Abstract

Cardiac fibrosis is a common pathological feature of many cardiovascular diseases. The regulatory mechanisms of miRNAs in cardiac fibrosis are still unknown. Previous studies on miR-214-3p in cardiac fibroblasts reached contradictory conclusions. Thus the role of miR-214-3p in cardiac fibrosis deserves further exploration. Using a combination of in vitro and in vivo studies, we identified miR-214-3p as an important regulator of cardiac fibrosis, and the proliferation and activation of cardiac fibroblasts. We demonstrated that the expression of miR-214-3p is down-regulated in TGF-β1-treated myofibroblasts and transverse aortic constriction (TAC)-induced murine model. Additionally, miR-214-3pflox/flox/FSP1-cre mice and miR-214-3pwt/wt/FSP1-cre mice were subjected to TAC operation or sham operation, and the conditional knockout of miR-214-3p in cardiac fibroblasts aggravates TAC-induced cardiac fibrosis. In vitro, our results indicate that miR-214-3p is an important repressor for fibroblasts proliferation and fibroblast-to-myofibroblast transition by functionally targeting NOD-like receptor family CARD domain containing 5 (NLRC5). In conclusion, our findings show that the deficiency of miR-214-3p exacerbates cardiac fibrosis and reveal a novel miR-214-3p/NLRC5 axis in the regulation of cardiac fibrosis.

Introduction

Cardiac fibrosis is characterized by the excessive deposition of extracellular matrix (ECM) proteins and is a common pathological feature of many cardiovascular diseases [1–3]. The abnormal proliferation and collagen secretion of myofibroblasts are the key reasons for the metabolic disorders of ECM [2,4]. Transforming growth factor-β1 (TGF-β1) is an essential fibrogenic cytokine implicated in cardiac fibrosis by activating fibroblasts proliferation and fibroblast-to-myofibroblast transition (FMT) [1,5–7]. Therefore, it is important to target TGF-β1 signaling to inhibit the development of cardiac fibrosis.

MicroRNAs (miRNAs), generally defined as non-coding RNAs (approximately 22 nucleotides in length), mainly restrain gene expression at post-transcriptional regulation of mRNA [8–11]. Notably, Aurora et al. found that the genetic deletion of miR-214 in mice caused loss of cardiac contractility, increased apoptosis, and excessive fibrosis in response to ischemia reperfusion (IR) [12]. However, previous studies on the role of miR-214 in cardiac fibroblasts reported contradictory results. One study showed that down-regulation of miR-214 attenuated the proliferation and collagen synthesis, while another study reported that miR-214 exerted a cardio-protective effect by inhibiting fibroblasts activation [13,14]. Therefore, the role of miR-214-3p in cardiac fibrosis deserves further exploration.

In the present study, we identified miR-214-3p as a crucial factor that inhibited cardiac fibrosis and revealed its regulatory mechanism.

Materials and methods

Animals

Male C57/BL6 mice were purchased from Shanghai Laboratory Animal Research Center (Shanghai, China) and housed in Zhejiang Academy of Medical Sciences. All mice were housed with controlled temperature and humidity and a 12:12-h dark-light cycle, and were provided water and mouse chow ad libitum. All experimental procedures were approved by the Animal Care Ethics Committee of the First Affiliated Hospital, Zhejiang University, and were performed in accordance with the National Institutes of Health guide for the care and use of laboratory animals. miR-214-3pflox/flox mice were purchased from Nanjing University-Nanjing Institute of Biomedical Research (Nanjing, China) (miR-214-3p genomic structure and targeting strategy were shown in Supplementary Figure S1. FSP1-cre mice were purchased from The Jackson Laboratory. miR-214-3pflox/flox/FSP1-cre mice used in the present study were generated by the crossing of miR-214-3pflox/flox with FSP1-cre mice. miR-214-3pflox/flox/FSP1-cre mice showed normal phenotypes with no apparent changes in the development. HE staining of the hearts (A) and heart weight/body weight (HW/BW) (B) in wide-type (WT) and miR-214-3p knockout (KO) mice with TAC treatment (TAC) or without TAC treatment (SHAM) were shown in Supplementary Figure S2.

Transverse aortic constriction surgery

The experimental mice (male, 5–6 weeks old) were subjected to transverse aortic constriction (TAC) surgery or sham surgery for 6 weeks following standard procedures. The general parameters of Sham and TAC groups are listed in Table 1.

Table 1
General parameters of Sham and TAC groups
 Initial BW (g) 2 weeks BW (g) 6 weeks 
   BW (g) HW (mg) HW/BW 
Sham-WT 17.93 ± 0.12 21.10 ± 0.45 26.42 ± 0.31 102.9 ± 2.4 3.9 ± 0.07 
TAC-WT 18.01 ± 0.10 21.25 ± 0.31 25.71 ± 0.24 145.6 ± 7.0* 5.7 ± 0.25* 
Sham-KO 17.99 ± 0.12 21.86 ± 0.34 26.15 ± 0.13 107.8 ± 3.3 4.1 ± 0.14 
TAC-KO 18.09 ± 0.12 21.91 ± 0.35 26.25 ± 0.23 171.3 ± 7.2# 6.5 ± 0.25# 
 Initial BW (g) 2 weeks BW (g) 6 weeks 
   BW (g) HW (mg) HW/BW 
Sham-WT 17.93 ± 0.12 21.10 ± 0.45 26.42 ± 0.31 102.9 ± 2.4 3.9 ± 0.07 
TAC-WT 18.01 ± 0.10 21.25 ± 0.31 25.71 ± 0.24 145.6 ± 7.0* 5.7 ± 0.25* 
Sham-KO 17.99 ± 0.12 21.86 ± 0.34 26.15 ± 0.13 107.8 ± 3.3 4.1 ± 0.14 
TAC-KO 18.09 ± 0.12 21.91 ± 0.35 26.25 ± 0.23 171.3 ± 7.2# 6.5 ± 0.25# 

Data were shown as mean ± SD. WT: wild-type mice; KO: miR-214-3p knockout mice; BW: body weight; HW: heart weight.

*

Indicated a significant difference between Sham-WT and TAC-WT.

#

Indicated a significant difference between Sham- KO and TAC-KO.

Isolation and culture of neonatal mouse cardiac fibroblasts

Neonatal mouse cardiac fibroblasts were isolated from C57BL/6 mice following standard procedures. Cells were cultured in high glucose Dulbecco’s modified Eagle medium supplemented with 10% fetal bovine serum, 100 U/ml penicillin, and 100 μg/ml streptomycin (Gibco). These cells were maintained at 37°C in a humidified atmosphere containing 5% CO2.

Transfection and chemical treatments

miR-214-3p mimic and the corresponding negative control (mimic NC), miR-214-3p inhibitor (antagomir), and the corresponding negative control (inhibitor NC) were purchased from Ribobio (Guangzhou, China), SiRNA targeting NLRC5 and negative control with scramble sequence were purchased from Genepharm (Shanghai, China). Fibroblasts were transfected using Lipofectamine 3000 reagent (Invitrogen, U.S.A.) according to the manufacturer’s instructions. The cells were treated with 10 ng/ml Recombinant Human TGF-β1 (Invitrogen, U.S.A.) for 48 h.

Masson staining and sirius red staining

Mouse hearts were fixed with 4% paraformaldehyde for 24 h. Fixed tissue was then paraffin embedded and serial sectioned with a microtome (5 μm thickness).The extent of both perivascular and interstitial fibrosis in the heart was evaluated by Masson staining or Sirius red staining. The fibrotic area was quantified by calculating the percentage of collagen staining (blue staining or red staining) using ImageJ analysis (National Institutes of Health, U.S.A.).

Cell Counting Kit-8 assay (CCK8) and EdU assay

Cardiac fibroblasts were trypsinized to obtain a single-cell suspension, and 10000 cells were seeded in 96-well plates. Cell Counting Kit-8 (Dojindo, Japan) was added and incubated at 37°C for 1–2 h, according to the color change. The OD (optical density) value at 450 nm was obtained using a microplate reader (SpectraMax i3x, Molecular Devices, U.S.A.). Cell proliferation quantification was performed using the Cell-Light EdU DNA Cell Proliferation Kit (Ribobio, China) according to the manufacturer’s instructions. The images were collected under green laser with Leica DM2000 Fluorescence Microscope (Leica, Germany).

Dual luciferase reporter assay

NLRC5 CDS wild-type (WT) sequence (carrying a miR-214-3p binding site) and mutant type (MUT) sequence (carrying a mut site) was amplified by PCR and inserted into pGL6-miR vector (Beyotime, China), and named pGL6-miR-WT and pGL6-miR-MUT, respectively. 293T cells were seeded in 24-well plates, cultured overnight. Empty vector, pGL6-miR-WT or pGL6-miR-MUT together with miR-214-3p mimic and mimic-NC and Renilla luciferase plasmid were co-transfected into 293T cells by Lipofectamine 3000 reagent (Invitrogen, U.S.A.). Forty-eight hours after transfection, the cells were harvested and lysed. Firefly luciferase activities were detected with a Dual-Luciferase Reporter Assay System E1910 (Promega, U.S.A.) and normalized to control Renilla luciferase levels.

RNA isolation and qRT-PCR

Total RNA was isolated from murine cardiac specimens and cells with the TRIzol reagent (Invitrogen, U.S.A.). according to the manufacturer’s instructions. A One-Step PrimeScript RT reagent Kit with gDNA Eraser (Takara, Japan) was used for reverse transcription. cDNA was generated from miRNA with Mir-X miRNA First Strand Synthesis Kit (Takara, Japan). Qualitative reverse transcriptase-polymerase chain reaction (qRT-PCR) was performed using TB Green Premix Ex Taq II (Takara, Japan) and primers listed in Table 2. GAPDH and U6 were used as endogenous controls.

Table 2
Primer used in the present study
Gene Forward primers (5′–3′) Reverse primers (5′–3′) 
GAPDH AGGTCGGTGTGAACGGATTTG TGTAGACCATGTAGTTGAGGTCA 
NLRC5 CAGATGGTGGAAACTTTTAGCC AACTTCCTTAGCACCTGGATCA 
U6 GCTCGCTTCGGCAGCACAT AAAATATGGAACGCTTCACG 
α-SMA CGGGAGAAAATGACCCAGATT AGGGACAGCACAGCCTGAATAG 
Col1α1 GGAGAGTACTGGATCGACCCTAAC ACACAGGTCTGACCTGTCTCCAT 
miR-214-3p GGACAGCAGGCACAGACAG CAGTGCGTGTCGTGGAGT 
Gene Forward primers (5′–3′) Reverse primers (5′–3′) 
GAPDH AGGTCGGTGTGAACGGATTTG TGTAGACCATGTAGTTGAGGTCA 
NLRC5 CAGATGGTGGAAACTTTTAGCC AACTTCCTTAGCACCTGGATCA 
U6 GCTCGCTTCGGCAGCACAT AAAATATGGAACGCTTCACG 
α-SMA CGGGAGAAAATGACCCAGATT AGGGACAGCACAGCCTGAATAG 
Col1α1 GGAGAGTACTGGATCGACCCTAAC ACACAGGTCTGACCTGTCTCCAT 
miR-214-3p GGACAGCAGGCACAGACAG CAGTGCGTGTCGTGGAGT 

Western blot analysis

The antibodies included GAPDH (Abcam Cat# ab8245, RRID:AB_2107448), NLRC5 (Abcam Cat# ab105411, RRID:AB_10710068), Col1α1 (CST Cat #84336, U.S.A.), α-SMA (Abcam Cat# ab5694, RRID:AB_2223021), Ago-2 (CST Cat# 2897, RRID:AB_2096291), and HRP-labeled Goat Anti-Rabbit IgG(H+L) (Beyotime, A0208, China). The animal heart tissue and cell sample was homogenized in RIPA Lysis Buffer (Beyotime, P0013B, China) supplemented with Protease inhibitor cocktail (Beyotime, P1005, China). Total protein was separated by SDS–PAGE and transferred to PVDF membranes. The membranes were incubated with primary antibody and then with secondary antibody. The signals were detected with an ECL kit (Millipore, U.S.A.).

RNA immunoprecipitation

Immunoprecipitation (IP) was performed with EZ-Magna RIP RNA-Binding Protein Immunoprecipitation Kit (Millipore, U.S.A.) according to the manufacturer’s instructions. Briefly, fibroblasts were collected and resuspended in RIP lysis buffer, and the cell extracts were incubated with IP buffer containing magnetic beads conjugated with rabbit anti-AGO2 antibody (CST), normal mouse IgG (Merck Millipore) or Anti-SNRNP70 antibody (Merck Millipore) overnight. Subsequently, the magnetic beads were incubated with proteinase K after washing six times by RIP Wash Buffer. Total RNA was subsequently isolated from the extracts using the TRIzol (Invitrogen, U.S.A.).

Statistical analysis

Data were expressed as mean ± SD of at least three biological replicates experiments. A two-sided Student’s t-test was used to analyze the differences between two groups. P<0.05 indicated significance. All statistical analysis was performed using SPSS 18.0 and GraphPad Prism 6.

Results

MiR-214-3p is down-regulated in TAC-induced cardiac fibrosis and TGF-β1-induced activation of fibroblasts

To investigate the role of miR-214-3p in the pathogenesis of cardiac fibrosis, we first subjected the mice with TAC to induce a classical model of cardiac fibrosis [15,16], and our results demonstrated that miR-214-3p expression was down-regulated in TAC-subjected hearts, compared with the sham group (Figure 1A). In addition, miR-214-3p expression was down-regulated in both fibroblasts and cardiomyocytes of TAC-subjected mice, compared with the sham group (Supplementary Figure S3). Next we measured the expression of two fibrotic markers Type I collagen alpha 1 (Col1α1) and alpha smooth muscle actin (α-SMA). We observed significant increase in both mRNA and protein levels of Col1 and α-SMA in the hearts of TAC-subjected mice (Figure 1B,C). Additionally, Masson staining showed very strong staining of total collagen in the heart tissues of TAC-subjected mice compared with sham-operated mice (Figure 1D). Finally, we detected serum miR-214 level and found that it was lower in mice subjected to TAC compared with sham operated (Supplementary Figure S4).

miR-214-3p is down-regulated in TAC mice and TGF-β1 treated myofibroblast

Figure 1
miR-214-3p is down-regulated in TAC mice and TGF-β1 treated myofibroblast

TAC surgery was performed in TAC-operated group mice. In the sham-operated group, aortic arch was exposed but not subjected to TAC surgery (n=9 in TAC-operated and sham-operated group). All hearts in TAC-operated and sham-operated group were collected 6 weeks after surgery. (A) miR-214-3p expression was measured by qRT-PCR. Col1α1 and α-SMA expression was measured by (B) qRT-PCR and (C) Western blot analysis. GAPDH was used as an internal control. (D) Accumulation of collagen in the left ventricular sections of Sham and TAC mice hearts were assessed by Masson staining. (E) qRT-PCR analysis of miR-214-3p level in myofibroblast treated with TGF-β1 or vehicle (1% BSA) (n=3). The data were presented as the means ± SD of three independent experiments. Scale bars, 50 μm. *P<0.05, **P<0.01, ***P<0.001, ****P<0.0001. BSA, bull serum albumin.

Figure 1
miR-214-3p is down-regulated in TAC mice and TGF-β1 treated myofibroblast

TAC surgery was performed in TAC-operated group mice. In the sham-operated group, aortic arch was exposed but not subjected to TAC surgery (n=9 in TAC-operated and sham-operated group). All hearts in TAC-operated and sham-operated group were collected 6 weeks after surgery. (A) miR-214-3p expression was measured by qRT-PCR. Col1α1 and α-SMA expression was measured by (B) qRT-PCR and (C) Western blot analysis. GAPDH was used as an internal control. (D) Accumulation of collagen in the left ventricular sections of Sham and TAC mice hearts were assessed by Masson staining. (E) qRT-PCR analysis of miR-214-3p level in myofibroblast treated with TGF-β1 or vehicle (1% BSA) (n=3). The data were presented as the means ± SD of three independent experiments. Scale bars, 50 μm. *P<0.05, **P<0.01, ***P<0.001, ****P<0.0001. BSA, bull serum albumin.

TGF-β1 is a crucial fibrogenic cytokine and promotes fibroblasts proliferation and the activation of FMT. TGF-β1 induced a remarkable down-regulation of miR-214-3p in myofibroblasts compared with vehicle treated fibroblasts (Figure 1E). Taken together, these data suggest that miR-214-3p expression was decreased in murine TAC-model and TGF-β1 stimulated myofibroblasts.

The deficiency of miR-214-3p exacerbates TAC-induced cardiac fibrosis

Compared with miR-214-3pwt/wt/FSP1-cre mice (with wild-type miR-214-3p; 311 bp), miR-214-3pflox/flox/FSP1-cre mice (with floxed miR-214-3p; 409 bp) showed successful deletion of the wild-type miR-214-3p gene on both alleles (Figure 2A). qPCR confirmed miR-214-3p expression in cardiac fibroblasts isolated from miR-214-3pwt/wt/FSP1-cre mice (WT) and successful depletion of miR-214-3p expression in cardiac fibroblasts isolated from miR-214-3pflox/flox/FSP1-cre (KO) (Figure 2B). Next, we performed TAC surgery or sham surgery in WT and KO. Sirius red staining showed little collagen deposition in both sham-subjected KO and sham-subjected WT groups, but TAC-subjected KO group showed more collagen deposition than TAC-subjected WT group (Figure 2C). qRT-PCR and Western blot (WB) analysis showed that mRNA levels of Col1α1 and α-SMA were elevated slightly in the hearts of sham-subjected KO group compared with sham-subjected WT (Figure 2D). However, we observed no differences at the protein levels between two groups (Figure 2E). Moreover, TAC-subjected KO group showed much more severe fibrosis than TAC-subjected WT group (Figure 2D,E). These in vivo results suggest that the deficiency of miR-214-3p exacerbates cardiac fibrosis in mice under TAC surgery but not under sham surgery.

The deficiency of miR-214-3p exacerbates TAC-induced cardiac fibrosis

Figure 2
The deficiency of miR-214-3p exacerbates TAC-induced cardiac fibrosis

(A) PCR was performed to demonstrate that wild-type miR-214-3p gene (311 bp) was replaced by floxed miR-214-3p genes (409 bp) in miR-214-3pflox/flox/FSP1-cre mice. (B) Neonatal cardiac fibroblasts were isolated from KO and WT, miR-214-3p was measured by qRT-PCR. (C) Representative images of Sirius red staining of ventricular sections. (D) mRNA and (E) protein expression of Col1α1 and α-SMA was measured by qRT-PCR and WB. All n=5 in model groups. The data were presented as the means ± SD of three independent experiments. Scale bars, 50 μm. *P<0.05, **P<0.01, ***P<0.001, #P>0.1, ##P>0.5. WT, miR-214-3pwt/wt/FSP1-cre mice; KO, miR-214-3pflox/flox/FSP1-cre mice.

Figure 2
The deficiency of miR-214-3p exacerbates TAC-induced cardiac fibrosis

(A) PCR was performed to demonstrate that wild-type miR-214-3p gene (311 bp) was replaced by floxed miR-214-3p genes (409 bp) in miR-214-3pflox/flox/FSP1-cre mice. (B) Neonatal cardiac fibroblasts were isolated from KO and WT, miR-214-3p was measured by qRT-PCR. (C) Representative images of Sirius red staining of ventricular sections. (D) mRNA and (E) protein expression of Col1α1 and α-SMA was measured by qRT-PCR and WB. All n=5 in model groups. The data were presented as the means ± SD of three independent experiments. Scale bars, 50 μm. *P<0.05, **P<0.01, ***P<0.001, #P>0.1, ##P>0.5. WT, miR-214-3pwt/wt/FSP1-cre mice; KO, miR-214-3pflox/flox/FSP1-cre mice.

miR-214-3p inhibits fibroblast proliferation and the induction of FMT

To evaluate the role of miR-214-3p in fibroblast proliferation and the induction of FMT, we overexpressed or suppressed miR-214-3p in neonatal mouse fibroblasts by transfecting miR-214-3p mimic or miR-214-3p inhibitor. Our results showed that miR-214-3p mimic markedly increased the levels of miR-214-3p (Figure 3A), but significantly decreased the mRNA and protein expression of FMT markers α-SMA and Col1α1 (Figure 3B–D). In addition, CCK8 assay and EdU assay showed that overexpression of miR-214-3p markedly inhibited the proliferation of fibroblasts (Figure 3E,F). In contrast, miR-214-3p inhibitor activated FMT (Figure 3B–D) and promoted proliferation ability of fibroblasts (Figure 3E,F). To extend the findings in mouse fibroblasts to human cardiac fibroblasts, we used miR-214-3p mimic or miR-214-3p inhibitor to transfect human cardiac fibroblasts and the results showed that miR-214-3p inhibited human cardiac fibroblast activation (Supplementary Figure S5).

The role of miR-214-3p in fibroblast proliferation and FMT

Figure 3
The role of miR-214-3p in fibroblast proliferation and FMT

(A) The overexpression efficiency of miR-214-3p mimic after transfection for 48 h. qRT-PCR analysis of mRNA levels of (B) Col1α1 and (C) α-SMA. (D) Western blot analysis of protein levels of Col1α1 and α-SMA, GAPDH was used as an internal control. (E) CCK-8 assay of fibroblast proliferation after treatment with mimic NC, miR-214-3p mimic, inhibitor NC, or miR-214-3p inhibitor. (F) EdU assay. Fibroblasts in the S-phase were stained with EdU in red while the nuclei were stained with DAPI in blue. The data were presented as the means ± SD of three independent experiments. Scale bars, 50 μm. *P<0.05, **P<0.01, ***P<0.001. NC, negative control.

Figure 3
The role of miR-214-3p in fibroblast proliferation and FMT

(A) The overexpression efficiency of miR-214-3p mimic after transfection for 48 h. qRT-PCR analysis of mRNA levels of (B) Col1α1 and (C) α-SMA. (D) Western blot analysis of protein levels of Col1α1 and α-SMA, GAPDH was used as an internal control. (E) CCK-8 assay of fibroblast proliferation after treatment with mimic NC, miR-214-3p mimic, inhibitor NC, or miR-214-3p inhibitor. (F) EdU assay. Fibroblasts in the S-phase were stained with EdU in red while the nuclei were stained with DAPI in blue. The data were presented as the means ± SD of three independent experiments. Scale bars, 50 μm. *P<0.05, **P<0.01, ***P<0.001. NC, negative control.

miR-214-3p inhibits the activation of fibroblasts by targeting NLRC5

NLRC5 (NOD-like receptor family CARD domain containing 5) has been suggested to accelerate deterioration in the fibrosis of organs, such as the skin [17], liver [18], and heart [19]. In addition, we found that TGF-β1 induced significant up-regulation of NLRC5 expression in fibroblasts at mRNA level (Figure 4A) and protein level (Figure 4B). Next we assessed NLRC5 protein expression in cardiac fibroblasts isolated from WT group and KO group, which received TAC-operation or sham-operation. We found that NLRC5 protein expression was elevated in fibroblasts isolated from both sham-subjected KO group and TAC-subjected KO group (Supplementary Figure S6). These data suggest that miR-214 regulates NLRC5 both under basal conditions and TAC-treatment conditions. Therefore, we wonder whether NLRC5 is a target of miR-214-3p to mediate the function of miR-214-3p in cardiac fibrosis.

NLRC5 promotes fibroblast activation

Figure 4
NLRC5 promotes fibroblast activation

(A) Relative mRNA level of NLRC5 was measured by qRT-PCR, (B) protein level of NLRC5 was measured by Western blot analysis after fibroblasts were treated with 10 ng/ml TGF-β1 for 48 h. Fibroblasts were transfected with Si-NLRC5 or Si-Scramble for 48 h. (C) The knockdown efficiency of Si-NLRC5 was measured by qRT-PCR. (D) CCK8 assay and (E) EdU assay was used to test proliferative capacity after transfection. Analysis of mRNA levels (F) and protein levels (G) of Col1α1 and α-SMA. The data were presented as the means ± SD of three independent experiments. Scale bars, 50 μm. *P<0.05, **P<0.01, ****P<0.0001.

Figure 4
NLRC5 promotes fibroblast activation

(A) Relative mRNA level of NLRC5 was measured by qRT-PCR, (B) protein level of NLRC5 was measured by Western blot analysis after fibroblasts were treated with 10 ng/ml TGF-β1 for 48 h. Fibroblasts were transfected with Si-NLRC5 or Si-Scramble for 48 h. (C) The knockdown efficiency of Si-NLRC5 was measured by qRT-PCR. (D) CCK8 assay and (E) EdU assay was used to test proliferative capacity after transfection. Analysis of mRNA levels (F) and protein levels (G) of Col1α1 and α-SMA. The data were presented as the means ± SD of three independent experiments. Scale bars, 50 μm. *P<0.05, **P<0.01, ****P<0.0001.

We designed siRNA targeting NLRC5 (Si-NLRC5) to knockdown NLRC5 in fibroblasts (Figure 4C). Compared with Si-Scramble, fibroblasts treated with Si-NLRC5 showed impaired proliferative capacity based on CCK8 assay (Figure 4D) and EdU staining assay (Figure 4E). In addition, Si-NLRC5 decreased α-SMA and Col1α1 expression at both mRNA level (Figure 4F) and protein level (Figure 4G).

To assess whether miR-214-3p inhibits fibroblast proliferation and FMT by targeting NLRC5, miR-214-3p mimic or mimic-NC was transfected into fibroblasts. While transfection with miR-214-3p mimic led to decreased NLRC5 expression, transfection with miR-214-3p inhibitor resulted in increased NLRC5 expression at both mRNA level (Figure 5A) and protein levels (Figure 5B).

miR-214-3p inhibits fibroblast activation by targeting NLRC5

Figure 5
miR-214-3p inhibits fibroblast activation by targeting NLRC5

Analysis of mRNA levels (A) and protein levels (B) of NLRC5. (C) The levels of α-SMA and Col1α1 were measured by RT-qPCR and (D) the proliferation of fibroblasts was assessed by EdU assay after fibroblasts were transfected with miR-214-3p inhibitor or Si-NLRC5. The data were presented as the means ± SD of three independent experiments. Scale bars, 50 μm. *P<0.05, **P<0.01, ***P<0.001.

Figure 5
miR-214-3p inhibits fibroblast activation by targeting NLRC5

Analysis of mRNA levels (A) and protein levels (B) of NLRC5. (C) The levels of α-SMA and Col1α1 were measured by RT-qPCR and (D) the proliferation of fibroblasts was assessed by EdU assay after fibroblasts were transfected with miR-214-3p inhibitor or Si-NLRC5. The data were presented as the means ± SD of three independent experiments. Scale bars, 50 μm. *P<0.05, **P<0.01, ***P<0.001.

Then we investigated whether the down-regulation of miR-214-3p exacerbates the activation of fibroblasts upon elevating NLRC5 expression. Our results showed that miR-214-3p inhibitor significantly increased the levels of α-SMA and Col1α1, but the increase could be restrained upon NLRC5 knockdown (Figure 5C). Moreover, EdU assay showed that increased proliferation of fibroblasts induced by miR-214-3p inhibitor could be suppressed by NLRC5 knockdown (Figure 5D). Taken together, these results suggest that miR-214-3p inhibits fibroblast proliferation and FMT by inhibiting NLRC5 expression.

miR-214-3p directly regulates NLRC5 in an Ago-2-dependent manner

To verify that NLRC5 is a direct target of miR-214-3p, we performed target gene prediction for miR-214-3p and found a putative miR-214-3p binding site in NLRC5 sequence (Figure 6A). We constructed wild-type (pGL6-miR-WT) and mutant (pGL6-miR-MUT) luciferase reporter vector. Luciferase activity assay showed that miR-214-3p significantly reduced luciferase activity of pGL6-miR-WT but not pGL6-miR-MUT (Figure 6B).

miR-214-3p directly regulates NLRC5 in an Ago-2-dependent manner

Figure 6
miR-214-3p directly regulates NLRC5 in an Ago-2-dependent manner

(A) CDS of NLRC5 contains one miR-214-3p binding site predicted by TargetScan software and we designed one NLRC5 mutated site (NLRC5-mut). (B) A dual-luciferase reporter assay was performed after co-transfection with reporter vector and miR-214-3p mimic or mimic NC in 293T for 48 h. (C) RIP products were measured by RT-qPCR. Western blot analysis of input proteins and proteins immunoprecipitated with either Ago-2 antibody or IgG. The data were presented as the means ± SD of three independent experiments. Scale bars, 50 μm. **P<0.01, ***P<0.001.

Figure 6
miR-214-3p directly regulates NLRC5 in an Ago-2-dependent manner

(A) CDS of NLRC5 contains one miR-214-3p binding site predicted by TargetScan software and we designed one NLRC5 mutated site (NLRC5-mut). (B) A dual-luciferase reporter assay was performed after co-transfection with reporter vector and miR-214-3p mimic or mimic NC in 293T for 48 h. (C) RIP products were measured by RT-qPCR. Western blot analysis of input proteins and proteins immunoprecipitated with either Ago-2 antibody or IgG. The data were presented as the means ± SD of three independent experiments. Scale bars, 50 μm. **P<0.01, ***P<0.001.

RNA-induced silencing complex (RISC) is an essential functional structure where miRNAs complete the assembly and induce gene silencing, and Ago-2 (argonaute-2) is a core element of RISC [20–24]. To determine whether NLRC5 mRNA and miR-214-3p bind directly in RISC, RNA immunoprecipitation was performed in fibroblasts with Ago-2 antibody or IgG control. The results showed that NLRC5 mRNA and miR-214-3p were preferentially enriched in immunoprecipitation of Ago-2 antibody compared with IgG control (Figure 6C). These results indicate that NLRC5 is directly targeted by miR-214-3p in an Ago-2-dependent manner.

Discussion

Numerous studies have focused on the role of miRNAs in various human disorders [3,25]. Previous studies on the role of miR-214 in cardiac fibrosis showed contradictory conclusions, perhaps due to the selection of different models. In isoproterenol-induced model miR-214 promoted fibrosis, while in acute myocardial infarction model miR-214 showed cardio-protective effect [13,14]. In the present study we employed TAC induced classical cardiac fibrosis model to confirm that miR-214-3p plays a protective role in cardiac fibrosis.

We found that miR-214-3p is remarkably down-regulated in murine TAC model and TGF-β1 stimulated fibroblasts, similar to a previous study showing that miR-214 expression decreased in Ang-II infusion model [26]. Fibroblast proliferation and FMT is the major mechanisms of cardiac fibrosis [5]. Our in vitro cell studies provide further evidence that miR-214-3p restrained fibroblast proliferation and FMT. However, Duan et al. showed that miR-214 was up-regulated in the serum of heart failure patients and also in heart tissue of TAC mouse model [27]. The different results may be due to the different time point at which miR-214 expression was detected after TAC. A time course analysis of miR-214 expression following TAC showed that miR-214-3p level gradually decreased at 2, 4, and 6 weeks after TAC (Supplementary Figure S7). Therefore, further studies are needed to address the discrepancy on the up-regulation or down-regulation of miR-214-3p following TAC. It should be pointed out Duan et al. focused on the role of miR-214 in cardiac angiogenesis and found that miR-214 inhibited cardiac angiogenesis [27]. In this study we focused on the role of miR-214 in cardiac fibrosis and our results are consistent with previous studies showing the protective effect of miR-214 by inhibition of fibroblast activation [14,26],

Furthermore, previous study demonstrated that genetic deletion of miR-214 in mice causes excessive fibrosis [12]. The FSP1-cre driver has been used to track cardiac fibroblast [28]. Therefore, we constructed miR-214-3pflox/flox/FSP1-cre mice to conditionally knockout miR-214-3p in cardiac fibroblasts. Then, miR-214-3pflox/flox/FSP1-cre mice (KO) and miR-214-3pwt/wt/FSP1-cre mice (WT) received sham operation or TAC operation. We observed no significant differences in fibrosis lesion between the sham-treated WT group and the sham-treated KO group, consistent with a previous study that miR-214 knockout mice have normal cardiac structure and function [12]. However, TAC-subjected KO group showed more severe fibrosis than TAC-subjected WT group. It is interesting that the deficiency of miR-214-3p did not cause cardiac fibrosis in sham-operation group. Only after TAC surgery could the deficiency of miR-214-3p exacerbates cardiac fibrosis. Our data distinctly reveal the in vivo function of miR-214-3p and indicate that miR-214-3p may be a potential therapeutic target of cardiac fibrosis.

NLRC5 plays an important role in cardiac disease [19,29]. We found that knockdown of NLRC5 significantly inhibited the proliferation of fibroblast, in agreement with the finding by Zhou et al. [19]. However, Ma and Xie [29] showed the opposite data that NLRC5 knockout mice had accelerated fibrosis and inflammation response by promoting α-SMA, Collagen I, Collagen III. The opposite results could be explained by the different cells used. We explored the role of NLRC5 in cardiac fibroblasts while Ma and Xie [29] used cardiomyocytes. In fact, the function of proteins may be different in different kinds of cells. For example, TGF-β1 promotes cardiomyocyte apoptosis [30], but promotes cardiac fibroblast proliferation [3]. Further studies are needed to investigate the role of NLRC5 in cardiac fibrosis in vivo.

The miRNAs mainly inhibit gene expression at post-transcription level via binding to the complementary sequences of mRNAs [8–10], which mostly locate at the 3′-untranslated region (3′-UTR) and also at CDS region [31,32]. In order to prove the role of miR-214-3p/NLRC5 axis in fibroblast activation, we showed that miR-214-3p negatively modulated the expression of NLRC5; rescue experiments demonstrated that the decreased level of miR-214-3p enhanced fibroblast activation upon elevating NLRC5 level; dual luciferase reporter assay revealed a putative miR-214-3p binding site in NLRC5 CDS region; RIP assay confirmed the direct interaction between miR-214-3p and NLRC5 mRNA. However, we could not exclude the possibility that miR-214-3p inhibits cardiac fibrosis via down-regulating its many targets such as EZH1, EZH2, Mfn2, NCX1, Bim, CamKII, and CypD because we found that miR-214-3p mimic inhibited mRNA expression of these target genes in cardiac fibroblasts (Supplementary Figure S8).

In conclusion, our findings show that the deficiency of miR-214-3p exacerbates cardiac fibrosis and reveal a novel miR-214-3p/NLRC5 axis in the regulation of cardiac fibrosis.

Clinical perspectives

  • Cardiac fibrosis is a common pathological feature of many cardiovascular diseases. The regulatory mechanisms of miRNAs in cardiac fibrosis are still unknown.

  • We demonstrated that the expression of miR-214-3p is down-regulated in TGF-β1-treated myofibroblasts and TAC-induced murine model. Additionally, conditional knockout of miR-214-3p in cardiac fibroblasts aggravates TAC-induced cardiac fibrosis. In vitro, we found that miR-214-3p is an important repressor for fibroblasts proliferation and FMT by functionally targeting NLRC5.

  • We reveal that miR-214-3p/NLRC5 axis is a potential therapeutic target for cardiac fibrosis.

Funding

This work was supported by the Zhejiang Provincial Medical and Health Science and Technology Project, China [grant number 2018KY047]. We are grateful for technical assistance and support from Dr. Xinmiao Zhou and Dr. Zhen Jia.

Author Contribution

XH designed the study. KY, JS, and ZH performed the experiments. All authors read and approved the manuscript.

Competing Interests

The authors declare that there are no competing interests associated with the manuscript.

Abbreviations

     
  • Col1α1

    Type I collagen alpha 1

  •  
  • ECM

    extracellular matrix

  •  
  • FMT

    fibroblast-to-myofibroblast transition

  •  
  • NLRC5

    NOD-like receptor family CARD domain containing 5

  •  
  • qRT-PCR

    qualitative reverse transcriptase-polymerase chain reaction

  •  
  • RISC

    RNA-induced silencing complex

  •  
  • SMA

    smooth muscle actin

  •  
  • TAC

    transverse aortic constriction

  •  
  • TGF-β1

    transforming growth factor-β1

  •  
  • WB

    Western blot

References

References
1.
Kong
P.
,
Christia
P.
and
Frangogiannis
N.G.
(
2014
)
The pathogenesis of cardiac fibrosis
.
Cell. Mol. Life Sci.
71
,
549
574
[PubMed]
2.
Polyak
A.
,
Kui
P.
,
Morvay
N.
,
Lepran
I.
,
Agoston
G.
,
Varga
A.
et al.
(
2018
)
Long-term endurance training-induced cardiac adaptation in new rabbit and dog animal models of the human athlete’s heart
.
Rev. Cardiovasc. Med.
19
,
135
142
[PubMed]
3.
Nagpal
V.
,
Rai
R.
,
Place
A.T.
,
Murphy
S.B.
,
Verma
S.K.
and
Ghosh
A.K.
(
2016
)
MiR-125b is critical for fibroblast-to-myofibroblast transition and cardiac fibrosis
.
Circulation
133
,
291
301
[PubMed]
4.
Abonnenc
M.
,
Nabeebaccus
A.A.
,
Mayr
U.
,
Barallobre-Barreiro
J.
,
Dong
X.
,
Cuello
F.
et al.
(
2013
)
Extracellular matrix secretion by cardiac fibroblasts: role of microRNA-29b and microRNA-30c
.
Circ. Res.
113
,
1138
1147
[PubMed]
5.
Weber
K.T.
,
Sun
Y.
,
Bhattacharya
S.K.
,
Ahokas
R.A.
and
Gerling
I.C.
(
2013
)
Myofibroblast-mediated mechanisms of pathological remodelling of the heart
.
Nat. Rev. Cardiol.
10
,
15
26
[PubMed]
6.
Tijsen
A.J.
,
van der Made
I.
,
van den Hoogenhof
M.M.
,
Wijnen
W.J.
,
van Deel
E.D.
,
de Groot
N.E.
et al.
(
2014
)
The microRNA-15 family inhibits the TGFbeta-pathway in the heart
.
Cardiovasc. Res.
104
,
61
71
[PubMed]
7.
Zeisberg
E.M.
and
Kalluri
R.
(
2010
)
Origins of cardiac fibroblasts
.
Circ. Res.
107
,
1304
1312
[PubMed]
8.
Bartel
D.P.
(
2004
)
MicroRNAs: genomics, biogenesis, mechanism, and function
.
Cell
116
,
281
297
[PubMed]
9.
Wightman
B.
,
Ha
I.
and
Ruvkun
G.
(
1993
)
Posttranscriptional regulation of the heterochronic gene lin-14 by lin-4 mediates temporal pattern formation in C. elegans
.
Cell
75
,
855
862
[PubMed]
10.
Zardo
G.
,
Ciolfi
A.
,
Vian
L.
,
Billi
M.
,
Racanicchi
S.
,
Grignani
F.
et al.
(
2012
)
Transcriptional targeting by microRNA-polycomb complexes: a novel route in cell fate determination
.
Cell Cycle
11
,
3543
3549
[PubMed]
11.
Bartel
D.P.
(
2018
)
Metazoan microRNAs
.
Cell
173
,
20
51
[PubMed]
12.
Aurora
A.B.
,
Mahmoud
A.I.
,
Luo
X.
,
Johnson
B.A.
,
van Rooij
E.
,
Matsuzaki
S.
et al.
(
2012
)
MicroRNA-214 protects the mouse heart from ischemic injury by controlling Ca(2)(+) overload and cell death
.
J. Clin. Invest.
122
,
1222
1232
[PubMed]
13.
Sun
M.
,
Yu
H.
,
Zhang
Y.
,
Li
Z.
and
Gao
W.
(
2015
)
MicroRNA-214 mediates isoproterenol-induced proliferation and collagen synthesis in cardiac fibroblasts
.
Sci. Rep.
5
,
18351
[PubMed]
14.
Dong
H.
,
Dong
S.
,
Zhang
L.
,
Gao
X.
,
Lv
G.
,
Chen
W.
et al.
(
2016
)
MicroRNA-214 exerts a cardio-protective effect by inhibition of fibrosis
.
Anat. Rec.
299
,
1348
1357
15.
Zhang
X.
,
Szeto
C.
,
Gao
E.
,
Tang
M.
,
Jin
J.
,
Fu
Q.
et al.
(
2013
)
Cardiotoxic and cardioprotective features of chronic beta-adrenergic signaling
.
Circ. Res.
112
,
498
509
[PubMed]
16.
Xiao
H.
,
Ma
X.
,
Feng
W.
,
Fu
Y.
,
Lu
Z.
,
Xu
M.
et al.
(
2010
)
Metformin attenuates cardiac fibrosis by inhibiting the TGFbeta1-Smad3 signalling pathway
.
Cardiovasc. Res.
87
,
504
513
[PubMed]
17.
Ma
H.L.
,
Zhao
X.F.
,
Chen
G.Z.
,
Fang
R.H.
and
Zhang
F.R.
(
2016
)
Silencing NLRC5 inhibits extracellular matrix expression in keloid fibroblasts via inhibition of transforming growth factor-beta1/Smad signaling pathway
.
Biomed. Pharmacother.
83
,
1016
1021
18.
Xu
T.
,
Ni
M.M.
,
Xing
L.
,
Li
X.F.
,
Meng
X.M.
,
Huang
C.
et al.
(
2016
)
NLRC5 regulates TGF-beta1-induced proliferation and activation of hepatic stellate cells during hepatic fibrosis
.
Int. J. Biochem. Cell Biol.
70
,
92
104
[PubMed]
19.
Zhou
H.
,
Yu
X.
and
Zhou
G.
(
2017
)
NLRC5 silencing ameliorates cardiac fibrosis by inhibiting the TGFbeta1/Smad3 signaling pathway
.
Mol. Med. Rep.
16
,
3551
3556
[PubMed]
20.
Gregory
R.I.
,
Chendrimada
T.P.
,
Cooch
N.
and
Shiekhattar
R.
(
2005
)
Human RISC couples microRNA biogenesis and posttranscriptional gene silencing
.
Cell
123
,
631
640
[PubMed]
21.
Yan
B.
,
Yao
J.
,
Liu
J.Y.
,
Li
X.M.
,
Wang
X.Q.
,
Li
Y.J.
et al.
(
2015
)
lncRNA-MIAT regulates microvascular dysfunction by functioning as a competing endogenous RNA
.
Circ. Res.
116
,
1143
1156
[PubMed]
22.
Liu
J.
,
Carmell
M.A.
,
Rivas
F.V.
,
Marsden
C.G.
,
Thomson
J.M.
,
Song
J.J.
et al.
(
2004
)
Argonaute2 is the catalytic engine of mammalian RNAi
.
Science
305
,
1437
1441
[PubMed]
23.
Meister
G.
,
Landthaler
M.
,
Patkaniowska
A.
,
Dorsett
Y.
,
Teng
G.
and
Tuschl
T.
(
2004
)
Human Argonaute2 mediates RNA cleavage targeted by miRNAs and siRNAs
.
Mol. Cell
15
,
185
197
[PubMed]
24.
Elkayam
E.
,
Kuhn
C.D.
,
Tocilj
A.
,
Haase
A.D.
,
Greene
E.M.
,
Hannon
G.J.
et al.
(
2012
)
The structure of human argonaute-2 in complex with miR-20a
.
Cell
150
,
100
110
[PubMed]
25.
Bowen
T.
,
Jenkins
R.H.
and
Fraser
D.J.
(
2013
)
MicroRNAs, transforming growth factor beta-1, and tissue fibrosis
.
J. Pathol.
229
,
274
285
[PubMed]
26.
Zhu
W.S.
,
Tang
C.M.
,
Xiao
Z.
,
Zhu
J.N.
,
Lin
Q.X.
,
Fu
Y.H.
et al.
(
2016
)
Targeting EZH1 and EZH2 contributes to the suppression of fibrosis-associated genes by miR-214-3p in cardiac myofibroblasts
.
Oncotarget
7
,
78331
78342
[PubMed]
27.
Duan
Q
,
Yang
L
,
Gong
W
,
Chaugai
S
,
Wang
F
,
Chen
C
et al.
(
2015
)
MicroRNA-214 Is upregulated in heart failure patients and suppresses XBP1-mediated endothelial cells angiogenesis
.
J. Cell. Physiol.
230
,
1964
1973
[PubMed]
28.
Ubil
E.
,
Duan
J.
,
Pillai
I.C.
,
Rosa-Garrido
M.
,
Wu
Y.
,
Bargiacchi
F.
et al.
(
2014
)
Mesenchymal-endothelial transition contributes to cardiac neovascularization
.
Nature
514
,
585
590
[PubMed]
29.
Ma
S.R.
and
Xie
X.W.
(
2017
)
NLRC5 deficiency promotes myocardial damage induced by high fat diet in mice through activating TLR4/NF-kappaB
.
Biomed. Pharmacother.
91
,
755
766
30.
Zhang
H.
,
Cui
Y.C.
,
Li
K.
,
Yang
B.Q.
,
Liu
X.P.
,
Zhang
D.
et al.
(
2016
)
Glutamine protects cardiomyocytes from hypoxia/reoxygenation injury under high glucose conditions through inhibition of the transforming growth factor-beta1-Smad3 pathway
.
Arch. Biochem. Biophys.
596
,
43
50
[PubMed]
31.
Pillai
R.S.
,
Bhattacharyya
S.N.
and
Filipowicz
W.
(
2007
)
Repression of protein synthesis by miRNAs: how many mechanisms?
Trends Cell Biol.
17
,
118
126
[PubMed]
32.
Carthew
R.W.
and
Sontheimer
E.J.
(
2009
)
Origins and mechanisms of miRNAs and siRNAs
.
Cell
136
,
642
655
[PubMed]

Supplementary data