuated renal inflammation and oxidative stress in cisplatin nephropathy

(A) Immunohistochemistry of F4/80 + macrophages. Scale bars = 50 μm. (B) Immunohistochemistry of TNF-α. Scale bars = 100 μm. Cpd-71 attenuated inflammatory response, including recruitment macrophages and secretion of TNF-α. (C) Real-time PCR analyses of renal TNF-α, MCP-1 and IL-6 mRNA levels. Data represent the mean ± S.E.M. for six mice. *, P<0.05; **, P<0.01; ***, P<0.001 compared with the control. #, P<0.05; ##, P<0.01; ###, P<0.001 compared with the model. Abbreviation: Cis, cisplatin.

Cpd-71 reduced oxidative stress in cisplatin nephropathy

Figure 9
Cpd-71 reduced oxidative stress in cisplatin nephropathy

(A) GSH level in kidney; (B) MDA level in kidney. (C) Western blot and quantitative analysis of Nox4. (D) Real-time PCR analyses of Nox4 mRNA level. Data represent the mean ± S.E.M. for six mice. **, P<0.01; ***, P<0.001 compared with the control. #, P<0.05; ##, P<0.01; ###, P<0.001 compared with the model. Abbreviation: Cis, cisplatin.

Figure 9
Cpd-71 reduced oxidative stress in cisplatin nephropathy

(A) GSH level in kidney; (B) MDA level in kidney. (C) Western blot and quantitative analysis of Nox4. (D) Real-time PCR analyses of Nox4 mRNA level. Data represent the mean ± S.E.M. for six mice. **, P<0.01; ***, P<0.001 compared with the control. #, P<0.05; ##, P<0.01; ###, P<0.001 compared with the model. Abbreviation: Cis, cisplatin.

Cpd-71 attenuated renal injury by targeting RIPK1-mediated necroptosis

It has been well accepted that necroptosis relates to the activation of RIPK1. Immunohistochemistry staining showed that Cpd-71 reduced RIPK1 expression in renal tubules (Figure 10A). Western blot confirmed that Cpd-71 had more inhibitory effects on RIPK1 and RIPK3 activation compared with Nec-1 in cisplatin nephropathy (Figure 10B). Furthermore, IF analysis suggested that Cpd-71 suppressed phosphorylation of MLKL in cisplatin-induced mice (Figure 10C), in vivo. In order to further verify the interaction between Cpd-71 and RIPK1 protein, we performed a CETSA that enables us to evaluate target engagement in vivo [33,38]. Results showed that the detected soluble RIPK1 proteins clearly differ at denaturation temperatures ranging from 47 to 59°C with and without Cpd-71 treatment, Cpd-71-treated mice showed a significant increase in the thermal stability of RIPK1 (Figure 10D). Which indicated that Cpd-71 is directly bound to the RIPK1 protein.

Cpd-71 inhibited RIPK1-mediated necroptosis in cisplatin nephropathy

Figure 10
Cpd-71 inhibited RIPK1-mediated necroptosis in cisplatin nephropathy

(A) Immunohistochemistry of RIPK1. IHC staining indicated RIPK1 positive area was mainly located in tubular epithelial cells; (B) RIPK1 and RIPK3 level were tested using Western blot. (C) IF of P-MLKL in renal tissue. (D) CETSA analysis the stabilization of RIPK1 in vivo with or without Cpd-71 treatment. Data represent the mean ± S.E.M. for six independent experiments. , P<0.05; **, P<0.01, ∗∗∗, P<0.001 compared with the control. ###, P<0.001 compared with the cisplatin-treated group. Scale bars = 100 μm. Abbreviation: Cis, cisplatin.

Figure 10
Cpd-71 inhibited RIPK1-mediated necroptosis in cisplatin nephropathy

(A) Immunohistochemistry of RIPK1. IHC staining indicated RIPK1 positive area was mainly located in tubular epithelial cells; (B) RIPK1 and RIPK3 level were tested using Western blot. (C) IF of P-MLKL in renal tissue. (D) CETSA analysis the stabilization of RIPK1 in vivo with or without Cpd-71 treatment. Data represent the mean ± S.E.M. for six independent experiments. , P<0.05; **, P<0.01, ∗∗∗, P<0.001 compared with the control. ###, P<0.001 compared with the cisplatin-treated group. Scale bars = 100 μm. Abbreviation: Cis, cisplatin.

Effect of Cpd-71 on kidney injury in established AKI mouse model

Next, we further detected whether Cpd-71 had therapeutic effects in established AKI model. In protocol II, Cpd-71 was administrated 1 day after cisplatin injection. As shown in Figure 11A, PAS staining showed Cpd-71 distinctly suppressed tubule damage compared with group of cisplatin on day 3. This finding was further confirmed by detecting BUN and serum Cr (Figure 11B,C). Additionally, Cpd-71 decreased KIM1 positive signals in established AKI mice (Figure 11D).

Cpd-71 attenuated cisplatin-induced kidney injury in established AKI mouse model

Figure 11
Cpd-71 attenuated cisplatin-induced kidney injury in established AKI mouse model

(A) Representative images and score of PAS-stained kidney sections; (B) BUN assay; (C) serum Cr assay; (D) immunohistochemistry and quantitative analysis of KIM1. Data represent the mean ± S.E.M. for six independent experiments. **, P<0.01; ***, P<0.001 compared with the control. ##, P<0.01; ###, P<0.001 compared with the cisplatin-treated group. Scale bars = 100 μm. Abbreviation: Cis, cisplatin.

Figure 11
Cpd-71 attenuated cisplatin-induced kidney injury in established AKI mouse model

(A) Representative images and score of PAS-stained kidney sections; (B) BUN assay; (C) serum Cr assay; (D) immunohistochemistry and quantitative analysis of KIM1. Data represent the mean ± S.E.M. for six independent experiments. **, P<0.01; ***, P<0.001 compared with the control. ##, P<0.01; ###, P<0.001 compared with the cisplatin-treated group. Scale bars = 100 μm. Abbreviation: Cis, cisplatin.

Discussion

In the present study, we demonstrated that Cpd-71 protected against cisplatin-induced kidney injury both in vivo and in vitro by limiting cell necroptosis, inflammation and oxidative stress. We further evaluated RIPK1-targeting therapy in nephrotoxic AKI model. Moreover, we identified that Cpd-71 showed high efficiency in inhibiting necroptosis and kidney injury compared with Nec-1, a classic inhibitor for RIPK1.

Necroptosis, a type of programmed necrosis, is mediated by RIPK1/RIPK3/MLKL activation and plays a significant role in various pathologic conditions [23]. When death signals transduce to RIPK1, it recruits and binds with RIPK3 in the presence of RIP homotypic interaction motif (RHIM), and then phosphorylates MLKL and promotes translocation of phospho-MLKL on to the plasma membrane which finally leads to plasma membrane disruption [39,40]. In the kidney, involvement of necroptosis in various pathologic conditions has gained much attention in recent years [41,42]. With respect to AKI condition, pharmacological inhibition and deficiency of RIPK1 protected against AKI induced by cisplatin, I/R injury [22] and contrast [30]. Additionally, disruption of downstream RIPK3 or MLKL prevented AKI by alleviating necroptosis [25,43,44]. Importantly, a previous study in our group had revealed that wogonin, a Traditional Chinese Medicine monomer, attenuated cisplatin nephropathy by inactivating RIPK1 via occupying its ATP-binding pocket [45]. And miR-500a-3p suppressed toxic and ischemic insults and inflammatory response via targeting MLKL-mediated necroptosis in renal epithelial cells [46].

Available evidence suggested that targeting RIPK1 may have an important role in AKI models. Nec-1 is an extensively used RIPK1 inhibitor with high kinase selectivity, however, it failed to be applied in clinic due to the narrow SAR profile and poor metabolic stability [28,47]. In this regard, we evaluated the renoprotective effect of Cpd-71, a novel RIPK1 inhibitor, which showed high affinity for RIPK1. For the first time, we found that Cpd-71 significantly inhibited RIPK1 activation, RIPK1/RIPK3 interaction, MLKL phosphorylation and membrane translocation, thereby attenuated kidney injury in two cell necrosis models (HK2 induced by TNF-α + zVAD and cisplatin, respectively), the binding of Cpd-71 to RIPK1 was further confirmed in mice by CETSA. Notably, Cpd-71 showed more efficiency in being renoprotective than Nec-1.

Additionally, increasing evidence has shown necroptosis, rather than apoptosis, leads to inflammation in AKI. Cells suffered necroptosis release damage-associated molecular patterns (DAMPs) like high-mobility group box 1 (HMGB1) and heat-shock proteins, binding with its receptors and inducing necro-inflammation which lead to more severe programmed cell death, immune cell infiltration and further renal damage in a positive feedback loop [48,49]. A recent study confirmed RIPK1 mediates a second wave of cell death in AKI models [24]. It is of note that RIPK1 regulate the inflammation in cell death-independent manner [50]. In this setting, blocking RIPK1-mediated necroptosis with Cpd-71 seemed to be an effective therapy against renal inflammation. In the current study, our work suggested that Cpd-71 exhibited higher anti-inflammatory effects compared with Nec-1 both in cisplatin-induced tubular epithelial cells and nephrotoxic AKI model, in vivo and in vitro.

Furthermore, previous studies also demonstrated that ROS increased cellular oxidative stress, and then led to DNA damage and programmed cell death [51,52]. ROS scavenger dramatically reduces Hypoxia/reoxygenation- or H2O2-induced cell necroptosis [53]. Consistently, we found that Nox-mediated oxidative stress was highly correlated to cell necroptosis [54,55]. Currently, we confirmed the role of Cpd-71 on distinctly attenuated oxidative stress by targeting RIPK1 in cisplatin-induced tubular epithelial cells and nephrotoxic AKI model, indicating that Cpd-71 may inhibit the feedback loop of oxidative stress and necroptosis simultaneously.

Collectively, our work demonstrated that Cpd-71, a novel RIPK1 kinase inhibitor, showed significant anti-necroptosis, anti-inflammation and antioxidant effects in cisplatin-induced tubular epithelial cells and nephrotoxic AKI models. We also found Cpd-71 had powerful renoprotective effects in treatment of AKI model. Our study raises a possibility that Cpd-71 may serve as a potential clinical candidate for AKI therapy.

Clinical perspectives

  • RIPK1 may serve as a potential therapeutic target for AKI.

  • Cpd-71 is a novel RIPK1 inhibitor with high efficiency in treatment of AKI.

  • Cpd-71 protects kidney function and attenuates necroptosis, inflammation and oxidative stress in cisplatin nephropathy.

Author Contribution

J.-n.W and F.W. performed the experiment, analyzed the data and wrote the manuscript. M.-m.L. conceived the molecular docking experiments. X.-M.M. designed, supervised and wrote the manuscript. X.C., Q.Y. and L.J. provided a series of experimental instructions and help. J.-n.W., F.W., Y.-t.C., C.L., X.-w.H., X.-q.L., J.-t.Y. and B.W. performed the animal experiments. T.-t.M, J.J., Y.-g.W. and J.L. contributed new reagents or analytic tools. All authors approved the final version of the manuscript.

Funding

This work was supported by the National Natural Science Foundation of China [grant number 81570623]; the Science and Technological Fund of Anhui Province for Outstanding Youth of China [grant number 1608085J07]; the Scientific Research Grants of Anhui Medical University [grant number XJ201627]; the Innovation and Entrepreneurship Support Program for Overseas Returnees in Anhui Province [grant number zd201708]; the Key Projects of Outstanding Youth Foundation in Colleges of Anhui Province of China [grant number gxyqZD2017021]; and the Research Foundation Project of the Anhui Institute of Translational Medicine [grant number 2017zhyx01].

Competing Interests

The authors declare that there are no competing interests associated with the manuscript.

Abbreviations

     
  • AKI

    acute kidney injury

  •  
  • BUN

    blood urea nitrogen

  •  
  • CETSA

    cellular thermal shift assay

  •  
  • CKD

    chronic kidney disease

  •  
  • Cpd-71

    compound 71 (N-(4-((4-((5-methyl-1H-pyrazol-3-yl)amino)-6-morpholinopyrimidin-2-yl)amino)phenyl)cyclopropanecarboxamide)

  •  
  • Cr

    creatinine

  •  
  • DAMPs

    damage-associated molecular patterns

  •  
  • DCFH-DA

    2′,7′-dichlorofluorescein diacetate

  •  
  • DHE

    dihydroethidium

  •  
  • DTNB

    5,5-dithiobis-2-nitrobenzoic acid

  •  
  • GSH

    glutathione

  •  
  • HK2

    human kidney tubular epithelial cell

  •  
  • HRMS

    high resolution mass spectrometry

  •  
  • HMGB1

    high-mobility group box 1

  •  
  • IF

    immunofluorescence

  •  
  • I/R

    ischemia–reperfusion

  •  
  • MDA

    malondialdehyde

  •  
  • Nec-1

    Necrostatin-1

  •  
  • NMR

    nuclear magnetic resonance

  •  
  • OD

    optical density

  •  
  • PAS

    Periodic acid–Schiff

  •  
  • ROS

    reactive oxygen species

  •  
  • RHIM

    RIP homotypic interaction motif

  •  
  • SAR

    structure–activity relationship

  •  
  • TNFR1

    TNF receptor 1

  •  
  • TRAF-2

    TNFR-associated factor 2

  •  
  • zVAD

    zVAD-fmk

References

References
1.
Andrade-Silva
M.
,
Cenedeze
M.A.
and
Perandini
L.A.
(
2018
)
TLR2 and TLR4 play opposite role in autophagy associated with cisplatin-induced acute kidney injury
.
Clin. Sci. (Lond.)
132
,
1725
1739
[PubMed]
2.
Sharfuddin
A.A.
and
Molitoris
B.A.
(
2011
)
Pathophysiology of ischemic acute kidney injury
.
Nat. Rev. Nephrol.
7
,
189
200
[PubMed]
3.
Hsu
R.K.
,
McCulloch
C.E.
,
Dudley
R.A.
et al. .
(
2013
)
Temporal changes in incidence of dialysis-requiring AKI
.
J. Am. Soc. Nephrol.
24
,
37
42
[PubMed]
4.
Odutayo
A.
,
Wong
C.X.
,
Farkouh
M.
et al. .
(
2017
)
AKI and long-term risk for cardiovascular events and mortality
.
J. Am. Soc. Nephrol.
28
,
377
387
[PubMed]
5.
Vanmassenhove
J.
,
Kielstein
J.
,
Jorres
A.
et al. .
(
2017
)
Management of patients at risk of acute kidney injury
.
Lancet
389
,
2139
2151
[PubMed]
6.
Carney
E.F.
(
2016
)
Transplantation: new tool for prediction of ESRD risk in living kidney donor candidates
.
Nat. Rev. Nephrol.
12
,
1
[PubMed]
7.
Xiao
L.
,
Zhou
D.
,
Tan
R.J.
et al. .
(
2016
)
Sustained activation of Wnt/beta-catenin signaling drives AKI to CKD progression
.
J. Am. Soc. Nephrol.
27
,
1727
1740
[PubMed]
8.
Zhang
D.
,
Liu
Y.
,
Wei
Q.
et al. .
(
2014
)
Tubular p53 regulates multiple genes to mediate AKI
.
J. Am. Soc. Nephrol.
25
,
2278
2289
[PubMed]
9.
Shi
M.
,
Flores
B.
,
Gillings
N.
et al. .
(
2016
)
alphaKlotho mitigates progression of AKI to CKD through activation of autophagy
.
J. Am. Soc. Nephrol.
27
,
2331
2345
[PubMed]
10.
Li
F.
,
Liu
Z.
,
Tang
C.
et al. .
(
2018
)
FGF21 is induced in cisplatin nephrotoxicity to protect against kidney tubular cell injury
.
FASEB J.
32
,
3423
3433
[PubMed]
11.
Mulay
S.R.
,
Kumar
S.V.
,
Lech
M.
et al. .
(
2016
)
How kidney cell death induces renal necroinflammation?
Semin. Nephrol.
36
,
162
173
[PubMed]
12.
Tang
J.
,
Shi
Y.
,
Liu
N.
et al. .
(
2018
)
Blockade of histone deacetylase 6 protects against cisplatin-induced acute kidney injury
.
Clin. Sci. (Lond.)
132
,
339
359
[PubMed]
13.
Dannappel
M.
,
Vlantis
K.
,
Kumari
S.
et al. .
(
2014
)
RIPK1 maintains epithelial homeostasis by inhibiting apoptosis and necroptosis
.
Nature
513
,
90
94
[PubMed]
14.
Orozco
S.
,
Yatim
N.
,
Werner
M.R.
et al. .
(
2014
)
RIPK1 both positively and negatively regulates RIPK3 oligomerization and necroptosis
.
Cell Death Differ.
21
,
1511
1521
[PubMed]
15.
You
Z.
,
Savitz
S.I.
,
Yang
J.
et al. .
(
2008
)
Necrostatin-1 reduces histopathology and improves functional outcome after controlled cortical impact in mice
.
J. Cereb. Blood Flow Metab.
28
,
1564
1573
[PubMed]
16.
Luedde
M.
,
Lutz
M.
,
Carter
N.
et al. .
(
2014
)
RIP3, a kinase promoting necroptotic cell death, mediates adverse remodelling after myocardial infarction
.
Cardiovasc. Res.
103
,
206
216
[PubMed]
17.
Lau
A.
,
Wang
S.
,
Jiang
J.
et al. .
(
2013
)
RIPK3-mediated necroptosis promotes donor kidney inflammatory injury and reduces allograft survival
.
Am. J. Transplant.
13
,
2805
2818
[PubMed]
18.
Pavlosky
A.
,
Lau
A.
,
Su
Y.
et al. .
(
2014
)
RIPK3-mediated necroptosis regulates cardiac allograft rejection
.
Am. J. Transplant.
14
,
1778
1790
[PubMed]
19.
Lin
J.
,
Li
H.
,
Yang
M.
et al. .
(
2013
)
A role of RIP3-mediated macrophage necrosis in atherosclerosis development
.
Cell Rep.
3
,
200
210
[PubMed]
20.
Ramachandran
A.
,
McGill
M.R.
,
Xie
Y.
et al. .
(
2013
)
Receptor interacting protein kinase 3 is a critical early mediator of acetaminophen-induced hepatocyte necrosis in mice
.
Hepatology
58
,
2099
2108
[PubMed]
21.
Zhang
C.
,
Luo
Y.
,
He
Q.
et al. .
(
2019
)
A pan-RAF inhibitor LY3009120 inhibits necroptosis by preventing phosphorylation of RIPK1 and alleviates dextran sulfate sodium-induced colitis
.
Clin. Sci. (Lond.)
133
,
919
932
[PubMed]
22.
Linkermann
A.
,
Brasen
J.H.
,
Himmerkus
N.
et al. .
(
2012
)
Rip1 (receptor-interacting protein kinase 1) mediates necroptosis and contributes to renal ischemia/reperfusion injury
.
Kidney Int.
81
,
751
761
[PubMed]
23.
Linkermann
A.
,
Chen
G.
,
Dong
G.
et al. .
(
2014
)
Regulated cell death in AKI
.
J. Am. Soc. Nephrol.
25
,
2689
2701
24.
Martin-Sanchez
D.
,
Fontecha-Barriuso
M.
,
Carrasco
S.
et al. .
(
2018
)
TWEAK and RIPK1 mediate a second wave of cell death during AKI
.
Proc. Natl. Acad. Sci. U.S.A.
115
,
4182
4187
[PubMed]
25.
Xu
Y.
,
Ma
H.
,
Shao
J.
et al. .
(
2015
)
A role for tubular necroptosis in cisplatin-induced AKI
.
J. Am. Soc. Nephrol.
26
,
2647
2658
26.
Xie
T.
,
Peng
W.
,
Liu
Y.
et al. .
(
2013
)
Structural basis of RIP1 inhibition by necrostatins
.
Structure
21
,
493
499
[PubMed]
27.
Brenner
D.
,
Blaser
H.
and
Mak
T.W.
(
2015
)
Regulation of tumour necrosis factor signalling: live or let die
.
Nat. Rev. Immunol.
15
,
362
374
[PubMed]
28.
Hofmans
S.
,
Devisscher
L.
,
Martens
S.
et al. .
(
2018
)
Tozasertib analogues as inhibitors of necroptotic cell death
.
J. Med. Chem.
61
,
1895
1920
[PubMed]
29.
Moerke
C.
,
Jaco
I.
,
Dewitz
C.
et al. .
(
2018
)
The anticonvulsive Phenhydan((R)) suppresses extrinsic cell death
.
Cell Death Differ.
[PubMed]
30.
Linkermann
A.
,
Heller
J.O.
,
Prokai
A.
et al. .
(
2013
)
The RIP1-kinase inhibitor necrostatin-1 prevents osmotic nephrosis and contrast-induced AKI in mice
.
J. Am. Soc. Nephrol.
24
,
1545
1557
[PubMed]
31.
Ning
Y.
,
Shi
Y.
,
Chen
J.
et al. .
(
2018
)
Necrostatin-1 attenuates cisplatin-induced nephrotoxicity through suppression of apoptosis and oxidative stress and retains Klotho expression
.
Front. Pharmacol.
9
,
384
32.
Xiao
X.
,
Du
C.
,
Yan
Z.
et al. .
(
2017
)
Inhibition of necroptosis attenuates kidney inflammation and interstitial fibrosis induced by unilateral ureteral obstruction
.
Am. J. Nephrol.
46
,
131
138
[PubMed]
33.
Ishii
T.
,
Okai
T.
,
Iwatani-Yoshihara
M.
et al. .
(
2017
)
CETSA quantitatively verifies in vivo target engagement of novel RIPK1 inhibitors in various biospecimens
.
Sci. Rep.
7
,
13000
[PubMed]
34.
Gao
L.
,
Liu
M.M.
,
Zang
H.M.
et al. .
(
2018
)
Restoration of E-cadherin by PPBICA protects against cisplatin-induced acute kidney injury by attenuating inflammation and programmed cell death
.
Lab. Invest.
98
,
911
923
[PubMed]
35.
Geng
F.
,
Yin
H.
,
Li
Z.
et al. .
(
2017
)
Quantitative analysis of necrostatin-1, a necroptosis inhibitor by LC-MS/MS and the study of its pharmacokinetics and bioavailability
.
Biomed. Pharmacother.
95
,
1479
1485
[PubMed]
36.
Muller
T.
,
Dewitz
C.
,
Schmitz
J.
et al. .
(
2017
)
Necroptosis and ferroptosis are alternative cell death pathways that operate in acute kidney failure
.
Cell. Mol. Life Sci.
74
,
3631
3645
[PubMed]
37.
Roskoski
R.
Jr
(
2016
)
Classification of small molecule protein kinase inhibitors based upon the structures of their drug-enzyme complexes
.
Pharmacol. Res.
103
,
26
48
[PubMed]
38.
Jafari
R.
,
Almqvist
H.
,
Axelsson
H.
et al. .
(
2014
)
The cellular thermal shift assay for evaluating drug target interactions in cells
.
Nat. Protoc.
9
,
2100
2122
[PubMed]
39.
Cho
Y.S.
,
Challa
S.
,
Moquin
D.
et al. .
(
2009
)
Phosphorylation-driven assembly of the RIP1-RIP3 complex regulates programmed necrosis and virus-induced inflammation
.
Cell
137
,
1112
1123
[PubMed]
40.
Wu
X.N.
,
Yang
Z.H.
,
Wang
X.K.
et al. .
(
2014
)
Distinct roles of RIP1-RIP3 hetero- and RIP3-RIP3 homo-interaction in mediating necroptosis
.
Cell Death Differ.
21
,
1709
1720
[PubMed]
41.
Galluzzi
L.
,
Kepp
O.
,
Chan
F.K.
et al. .
(
2017
)
Necroptosis: mechanisms and relevance to disease
.
Annu. Rev. Pathol.
12
,
103
130
42.
Gao
L.
,
Wu
W.F.
,
Dong
L.
et al. .
(
2016
)
Protocatechuic aldehyde attenuates cisplatin-induced acute kidney injury by suppressing Nox-mediated oxidative stress and renal inflammation
.
Front. Pharmacol.
7
,
479
43.
Newton
K.
,
Dugger
D.L.
,
Maltzman
A.
et al. .
(
2016
)
RIPK3 deficiency or catalytically inactive RIPK1 provides greater benefit than MLKL deficiency in mouse models of inflammation and tissue injury
.
Cell Death Differ.
23
,
1565
1576
[PubMed]
44.
Sureshbabu
A.
,
Patino
E.
,
Ma
K.C.
et al. .
(
2018
)
RIPK3 promotes sepsis-induced acute kidney injury via mitochondrial dysfunction
.
JCI Insight
3
45.
Meng
X.M.
,
Li
H.D.
,
Wu
W.F.
et al. .
(
2018
)
Wogonin protects against cisplatin-induced acute kidney injury by targeting RIPK1-mediated necroptosis
.
Lab. Invest.
98
,
79
94
[PubMed]
46.
Jiang
L.
,
Liu
X.Q.
,
Ma
Q.
et al. .
(
2019
)
hsa-miR-500a-3P alleviates kidney injury by targeting MLKL-mediated necroptosis in renal epithelial cells
.
FASEB J.
33
,
3523
3535
[PubMed]
47.
Degterev
A.
and
Linkermann
A.
(
2016
)
Generation of small molecules to interfere with regulated necrosis
.
Cell. Mol. Life Sci.
73
,
2251
2267
[PubMed]
48.
Kaczmarek
A.
,
Vandenabeele
P.
and
Krysko
D.V.
(
2013
)
Necroptosis: the release of damage-associated molecular patterns and its physiological relevance
.
Immunity
38
,
209
223
[PubMed]
49.
Sarhan
M.
,
Land
W.G.
,
Tonnus
W.
et al. .
(
2018
)
Origin and consequences of necroinflammation
.
Physiol. Rev.
98
,
727
780
[PubMed]
50.
Peltzer
N.
and
Walczak
H.
(
2019
)
Cell death and inflammation - a vital but dangerous liaison
.
Trends Immunol.
40
,
387
402
[PubMed]
51.
Dixon
S.J.
and
Stockwell
B.R.
(
2014
)
The role of iron and reactive oxygen species in cell death
.
Nat. Chem. Biol.
10
,
9
17
[PubMed]
52.
Fulda
S.
(
2016
)
Regulation of necroptosis signaling and cell death by reactive oxygen species
.
Biol. Chem.
397
,
657
660
[PubMed]
53.
Qian
Y.
,
Guo
X.
,
Che
L.
et al. .
(
2018
)
Klotho reduces necroptosis by targeting oxidative stress involved in renal ischemic-reperfusion injury
.
Cell. Physiol. Biochem.
45
,
2268
2282
54.
Meng
X.M.
,
Ren
G.L.
,
Gao
L.
et al. .
(
2018
)
NADPH oxidase 4 promotes cisplatin-induced acute kidney injury via ROS-mediated programmed cell death and inflammation
.
Lab. Invest.
98
,
63
78
[PubMed]
55.
Yang
Q.
,
Wu
F.R.
,
Wang
J.N.
et al. .
(
2018
)
Nox4 in renal diseases: an update
.
Free Radic. Biol. Med.
124
,
466
472
[PubMed]

Author notes

*

These authors contributed equally to this work.

Supplementary data