Abstract

Circular RNAs (circRNAs) play a vital role in cancers. Accumulated evidences showed that the physiological condition of cells can be reflected by the circRNAs in the exosomes they secrete, and these exosomal circRNAs can be captured by the receptor cells, thereby inducing a series of cellular responses. We performed qRT-PCR to detect the expression level of circ-0000284 in cholangiocarcinoma cell lines, tissues and plasma exosomes. Then the direct interaction between circ-0000284 and miR-637 was investigated through dual-luciferase reporter assay, RNA binding protein immunoprecipitation (RIP) assay and Fluorescent in situ hybridization (FISH) assay. Subsequently, EdU (5-ethynyl-2′-deoxyuridine), migration, invasion assay, flow cytometry and nude mouse tumorigenicity assay were adopted to evaluate the effect of circ-0000284 on migration, invasion, proliferation and apoptosis of cholangiocarcinoma cells. Additionally, TEM was conducted to investigate the shape and size of exosomes from cholangiocarcioma and 293T cell lines. Circ-0000284 was evidently elevated in cholangiocarcinoma cell lines, tumor tissues and plasma exosomes. Meanwhile, the high expression of circ-0000284 enhanced the migration, invasion and proliferation abilities of cholangiocarcinoma cells in vivo and in vitro. Besides, the levels of circ-0000284 were increased in cholangiocarcinoma cells and exosomes from them. Moreover, exosomes from cholangiocarcinoma cells enhanced circ-0000284 expression and stimulated migration and proliferation of the surrounding normal cells. Our findings suggest that on the one hand circ-0000284 functions as a competitive endogenous RNA to promote cholangiocarcinoma progression, and on the other hand, circ-0000284 can be directly transferred from cholangiocarcinoma cells to surrounding normal cells via exosomes and in this way regulate the biological functions of surrounding normal cells.

Introduction

Cholangiocarcinoma, a fatal cancer that arises from the epithelium cells of bile ducts, frequently occurs in the intrahepatic or extrahepatic bile duct [1]. In past decades, the incidence rate of cholangiocarcinoma increased remarkably [2]. Several risk factors including chronic biliary inflammation have been identified, but the pathogenesis in most cases remain unclear [3]. With a poor prognosis, late cholangiocarcinoma can only potentially be cured by surgery. However, most patients are already in the advanced stage when diagnosed, thus resulting in common recurrence after resection [4]. As such, accurate early diagnosis and effective inhibition or blocking of the metastasis of cholangiocarcinoma cells have become the key for the treatment of cholangiocarcinoma. Therefore, in addition to the existing treatment methods for cholangiocarcinoma such as surgery, radiotherapy, chemotherapy and immunotherapy, scientific researchers are committed to finding more effective early diagnosis tools and new methods to better predict the prognosis and inhibit the metastasis of cholangiocarcinoma, and eventually reduce the mortality rate of patients with cholangiocarcinoma.

Circular RNA (circRNA) is a class of non-coding RNA molecule that does not have a 5′ cap and a 3′ poly (A) tail and forms a circular structure by covalent bonds [5]. As a new type of RNAs, they are different from traditional linear RNAs. CircRNAs are abundant in the eukaryotic transcriptome with spatiotemporal specific expression [6]. It is clinically valuable to explore the regulation of circRNAs on gene transcription and their role as a marker for disease diagnosis. Numerous studies have proved that circRNAs exert crucial effects in the pathological process of the diseases in the immune, digestive, urinary, and other systems [7–11]. For instance, the research of Jiang et al. [12] revealed that the up-regulated circRNA Cdr1as serves as a novel prognostic biomarker for cholangiocarcinoma. Xu et al. [13] verified that down-regulated circ-0001649 modulates migration, proliferation and invasion in cholangiocarcioma cells, and elevation of circRNA circ_0005230 facilitates cell growth and metastasis via sponging miR-1238 and miR-1299 in cholangiocarcinoma [14]. Meanwhile, through reading and summarizing the literature, we detected another seven well-known cancer-related circRNAs for further exploration [15–21]. It was found that compared with the expression in the human normal bile duct cell line H69, only circ-0000284 that derives from HIPK3 transcript exhibited a stable increase in all the six cholangiocarcinoma cell lines. So, we chose it for further study.

Exosomes refer to a group of small membrane vesicles of 30–150 nm containing protein, nucleic acids and additional biomolecules [22,23]. They were first found in sheep reticulocytes in 1983 [24,25] and later named by Johnstone in 1989 [26]. Exosomes are currently regarded as specifically secreted membrane vesicles that participate in intercellular communication [27,28]. In this research, the expression levels of circ-0000284 in exosomes from the normal control 293T cell line and cholangiocarcinoma cell lines were detected. Interestingly, we found that exosomal circ-0000284 level was markedly up-regulated in cholangiocarcinoma cell lines. However, there is currently no data regarding the biological role of exosomal circRNA in cholangiocarcinoma. Therefore, the present study intends to explore whether exosomal circ-0000284 is involved in intercellular communication, which may promote the progression of cholangiocarcinoma.

In summary, the present study ascertained through a series of experiments that circ-0000284, as a competing endogenous RNA (ceRNA), modulated lymphocyte antigen 6 family member E (LY6E) expression in cholangiocarcinoma cells through competitively binding to miR-637. Moreover, circ-0000284 transmitted by exosomes stimulated the malignant behavior of surrounding normal cells and eventually promoted the progression of cholangiocarcinoma.

Materials and methods

Cell culture and transfection

Human cholangiocarcinoma cell lines (TFK-1, SNU-869, SSP-25, RBE, HuCCT1 and HuH28) and human normal bile duct cell line H69 were all bought from the Chinese Academy of Sciences (Shanghai, China). Cells were cultured in RPMI 1640 medium with 10% inactivated FBS, 100 U/ml streptomycin and 100 U/ml penicillin under 5% CO2 at 37°C, followed by medium replacement once every 2–3 days. When confluence reached 90%, subculture would be carried out to maintain cells in the logarithmic growth phase, and the cells were taken for experiments. The lentivirus containing overexpression sequences or shRNAs, miRNA inhibitors and miRNA mimics used in the present study were bought from GenePharma (Shanghai, China) [29,30]. Using Lipofectamine 2000 Reagent (Invitrogen, Shanghai, China), all transfection experiments were conducted with reference to the manufacturer’s instructions. Detailed sequences were depicted in Table 1.

Table 1
Sequences of primers for qRT-PCR and shRNA-related sequence
Name Sequence 
circ-0000284 Forward 5′-TATGTTGGTGGATCCTGTTCGGCA-3′ 
 Reverse 5′-TGGTGGGTAGACCAAGACTTGTGA-3′ 
miR-637 Forward 5′-ACACTCCAGCTGGGACTGGGGGCTTTCGGGCT-3′ 
 Reverse 5′-CTCAACTGGTGTCGTGGAGTCGGCAATTCAGTTGAGACGCAGAG′ 
GAPDH Forward 5′-GCACCGTCAAGGCTGAGAAC-3′ 
 Reverse 5′-GGATCTCGCTCCTGGAAGATG-3′ 
U6 Forward 5′-CTCGCTTCGGCAGCACA-3′ 
 Reverse 5′-AACGCTTCACGAATTTGCGT-3′ 
LY6E Forward 5′-CAGCTCGCTGATGTGCTTCT-3′ 
 Reverse 5′′-CAGACACAGTCACGCAGTAGT-3′ 
circ-0000284 shRNA Forward 5′-GATCCCCTCTCGGTACTACACCTATGCTTCCTGTCACATAGGTGTAGTACCG AGATTTTTGGAAA-3′ 
 Reverse 5′-AGCTTTTCCAAAAATCTCGGTACTACACCTATGTGACAGGAAGCATAGGTG TAGTACCGAGAGGG-3′ 
LY6E shRNA Forward 5′-CCGGTGCTTGAACCAGAAGAGCAACTCGAGTTGCTCTTCTGGTTCAAGCT TTTTTTG-3′ 
 Reverse 5′-AATTCAAAAAAAGCTTGAACCAGAAGAGCAACTCGAGTTGCTCTTCTGGT TCAAGCA-3′ 
miR-637 mimics Sense 5′-ACUGGGGGCUUUCGGGCUCUGCGU-3′ 
 Antisense 5′-GCAGAGCCCGAAAGCCCCCAGUUU-3′ 
miR-637 inhibitor Sense 5′-ACGCAGAGCCCGAAAGCCCCCAGU-3′ 
Name Sequence 
circ-0000284 Forward 5′-TATGTTGGTGGATCCTGTTCGGCA-3′ 
 Reverse 5′-TGGTGGGTAGACCAAGACTTGTGA-3′ 
miR-637 Forward 5′-ACACTCCAGCTGGGACTGGGGGCTTTCGGGCT-3′ 
 Reverse 5′-CTCAACTGGTGTCGTGGAGTCGGCAATTCAGTTGAGACGCAGAG′ 
GAPDH Forward 5′-GCACCGTCAAGGCTGAGAAC-3′ 
 Reverse 5′-GGATCTCGCTCCTGGAAGATG-3′ 
U6 Forward 5′-CTCGCTTCGGCAGCACA-3′ 
 Reverse 5′-AACGCTTCACGAATTTGCGT-3′ 
LY6E Forward 5′-CAGCTCGCTGATGTGCTTCT-3′ 
 Reverse 5′′-CAGACACAGTCACGCAGTAGT-3′ 
circ-0000284 shRNA Forward 5′-GATCCCCTCTCGGTACTACACCTATGCTTCCTGTCACATAGGTGTAGTACCG AGATTTTTGGAAA-3′ 
 Reverse 5′-AGCTTTTCCAAAAATCTCGGTACTACACCTATGTGACAGGAAGCATAGGTG TAGTACCGAGAGGG-3′ 
LY6E shRNA Forward 5′-CCGGTGCTTGAACCAGAAGAGCAACTCGAGTTGCTCTTCTGGTTCAAGCT TTTTTTG-3′ 
 Reverse 5′-AATTCAAAAAAAGCTTGAACCAGAAGAGCAACTCGAGTTGCTCTTCTGGT TCAAGCA-3′ 
miR-637 mimics Sense 5′-ACUGGGGGCUUUCGGGCUCUGCGU-3′ 
 Antisense 5′-GCAGAGCCCGAAAGCCCCCAGUUU-3′ 
miR-637 inhibitor Sense 5′-ACGCAGAGCCCGAAAGCCCCCAGU-3′ 

RNA isolation and qRT-PCR

Tissue and cell RNAs were extracted with reference to the TRIzol instructions for rapid extraction of total RNAs and stored in a refrigerator at −80°C for standby application after their concentration was measured. Then reverse transcription was conducted based on the instructions of Takara OneStep PrimeScript® miRNA cDNA Synthesis Kit. SYBR Green I fluorescent dye was used for PCR detection. PCR amplification conditions: 94°C for 5 min, 94°C for 30 s, 55°C for 30 s and 72°C for 1 min and 30 s for 40 cycles. All the PCR primers are listed in Table 1.

Clinical specimens

All the subjects signed the written informed and the study protocol received the approval from the Ethics Committee of both Nantong University Affiliated Hospital and The Affiliated Huaian No.1 People’s Hospital of Nanjing Medical University. The present study analyzed the plasma specimens from 25 cholangiocarcinoma patients and 25 healthy controls, together with 25 cholangiocarcinoma tissues and the corresponding paracarcinoma normal bile duct tissues from Nantong University Affiliated Hospital or The Affiliated Huaian No.1 People’s Hospital of Nanjing Medical University. In brief, cholangiocarcinoma tissues and the corresponding paracarcinoma normal bile duct tissues were obtained from patients diagnosed with cholangiocarcinoma who underwent resection. No previous local or systemic treatment had been conducted on these patients before surgery. All collected specimens were immediately frozen in liquid nitrogen and stored at −80°C until use.

RNase R digestion

Total RNA (5 μg) was kept at 37°C for 15 min with 3 units of RNase R (Epicentre Biotechnologies, Shanghai, China) per 1 μg RNA to remove the linear RNAs. After treatment with RNase R, circ-0000284 and HIPK3 mRNA expression were detected by qRT-PCR.

Sanger sequencing

The amplified product was added into the T vector for Sanger sequencing. After determination of the full length, primers were constructed to verify the back-splice joint of circ-0000284. Invitrogen (Shanghai, China) was authorized to construct the primers, and Sanger sequencing was carried out by Realgene (Nanjing, China). After PCR amplification, the PCR products were purified and were then sequenced and analyzed by software. The PCR products were purified by AGE (agarose gel electrophoresis) and DNA gel extraction kit.

Cell proliferation assay

Cell proliferation was measured using the EdU (5-ethynyl-2′-deoxyuridine) detection kit (Ribobio, Guangzhou, China) following the protocols, and a confocal laser scanning microscope (×100) was applied to obtain images. Ultimately, ImageJ software (National Institutes of Health, Sacaton, AZ, U.S.A.) was used to calculate the ratio of EdU staining-positive cell/DAPI staining-positive cell.

Cell migration and invasion assays

Cells to be tested were cultured to the logarithmic growth phase, dissociated and washed sequentially with PBS and medium free of serum. After that, the cells were suspended with medium free of serum and counted, and their concentration was adjusted to 1 × 105/ml. Subsequently, 600 μl of culture medium containing 10% serum was added to the lower chamber (i.e. bottom of a 24-well plate) and 100 μl of cell suspension to the upper chamber for further incubation for 24 h. After liquid in the upper chamber was removed, the cells were fixed in maldehyde for 30 min, followed by Crystal Violet staining for 30 min. Finally, they were observed and photographed after mounting under an inverted microscope. Invasion: the Transwell chamber was coated with Matrigel diluted with a serum-free medium at the bottom of the upper chamber before adding cells into the upper compartment of the chamber.

Cell apoptosis analysis

Annexin V-FITC/Propidium Iodide Kit (KeyGen Biotech, Nanjing, China) was used to stain the harvested cells based on the manufacturer’s protocol so as to analyze cell apoptosis. Data analysis was carried out using FlowJo V7 software (Tree Star, Oregon, U.S.A.). The tests were repeated three times.

Dual-luciferase reporter gene assay

In this assay, the binding sites of circ-0000284 and LY6E, including circ-0000284-Wild, circ-0000284-Mut, LY6E-Wild, LY6E-Mut were added into the KpnI and SacI sites of pGL3 promoter vector (Realgene, Nanjing, China). At first, 80 ng plasmids, 5 ng Renilla luciferase vector pRL-SV40, 50 nM miR-637 mimics and negative control were used to transfect cells placed on 24-well plates using Lipofectamine 2000 (Invitrogen, Shanghai, China). Then the cells were collected and measured based on the manufacturer’s instructions through dual-luciferase reporter assay (Promega, Madison, WI, U.S.A.) after 48 h of transfection. The same experiment was conducted three times.

Cell fractionation

Cytoplasmic and nuclear RNAs were extracted with the PARIS Kit (Life Technologies, Carlsbad, CA, U.S.A.) and determined via qRT-RCR with GAPDH and U6 as the internal references, respectively.

RNA binding protein immunoprecipitation assay

This assay was operated in strict accordance with the procedures of Magna RIP™ Kit (Millipore, Bill Erica, MA, U.S.A.). After cell lysis, antibodies to be detected were added, with the working concentration of 8 μg per reaction system. After incubation overnight in a shaker at 4°C, it was reheated to room temperature for 1 h. Then protein G magnetic beads were added to capture complexes. After rinsing with buffer, the RNAs were extracted, RT-PCR was performed, and the RNA level was measured via fluorescence qPCR.

Exosome isolation

Cells and cellular debris were discarded from the collected culture medium that was centrifuged at 3000×g for 15 min. Then Exoquick exosome precipitation solution (System Biosciences, CA, U.S.A.) was utilized for exosome separation [31–33].

Nanoparticle tracking analysis

We measured the exosome particle size and concentration using Nanoparticle tracking analysis (NTA) with ZetaView PMX 110 (Particle Metrix, Meerbusch, Germany) and corresponding software ZetaView 8.04.02. Isolated exosome samples were appropriately diluted using 1× PBS buffer (Biological Industries, Israel) to measure the particle size and concentration. NTA measurement was recorded and analyzed at 11 positions. The ZetaView system was calibrated using 110-nm polystyrene particles. Temperature was maintained at approximately 23 and 37°C.

TEM

The exosomes were kept at 4°C for TEM analysis after suspension in 100 μl PBS and fixation with 5% glutaraldehyde at the temperature for incubation. After that, exosome samples were placed on a copper grid coated by carbon and immersed in 2% PTA solution (pH 7.0) for 30 s based on the TEM sample preparation procedure. Finally, a transmission electron microscope (Tecnai G2 Spirit Bio TWIN, FEI, U.S.A.) was used for observing preparations.

Exosome labeling

Exosomes from 1.5 × 106 cholangiocarcinoma cells were suspended in 100 μl PBS containing 1 ml mixed PKH67 (Sigma, in diluent C). Following 4 min of incubation at room temperature, exosomal labeling was stopped using 2 ml 0.5% BSA, and Exoquick exosome precipitation solution was applied to separate the stained exosomes. Thereafter, the exosomes were suspended in 9.6 ml basal medium, 250 μl of which were added to the subconfluent layer of 293T cells. Following 3 h of incubation at 37°C, the cells were rinsed and fixed at room temperature. Ultimately, DAPI (Sigma) was added to stain the nuclei for 10 min, and a fluorescence microscope (Zeiss, LSM700B, Germany) was used to observe the stained cells.

Western blotting

RIPA was utilized to extract total proteins. Based on the molecular weight of the target proteins, sodium dodecyl sulfate/polyacrylamide gel electrophoresis (SDS/PAGE) gel with appropriate concentration was selected. After electrophoresis, the proteins were transferred on to a polyvinylidene fluoride (PVDF) membrane and subjected to routine immunostaining. GAPDH, LY6E, TSG101 and CD63 primary antibodies (Abcam, Shanghai, China) with the working concentration of 1:500 and secondary antibodies with the working concentration of 1:1000 were added for 2 h of incubation at 37°C, followed by chemiluminescence. Finally, the color was developed and fixed, and photography was conducted. The average value was taken after the same experiment was repeated for three times.

Fluorescent in situ hybridization

Fluorescent in situ hybridization (FISH) was carried out based on the method described above [34]. During the application of FISH, any given sequence within a nucleus can be targeted with non-toxic fluorescent DNA probes, thereby leading to colored signals that are examined under a fluorescence microscope by Biosense Co. Ltd (Guangzhou, China). Paraffin-embedded tissue blocks were obtained from cholangiocarcinoma patients and tumor-bearing nude mice, and respectively analyzed. Subsequently, the presence of cholangiocarcinoma was determined through FISH with quantum dots using an oligonucleotide probe labeled with FAM and FAM-antibody–conjugated quantum dots. Meanwhile, miR-637 was detected using a CY5-labeled oligonucleotide probe.

Tumorigenicity assay

All animal experiments took place in SPF Laboratory Animal Central at The Affiliated Huaian No.1 People’s Hospital of Nanjing Medical University. The nude mice were bought from the Shanghai Institutes for Biological Sciences (SIBS, Shanghai, China) and placed in a laminar flow cabinet free of pathogens. A total of 1 × 106 RBE cells were injected subcutaneously into the back of mice and stably transfected with sh-circ-0000284 or sh-NC and suspended in 100 μl Hank’s balanced salt solution. Ultimately, tumors were harvested after the mice were killed at the 4th week by cervical dislocation.

Lung metastasis assay

Briefly, 1 × 106 RBE cells in 30 μl of 30% Matrigel were injected intravenously through the tail vein of nude mice. After 6 weeks, nude mice were killed, and metastatic nodules in each lung were analyzed. All animal experiments were performed using protocols approved by the animal ethics committee, The Affiliated Huaian No.1 People’s Hospital of Nanjing Medical University.

Hematoxylin and Eosin staining

Lung tissues from nude mice were fixed in 10% formalin, processed and embedded in paraffin. Multiple sections (10 μm in thickness) were prepared and stained with Hematoxylin and Eosin (H&E) for morphological observation.

Immunohistochemical staining

Xenograft tumors were taken, respectively, and subjected to immunohistochemical staining primarily with the streptomycin avidin–peroxidase complex in accordance with the standard process. LY6E, Bax and Ki-67 staining were carried out in the nucleus and/or the cytoplasm, which were pale brown or medium brown.

Statistical analysis

SPSS 20.0 (SPSS Inc., Chicago, IL, U.S.A.) and GraphPad (GraphPad Software, La Jolla, CA, U.S.A.) were adopted for data analysis. The characteristic differences between Low expression group patients and High expression group patients were assessed by two-sided Fisher’s exact test. The paired t test was performed to detect the differential expression of circ-0000284 and LY6E in cancer tissues compared with adjacent non-malignant tissues. The unpaired Student’s t test or Mann–Whitney U-test were performed for assessing the significance of other between-group differences. Statistically significant differences between the cholangiocarcinoma cell lines and human normal bile duct cells were determined by one-way ANOVA followed by Dunnett’s multiple comparison test (including other multigroup comparisons). The Pearson correlation analysis was performed to assess correlations between circ-0000284, miR-637 and LY6E. P<0.05 represented a statistically significant difference.

Results

Characteristics and expressions of circ-0000284 in cholangiocarcinoma

First of all, to explore the function of circRNAs in the progress of cholangiocarcinoma, we detected ten cancer-related circRNAs in cholangiocarcinoma cell lines and human normal bile duct cells via qRT-PCR. All the ten circRNAs had have confirmed their involvement in tumorigenesis. It was found that compared with that in the human normal bile duct cell line H69, only circ-0000284 exhibited a stable increase in all the six cholangiocarcinoma cell lines. It should be noted that the up-regulation of circ-0000284 in all the six cholangiocarcinoma cell lines are statistically significant. And among them, the expression level of circ-0000284 was the highest in RBE cell line and the lowest in HuCCT1 cell line. Therefore, RBE and HuCCT1 cell lines were used as cell models in subsequent studies. The above results indicate that circ-0000284 may be involved in the occurrence of cholangiocarcinoma (Figure 1A). Second, the results of circ-0000284 levels in cholangiocarcinoma tumors and paired paracarcinoma normal tissues showed significantly higher circ-0000284 in cholangiocarcinoma tumor tissues (Figure 1B). Expression of circ-0000284 in 25 cholangiocarcinoma tumor tissues was detected by qRT-PCR. Cholangiocarcinoma tumor tissues were divided into high circ-0000284 group (n=12) and low circ-0000284 group (n=13) according to the median value. Then we found that high expression of circ-0000284 in the tumor tissues was associated with Grade of differentiation, TNM stage, Lymph node invasion, but not with other clinicopathological features including gender, age, tumor site, tumor diameter (Table 2). Sanger sequencing verified that circ-0000284 sequences amplified by primers were consistent with sequences in circbase (Figure 1C). RNase R degrades linear RNAs characterized by free 3′, but has no effect on circRNA. RNase R was added to the total RNAs so as to further determine the circRNA nature of circ-0000284. This assay proves that circ-0000284 is indeed a circRNA resistant to RNase R digestion (Figure 1D,E).

Characteristics and expressions of circ-0000284 in cholangiocarcinoma

Figure 1
Characteristics and expressions of circ-0000284 in cholangiocarcinoma

(A) The expression level of ten widely investigated cancer-related circRNAs in cholangiocarcinoma cell lines and human normal bile duct cell line H69 are detected via qRT-PCR. (B) qRT-PCR detection of the relative expression of circ-0000284 in paired cholangiocarcinoma tumor and paired paracarcinoma tissues (n=25). (C) The sequence of circ-0000284 in circBase (upper panel) is consistent with the result of Sanger sequencing (lower panel). (D,E) Total RNAs were degraded with RNase R followed by qRT-PCR detection of circ-0000284 expression in RBE (D) and HuCCT1 (E) cells. HIPK3 mRNA was detected as the RNase R-sensitive control. Results are shown as mean ± SD. *P<0.05, **P<0.01.

Figure 1
Characteristics and expressions of circ-0000284 in cholangiocarcinoma

(A) The expression level of ten widely investigated cancer-related circRNAs in cholangiocarcinoma cell lines and human normal bile duct cell line H69 are detected via qRT-PCR. (B) qRT-PCR detection of the relative expression of circ-0000284 in paired cholangiocarcinoma tumor and paired paracarcinoma tissues (n=25). (C) The sequence of circ-0000284 in circBase (upper panel) is consistent with the result of Sanger sequencing (lower panel). (D,E) Total RNAs were degraded with RNase R followed by qRT-PCR detection of circ-0000284 expression in RBE (D) and HuCCT1 (E) cells. HIPK3 mRNA was detected as the RNase R-sensitive control. Results are shown as mean ± SD. *P<0.05, **P<0.01.

Table 2
Relationship between circ-0000284 expression and clinicopathological characteristics of cholangiocarcinoma patients
Clinicopathological characteristics n High expression Low expression P-value 
Total 25 12 13  
Gender    0.695 
  Male 11  
  Female 14  
Age (years)    0.695 
  ≤60 12  
  >60 13  
Grade of differentiation    0.022* 
  Low 10  
  Middle  
  High  
Tumor diameter (cm)    0.161 
  ≤3 16 10  
  >3  
Lymph node invasion    0.047* 
  Absent 12  
  Present 13  
TNM stage    0.028* 
  I-II 14 10  
  III-IV 11  
Tumor site    0.821 
  Intrahepatic 11  
  Extrahepatic 14  
Clinicopathological characteristics n High expression Low expression P-value 
Total 25 12 13  
Gender    0.695 
  Male 11  
  Female 14  
Age (years)    0.695 
  ≤60 12  
  >60 13  
Grade of differentiation    0.022* 
  Low 10  
  Middle  
  High  
Tumor diameter (cm)    0.161 
  ≤3 16 10  
  >3  
Lymph node invasion    0.047* 
  Absent 12  
  Present 13  
TNM stage    0.028* 
  I-II 14 10  
  III-IV 11  
Tumor site    0.821 
  Intrahepatic 11  
  Extrahepatic 14  

Two-sided Fisher’s exact test for all variables between Low expression group and High expression group.

*P<0.05.

Exosomal RNAs were extracted from the plasma. Plasma-derived exosomes of cholangiocarcinoma patients and controls were both isolated and characterized. The size of exosomes from cholangiocarcinoma patients was similar to the controls as indicated by TEM and NTA (Figure 2A,B). Result of Western blot detection showed the presence of TSG101 and CD63 as exosome biomarkers (Figure 2C). And then the circ-0000284 expression was detected in exosomes from plasma. Cholangiocarcinoma patients showed significantly higher circ-0000284 expression in exosomes compared with healthy controls (P<0.05, Figure 2D). These results suggested that circ-0000284 is elevated in cholangiocarcinoma cell lines, tumor tissues and plasma exosomes.

Characteristics of exosomes in cholangiocarcinoma

Figure 2
Characteristics of exosomes in cholangiocarcinoma

(A,B) Micrographs of plasma-derived exosomes in healthy controls (A) and cholangiocarcinoma patients (B) were detected by transmission electron microscope (scale bar corresponds to 500 nm) and their size distribution were measured using NTA. (C) Western blots of CD63 and TSG101 in circulating exosomes. (D) qRT-PCR of circ-0000284 in plasma-derived exosomes. Results are shown as mean ± SD. *P<0.05.

Figure 2
Characteristics of exosomes in cholangiocarcinoma

(A,B) Micrographs of plasma-derived exosomes in healthy controls (A) and cholangiocarcinoma patients (B) were detected by transmission electron microscope (scale bar corresponds to 500 nm) and their size distribution were measured using NTA. (C) Western blots of CD63 and TSG101 in circulating exosomes. (D) qRT-PCR of circ-0000284 in plasma-derived exosomes. Results are shown as mean ± SD. *P<0.05.

Circ-0000284 stimulated the migration, invasion and proliferation of cholangiocarcinoma cells and inhibited their apoptosis

The expression of circ-0000284 was silenced by transfection with circ-0000284 shRNA lentiviral vector in RBE cells, so as to study the biological function of circ-0000284 in cholangiocarcinoma. Moreover, HuCCT1 cells were transfected with overexpression lentiviral vector to increase the expression of circ-0000284. According to the results, transfecting circ-0000284 shRNAs could effectively suppress the expression of circ-0000284 rather than HIPK3 mRNA in RBE cells (Supplementary Figure S1A), while transfecting circ-0000284 overexpression lentiviral vector could up-regulate the level of circ-0000284 in HuCCT1 cells (Supplementary Figure S1B). Then EdU assay, Transwell assay and apoptosis assay were carried out, which manifested that the decreased circ-0000284 notably reduced the migration, invasion and proliferation capabilities of the RBE cell line, but enhanced its apoptosis (Figure 3A,C,E,G). Conversely, overexpressed circ-0000284 prominently boosted the migration, invasion and proliferation of the cholangiocarcinoma cell line HuCCT1 and inhibited its apoptosis (Figure 3B,D,F,H). In summary, the above results denote that circ-0000284 may have certain regulatory effects on the migration, invasion, proliferation and apoptosis of cholangiocarcinoma cells.

Functions of circ-0000284 in cholangiocarcinoma cell lines

Figure 3
Functions of circ-0000284 in cholangiocarcinoma cell lines

Circ-0000284/NC shRNA lentiviral vector was transfected into RBE cells, namely sh-circ-0000284 and sh-NC, respectively. Circ-0000284/NC lentiviral vector was transfected into HuCCT1 cells, namely circ-0000284 and vector, respectively. (A,B) Effects of circ-0000284 shRNA (A) and circ-0000284 overexpression vectors (B) on cell proliferation of human RBE and HuCCT1 cells were observed through EdU assay (scale bar corresponds to 100 μm). (C,D) Transwell migration assay showed that circ-0000284 could modulate the migration of RBE and HuCCT1 cells. The results displayed that the down-regulation of circ-0000284 inhibited the migration of RBE cells (C), and circ-0000284 overexpression promoted the migration of HuCCT1 cells (D) (scale bar corresponds to 100 μm). (E,F) Transwell invasion assay showed that circ-0000284 could modulate the invasion of RBE and HuCCT1 cells. The results displayed that the down-regulation of circ-0000284 inhibited the invasion of RBE cells (E), and circ-0000284 overexpression promoted the invasion of HuCCT1 cells (F) (scale bar corresponds to 100 μm). (G,H) Apoptosis assay showed that the down-regulation of circ-0000284 could stimulate RBE cell apoptosis (G), and the overexpression of circ-0000284 inhibited the apoptosis of HuCCT1 cells (H). Results are shown as mean ± SD. *P<0.05, **P<0.01, ***P<0.001. All experiments were carried out three times.

Figure 3
Functions of circ-0000284 in cholangiocarcinoma cell lines

Circ-0000284/NC shRNA lentiviral vector was transfected into RBE cells, namely sh-circ-0000284 and sh-NC, respectively. Circ-0000284/NC lentiviral vector was transfected into HuCCT1 cells, namely circ-0000284 and vector, respectively. (A,B) Effects of circ-0000284 shRNA (A) and circ-0000284 overexpression vectors (B) on cell proliferation of human RBE and HuCCT1 cells were observed through EdU assay (scale bar corresponds to 100 μm). (C,D) Transwell migration assay showed that circ-0000284 could modulate the migration of RBE and HuCCT1 cells. The results displayed that the down-regulation of circ-0000284 inhibited the migration of RBE cells (C), and circ-0000284 overexpression promoted the migration of HuCCT1 cells (D) (scale bar corresponds to 100 μm). (E,F) Transwell invasion assay showed that circ-0000284 could modulate the invasion of RBE and HuCCT1 cells. The results displayed that the down-regulation of circ-0000284 inhibited the invasion of RBE cells (E), and circ-0000284 overexpression promoted the invasion of HuCCT1 cells (F) (scale bar corresponds to 100 μm). (G,H) Apoptosis assay showed that the down-regulation of circ-0000284 could stimulate RBE cell apoptosis (G), and the overexpression of circ-0000284 inhibited the apoptosis of HuCCT1 cells (H). Results are shown as mean ± SD. *P<0.05, **P<0.01, ***P<0.001. All experiments were carried out three times.

Circ-0000284 interacted with miR-637 in a direct manner

Based on the bioinformatics predictions from RegRNA 2.0 and CircInteractome, we found 3 mRNAs and 41 miRNAs that highly matched with the 3′-UTR sequence of circ-0000284, respectively. The intersection of miRNAs predicted by the two websites demonstrated that miR-637 mostly matched with the 3′UTR sequence of circ-0000284 (Figure 4A). According to the results of qRT-PCR, the miR-637 expression in cholangiocarcinoma cell lines was prominently lower than that in human normal bile duct cell line H69 (Figure 4B). Then, the results of miR-637 levels in cholangiocarcinoma tumors and paired paracarcinoma normal tissues showed significantly lower miR-637 in cholangiocarcinoma tumor tissues (Figure 4C). Furthermore, the subcellular localization of circ-0000284 and miR-637 in RBE and HuCCT1 cells were determined so as to explore the ways in which they exert biological functions. The results verified that circ-0000284 and miR-637 primarily exist in the cytoplasm (Figure 4D), indicating that circ-0000284 is probably involved in the pathogenesis of cholangiocarcinoma through post-transcriptional level regulation. In order to explore the correlation between circ-0000284 and predicted miRNAs, plasmids with wild-type or mutant circ-0000284 sequences were constructed (Figure 4E). Subsequently, to confirm the speculation that miR-637 directly targets circ-0000284, dual-luciferase reporter assay was carried out in RBE and HuCCT1 cells, which denoted that the relative luciferase activity in cells co-transfected with circ-0000284 WT and miR-637 mimics was evidently weakened in comparison with that in NC. However, no significant difference in the relative luciferase activity was found between the cells co-transfected with circ-0000284 MUT and miR-637 mimics and the NC (Figure 4F,G). MiR-637 co-localized with circ-0000284 in cholangiocarcinoma tissues or the corresponding paracarcinoma normal tissues was detected by FISH. Based on the results, in comparison with those in matched paracarcinoma normal tissues, circ-0000284 level declined and miR-637 level was elevated in cholangiocarcinoma tissues. Interestingly, the subcellular localization of circ-0000284 was consistent with that of miR-637 in both cholangiocarcinoma and paracarcinoma normal tissues (Figure 4H). In addition, RNA binding protein immunoprecipitation (RIP) assay was performed in RBE and HuCCT1 cells to figure out whether circ-0000284 is present in ribonucleoprotein complexes with miRNAs. Subsequently, the expression of RNA in immunoprecipitates was detected via qRT-PCR with respect to that of immunoglobulin G (IgG) controls, which displayed that circ-0000284 were enriched by anti-AGO2 antibodies in cholangiocarcinoma cells. As expected, similar results were obtained on miR-637 (Figure 4I,J). All the above results demonstrate that circ-0000284 bound to miR-637 in cholangiocarcinoma in a direct manner.

Circ-0000284 interacts with miR-637 in a direct manner

Figure 4
Circ-0000284 interacts with miR-637 in a direct manner

(A) Bioinformatics predictions from RegRNA 2.0 and CircInteractome. (B) Expression of miR-637 in cholangiocarcinoma cells and H69 cells. (C) qRT-PCR detection of the relative expression of miR-637 in paired cholangiocarcinoma tumor and paired paracarcinoma tissues (n=25). (D) Detection of the levels of circ-0000284 and miR-637 in the nucleus and cytoplasm of RBE and HuCCT1 cells via qRT-PCR. (E) Bioinformatics evidence for the binding of miR-637 to the 3′-UTR of circ-0000284. (F,G) Determination of the luciferase activity in RBE (F) and HuCCT1 cells (G) after co-transfection of plasmid (pGL3-circ-0000284-WT or pGL3-circ-0000284-MUT) and miRNA via dual-luciferase reporter assay. (H) Detection of miR-637 co-localized with circ-0000284 in tissues of cholangiocarcinoma or normal group by FISH (scale bar corresponds to 20 μm). (I,J) Measurement of the amount of circ-0000284 and miR-637 in RBE (I) and HuCCT1 cells (J) via RIP experiments. The expression levels of circ-0000284 and miR-637 were examined via qRT-PCR. Results are shown as mean ± SD. *P<0.05, ***P<0.001. All the experiments were performed in triplicate.

Figure 4
Circ-0000284 interacts with miR-637 in a direct manner

(A) Bioinformatics predictions from RegRNA 2.0 and CircInteractome. (B) Expression of miR-637 in cholangiocarcinoma cells and H69 cells. (C) qRT-PCR detection of the relative expression of miR-637 in paired cholangiocarcinoma tumor and paired paracarcinoma tissues (n=25). (D) Detection of the levels of circ-0000284 and miR-637 in the nucleus and cytoplasm of RBE and HuCCT1 cells via qRT-PCR. (E) Bioinformatics evidence for the binding of miR-637 to the 3′-UTR of circ-0000284. (F,G) Determination of the luciferase activity in RBE (F) and HuCCT1 cells (G) after co-transfection of plasmid (pGL3-circ-0000284-WT or pGL3-circ-0000284-MUT) and miRNA via dual-luciferase reporter assay. (H) Detection of miR-637 co-localized with circ-0000284 in tissues of cholangiocarcinoma or normal group by FISH (scale bar corresponds to 20 μm). (I,J) Measurement of the amount of circ-0000284 and miR-637 in RBE (I) and HuCCT1 cells (J) via RIP experiments. The expression levels of circ-0000284 and miR-637 were examined via qRT-PCR. Results are shown as mean ± SD. *P<0.05, ***P<0.001. All the experiments were performed in triplicate.

Circ-0000284 modulated miR-637 target gene, LY6E

Bioinformatics analysis (TargetScan, DIANA, miRanda) was carried out to find the potential target genes of miR-637 and we acquired the intersection results, which revealed that the binding sites of LY6E and miR-637 exactly matched those of circ-0000284 and miR-637. In order to further determine the interaction between miR-637 and LY6E, pGL3-LY6E-WT and pGL3-LY6E-MUT plasmids were constructed (Figure 5A), which were then used to transfect cholangiocarcinoma cells. Compared with that in the control group, the luciferase activity in cells co-transfected with pGL3-LY6E-WT and miR-637 mimics was decreased markedly, but the luciferase activity did not change in cells co-transfected with pGL3-LY6E-MUT and miR-637 mimics (Figure 5B,C). After that, the mRNA level of LY6E in cholangiocarcinoma cell lines was examined. Compared with that in H69 cell line, the expression level of LY6E in cholangiocarcinoma cell lines was obviously up-regulated (Figure 5D). Analogously, the protein expression level of LY6E in RBE and HuCCT1 cell lines was also remarkably increased (Figure 5E). Then, the results of LY6E levels in cholangiocarcinoma tumors and paired paracarcinoma normal tissues showed significantly higher LY6E in cholangiocarcinoma tumor tissues (Figure 5F). To sum up, the above-mentioned results elucidate that LY6E is a target gene of miR-637.

LY6E is the direct target of miR-637

Figure 5
LY6E is the direct target of miR-637

(A) Predicted binding site of miRNA in LY6E sequences. The predicted miRNA binding site is cloned downstream of the luciferase gene and named as pGL3-LY6E-WT. (B,C) The luciferase activity in RBE (B) and HuCCT1 cells (C) after co-transfection with plasmids (pGL3-LY6E-WT or pGL3-LY6E-MUT) and miRNA mimics was detected via dual-luciferase reporter assay. (D) Relative expression of LY6E in cholangiocarcinoma cell lines compared with that in control normal bile duct H69 cells. (E) The protein level of LY6E in normal bile duct cell line H69 and cholangiocarcinoma cell lines (HuCCT1 and RBE) was detected via Western blotting. (F) qRT-PCR detection of the relative expression of LY6E in paired cholangiocarcinoma tumor and paired paracarcinoma tissues (n=25). (G) Correlation between circ-0000284 and LY6E in cholangiocarcinoma samples. (H) Correlation between circ-0000284 and miR-637 in cholangiocarcinoma samples. (I) Correlation between miR-637 and LY6E in cholangiocarcinoma samples. (J) After RBE cells were treated with circ-0000284 shRNA (with inh-NC or with miR-637 inhibitors), Western blotting analysis were adopted to measure the LY6E protein level, with GAPDH as a control. (K) HuCCT1 cells were transfected with circ-0000284 overexpression lentiviral vector (with mimics-NC or with miR-637 mimics), and Western blotting was adopted to detect the LY6E protein expression level compared with the control. MiR-637 inh/mimics means transfection with miR-637 inhibitor/mimics, sh-circ-0000284/circ-0000284 means transfection with circ-0000284 shRNA/circ-0000284 lentiviral vector. Results are shown as mean ± SD. *P<0.05, **P<0.01 vs. negative control group, ##P<0.01 vs. circ-0000284 overexpression or shRNA + negative control group. Abbreviation: inh, inhibitor. All experiments were carried out three times.

Figure 5
LY6E is the direct target of miR-637

(A) Predicted binding site of miRNA in LY6E sequences. The predicted miRNA binding site is cloned downstream of the luciferase gene and named as pGL3-LY6E-WT. (B,C) The luciferase activity in RBE (B) and HuCCT1 cells (C) after co-transfection with plasmids (pGL3-LY6E-WT or pGL3-LY6E-MUT) and miRNA mimics was detected via dual-luciferase reporter assay. (D) Relative expression of LY6E in cholangiocarcinoma cell lines compared with that in control normal bile duct H69 cells. (E) The protein level of LY6E in normal bile duct cell line H69 and cholangiocarcinoma cell lines (HuCCT1 and RBE) was detected via Western blotting. (F) qRT-PCR detection of the relative expression of LY6E in paired cholangiocarcinoma tumor and paired paracarcinoma tissues (n=25). (G) Correlation between circ-0000284 and LY6E in cholangiocarcinoma samples. (H) Correlation between circ-0000284 and miR-637 in cholangiocarcinoma samples. (I) Correlation between miR-637 and LY6E in cholangiocarcinoma samples. (J) After RBE cells were treated with circ-0000284 shRNA (with inh-NC or with miR-637 inhibitors), Western blotting analysis were adopted to measure the LY6E protein level, with GAPDH as a control. (K) HuCCT1 cells were transfected with circ-0000284 overexpression lentiviral vector (with mimics-NC or with miR-637 mimics), and Western blotting was adopted to detect the LY6E protein expression level compared with the control. MiR-637 inh/mimics means transfection with miR-637 inhibitor/mimics, sh-circ-0000284/circ-0000284 means transfection with circ-0000284 shRNA/circ-0000284 lentiviral vector. Results are shown as mean ± SD. *P<0.05, **P<0.01 vs. negative control group, ##P<0.01 vs. circ-0000284 overexpression or shRNA + negative control group. Abbreviation: inh, inhibitor. All experiments were carried out three times.

Furthermore, Bivariate correlation analysis was processed to assess the interactions between circ-0000284, miR-637 and LY6E in the tissues. According to the analysis, we found that circ-0000284 positively correlated with levels of LY6E (Figure 5G) and miR-637 expression was inversely correlated with circ-0000284 (Figure 5H) and LY6E (Figure 5I) expression in control and cholangiocarcinoma tissues. After this confirmation, whether circ-0000284 can mediate the expression of LY6E by binding to miR-637 was explored. After RBE cells were transfected with sh-circ-0000284, the results revealed that the protein expression level of LY6E was evidently reduced, which could be reversed by the addition of miR-637 inhibitors (Figure 5J). Then HuCCT1 cells were transfected with circ-0000284 overexpression plasmids, and later we found that the protein level of LY6E expression was notably increased. However, the addition of miR-637 mimics could reverse this effect (Figure 5K). Briefly, these data imply that circ-0000284 up-regulated the expression of LY6E by sequencing miR-637.

miR-637/LY6E regulatory axis played an indispensable role in cell function

Whether miR-637 affects the proliferation, migration, invasion and apoptosis of RBE and HuCCT1 cells was further explored. Experiments proved that miRNA inhibitors could down-regulate miRNA expression level (Supplementary Figure S1C), while miRNA mimics could elevate miRNA expression level (Supplementary Figure S1D). Analogously, it was also proved that transfection of LY6E shRNAs into RBE cells effectively inhibited LY6E expression (Supplementary Figure S1E), and transfection of LY6E overexpression lentiviral vector up-regulated LY6E level in HuCCT1 cells (Supplementary Figure S1F). Compared with NC, down-regulation of miR-637 in RBE cells significantly boosted cell migration, invasion and proliferation and inhibited apoptosis. At the same time, the down-regulation of LY6E was capable of reversing the effect of miR-637 in part (Figure 6A,C,E,G). Moreover, compared with NC, the overexpression of miR-637 in HuCCT1 cells evidently suppressed cell migration, invasion and proliferation and stimulated cell apoptosis. Similarly, elevation of LY6E was able to reverse the effect of miR-637 in part (Figure 6B,D,F,H). In conclusion, the above-mentioned results reflect that the circ-0000284/miR-637/LY6E regulatory axis exerts a crucial effect on cholangiocarcinoma cell function.

miR-637/LY6E regulatory axis exerts a vital effect on cell function

Figure 6
miR-637/LY6E regulatory axis exerts a vital effect on cell function

(A) After transfection, the proliferation level of RBE cells was examined through EDU (scale bar corresponds to 100 μm). (B) After transfection, the proliferation ability of HuCCT1 cells was detected via EDU (scale bar corresponds to 100 μm). (C) After transfection, the migration ability of RBE cells was measured by cell migration assay (scale bar corresponds to 100 μm). (D) After transfection, the migration ability of HuCCT1 was detected using cell migration assay (scale bar corresponds to 100 μm). (E) After transfection, the invasion ability of RBE cells was measured by cell invasion assay (scale bar corresponds to 100 μm). (F) After transfection, the invasion ability of HuCCT1 was detected using cell invasion assay (scale bar corresponds to 100 μm). (G) After transfection, the apoptosis of RBE cells was tested using apoptosis assay. (H) After transfection, the apoptosis of HuCCT1 cells was detected using apoptosis assay. MiR-637 inh/mimics NC means transfection with miR-637 inhibitor/mimics negative controls, miR-637 inh/mimics means transfection with miR-637 inhibitor/mimics, sh-LY6E/LY6E means transfection with LY6E shRNA/LY6E lentiviral vector. Results are presented as mean ± SD. *P<0.05, **P<0.01, ***P<0.0001 vs. negative control group, #P<0.05, ##P<0.01, ###P<0.001 vs. miR-637 inhibitor or mimics + negative control group. All of the experiments were performed in triplicate.

Figure 6
miR-637/LY6E regulatory axis exerts a vital effect on cell function

(A) After transfection, the proliferation level of RBE cells was examined through EDU (scale bar corresponds to 100 μm). (B) After transfection, the proliferation ability of HuCCT1 cells was detected via EDU (scale bar corresponds to 100 μm). (C) After transfection, the migration ability of RBE cells was measured by cell migration assay (scale bar corresponds to 100 μm). (D) After transfection, the migration ability of HuCCT1 was detected using cell migration assay (scale bar corresponds to 100 μm). (E) After transfection, the invasion ability of RBE cells was measured by cell invasion assay (scale bar corresponds to 100 μm). (F) After transfection, the invasion ability of HuCCT1 was detected using cell invasion assay (scale bar corresponds to 100 μm). (G) After transfection, the apoptosis of RBE cells was tested using apoptosis assay. (H) After transfection, the apoptosis of HuCCT1 cells was detected using apoptosis assay. MiR-637 inh/mimics NC means transfection with miR-637 inhibitor/mimics negative controls, miR-637 inh/mimics means transfection with miR-637 inhibitor/mimics, sh-LY6E/LY6E means transfection with LY6E shRNA/LY6E lentiviral vector. Results are presented as mean ± SD. *P<0.05, **P<0.01, ***P<0.0001 vs. negative control group, #P<0.05, ##P<0.01, ###P<0.001 vs. miR-637 inhibitor or mimics + negative control group. All of the experiments were performed in triplicate.

Knockdown of circ-0000284 inhibited cholangiocarcinoma growth and metastasis in vivo

To study the role of circ-0000284 in tumor growth and metastasis in vivo, RBC cells transfected with scrambled or circ-0000284 shRNAs were subcutaneously injected into nude mice. The results showed that after 4 weeks of subcutaneous injection, knocking down circ-0000284 reduced the tumor volume (Figure 7A,B). To assess the effects of circ-0000284 on the metastasis of cholangiocarcinoma in vivo, circ-0000284 knockdown RBE cells and negative control RBE cells were injected via the tail vein into nude mice. Six weeks later, we found that the number and size of metastatic colonies were largely decreased on the lung surface in the circ-0000284 knockdown group. (Figure 7C). Immunohistochemistry results of tissues in tumor-bearing nude mice showed that knocking down circ-0000284 could impede the expression of LY6E. In addition, transfection with circ-0000284 shRNAs decreased the proliferation-specific gene Ki-67 and elevated the expression level of pro-apoptotic gene Bax (Figure 7D). These results indicate that circ-0000284 elevated the growing and metastatic ability of cholangiocarcinoma cells in vivo. The above results are consistent with those in vitro.

Knockdown of circ-0000284 in tumors repressed cholangiocarcinoma growth and metastasis

Figure 7
Knockdown of circ-0000284 in tumors repressed cholangiocarcinoma growth and metastasis

Circ-0000284/NC shRNA lentiviral vector was transfected into RBE cells, namely sh-circ-0000284 and sh-NC, respectively. (A) Representative images of xenograft tumors (n=3 in each group) in nude mice. (B) Xenograft tumor volume. (C) Knockdown of circ-0000284 inhibits tumor metastasis in vivo (scale bar: 200 μm). (Left) Representative bright field images of lungs. (Middle) H&E staining of lung serial sections. (Right) the number of nodules on lungs of mice (n=3 per group) at 6 weeks after tail vein injection of RBE cells. (D) Immunohistochemical staining of LY6E, Bax and Ki-67 expressions in xenograft tumors (scale bar corresponds to 50 μm). (E) MiR-637 co-localized with circ-0000284 in xenograft tumors of sh-NC or sh-circ-0000284 group was detected by FISH (scale bar corresponds to 50 μm). Results are shown as mean ± SD. **P<0.01. All experiments were carried out three times.

Figure 7
Knockdown of circ-0000284 in tumors repressed cholangiocarcinoma growth and metastasis

Circ-0000284/NC shRNA lentiviral vector was transfected into RBE cells, namely sh-circ-0000284 and sh-NC, respectively. (A) Representative images of xenograft tumors (n=3 in each group) in nude mice. (B) Xenograft tumor volume. (C) Knockdown of circ-0000284 inhibits tumor metastasis in vivo (scale bar: 200 μm). (Left) Representative bright field images of lungs. (Middle) H&E staining of lung serial sections. (Right) the number of nodules on lungs of mice (n=3 per group) at 6 weeks after tail vein injection of RBE cells. (D) Immunohistochemical staining of LY6E, Bax and Ki-67 expressions in xenograft tumors (scale bar corresponds to 50 μm). (E) MiR-637 co-localized with circ-0000284 in xenograft tumors of sh-NC or sh-circ-0000284 group was detected by FISH (scale bar corresponds to 50 μm). Results are shown as mean ± SD. **P<0.01. All experiments were carried out three times.

MiR-637 co-localized with circ-0000284 in tumor-bearing nude mice tissues were detected by FISH. According to the results, compared with sh-NC, the level of circ-0000284 in sh-circ-0000284 group was decreased while the level of miR-637 was increased. Furthermore, the subcellular localization of circ-0000284 in tumor-bearing nude mice tissues was consistent with that of miR-637 (Figure 7E).

Exosomal circ-0000284 mediated intercellular communication

The existing pattern of extravascular circ-0000284 was explored. The picture of exosomes was detected via TEM (Figure 8A), and Western blotting was conducted to determine the presence of TSG101 and CD63 (Figure 8B). Subsequently, the expression of circ-0000284 in RBE and HuCCT1 cells was found to be remarkably higher than that in 293T cells (Supplementary Figure S1G). As expected, compared with 293T cells, RBE and HuCCT1 cells had significantly increased exosomal circ-0000284 levels (Supplementary Figure S1H). Besides, the level of circ-0000284 in exosomes was three times than in production cells (Figure 8C). Hence, exosomes from RBE and HuCCT1 cells contain more circ-0000284 than those from 293T cells. Then exosomes from RBE and HuCCT1 cells were labeled with green fluorescent marker PKH67. After 3 h of incubation of receptor cells (293T cells) with labeled exosomes from RBE and HuCCT1 cells, it was surprisingly found that PKH67 located in the cytoplasm of receptor cells (Figure 8D), suggesting that RBE and HuCCT1 cells can transport circ-0000284 to surrounding cells by secreting exosomes.

Exosomal circ-0000284 serves as a mediator in intercellular communication

Figure 8
Exosomal circ-0000284 serves as a mediator in intercellular communication

Exosomes (Exos) were isolated from RBE cells transfected with circ-0000284 shRNA lentiviral vector or NC shRNA lentiviral vector namely sh-circ-0000284-Exos and sh-NC-Exos, respectively. Exosomes (Exos) were isolated from HuCCT1 cells transfected with circ-0000284-expression lentiviral vector or NC lentiviral vector namely circ-0000284-Exos and NC-Exos, respectively. Their exosomes were extracted and added to the 293T cells for 24 h. (A) Micrographs of exosomes isolated from RBE (left), HuCCT1 (middle) and 293T cells (right) (scale bar corresponds to 200 nm). (B) Western blot analysis of TSG101 and CD63 in exosomes of cell lines. (C) qRT-PCR detection of the fold change of circ-0000284 between exos of RBE, HuCCT1 and 293T and their producer cells. (D) Exos of RBE and HuCCT1 cells were labeled with PKH67; green represents PKH67, and blue represents nuclear DNA staining by DAPI. 293T cells were incubated with exosomes derived from RBE and HuCCT1 cells for 3 h (scale bar corresponds to 20 μm). (E) EdU assays of cell proliferation ability (scale bar corresponds to 50 μm). (F) Representative images of migration assays of 293T cells. The number of cells were counted (scale bar corresponds to 50 μm). (G) Flow cytology assays of cell apoptosis. Results are presented as mean ± SD. *P<0.05, **P<0.01, ***P<0.001. All of the experiments were performed in triplicate.

Figure 8
Exosomal circ-0000284 serves as a mediator in intercellular communication

Exosomes (Exos) were isolated from RBE cells transfected with circ-0000284 shRNA lentiviral vector or NC shRNA lentiviral vector namely sh-circ-0000284-Exos and sh-NC-Exos, respectively. Exosomes (Exos) were isolated from HuCCT1 cells transfected with circ-0000284-expression lentiviral vector or NC lentiviral vector namely circ-0000284-Exos and NC-Exos, respectively. Their exosomes were extracted and added to the 293T cells for 24 h. (A) Micrographs of exosomes isolated from RBE (left), HuCCT1 (middle) and 293T cells (right) (scale bar corresponds to 200 nm). (B) Western blot analysis of TSG101 and CD63 in exosomes of cell lines. (C) qRT-PCR detection of the fold change of circ-0000284 between exos of RBE, HuCCT1 and 293T and their producer cells. (D) Exos of RBE and HuCCT1 cells were labeled with PKH67; green represents PKH67, and blue represents nuclear DNA staining by DAPI. 293T cells were incubated with exosomes derived from RBE and HuCCT1 cells for 3 h (scale bar corresponds to 20 μm). (E) EdU assays of cell proliferation ability (scale bar corresponds to 50 μm). (F) Representative images of migration assays of 293T cells. The number of cells were counted (scale bar corresponds to 50 μm). (G) Flow cytology assays of cell apoptosis. Results are presented as mean ± SD. *P<0.05, **P<0.01, ***P<0.001. All of the experiments were performed in triplicate.

Effect of exosomal circ-0000284 on surrounding normal cells

As is known to all, exosomes exert key effects on cell communication [35,36]. As described in this study, circ-0000284 could be transferred from HuCCT1 and RBE cells to 293T cells by exosomes. Then it was predicted that exosomal circ-0000284 from HuCCT1 and RBE cells could change the biological function of 293T cells. In order to determine the function of exosomal circ-0000284, exosomes were separated from RBE cells that were transfected with circ-0000284 shRNA lentiviral vector or NC lentiviral vector, namely sh-circ-0000284-Exos or sh-NC-Exos. Meanwhile exosomes were separated from HuCCT1 cells transfected with circ-0000284 overexpression lentiviral vector or NC lentiviral vector, namely, circ-0000284-Exos or NC-Exos. After that, these Exos were added to 293T cells at a concentration of 100 μg/ml for 24 h. The results revealed that the level of circ-0000284 in 293T cells transfected with sh-circ-0000284-Exos obviously declined (Supplementary Figure S1I), while the level in the cells transfected with circ-0000284-Exos increased significantly (Supplementary Figure S1J). Additionally, sh-circ-0000284-Exos was capable of evidently reducing the migration and proliferation of 293T cells and boosting their apoptosis (Figure 8E,F,G). As expected, circ-0000284-Exos facilitated the migration and proliferation of 293T cells and suppressed their apoptosis (Figure 8E,F,G). To sum up, circ-0000284 competitively bound to miR-637, resulting in up-regulation of LY6E. Furthermore, the up-regulation of LY6E stimulated the migration, invasion and proliferation of cholangiocarcinoma cell line and inhibited its apoptosis. At the same time, circ-0000284 delivered by exosomes was able to stimulate the malignant behavior of surrounding normal cells and eventually promote the progression of cholangiocarcinoma (Supplementary Figure S2).

Discussion

Cholangiocarcinoma, as an invasive malignant tumor of the biliary tract characterized by less early symptoms and its invasive biological behaviors, is difficult to diagnose and has high mortality rate [37,38]. As the incidence rate of cholangiocarcinoma increases year by year, finding accurate early diagnosis methods and effective measures to inhibit or block the metastasis of cholangiocarcinoma cells have become an important task for medical researchers. Recent studies have found that circRNAs can regulate gene transcription and act as diagnostic markers for diseases. For example, Jiang et al. [12] have found that circRNA Cdr1as functions as a biomarker for the prognosis of cholangiocarcinoma. So, it can be concluded that circRNAs are correlated with the occurrence and development of cholangiocarcinoma.

In the present study, ten cancer-related circRNAs that have been studied widely were selected and their expressions in cholangiocarcinoma cells were detected via qRT-PCR. The results manifested that the expression of circ-0000284 in cholangiocarcinoma cell lines was markedly higher than that in normal H69 cells. Population-based study verified this result. Subsequent in-vivo and in-vitro experiments indicated that down-regulation of circ-0000284 had the ability to evidently inhibit the migration, invasion and proliferation of cells and boost apoptosis, showing that circ-0000284 is an indispensable positive growth regulator of cholangiocarcinoma cells and acts as an oncogene. Hence, deeply exploring the mechanism of circ-0000284 boosting the growth of cholangiocarcinoma cells is of great significance for understanding the occurrence and development of cholangiocarcinoma.

According to nuclear and cytoplasmic separation experiments, subcellular localization shows circ-0000284 was mainly in the cytoplasm, indicating that circ-0000284 may function as a ceRNA. Besides, RIP and dual-luciferase reporter assays proved that circ-0000284 was a molecular sponge stimulating LY6E expression through competitively binding to miR-637. So far, there are very few reports regarding miR-637 in cholangiocarcinoma. The present research demonstrated that miR-637 was down-regulated in cholangiocarcinoma cell lines, while LY6E was highly expressed in these cell lines. Transfection of circ-0000284 shRNA prominently reduced the expression of LY6E, and this change could be reversed by co-transfection with miR-637 inhibitors. It was also found that in comparison with the normal control, the migration, invasion and proliferation abilities of cells were impeded by miR-637 mimics, but miR-637 mimics enhanced their apoptosis, which could be reversed by overexpression of or LY6E. Interestingly, there is a positive correlation between circ-0000284 and LY6E in cholangiocarcinoma samples. The above-mentioned results verify that the circ-0000284/miR-637/LY6E regulatory axis may participate in the occurrence and development of cholangiocarcinoma by modulating the proliferation, migration, invasion and apoptosis of cholangiocarcinoma cells.

It was found in the present study that the level of circ-0000284 in cholangiocarcinoma cells and their exosomes were increased, and its expression in exosomes was approximately three times than in production cells. These results suggest that circ-0000284 is mainly present in exosomes. Up to now, accumulated evidence shows that exosomal circRNAs reflect the physiological status of donor cells, and they are captured by receptor cells to induce a train of cell reactions [32,39,40]. In the previous study, 293 cells were used to represent surrounding normal cells [32]. So, our study revealed the shape and size of exosomes from cholangiocarcinoma and normal control cell line 293T through TEM experiments. At the same time, exosomes were verified through the detection of exosome markers, TSG101 and CD63 [41,42]. Similar to the results of other reports [43,44], fluorescence microscopy showed that exosomes from cholangiocarcinoma cells labeled with PKH67 could be transferred to 293T cells. These findings confirm the possibility that cholangiocarcinoma cells can transmit circ-0000284 to 293T cells by secreting exosomes. The results of this research indicated that circ-0000284-Exos from cholangiocarcinoma cells enhanced the expression of circ-0000284 in 293T cells, stimulated the migration and proliferation of 293T cells and suppressed cell apoptosis. Therefore, the above results suggest that circ-0000284 may transfer from cholangiocarcinoma cells to surrounding normal cells through exosomes in a direct way and modulate the biological functions of surrounding normal cells.

Conclusions

To sum up, this research shows that circ-0000284 regulates LY6E expression by sponging miR-637 like a ceRNA and is of great significance in the pathogenesis of cholangiocarcinoma. Meanwhile, exosome-transmitted circ-0000284 may stimulate malignant behaviors of surrounding normal cells by boosting the migration and proliferation and inhibiting the apoptosis of these cells.

Clinical perspectives

  • The molecular mechanisms of cholangiocarcinoma carcinogenesis are not fully understood, and the roles of circRNAs in cholangiocarcinoma still remain largely uncovered.

  • Circ-0000284 was elevated in cholangiocarcinoma cell lines, tumor tissues and plasma exosomes. Meanwhile, the high expression of circ-0000284 enhanced the migration, invasion and proliferation abilities of cholangiocarcinoma cells in vivo and in vitro. Moreover, exosomes from cholangiocarcinoma cells enhanced circ-0000284 expression and stimulated migration and proliferation of the surrounding normal cells.

  • Collectively, we demonstrated for the first time that there was a higher expression of circ-0000284 in cholangiocarcinoma. Furthermore, we constructed a ceRNA network to identify the regulatory role of circ-0000284 in cholangiocarcinoma. Our findings also show that exosomal circ-0000284 may be a promoting factor for cholangiocarcinoma progression, providing new insights into understanding the mechanism of cholangiocarcinoma.

Data Availability Statement

The data in the current study are available from the corresponding authors on reasonable request.

Acknowledgments

We would like to thank Dr. Chao Xu, Yuting Liu and Xiang Jiang at The Affiliated Huaian No.1 People’s Hospital of Nanjing Medical University for sample collection.

Author Contribution

Conceptualization, Yang Su. Data curation, Yilin Hu and Xiurui Lv. Formal analysis, Xiurui Lv. Funding acquisition, Yong Sun. Investigation, Shuming Wang and Dianhua Gu. Methodology, Shuming Wang. Resources, Yong Sun. Software, Bin Li and Yang Li. Supervision, Yang Su. Validation, Yang Su. Visualization, Yilin Hu and Yang Li.

Funding

This work was supported in part by the Science and Technology Development Foundation of Nanjing Medical University [grant number 2016NJMUZD086].

Competing Interests

The authors declare that there are no competing interests associated with the manuscript.

Abbreviations

     
  • ceRNA

    competing endogenous RNA

  •  
  • circRNA

    circular RNA

  •  
  • EdU

    5-ethynyl-2′-deoxyuridine

  •  
  • FISH

    fluorescent in situ hybridization

  •  
  • LY6E

    lymphocyte antigen 6 family member E

  •  
  • NTA

    nanoparticle tracking analysis

  •  
  • RIP

    RNA binding protein immunoprecipitation

References

References
1.
Khan
S.A.
,
Toledano
M.B.
and
Taylor-Robinson
S.D.
(
2008
)
Epidemiology, risk factors, and pathogenesis of cholangiocarcinoma
.
HPB (Oxford)
10
,
77
82
[PubMed]
2.
Doherty
B.
,
Nambudiri
V.E.
and
Palmer
W.C.
(
2017
)
Update on the diagnosis and treatment of cholangiocarcinoma
.
Curr. Gastroenterol. Rep.
19
,
2
[PubMed]
3.
Blechacz
B.R.
and
Gores
G.J.
(
2008
)
Cholangiocarcinoma
.
Clin. Liver Dis.
12
,
131
150, ix
,
[PubMed]
4.
Blechacz
B.
(
2017
)
Cholangiocarcinoma: current knowledge and new developments
.
Gut Liver
11
,
13
26
[PubMed]
5.
Zhang
S.
,
Zhu
D.
,
Li
H.
,
Li
H.
,
Feng
C.
and
Zhang
W.
(
2017
)
Characterization of circRNA-associated-ceRNA networks in a senescence-accelerated mouse prone 8 brain
.
Mol. Ther.
25
,
2053
2061
[PubMed]
6.
Cui
X.
,
Niu
W.
,
Kong
L.
,
He
M.
,
Jiang
K.
,
Chen
S.
et al. .
(
2016
)
hsa_circRNA_103636: potential novel diagnostic and therapeutic biomarker in Major depressive disorder
.
Biomark. Med.
10
,
943
952
[PubMed]
7.
Wang
M.
,
Yu
F.
,
Wu
W.
,
Zhang
Y.
,
Chang
W.
,
Ponnusamy
M.
et al. .
(
2017
)
Circular RNAs: a novel type of non-coding RNA and their potential implications in antiviral immunity
.
Int. J. Biol. Sci.
13
,
1497
1506
[PubMed]
8.
Zhang
H.D.
,
Jiang
L.H.
,
Sun
D.W.
,
Hou
J.C.
and
Ji
Z.L.
(
2018
)
CircRNA: a novel type of biomarker for cancer
.
Breast Cancer
25
,
1
7
[PubMed]
9.
Chen
L.
,
Zhang
S.
,
Wu
J.
,
Cui
J.
,
Zhong
L.
,
Zeng
L.
et al. .
(
2017
)
circRNA_100290 plays a role in oral cancer by functioning as a sponge of the miR-29 family
.
Oncogene
36
,
4551
4561
[PubMed]
10.
Zhao
J.
,
Li
L.
,
Wang
Q.
,
Han
H.
,
Zhan
Q.
and
Xu
M.
(
2017
)
CircRNA expression profile in early-stage lung adenocarcinoma patients
.
Cell. Physiol. Biochem.
44
,
2138
2146
[PubMed]
11.
Hansen
T.B.
,
Kjems
J.
and
Damgaard
C.K.
(
2013
)
Circular RNA and miR-7 in cancer
.
Cancer Res.
73
,
5609
5612
[PubMed]
12.
Jiang
X.M.
,
Li
Z.L.
,
Li
J.L.
,
Xu
Y.
,
Leng
K.M.
,
Cui
Y.F.
et al. .
(
2018
)
A novel prognostic biomarker for cholangiocarcinoma: circRNA Cdr1as
.
Eur. Rev. Med. Pharmacol. Sci.
22
,
365
371
[PubMed]
13.
Xu
Y.
,
Yao
Y.
,
Zhong
X.
,
Leng
K.
,
Qin
W.
,
Qu
L.
et al. .
(
2018
)
Downregulated circular RNA hsa_circ_0001649 regulates proliferation, migration and invasion in cholangiocarcinoma cells
.
Biochem. Biophys. Res. Commun.
496
,
455
461
[PubMed]
14.
Xu
Y.
,
Yao
Y.
,
Liu
Y.
,
Wang
Z.
,
Hu
Z.
,
Su
Z.
et al. .
(
2019
)
Elevation of circular RNA circ_0005230 facilitates cell growth and metastasis via sponging miR-1238 and miR-1299 in cholangiocarcinoma
.
Aging (Albany N.Y.)
11
,
1907
1917
[PubMed]
15.
Xie
H.
,
Ren
X.
,
Xin
S.
,
Lan
X.
,
Lu
G.
,
Lin
Y.
et al. .
(
2016
)
Emerging roles of circRNA_001569 targeting miR-145 in the proliferation and invasion of colorectal cancer
.
Oncotarget
7
,
26680
26691
[PubMed]
16.
Du
W.W.
,
Yang
W.
,
Liu
E.
,
Yang
Z.
,
Dhaliwal
P.
and
Yang
B.B.
(
2016
)
Foxo3 circular RNA retards cell cycle progression via forming ternary complexes with p21 and CDK2
.
Nucleic Acids Res.
44
,
2846
2858
[PubMed]
17.
Zheng
Q.
,
Bao
C.
,
Guo
W.
,
Li
S.
,
Chen
J.
,
Chen
B.
et al. .
(
2016
)
Circular RNA profiling reveals an abundant circHIPK3 that regulates cell growth by sponging multiple miRNAs
.
Nat. Commun.
7
,
11215
[PubMed]
18.
Hsiao
K.Y.
,
Lin
Y.C.
,
Gupta
S.K.
,
Chang
N.
,
Yen
L.
,
Sun
H.S.
et al. .
(
2017
)
Noncoding effects of circular RNA CCDC66 promote colon cancer growth and metastasis
.
Cancer Res.
77
,
2339
2350
[PubMed]
19.
Yang
C.
,
Yuan
W.
,
Yang
X.
,
Li
P.
,
Wang
J.
,
Han
J.
et al. .
(
2018
)
Circular RNA circ-ITCH inhibits bladder cancer progression by sponging miR-17/miR-224 and regulating p21, PTEN expression
.
Mol. Cancer
17
,
19
[PubMed]
20.
Han
D.
,
Li
J.
,
Wang
H.
,
Su
X.
,
Hou
J.
,
Gu
Y.
et al. .
(
2017
)
Circular RNA circMTO1 acts as the sponge of microRNA-9 to suppress hepatocellular carcinoma progression
.
Hepatology
66
,
1151
1164
[PubMed]
21.
Yu
J.
,
Xu
Q.G.
,
Wang
Z.G.
,
Yang
Y.
,
Zhang
L.
,
Ma
J.Z.
et al. .
(
2018
)
Circular RNA cSMARCA5 inhibits growth and metastasis in hepatocellular carcinoma
.
J. Hepatol.
68
,
1214
1227
[PubMed]
22.
Li
X.
and
Wang
X.
(
2017
)
The emerging roles and therapeutic potential of exosomes in epithelial ovarian cancer
.
Mol. Cancer
16
,
92
[PubMed]
23.
Beuzelin
D.
and
Kaeffer
B.
(
2018
)
Exosomes and miRNA-loaded biomimetic nanovehicles, a focus on their potentials preventing type-2 diabetes linked to metabolic syndrome
.
Front. Immunol.
9
,
2711
[PubMed]
24.
Harding
C.
,
Heuser
J.
and
Stahl
P.
(
1983
)
Receptor-mediated endocytosis of transferrin and recycling of the transferrin receptor in rat reticulocytes
.
J. Cell Biol.
97
,
329
339
[PubMed]
25.
Pan
B.T.
and
Johnstone
R.M.
(
1983
)
Fate of the transferrin receptor during maturation of sheep reticulocytes in vitro: selective externalization of the receptor
.
Cell
33
,
967
978
[PubMed]
26.
Johnstone
R.M.
,
Bianchini
A.
and
Teng
K.
(
1989
)
Reticulocyte maturation and exosome release: transferrin receptor containing exosomes shows multiple plasma membrane functions
.
Blood
74
,
1844
1851
[PubMed]
27.
Lu
J.
,
Liu
Q.H.
,
Wang
F.
,
Tan
J.J.
,
Deng
Y.Q.
,
Peng
X.H.
et al. .
(
2018
)
Exosomal miR-9 inhibits angiogenesis by targeting MDK and regulating PDK/AKT pathway in nasopharyngeal carcinoma
.
J. Exp. Clin. Cancer Res.
37
,
147
[PubMed]
28.
Li
W.
,
Li
C.
,
Zhou
T.
,
Liu
X.
,
Liu
X.
,
Li
X.
et al. .
(
2017
)
Role of exosomal proteins in cancer diagnosis
.
Mol. Cancer
16
,
145
[PubMed]
29.
Ren
F.
,
Wu
H.
,
Lei
Y.
,
Zhang
H.
,
Liu
R.
,
Zhao
Y.
et al. .
(
2010
)
Quantitative proteomics identification of phosphoglycerate mutase 1 as a novel therapeutic target in hepatocellular carcinoma
.
Mol. Cancer
9
,
81
[PubMed]
30.
Wang
Y.
,
Zeng
X.
,
Wang
N.
,
Zhao
W.
,
Zhang
X.
,
Teng
S.
et al. .
(
2018
)
Long noncoding RNA DANCR, working as a competitive endogenous RNA, promotes ROCK1-mediated proliferation and metastasis via decoying of miR-335-5p and miR-1972 in osteosarcoma
.
Mol. Cancer
17
,
89
[PubMed]
31.
Hu
J.L.
,
Wang
W.
,
Lan
X.L.
,
Zeng
Z.C.
,
Liang
Y.S.
,
Yan
Y.R.
et al. .
(
2019
)
CAFs secreted exosomes promote metastasis and chemotherapy resistance by enhancing cell stemness and epithelial-mesenchymal transition in colorectal cancer
.
Mol. Cancer
18
,
91
[PubMed]
32.
Zheng
R.
,
Du
M.
,
Wang
X.
,
Xu
W.
,
Liang
J.
,
Wang
W.
et al. .
(
2018
)
Exosome-transmitted long non-coding RNA PTENP1 suppresses bladder cancer progression
.
Mol. Cancer
17
,
143
[PubMed]
33.
Xu
B.
,
Zhang
Y.
,
Du
X.F.
,
Li
J.
,
Zi
H.X.
,
Bu
J.W.
et al. .
(
2017
)
Neurons secrete miR-132-containing exosomes to regulate brain vascular integrity
.
Cell Res.
27
,
882
897
[PubMed]
34.
Zhai
W.
,
Sun
Y.
,
Guo
C.
,
Hu
G.
,
Wang
M.
,
Zheng
J.
et al. .
(
2017
)
LncRNA-SARCC suppresses renal cell carcinoma (RCC) progression via altering the androgen receptor (AR)/miRNA-143-3p signals
.
Cell Death Differ.
24
,
1502
1517
[PubMed]
35.
Wesolowska
A.
and
Piwocka
K.
(
2017
)
Exosomal microRNAs as a part of the cell-cell communication in cancer
.
Postepy Biochem.
63
,
110
118
[PubMed]
36.
McCoy-Simandle
K.
,
Hanna
S.J.
and
Cox
D.
(
2016
)
Exosomes and nanotubes: Control of immune cell communication
.
Int. J. Biochem. Cell Biol.
71
,
44
54
[PubMed]
37.
Khan
S.A.
,
Thomas
H.C.
,
Davidson
B.R.
and
Taylor-Robinson
S.D.
(
2005
)
Cholangiocarcinoma
.
Lancet
366
,
1303
1314
[PubMed]
38.
Bartella
I.
and
Dufour
J.F.
(
2015
)
Clinical diagnosis and staging of intrahepatic cholangiocarcinoma
.
J. Gastrointestin. Liver Dis.
24
,
481
489
[PubMed]
39.
Sun
Z.
,
Yang
S.
,
Zhou
Q.
,
Wang
G.
,
Song
J.
,
Li
Z.
et al. .
(
2018
)
Emerging role of exosome-derived long non-coding RNAs in tumor microenvironment
.
Mol. Cancer
17
,
82
[PubMed]
40.
Milane
L.
,
Singh
A.
,
Mattheolabakis
G.
,
Suresh
M.
and
Amiji
M.M.
(
2015
)
Exosome mediated communication within the tumor microenvironment
.
J. Control. Release
219
,
278
294
[PubMed]
41.
Fang
T.
,
Lv
H.
,
Lv
G.
,
Li
T.
,
Wang
C.
,
Han
Q.
et al. .
(
2018
)
Tumor-derived exosomal miR-1247-3p induces cancer-associated fibroblast activation to foster lung metastasis of liver cancer
.
Nat. Commun.
9
,
191
[PubMed]
42.
Chen
C.
,
Luo
F.
,
Liu
X.
,
Lu
L.
,
Xu
H.
,
Yang
Q.
et al. .
(
2017
)
NF-kB-regulated exosomal miR-155 promotes the inflammation associated with arsenite carcinogenesis
.
Cancer Lett.
388
,
21
33
[PubMed]
43.
Li
P.
,
Kaslan
M.
,
Lee
S.H.
,
Yao
J.
and
Gao
Z.
(
2017
)
Progress in exosome isolation techniques
.
Theranostics
7
,
789
804
[PubMed]
44.
Hannafon
B.N.
,
Trigoso
Y.D.
,
Calloway
C.L.
,
Zhao
Y.D.
,
Lum
D.H.
,
Welm
A.L.
et al. .
(
2016
)
Plasma exosome microRNAs are indicative of breast cancer
.
Breast Cancer Res.
18
,
90
[PubMed]

Author notes

*

These authors contributed equally to this work.

Supplementary data