Abstract

Inflammatory bowel disease (IBD) is a chronic intestinal inflammation, but the accurate etiology remains to be elucidated. Increasing evidence has shown that macrophages polarize to different phenotypes depending on the intestinal microenvironment and are associated with the progression of IBD. In the present study, we investigated the effect of oxytocin, a neuroendocrinal, and pro-health peptide, on the modulation of macrophages polarization and the progression of experimental colitis. Our data demonstrated that oxytocin decreased the sensitivity of macrophages to lipopolysaccharide stimulation with lower expression of inflammatory cytokines, like IL-1β, IL-6, and TNF-α, but increased the sensitivity to IL-4 stimulation with enhanced expression of M2-type genes, arginase I (Arg1), CD206, and chitinase-like 3 (Chil3). This bidirectional modulation was partly due to the up-regulation of β-arrestin2 and resulted in the inhibition of NF-κB signaling and reinforcement of Signal transducer and activator of transcription (STAT) 6 phosphorylation. Moreover, oxytocin receptor (OXTR) myeloid deficiency mice were more susceptible to dextran sulfate sodium (DSS) intervention compared with the wild mice. For the first time, we reveal that oxytocin–oxytocin receptor system participates in modulating the polarization of macrophages to an anti-inflammatory phenotype and alleviates experimental colitis. These findings provide new potential insights into the pathogenesis and therapy of IBD.

Introduction

Inflammatory bowel disease (IBD) is a world-wide chronic intestinal inflammation, including two major subtypes, Crohn’s disease, and ulcerative colitis [1]. The global incidence of IBD has increased in the past few decades, especially in developing countries [2]. It has become an enormous financial burden on the patients and governments because of its prolonged healing and repeated recurrence. It may be due to the uncontrolled immune-medicated inflammatory response combined with unknown environmental triggers, intestinal flora imbalance and specific genetic factors [3].

Innate immunity especially the intestinal monocyte-macrophage has been reported to play a critical role in IBD. There are a large number of intestinal macrophages in lamina propria, acting as the most essential innate immune cells in removing invasive bacteria and maintaining intestinal homeostasis [4]. The intestinal macrophages are highly plastic and continuously replaced by incoming monocytes which acquire a tissue-protective or pro-inflammatory signature depending on the local microenvironment [5,6]. At steady state, intestinal resident macrophages prefer an anti-inflammatory phenotype, also known as alternatively activated (M2-like) macrophages, under the effect of TGF-β, and IL-10 secreted by epithelial cells, mast cells, and stromal cells. M2-like macrophages exhibit tolerogenic properties, producing less pro-inflammatory cytokines but more IL-10, mannose receptor (CD206), CD163 and arginase I (Arg1) antigens, participating in tissue restitution after injury [7]. When pathogenic microorganisms invade the mucosa, monocytes are recruited into the intestine and tend to polarize into pro-inflammatory macrophages, also called classically activated (M1-like) macrophages, induced by IFN-γ, TNF-α, and lipopolysaccharide (LPS). The M1-like macrophages produce significant numbers of proinflammatory cytokines and chemokines, like IL-1β, IL-6, TNF-α, inducible nitric oxide synthase (iNOS) and reactive oxygen species, exacerbating the inflammatory response and tissue injury [8]. Regulation of the balance between M1 and M2 macrophage subsets becomes an intriguing target for the treatment of IBD.

Oxytocin is traditionally recognized as a hormone produced by the supraoptic nucleus and paraventricular nucleus of the hypothalamus and released from the posterior pituitary into circulation [9]. In mammals, it is involved in reproductive functions like uterine contraction and milk ejection, as well as the regulation of social behaviors [10,11]. Recently, some studies indicated that oxytocin receptors (OXTRs) were expressed in immune cells and participated in maintaining immune homeostasis, although the mechanisms were still unclear [12,13]. In the intestine, oxytocin is produced by the enteric neurons [14]. Our previous studies indicated that oxytocin administration protected the intestine from dextran sulfate sodium (DSS) colitis in mice [15]. It was reported that oxytocin decreased IL-6 mRNA expression in THP-1 cells and TNF-α mRNA expression in bone marrow-derived macrophages induced by LPS [16,17], but there were few reports about the effects of oxytocin on M2 macrophages polarization. In our present study, we first investigated that, both in vivo and in vitro experiments, oxytocin inhibited the activity of pro-inflammatory macrophages and enhanced the anti-inflammatory polarization. Considering the critical role of intestinal macrophages in the colitis, we inferred endogenous oxytocin ameliorates intestinal inflammation by modulating the polarization of macrophages.

Materials and methods

Reagents

Lipopolysaccharide (100 ng ml−1), phorbol 12-myristate 13-acetate (PMA, 100 nM), oxytocin (10−8 M), and atosiban (10−6 M) were purchased from Sigma–Aldrich (St. Louis, CA). Recombinant mouse IL-4 (10 ng ml−1) and macrophage colony stimulating factor (MCSF, 20 ng ml−1) were purchased from R&D Systems (Minneapolis, MN). Recombinant human interferon-γ (IFN-γ, 20 ng ml−1) and IL-4 (20 ng ml−1) were purchased from Peprotech (Rocky Hill, NJ). Antibodies for CD206, F4/80 and GAPDH, β-arrestin2, Signal transducer and activator of transcription (STAT) 6, phospho-STAT6, p65, and phospho-p65 were from Abcam (Cambridge, U.K.) and Cell Signaling Technology (Danvers, MA). The secondary antibodies were purchased from Invitrogen Life Technology (Foster City, CA). Mouse ELISA kits were obtained from R&D Systems and Dakewe Biotech (Shenzhen, China). All reagents were analytical grade.

Cell isolation and culture

RAW264.7 macrophage-like cell line was purchased from the Cell Bank of Chinese Academy of Science (Shanghai, China). Mouse peritoneal macrophages were obtained from C57BL6/J mice as previously described [18]. Briefly, the mouse was euthanized with no pain, spayed with 75% ethanol, and cut the outer skin of the peritoneum. 5 ml ice-cold PBS with 3% fetal bovine serum (FBS) was injected into the peritoneum cavity using a 27 g needle. The mouse was putted on ice and massaged the peritoneum for 30 min. Peritoneal fluid was gently collected with a 25 g needle, and spun at 1500 RPM for 8 min to get the cells. Cells were cultured in Dulbecco’s modified Eagle’s medium (Hyclone, Logan, Utah) supplemented 10% heat-inactivated FBS (Gibco, Foster City, CA) and 1% penicillin–streptomycin solutions (Gibco) in a humidified incubator with 5% CO2 at 37°C. Cells were treated with oxytocin (10−8 M) for 50 min before LPS (100 ng ml−1) or IL-4 (10 ng ml−1) was added. Human monocyte cell line THP-1 was purchased from the Cell Bank of Chinese Academy of Science and maintained in RMPI 1640 medium with 10% heat-inactivated fetal bovine serum and 1% penicillin–streptomycin solutions in a humidified incubator with 5% CO2 at 37°C. THP-1 cells were stimulated with 100 nM of PMA for 48 h to obtain THP-1 derived macrophages. Then cells were treated with oxytocin (10−8 M) for 50 min before LPS (100 ng ml−1) and human IFN-γ (20 ng ml−1) or IL-4 (20 ng ml−1) was added.

Experimental animals

Wild-type C57BL6/J mice were purchased from the Animal Center of Shandong University. The OXTR floxed (OXTRFL/FL) mice were purchased from the Jackson Laboratory (stock No. 008471). The LysM-Cre transgenic mice were kindly provided by Dr. Liu Shangming (Shandong University). OXTR floxed (OXTRFL/FL) mice were crossed with LysM-Cre transgenic mice to generate myeloid-specific OXTR knockout mice (OXTRmyel-KO), and their littermates OXTRFL/FL mice were used as myeloid-specific OXTR wild-type control (OXTRmyel-WT). All mice used were male and 8–10 weeks old. Experimental mice were randomly grouped and maintained under pathogen-free conditions in the animal care facilities. All animal experiments were carried out at the Animal Center of Shandong University Cheeloo Medical College and approved by the Medical Ethics Committee for Experimental Animals, Shandong University School of Basic Medicine Sciences (ECAESDUSM 2014056). The suffering of mice was kept to the minimum.

Immunocytofluorescense

The cell slides were fixed with 4% paraformaldehyde at room temperature for 30 min and then washed with PBS for three-times. After blocked with 10% donkey serum for 50 min at 25°C, the cells were incubated with rabbit anti-OXTR (1:100, Abcam) and rat anti-F4/80 (1:100, Abcam) primary antibodies dissolved in blocking solution overnight at 4°C. The paraffin sections of mice colon were dewaxed and then repaired by boiling slices in sodium citrate buffer (10 mM, PH = 6, Beyotime) for 30 min. After cooling down, tissues were blocked with 10% donkey serum for 50 min at 25°C and then incubated with rabbit anti-CD206 (1:500, Abcam) primary antibodies dissolved by blocking solution overnight at 4°C. After multiple washes, the slides were incubated with Alexa Fluor 568 (or 488) donkey antirabbit (1:2000, Invitrogen) or Alexa Fluor 488 donkey antirat (1:200, Abcam) secondary antibodies for 1 h and then counterstained with DAPI (1:1000, Beyotime) for 5 min. The images were observed by a fluorescent microscope (Olympus IX71).

RNA extraction and quantitative real-time PCR

The total RNA was prepared from cells and colonic tissue using a tissue/cell rapid extraction kit (Aidlab Biotechnologies, Beijing, China) in accordance with the operating instruction. RNA was reverse transcribed using a Takara PCR Thermal Cycler SP (Takara Bio, Shiga, Japan). Real-time quantitative PCR was carried out using the SYBR Premix Dimer Eraser (Takara Bio, Shiga, Japan). The level of mRNA expression was presented as ratio relative to that of the control housekeeping gene. The primers were composed by The Beijing Genomics Institute (Shenzhen, China) and the sequences of the specific primers used were as showed in Table 1.

Table 1

Primer pairs used for qRT-PCR

Gene Species Forward primer Reverse primer 
GAPDH Mouse ATACGGCTACAGCAACAGGG GCCTCTCTTGCTCAGTGTCC 
TNF-α Mouse CCCTCACACTCAGATCATCTTCT GCTACGACGTGGGCTACAG 
IL-6 Mouse TCCTTCCTACCCCAATTCCA GTCTTGGTCCTTAGCCACTCC 
iNOS Mouse CCGAAGCAAACATCACATTCA GGTCTAAAGGCTCCGGGCT 
CXCL10 Mouse GACGGTCCGCTGCAACTG GCTTCCCTATGGCCCTCATT 
IL-1β Mouse GGCAACCGTACCTGAACCCA CCACGATGACCGACACCACC 
CCL2 Mouse TTAAAAACCTGGATCGGAACCAA GCATTAGCTTCAGTTACGGGT 
Arg1 Mouse TGTCCCTAATGACAGCTCCTT GCATCCACCCAAATGACACAT 
CD206 Mouse TGATTACGAGCAGTGGAAGC GCTACGACGTGGGCTACAG 
Chil3 Mouse GATGGCCTCAACCTGGACTG CGTCAATGATTCCTGCTCCTG 
OXTR Mouse GGCCGTGTTCCAGGTTCTC TGCAAGTATGACCAGACGAC 
β-arrestin2 Mouse AGTCGAGCCCTAACTGCAAG ACGAACACTTTCCGGTCCTTC 
GAPDH Human GCACCGTCAAGGCTGAGAAC TGGTGAAGACGCCAGTGGA 
CCL2 Human AGAATCACCAGCAGCAAGTGTCC TTGCTTGTCCAGGTGGTCCATG 
CD86 Human TGCTCATCTATACACGGTTACC TGCATAACACCATCATACTCGA 
CD206 Human GACGTGGCTGTGGATAAATAAC CAGAAGACGCATTAAAGCTAC 
F13A1 Human ACACCATCACAGCTTATCTCTC CGAACGTCTCCTTCTTGAATTC 
iNOS Human GACTTTCCAAGACACACTTCAC TTCGATAGCTTGAGGTAGAAGC 
PTGS2 Human TGTCAAAACCGAGGTGTATGTA AACGTTCCAAATCCCTTGAAG 
TNF-α Human AGCTGGTGGTGCCATCAGAGG TGGTAGGAGACGGCGATGCG 
Gene Species Forward primer Reverse primer 
GAPDH Mouse ATACGGCTACAGCAACAGGG GCCTCTCTTGCTCAGTGTCC 
TNF-α Mouse CCCTCACACTCAGATCATCTTCT GCTACGACGTGGGCTACAG 
IL-6 Mouse TCCTTCCTACCCCAATTCCA GTCTTGGTCCTTAGCCACTCC 
iNOS Mouse CCGAAGCAAACATCACATTCA GGTCTAAAGGCTCCGGGCT 
CXCL10 Mouse GACGGTCCGCTGCAACTG GCTTCCCTATGGCCCTCATT 
IL-1β Mouse GGCAACCGTACCTGAACCCA CCACGATGACCGACACCACC 
CCL2 Mouse TTAAAAACCTGGATCGGAACCAA GCATTAGCTTCAGTTACGGGT 
Arg1 Mouse TGTCCCTAATGACAGCTCCTT GCATCCACCCAAATGACACAT 
CD206 Mouse TGATTACGAGCAGTGGAAGC GCTACGACGTGGGCTACAG 
Chil3 Mouse GATGGCCTCAACCTGGACTG CGTCAATGATTCCTGCTCCTG 
OXTR Mouse GGCCGTGTTCCAGGTTCTC TGCAAGTATGACCAGACGAC 
β-arrestin2 Mouse AGTCGAGCCCTAACTGCAAG ACGAACACTTTCCGGTCCTTC 
GAPDH Human GCACCGTCAAGGCTGAGAAC TGGTGAAGACGCCAGTGGA 
CCL2 Human AGAATCACCAGCAGCAAGTGTCC TTGCTTGTCCAGGTGGTCCATG 
CD86 Human TGCTCATCTATACACGGTTACC TGCATAACACCATCATACTCGA 
CD206 Human GACGTGGCTGTGGATAAATAAC CAGAAGACGCATTAAAGCTAC 
F13A1 Human ACACCATCACAGCTTATCTCTC CGAACGTCTCCTTCTTGAATTC 
iNOS Human GACTTTCCAAGACACACTTCAC TTCGATAGCTTGAGGTAGAAGC 
PTGS2 Human TGTCAAAACCGAGGTGTATGTA AACGTTCCAAATCCCTTGAAG 
TNF-α Human AGCTGGTGGTGCCATCAGAGG TGGTAGGAGACGGCGATGCG 

Abbreviations: CCL2, C–C motif chemokine ligand; Chil3, chitinase-like 3; CXCL, C-X-C motif chemokine.

ELISA and NO assay

The cell supernatant was collected and centrifugalized after stimulated by drugs. The concentration of specific protein was detected with a precoated ELISA kit according to the manual instruction. The NO production in cell culture media was detected using the classic Griess method as previous described [19].

DSS colitis conduction

Acute colitis was induced by administration of 2.5% DSS salt (reagent-grade, MW 36–50 kDa, MP Biomedicals, Canada) in the drinking water for 7 days. Neutrophils were depleted as described by using anti-Ly6G MAb 1A8 (1 mg per mouse, i.p., Bio X Cell) 1 day before DSS administration [20]. The body weight was measured daily. The disease activity index was measured based on weight loss, stool consistence, and occult bleeding, as previously described [21]. At day 7, mice were fed with FITC-dextran (400 mg kg−1, Sigma) by oral gavage. Serum samples (100 ul) were accessed from the submandibular vein 4 h later, and the fluorescence intensity was measured at 520 nm. Mice were euthanized by intraperitoneal administration of sodium pentobarbital (200 mg kg−1) on the day 7, and the colons were removed following PBS infusion. To induce chronic colitis, the mice underwent three cycles of DSS treatment. One cycle consisted of 5 days of 2% DSS in drinking water followed by 9 days of normal drinking water. This treatment is suited to induce a consistent and reproducible state of chronic colitis [22–25]. Mice were euthanized by intraperitoneal administration of sodium pentobarbital on the day 41. Distal colon was embedded by 4% paraformaldehyde solution, and the transverse sections were stained with Hematoxylin and Eosin. Two analysts were needed to measure the histological scores, blinded to each animal groups. The assessment criteria included epithelial surface damage, the loss of crypts, and inflammatory infiltrate described by Zaki [26], ranging from 0 to 6 (combining inflammatory cells infiltration score and tissue damage score). Picrosirius red were used to evaluate the colitis-associated collagen deposition. Under polarized light, collagen I appears red or yellow and has strong birefringence. Collagen III is green and weak birefringence. The images were observed by a polarization microscope (Nikon Eclipse Ci). The results were quantified by Image-Pro plus 6.0 and expressed as mean optical density. For 7-day DSS intervention, data were expressed as mean ± SEM from three independent experiments. For chronic DSS-induced colitis, two independent experiments were performed.

Isolation of colonic lamina propria cells

Lamina propria mononuclear cells (LPMCs) were isolated using a modified technique described previously [27]. In brief, the colons of mice were removed and washed in ice-cold PBS to remove the intestinal contents. The intestines were opened longitudinally and cut into 0.5 cm sections. Segments were twice vigorously shaken in PBS containing 5% fetal calf serum, 1% penicillin–streptomycin, 1 mM DTT (Sigma–Aldrich) and 1 nM EDTA (Sigma–Aldrich) at 37°C for 20 min and the supernatants were discarded. The remain tissue was further minced and digested in shacking RPMI 1640 with 1 mg ml−1 collagenase IV (Roche, Germany) at 37°C for 30 min. The tube was shaken vigorously every 15 min during incubation. The supernatant was passed through a 40 μm cell strainer. To get the LPMCs, cells were isolated over a 40–75% Percoll (GE Healthcare, Sweden) gradient and spun at 2000 RPM for 20 min without the breaks. Isolated cells at the interface were gently collected for further analysis.

Flow cytometry

The mice were peritoneally injected with anti-Ly6G MAb 1A8 (1 mg per mouse) to deplete neutrophils. On the day 8, the cells in the lamina propria were collected as described above to assess the number of granulocytes by standard flow cytometry. Cells from lamina propria were stained with Percp antimouse Ly6G (Biolegend, San Diego, CA) and data were acquired using a FACS flow cytometer C6 (BD Biosciences, England).

Human colonic tissue samples

The colonic tissue samples were obtained from patients undergoing abdominal surgery at Qilu Hospital of Shandong University and Jinan Central Hospital. The samples were categorized as discard tissue and macroscopically normal in appearance. Surgical specimens were taken from seven patients (five males and two females) with a median age of 50.8 years (range 35–75 years) for colonic neoplasms (n=6) and structural anomalies (n=1). After multiple washing, specimens were trimmed into 1.0 cm pieces and cultured in RPMI 1640 supplemented 5% heat-inactivated FBS and 1% penicillin–streptomycin solutions in a humidified incubator with 5% CO2 at 37°C. The specimens were treated with oxytocin (10−8 M) for 40 min before LPS (100 ng ml−1) and human IFN-γ (20 ng ml−1) added. LPMCs were collected by using previously described methods with slightly modifications after the 5-h stimulation [28,29]. Briefly, the mucosal tissue was gently dissected and twice vigorously shaken in Hanks’ balanced salt solution (HBSS, Hyclone) containing 5% fetal calf serum, 1% penicillin-streptomycin, 1 mM DTT, and 1 nM EDTA at 37°C for 40 min and the supernatants were discarded. After rinsed with HBSS, the remaining tissue was minced and digested in RPMI 1640 with 1 mg ml−1 collagenase IV, 2% fetal calf serum, 1% penicillin-streptomycin and 20 ug ml−1 DNase (Sigma–Aldrich) at 37°C for 90 min. The tube was shaken vigorously every 15 min during incubation. The supernatant was passed through a 40 μm cell strainer. To get the LPMCs, cells were isolated by Ficoll-Hypaque (GE Healthcare) density centrifugation. Isolated cells at the interface were gently collected for further analysis.

All the patients were informed and consented to the unrestricted use of discarded tissue. The research was reviewed and approved by the Medical Ethics Committee, Shandong University School of Basic Medicine Sciences (ECSBMSSDU2018-1-039).

Western blotting analysis

After incubating by specific drugs, cells were harvested in RIPA-lysis buffer (Bioster Bio, Pleasanton, CA), and protein samples were electrophoresed and transferred to PVDF membrane. The membranes were blocked with 5% non-fat dry milk dissolved by tween/tris-buffered salt solution for 1 h at 25°C and then incubated with rabbit anti-CD206 (1:1000, Abcam), anti-OXTR (1:1000, Abcam), anti-p65 (1:1000, CST), anti-phospho-p65 (1:800, CST), anti-STAT6 (1:1000, CST), antiphospho-STAT6 (1:1000, CST), anti-β-arrestin2 (1:1000, CST) antibodies, and mouse anti-GAPDH (1:2000, CST) antibody overnight at 4°C. After multiple washes, membranes were incubated with goat antirabbit or mouse IgG secondary antibodies (1:2000, Beyotime) conjugated with HRP at 25°C for 1 h. Chemiluminescence was detected by using ECL plus (Beyotime, China). The signal intensities were analyzed by ImageJ software.

RNA interference

The genetic sequence targeting mouse β-arrestin2 was already confirmed as follows 5′-AAGGACCGGAAAGUGUUCGUG-3 [30]. β-arrestin2 shRNA (shβ-arr2) plasmids were constructed by Genechem (Shanghai, China), and they were cloned into the lentiviral vectors for interference. RAW264.7 cells were infected with shβ-arr2 or negative control lentivirus separately for 24 h by using lipofectamine 2000 (Invitrogen, Foster City, CA). Cells were selected by puromycin (3μg ml−1, Sigma) for 24 h, after 4-day transfection. The expression of β-arrestin2 was detected by Western blot and qRT-PCR.

Statistical analysis

Data were expressed as mean ± SEM from at least two independent experiments, and n presented the number of samples in the specific experiments. One-way ANOVA or two-tailed Student’s t-test were used to compare between groups. GraphPad Prism version 5 (La Jolla, CA) was used for statistical analysis. P<0.05 was considered statistically significant.

Results

Oxytocin depresses proinflammatory mediators release in LPS-activated RAW264.7 and THP-1 derived macrophages

In our study, we revealed that OXTRs were expressed on the membrane of primary and subcultured macrophages (Supplementary Figure S1). First, we used LPS to promote an M1 polarization and investigated the role of oxytocin in it. We found that LPS-induced macrophages to M1 polarization and oxytocin suppressed the transcription of inflammatory cytokines in LPS-stimulated RAW264.7 cells, like IL-1β, TNF-α, iNOS, chemokines C-C motif chemokine ligand (CCL) 2, and C-X-C motif chemokine (CXCL) 10 (Figure 1A). Oxytocin (10−6 M to 10−9 M) lessened IL-6 transcription induced by LPS in a concentration-independent manner (Figure 1B). Consistently, LPS-induced release of NO, TNF-α, IL-1β, and IL-6 were also significantly restrained by pretreatment of oxytocin (Figure 1C,D). These effects were reversed by atosiban, the OXTR antagonist. To obtain THP-1 derived macrophages, THP-1 cells were stimulated with of PMA (100 nM) for 48 h. Then we used LPS (100 ng ml−1) and human IFN-γ (20 ng ml−1) to promote an M1 polarization with up-regulated transcription of inflammatory markers, like CCL2, TNF-α, and CD86. Consistently, this effect was restrained by the pretreatment of oxytocin (Figure 1E). These findings indicated that oxytocin could restrain the polarization of macrophages to M1 phenotype and exert an anti-inflammatory function in vitro.

Oxytocin inhibits proinflammatory mediators release in LPS-activated RAW264.7 and THP-1 derived macrophages

Figure 1
Oxytocin inhibits proinflammatory mediators release in LPS-activated RAW264.7 and THP-1 derived macrophages

(A) qRT-PCR analyzed levels of inflammatory cytokines IL-1β, TNF-α, iNOS mRNA, and chemokines CCL2, CXCL10 mRNA in RAW264.7 cells stimulated by LPS (100 ng ml−1) for 24 h without or with 50-min oxytocin (10−8 M) preincubation. Pretreatment of atosiban (10−6 M) for 40 min inhibited the effects of oxytocin. (B) Oxytocin (from 10−6 M to 10−9 M) decreased IL-6 transcription induced by LPS. (C) The levels of NO, TNF-α, and IL-1β in cell supernatant were detected by classic Griess method and ELISA. (D) Dose response of oxytocin treatment on the LPS induced IL-6 expression was measured by ELISA. (E) qRT-PCR analyzed levels of CCL2, TNF-α, and CD86 mRNA in THP-1 derived macrophages stimulated by LPS (100 ng ml−1) and IFN-γ (20 ng ml−1) for 24 h without or with 50-min oxytocin (10−8 M) preincubation. Values are mean ± SEM of six samples and were compared by One-way ANOVA with Newman–Keuls for multiple comparisons. *P<0.05, **P<0.01, ***P<0.001 vs control group. #P<0.05, ##P<0.01, ###P<0.001 vs LPS group. P<0.05, ∧∧P<0.01, ∧∧∧P<0.001 vs OT + LPS group.

Figure 1
Oxytocin inhibits proinflammatory mediators release in LPS-activated RAW264.7 and THP-1 derived macrophages

(A) qRT-PCR analyzed levels of inflammatory cytokines IL-1β, TNF-α, iNOS mRNA, and chemokines CCL2, CXCL10 mRNA in RAW264.7 cells stimulated by LPS (100 ng ml−1) for 24 h without or with 50-min oxytocin (10−8 M) preincubation. Pretreatment of atosiban (10−6 M) for 40 min inhibited the effects of oxytocin. (B) Oxytocin (from 10−6 M to 10−9 M) decreased IL-6 transcription induced by LPS. (C) The levels of NO, TNF-α, and IL-1β in cell supernatant were detected by classic Griess method and ELISA. (D) Dose response of oxytocin treatment on the LPS induced IL-6 expression was measured by ELISA. (E) qRT-PCR analyzed levels of CCL2, TNF-α, and CD86 mRNA in THP-1 derived macrophages stimulated by LPS (100 ng ml−1) and IFN-γ (20 ng ml−1) for 24 h without or with 50-min oxytocin (10−8 M) preincubation. Values are mean ± SEM of six samples and were compared by One-way ANOVA with Newman–Keuls for multiple comparisons. *P<0.05, **P<0.01, ***P<0.001 vs control group. #P<0.05, ##P<0.01, ###P<0.001 vs LPS group. P<0.05, ∧∧P<0.01, ∧∧∧P<0.001 vs OT + LPS group.

Oxytocin attenuates the release of inflammatory mediators by LPS-stimulated macrophages via its receptors

Atosiban is not entirely selective to OXTR, so we established myeloid cell-specific deletion (OXTRmyel-KO) mice to investigate the function of OXT-OXTR system specifically. First, we confirmed that the transcription and expression of OXTR on OXTRmyel-KO macrophages were depleted successfully (Supplementary Figure S2). Then we isolated peritoneal macrophages from OXTRmyel-KO mice and the wild litter mates (OXTRmyel-WT). In OXTRmyel-WT peritoneal macrophages, LPS raised the expressions of inflammatory cytokines, like IL-1β, IL-6, and TNF-α. Preincubation of oxytocin inhibited the elevation of inflammatory cytokines induced by LPS. However, in OXTRmyel-KO peritoneal macrophages, oxytocin preincubation did not affect the increased expressions of IL-1β, IL-6, and TNF-α induced by LPS (Figure 2A–C). Therefore, we believe that oxytocin requires its receptors to inhibit the release of proinflammatory cytokines induced by LPS in macrophages.

Oxytocin attenuates the release of inflammatory mediators by LPS-stimulated macrophages via its receptors

Figure 2
Oxytocin attenuates the release of inflammatory mediators by LPS-stimulated macrophages via its receptors

In OXTRmyel-WT and OXTRmyel-KO peritoneal macrophages, mRNA or protein levels of inflammatory cytokines IL-1β (A), IL-6 (B), and TNF-α (C) stimulated by LPS (100 ng ml−1) for 24 h with or without preincubation of oxytocin (10−8 M) for 50 min were detected by qRT-PCR or ELISA. Values are mean ± SEM of six samples and were compared by One-way ANOVA with Newman–Keuls for multiple comparisons. *P<0.05, **P<0.01, ***P<0.001.

Figure 2
Oxytocin attenuates the release of inflammatory mediators by LPS-stimulated macrophages via its receptors

In OXTRmyel-WT and OXTRmyel-KO peritoneal macrophages, mRNA or protein levels of inflammatory cytokines IL-1β (A), IL-6 (B), and TNF-α (C) stimulated by LPS (100 ng ml−1) for 24 h with or without preincubation of oxytocin (10−8 M) for 50 min were detected by qRT-PCR or ELISA. Values are mean ± SEM of six samples and were compared by One-way ANOVA with Newman–Keuls for multiple comparisons. *P<0.05, **P<0.01, ***P<0.001.

Oxytocin promotes the M2 macrophages polarization in coordination with IL-4

The results mentioned above indicated that oxytocin inhibited macrophages polarizing toward the M1 phenotype induced by LPS. Then we investigated the effect of oxytocin on M2 polarization. We used IL-4 to promote an M2 polarization and found in cell line RAW264.7, oxytocin preincubation increased the sensitivity of macrophages to IL-4 stimulation with raised M2 markers, including CD206 and Arg1 (Figure 3A). Similarly, in THP-1 derived macrophages, oxytocin preincubation enhanced the expression of CD206, F13A1 and PTGS2 induced by IL-4 (Figure 3B).

Similarly to subcultured cells, in OXTRmyel-WT peritoneal macrophages, oxytocin preincubation increased the expression of CD206, Arg1, and Chil3 induced by IL-4. However, in OXTRmyel-KO peritoneal macrophages, oxytocin did not change the sensitivity to IL-4 stimulation (Figure 3C–E). To the best of our knowledge, this is the first time that the oxytocin system has been shown to promote M2-type polarization directly.

Oxytocin promotes the M2 macrophages polarization in coordination with IL-4

Figure 3
Oxytocin promotes the M2 macrophages polarization in coordination with IL-4

(A) The levels of CD206 and Arg1 mRNA in IL-4-activated RAW264.7. Cells were pretreated with oxytocin (10−8 M) for 50 min and then stimulated by IL-4 (10 ng ml−1) for 24 h. (B) The levels of CD206, F13A1, and PTGS2 mRNA in IL-4-activated THP-1 derived macrophages with or without pretreatment of oxytocin (10−8 M) for 50 min. The levels of CD206 (C), Arg1 (D) and chitinase-like 3 (Chil3) (E) mRNA in IL-4-activated OXTRmyel-WT or OXTRmyel-KO primary peritoneal macrophage with or without oxytocin preincubation. Values are mean ± SEM of six samples and were compared by One-way ANOVA with Newman–Keuls for multiple comparisons. *P<0.05, **P<0.01, ***P<0.001 vs control group. #P<0.05, ##P<0.01, ###P<0.001 vs IL-4 group.

Figure 3
Oxytocin promotes the M2 macrophages polarization in coordination with IL-4

(A) The levels of CD206 and Arg1 mRNA in IL-4-activated RAW264.7. Cells were pretreated with oxytocin (10−8 M) for 50 min and then stimulated by IL-4 (10 ng ml−1) for 24 h. (B) The levels of CD206, F13A1, and PTGS2 mRNA in IL-4-activated THP-1 derived macrophages with or without pretreatment of oxytocin (10−8 M) for 50 min. The levels of CD206 (C), Arg1 (D) and chitinase-like 3 (Chil3) (E) mRNA in IL-4-activated OXTRmyel-WT or OXTRmyel-KO primary peritoneal macrophage with or without oxytocin preincubation. Values are mean ± SEM of six samples and were compared by One-way ANOVA with Newman–Keuls for multiple comparisons. *P<0.05, **P<0.01, ***P<0.001 vs control group. #P<0.05, ##P<0.01, ###P<0.001 vs IL-4 group.

OXTR myeloid lineage conditioned KO mice have the increased inflammatory response and severity in DSS-induced colitis

Our previous studies indicated that exogenous oxytocin treatment significantly ameliorated DSS colitis in mice [15]. Welch et al. [31] also reported that OXTR deficient mice had more severe DSS colitis. Innate immune cells especially macrophages play a crucial role in the progression and recovery of IBD. Therefore, we compared the severity of DSS-induced colitis in OXTRmyel-WT and OXTRmyel-KO mice to investigate the possible role of macrophagic oxytocin system in IBD course. To induce acute colitis, male OXTRmyel-KO mice and their wild OXTRmyel-WT littermates aged 8–10 weeks were treated with or without 2.5% DSS dissolved in drinking water for 7 days (n=8 in each group). The control mice had no significant inflammation in the colon and mice treated with 2.5% DSS, in both OXTRmyel-WT and OXTRmyel-KO groups, developed severe colitis. Compared with OXTRmyel-WT mice, the OXTRmyel-KO mice had more weight loss, shorter colon lengths, and higher disease activity index after DSS administration (Figure 4A–C). On the day 7, histological assessment of the OXTRmyel-KO mice showed more severe epithelial destruction, crypt loss, submucosal edema, and inflammatory cell infiltration in the colon than those of their wild littermates (Figure 4D). The histological index of colitis in OXTRmyel-KO mice was also significantly higher (Figure 4E). FITC-dextran was administered orally on the day 7, and its fluorescence intensity in serum was measured after 4 h to reflect the mucosal permeability. FITC fluorescence intensity in serum was significantly greater in OXTRmyel-KO mice than that in OXTRmyel-WT mice (Figure 4F), suggesting that OXTRmyel-KO mice had more severe mucosal damage and greater macromolecular permeability. To further evaluate whether OXTR deletion in macrophages had the same effect in chronic colitis, the male OXTRmyel-WT and OXTRmyel-KO mice underwent three cycles of 2% DSS treatment. During the experiment, OXTRmyel-KO mice were more sensitive to DSS treatment. The OXTRmyel-KO mice had more weight loss during DSS intervention compared with OXTRmyel-WT mice (Figure 4G). On the day 41, more severe shortening of colon was observed in OXTRmyel-KO mice (Figure 4H). On the day 5 and day 34, the OXTRmyel-KO mice had higher disease activity index compared with OXTRmyel-WT mice (Figure 4I). The LysM-Cre transgene is expressed in granulocytic cells in addition to macrophages [32]. According to the method of Li et al. [20], we depleted granulocytes with anti-Ly6G antibody prior to DSS administration to exclude a role for these cells in enhanced colitis in OXTRmyel-KO mice, and granulocytes were effectively depleted for 8 days (Supplementary Figure S3). The anti-Ly6G intervention did not alter the disease course or severity in either OXTRmyel-WT or OXTRmyel-KO mice (Figure 4J). This indicated that macrophages but not granulocytes contributed to the protective effects of OXTR in colitis. All evidence above indicates that down-regulation of the OXTRs on macrophages would aggravate the inflammatory response induced by DSS in mice.

OXTR myeloid lineage conditioned KO mice become more sensitive to DSS-induced colitis

Figure 4
OXTR myeloid lineage conditioned KO mice become more sensitive to DSS-induced colitis

To induce acute colitis, male OXTRmyel-KO mice and their wild-type OXTRmyel-WT littermates aged 8–10 weeks received 2.5% DSS dissolved in drinking water for 7 days. (A) Body weight change of OXTRmyel-KO and OXTRmyel-WT mice during the 7 days with or without DSS induction. (B) The lengths of the colons from different groups were statistically compared. (C) Representative disease activity index in each group based on body weight loss, stool consistence and hematochezia. (D) Representative H&E stained colonic section in each group (Scale bar: 100 μm). (E) Histological assessment of the indicated group. (F) The representative fluorescence intensity of FITC-dextran in the serum from each group. To induce chronic colitis, the OXTRmyel-WT, and OXTRmyel-KO mice underwent three cycles of 2% DSS treatment. (G) Body weight change of OXTRmyel-KO and OXTRmyel-WT mice during the 41 days with or without DSS induction. (H) The lengths of the colons from different groups were statistically compared on the day 41. (I) Representative disease activity index was valued on specific days in each group. (J) Body weight change of OXTRmyel-KO and OXTRmyel-WT mice during the 7-day DSS intervention with or without granulocytic depletion. Values are mean ± SEM of eight samples in each group and were compared by t-test. *P<0.05, **P<0.01, ***P<0.001.

Figure 4
OXTR myeloid lineage conditioned KO mice become more sensitive to DSS-induced colitis

To induce acute colitis, male OXTRmyel-KO mice and their wild-type OXTRmyel-WT littermates aged 8–10 weeks received 2.5% DSS dissolved in drinking water for 7 days. (A) Body weight change of OXTRmyel-KO and OXTRmyel-WT mice during the 7 days with or without DSS induction. (B) The lengths of the colons from different groups were statistically compared. (C) Representative disease activity index in each group based on body weight loss, stool consistence and hematochezia. (D) Representative H&E stained colonic section in each group (Scale bar: 100 μm). (E) Histological assessment of the indicated group. (F) The representative fluorescence intensity of FITC-dextran in the serum from each group. To induce chronic colitis, the OXTRmyel-WT, and OXTRmyel-KO mice underwent three cycles of 2% DSS treatment. (G) Body weight change of OXTRmyel-KO and OXTRmyel-WT mice during the 41 days with or without DSS induction. (H) The lengths of the colons from different groups were statistically compared on the day 41. (I) Representative disease activity index was valued on specific days in each group. (J) Body weight change of OXTRmyel-KO and OXTRmyel-WT mice during the 7-day DSS intervention with or without granulocytic depletion. Values are mean ± SEM of eight samples in each group and were compared by t-test. *P<0.05, **P<0.01, ***P<0.001.

OXTR myeloid-lineage defect causes macrophages to polarize into a pro-inflammatory phenotype in DSS colitis

Macrophages take a critical role in the pathogenesis of intestinal inflammation. Previous data showed that oxytocin could up-regulate the sensitivity of macrophages to IL-4 stimulation, but down-regulate the sensitivity to LPS stimulation. In order to confirm the hypothesis that oxytocin performed the same function in vivo, we investigated macrophage subpopulations in the LPMCs from both OXTRmyel-WT and OXTRmyel-KO mice after DSS treatment (n=8 in each group). The expression of IL-1β, IL-6 and iNOS mRNA was distinctly higher in OXTRmyel-KO than those in OXTRmyel-WT mice after the 7-day DSS administration (Figure 5A). We also investigated the M2-type macrophages infiltrating into colonic submucosal tissue during colitis by immunofluorescence. There were less CD206-positive cells recruited in the OXTRmyel-KO mice than those in OXTRmyel-WT mice after 7-day DSS treatment (Figure 5B). Consistently, the levels of CD206 and Arg1, hallmarks of M2 macrophages, were apparently lower in the LPMCs from OXTRmyel-KO mice (Figure 5A). Similarly, in chronic DSS-induced colitis, the LPMCs from OXTRmyel-KO mice expressed more IL-1β, IL-6, TNF-α and less CD206 (Figure 5C). Besides we used picrosirius red staining to evaluate the colitis-associated fibrosis in each group. There was no significant difference on the collagen deposition between OXTRmyel-WT and OXTRmyel-KO mice on the day 41 (Figure 5D,E). These results indicate that macrophages are more prone to M1-like polarization when the OXTRs on macrophages were knocked out during colitis. Human colonic specimens from patients with colonic neoplasms (n=6) and structural anomalies (n=1) were stimulated by LPS (100 ng ml−1) and human IFN-γ (20 ng ml−1) for 5 h with or without 40-min oxytocin preincubation and then LPMCs were isolated from each group. Oxytocin effectively inhibited the expression of inflammatory cytokine induced by LPS and IFN-γ in LPMC, such as IL-6, iNOS, and TNF-α. Besides, oxytocin also enhanced the transcription of CD206 (Figure 5F). In other words, oxytocin may ameliorate the symptoms of IBD by inducing macrophages to a more anti-inflammatory phenotype.

OXTR myeloid defect causes macrophages to polarize into a pro-inflammatory phenotype in DSS mice

Figure 5
OXTR myeloid defect causes macrophages to polarize into a pro-inflammatory phenotype in DSS mice

(A) The levels of IL-1β, IL-6, iNOS, Arg1, and CD206 mRNA of LPMCs from OXTRmyel-KO and OXTRmyel-WT mice induced by DSS for 7 days were measured by qRT-PCR. (B) Colonic tissue sections from the indicated groups were stained with anti-CD206 antibodies and DAPI, respectively, to detect macrophage subsets (Scale bar: 50 μm). (C) The levels of IL-1β, IL-6, TNF-α, Arg1, and CD206 mRNA of LPMCs from OXTRmyel-KO and OXTRmyel-WT mice induced by DSS for 41 days were measured by qRT-PCR. (D) Picrosirius red staining to evaluate collagen deposition in the colons of OXTRmyel-WT and OXTRmyel-KO mice after 41-day DSS treatment. (E) Mean optical density of collagen I and III. (F) Human colonic specimens were stimulated by LPS (100 ng ml−1) and human IFN-γ (20 ng ml−1) for 5 h with or without 40-min oxytocin preincubation and then LPMCs were isolated from each group. Oxytocin effectively inhibited the transcription of IL-6, iNOS, TNF-α and enhanced CD206 expression after LPS and IFN-γ stimulation in LPMC. Values are mean ± SEM of eight samples (For human LPMC, n=7) in each group and were compared by t-test. *P<0.05, **P<0.01, ***P<0.001.

Figure 5
OXTR myeloid defect causes macrophages to polarize into a pro-inflammatory phenotype in DSS mice

(A) The levels of IL-1β, IL-6, iNOS, Arg1, and CD206 mRNA of LPMCs from OXTRmyel-KO and OXTRmyel-WT mice induced by DSS for 7 days were measured by qRT-PCR. (B) Colonic tissue sections from the indicated groups were stained with anti-CD206 antibodies and DAPI, respectively, to detect macrophage subsets (Scale bar: 50 μm). (C) The levels of IL-1β, IL-6, TNF-α, Arg1, and CD206 mRNA of LPMCs from OXTRmyel-KO and OXTRmyel-WT mice induced by DSS for 41 days were measured by qRT-PCR. (D) Picrosirius red staining to evaluate collagen deposition in the colons of OXTRmyel-WT and OXTRmyel-KO mice after 41-day DSS treatment. (E) Mean optical density of collagen I and III. (F) Human colonic specimens were stimulated by LPS (100 ng ml−1) and human IFN-γ (20 ng ml−1) for 5 h with or without 40-min oxytocin preincubation and then LPMCs were isolated from each group. Oxytocin effectively inhibited the transcription of IL-6, iNOS, TNF-α and enhanced CD206 expression after LPS and IFN-γ stimulation in LPMC. Values are mean ± SEM of eight samples (For human LPMC, n=7) in each group and were compared by t-test. *P<0.05, **P<0.01, ***P<0.001.

OXT-OXTR signaling modulates macrophage polarization by inhibiting NF-κB and promoting STAT6 phosphorylation

The nuclear transcription factor NF-κB is indispensable for intestinal immune homeostasis. It is known that the release of proinflammatory mediators induced by LPS stimulation is predominantly regulated by NF-κB at transcriptional level [33]. It has been reported that the increase of phosphorylated NF-κB could cause macrophages to polarize toward M1 phenotype with enhanced expression of inflammatory cytokines and chemokines [34]. STAT 6 is mainly responsible for the polarization to M2 macrophages induced by IL-4 [35]. In our study, we investigated the effect of oxytocin on the phosphorylation of NF-κB and STAT6 during macrophage polarization. After stimulated by LPS for 1 h, the degree of p65 phosphorylation in peritoneal macrophages was higher than that of the control group. Oxytocin preincubation blocked the activation of p65 induced by LPS partly (Figure 6A). We used IL-4 to promote M2 polarization. The phosphorylation of STAT6 was enhanced when peritoneal macrophages were treated with IL-4 and oxytocin potentiated this effect (Figure 6B). Oxytocin alone had no effect on the phosphorylation of p65 and STAT6 (Supplementary Figure S4). We also extracted the colonic proteins from both OXTRmyel-KO and OXTRmyel-WT mice treated by 7-day DSS and found the expression of phosphorylated p65 in OXTRmyel-KO mice was higher than that in OXTRmyel-WT mice (Figure 6D). Therefore, our results demonstrate that oxytocin modulates the polarization of macrophages to a more anti-inflammatory phenotype primarily by inhibiting the LPS/NF-κB p65 signaling as well as promoting the IL-4/STAT6 signaling. However, the exactly underlying mechanisms are still unfathomed.

OXT-OXTR signaling modulates macrophage polarization by inhibiting NF-κB and promoting STAT6 phosphorylation

Figure 6
OXT-OXTR signaling modulates macrophage polarization by inhibiting NF-κB and promoting STAT6 phosphorylation

(A) Wild peritoneal macrophages were pretreated with oxytocin (10−8 M) for 50 min before treatment of LPS (100 ng ml−1) for 1 h. Effect of oxytocin on LPS-induced phosphorylation of p65, and the ratio of p-p65 to total p65 in each group were detected by Western blot. (B) Levels of phosphorylation of STAT6 in IL-4 (10 ng ml−1) induced peritoneal macrophages in the presence or absence of oxytocin (10−8 M) preincubation were measured by Western blot. The ratio of p-STAT6 to total STAT6 in each group was analyzed. (C) Levels of phosphorylation of p65 in DSS-induced OXTRmyel-KO and OXTRmyel-WT colonic tissue were measured by Western blot. Representative ratio of p-p65 to total p65 was calculated from indicated groups. (D) Levels of β-arrestin2 in DSS-induced OXTRmyel-KO and OXTRmyel-WT colonic tissue were measured by Western blot. Representative ratio of β-arrestin2 to GAPDH was calculated from indicated groups. Values are mean ± SEM of eight samples in each group and were compared by t-test or One-way ANOVA with Newman–Keuls for multiple comparisons. *P<0.05, **P<0.01, ***P<0.001 vs control (or WT-DSS) group. #P<0.05 vs LPS (or IL-4) group.

Figure 6
OXT-OXTR signaling modulates macrophage polarization by inhibiting NF-κB and promoting STAT6 phosphorylation

(A) Wild peritoneal macrophages were pretreated with oxytocin (10−8 M) for 50 min before treatment of LPS (100 ng ml−1) for 1 h. Effect of oxytocin on LPS-induced phosphorylation of p65, and the ratio of p-p65 to total p65 in each group were detected by Western blot. (B) Levels of phosphorylation of STAT6 in IL-4 (10 ng ml−1) induced peritoneal macrophages in the presence or absence of oxytocin (10−8 M) preincubation were measured by Western blot. The ratio of p-STAT6 to total STAT6 in each group was analyzed. (C) Levels of phosphorylation of p65 in DSS-induced OXTRmyel-KO and OXTRmyel-WT colonic tissue were measured by Western blot. Representative ratio of p-p65 to total p65 was calculated from indicated groups. (D) Levels of β-arrestin2 in DSS-induced OXTRmyel-KO and OXTRmyel-WT colonic tissue were measured by Western blot. Representative ratio of β-arrestin2 to GAPDH was calculated from indicated groups. Values are mean ± SEM of eight samples in each group and were compared by t-test or One-way ANOVA with Newman–Keuls for multiple comparisons. *P<0.05, **P<0.01, ***P<0.001 vs control (or WT-DSS) group. #P<0.05 vs LPS (or IL-4) group.

Oxytocin modulates the polarization of macrophages through OXTR-β-arrestin2 pathway

β-arrestin2, as a multi-functional scaffold that regulates G protein-coupled receptors (GPCR), is reported to be an endogenous regulator of NF-κB signaling in a G protein independent manner [36]. To explore the role of β-arrestin2 in the connection between OXT-OXTR system and NF-κB signaling, we detected the expression of β-arrestin2 after LPS or IL-4 stimulation in mouse RAW264.7 macrophages. The transcription and expression of β-arrestin2 decreased after LPS treatment. Oxytocin preincubation abrogated the down-regulation of β-arrestin2 induced by LPS (Figure 7A). On the contrary, IL-4 enhanced the expression of β-arrestin2, and oxytocin potentiated the effect of IL-4 (Figure 7B). These data indicate that β-arrestin2 might be involved in regulating the effect of OXTR on TLR4- or IL-4R-signaling. Then we used RNA interference to knock down the expression of β-arrestin2 in RAW264.7 cells to prove this hypothesis. After infected with shβ-arr2 lentivirus, the expression of β-arrestin2 in RAW264.7 cells significantly decreased compared with those infected with negative control lentivirus (Figure 7C). After shβ-arr2 lentivirus interference, LPS could still induce the expression of inflammatory cytokines, like IL-1β, IL-6, and TNF-α mRNA in RAW264.7 cells, but oxytocin pretreatment had no effect on LPS (Figure 7D). Similarly, shβ-arr2 lentivirus infection did not change the up-regulation of Arg1 and CD206 induced by IL-4 but abrogated the potentiation of oxytocin (Figure 7E). In shβ-arr2 lentivirus infected cells, LPS could still increase the phosphorylation of p65, but oxytocin lost the inhibitory effect (Figure 7F). Similarly, when β-arrestin2 was knocked down, oxytocin could no longer enhance the phosphorylation of STAT6 induced by IL-4 (Figure 7F). Consistently, the expression of β-arrestin2 in OXTRmyel-KO mice was lower than that in OXTRmyel-WT mice administrated with DSS for 7 days (Figure 6D). In conclusion, oxytocin regulates the macrophage polarization presumably through β-arrestin2 in the G protein non-dependent manner.

Oxytocin modulates the polarization of macrophages through OXTR-β-arrestin2 pathway

Figure 7
Oxytocin modulates the polarization of macrophages through OXTR-β-arrestin2 pathway

(A) RAW264.7 cells were pretreated with oxytocin (10−8 M) for 50 min before LPS (100 ng ml−1) for 24 h. β-arrestin2 was measured by Western blot (up) and qRT-PCR (down) assay. (B) RAW264.7 cells were pretreated with oxytocin (10−8 M) for 50 min before IL-4 (10 ng ml−1) treatment for 24 h. The expression of β-arrestin2 was measured by Western blot (up) and qRT-PCR (down) assay. (C) β-arrestin2 of RAW264.7 cells were knocked down by RNA interference, both in protein (up) and mRNA levels (down) (D) RAW264.7 cells were pretreated with negative or shβ-arr2 lentivirus to reduce endogenous β-arrestin2 expression. Then the infected cells were pretreated with oxytocin (10−8 M) for 50 min before LPS (100 ng ml−1) for 24 h. The levels of IL-1β, IL-6, and TNF-α mRNA were measured by qRT-PCR. (E) RAW264.7 cells were pretreated with negative or shβ-arr2 lentivirus and then the infected cells were pretreated with oxytocin (10−8 M) for 50 min before IL-4 (10 ng ml−1) for 24 h. The levels of Arg1, and CD206 mRNA were measured by qRT-PCR. (F) Effects of oxytocin on the LPS-induced phosphorylation of p65 (left) and IL-4 induced phosphorylation of STAT6 (right) in RAW264.7 cells pretreated with shβ-arr2 lentivirus were analyzed by Western blot. Values are mean ± SEM of six or eight samples and were compared by One-way ANOVA with Newman–Keuls for multiple comparisons. *P<0.05, **P<0.01, ***P<0.001 vs control group. #P<0.05, ##P<0.01, ###P<0.001 vs LPS (or IL-4) group.

Figure 7
Oxytocin modulates the polarization of macrophages through OXTR-β-arrestin2 pathway

(A) RAW264.7 cells were pretreated with oxytocin (10−8 M) for 50 min before LPS (100 ng ml−1) for 24 h. β-arrestin2 was measured by Western blot (up) and qRT-PCR (down) assay. (B) RAW264.7 cells were pretreated with oxytocin (10−8 M) for 50 min before IL-4 (10 ng ml−1) treatment for 24 h. The expression of β-arrestin2 was measured by Western blot (up) and qRT-PCR (down) assay. (C) β-arrestin2 of RAW264.7 cells were knocked down by RNA interference, both in protein (up) and mRNA levels (down) (D) RAW264.7 cells were pretreated with negative or shβ-arr2 lentivirus to reduce endogenous β-arrestin2 expression. Then the infected cells were pretreated with oxytocin (10−8 M) for 50 min before LPS (100 ng ml−1) for 24 h. The levels of IL-1β, IL-6, and TNF-α mRNA were measured by qRT-PCR. (E) RAW264.7 cells were pretreated with negative or shβ-arr2 lentivirus and then the infected cells were pretreated with oxytocin (10−8 M) for 50 min before IL-4 (10 ng ml−1) for 24 h. The levels of Arg1, and CD206 mRNA were measured by qRT-PCR. (F) Effects of oxytocin on the LPS-induced phosphorylation of p65 (left) and IL-4 induced phosphorylation of STAT6 (right) in RAW264.7 cells pretreated with shβ-arr2 lentivirus were analyzed by Western blot. Values are mean ± SEM of six or eight samples and were compared by One-way ANOVA with Newman–Keuls for multiple comparisons. *P<0.05, **P<0.01, ***P<0.001 vs control group. #P<0.05, ##P<0.01, ###P<0.001 vs LPS (or IL-4) group.

Discussion

Our current study demonstrated that in vitro, oxytocin reduced LPS-induced M1 polarization with impaired expression of inflammatory cytokines and chemokines, but promoted IL-4-induced M2 polarization with a significant increase of expressions of M2 hallmarks, including CD206, Arg1, and Chil3. The OXTR-deficient peritoneal macrophages exerted diminished anti-inflammatory characteristic and enhanced proinflammatory phenotype. For the first time, we demonstrated that oxytocin was directly involved in the modulation of M1/M2 polarization status. Consistent with findings in vitro, OXTR macrophage deficient mice were more susceptible to DSS colitis compared with wild-type mice. The colonic macrophages in OXTR conditioned knockout mice stimulated by DSS exhibited enhanced proinflammatory properties with higher levels of IL-1β, IL-6, and iNOS, as well as lower levels of CD206 and Arg1. The anti-inflammatory effect of oxytocin functioned mainly by strengthening the expression of β-arrestin2, leading to the down-regulation of NF-κB and up-regulation of STAT6 signaling in a GPCR independent manner (Figure 8). β-arrestin2 might become a potential target for the intervention of IBD.

Proposed mechanisms for oxytocin-modulated macrophage polarization

Figure 8
Proposed mechanisms for oxytocin-modulated macrophage polarization

Oxytocin released from enteric nervous system (ENS) activates β-arrestin2 in macrophages, and inhibits LPS-induced M1-like polarization with impaired expression of inflammatory cytokines and chemokines, as well as promotes IL-4-induced M2-like polarization with increased expressions of M2 hallmarks. This is modulated by the down-regulation of NF-κB and up-regulation of STAT6 signaling.

Figure 8
Proposed mechanisms for oxytocin-modulated macrophage polarization

Oxytocin released from enteric nervous system (ENS) activates β-arrestin2 in macrophages, and inhibits LPS-induced M1-like polarization with impaired expression of inflammatory cytokines and chemokines, as well as promotes IL-4-induced M2-like polarization with increased expressions of M2 hallmarks. This is modulated by the down-regulation of NF-κB and up-regulation of STAT6 signaling.

The gut is one of the largest immune organs in the body, which consists of innate and adaptive immune cells and macrophages are one of the most abundant innate immune cells [37]. Intestinal macrophages are continuously replaced by bone marrow-derived monocytes and embryonic precursors might also contribute to the maintaining of resident macrophage populations [6,38]. Challenges such as bacterial translocation or tissue damage will result in the recruitment of highly plastic monocytes from peripheral blood circulation and differentiate to M1-like macrophages in response to the inflammation in gut [39]. The recruited M1-like macrophages produce large amounts of pro-inflammatory cytokines, such as IL-1β, IL-6, TNF-α, and reactive oxygen species, resulting in inflammation amplification, tissue damage, killing of intracellular microbes and promoting Th1/Th17 immune response [40]. The unbalanced production of proinflammatory mediators contributes to the pathogenesis of IBD. Though the population of M1-like macrophages predominates during colitis, there are still M2-like macrophages maintaining the immune homeostasis, promoting the integrity of the epithelium, and producing IL-10 to facilitate the expansion of the regulatory T cells [7]. The specific factors that lead colonic macrophages to polarize to an anti-inflammatory phenotype are not currently understood, but it may be a result from the interaction with IL-10 signaling, TLR-4 signaling, the gut microflora and the intestinal epithelial cells [41]. Regulation of the balance between M1- and M2-like macrophages is critical to the progression of IBD. Several studies suggested that increasing the proportion of colonic M2 macrophages could reduce intestinal inflammation [42,43]. Oxytocin, as a crucial neuroimmunomodulator, could inhibit the transcription of TNF-α in macrophages induced by LPS [17]. But the connection between oxytocin and the M2 polarization was still ambiguous. To the best of our knowledge, our study is the first to report oxytocin promoted polarization of macrophages to a more anti-inflammatory phenotype with enhanced expression of CD206, Arg1, and Chil3.

It is worth mentioning that we found the anti-inflammatory effect of oxytocin on macrophages functioned mainly by enhancing the expression of β-arrestin2, leading to the down-regulation of NF-κB signaling in the absence of G protein activation. As is known, NF-κB family is the most popular player in innate immunity and involved in the polarization of macrophages closely. When LPS binds to TLR4, TRIF- and MyD88-dependent pathway are activated and many other bridging inducers are recruited to induce the degradation of the inhibitor of NF-κB (IκBα) and activation of NF-κB. The activated NF-κB translocates into the nucleus and binds to the promotors of large amounts of inflammatory genes, such as IL-1β, IL-6, iNOS, and ROS, which lead macrophages to M1 polarization [44]. Although molecular mechanisms involved in the modulation of M2 polarization are poorly understood, IL-4-induced STAT6 activation is playing a critical role in the expression of large amounts of genes during M2 polarization and STAT6 signaling shows extensive overlap with NF-κB pathway in modulating the polarization of macrophages [45].In this article, we revealed that oxytocin could regulate the anti-inflammatory polarization of macrophages through inhibiting the LPS/NF-κB as well as reinforcing IL-4/STAT6 signaling.

Based on the published data, β-arrestins are ubiquitously expressed, and canonically act on the GPCR desensitization and internalization. Recently, the uncanonical function of β-arrestins, serving as signal transduction scaffolds for numerous pathways, has come to light [46]. Jiang et al. [47] have found that β-arrestin2 attenuated LPS-induced liver injury by inhibiting TLR4/NF-κB pathway. β-arrestin2 was also involved in macrophages to modulate the enhanced inflammatory response during myocardial infarction, indicating β-arrestin2 might have a role in the M2 transition [48]. Gao et al. [49] also observed that β-arrestin2 directly interacted with IκBα to modulate the activation of NF-κB. β-arrestin2, as an important negative regulator of inflammatory cascade, might become an indispensable intermediate between OXT-OXTR system and NF-κB signaling in macrophages. In our research, we observed that β-arrestin2 participated in the modulation of p65 or STAT6 phosphorylation induced by LPS or IL-4 after the activation of OXTR. The discovery that β-arrestin2 is involved in regulating macrophage polarization is extremely innovative and attractive. The last but not the least, further researches are urgently desired to explore the underlying mechanisms accurately.

Consistent with the findings in vitro, we first established OXTR macrophage-deficient mice and found those conditionally deficient mice were more susceptible to DSS intervention and had a lower percentage of M2-like macrophages in the colon compared with the wild-type mice. When OXTRs were conditionally deleted on macrophages, the colonic macrophages stimulated by DSS showed enhanced proinflammatory properties with higher levels of IL-1β, IL-6 and iNOS, and lower levels of CD206 and Arg1. Therefore, regulation of the intestinal macrophages balance is a potential target for IBD intervention. Numerous researches revealed that oxytocin exerted anti-inflammatory effect in different organs [17,50]. In the intestine, oxytocin is produced by the enteric nervous system (ENS) and the concentration of oxytocin increases in the serum and colon during colitis (Supplementary Figure S5). Szeto et al. [51] found that under inflammatory stimulation, the expression of OXTRs increased in cultured human and mouse macrophages, responding as an acute phase protein. In the early phase of sepsis, the level of oxytocin in plasma is up-regulated, which diminishes the release of TNF-α, IL-1β, and nitrite in macrophages. Our previous studies demonstrated that oxytocin administrated by intraperitoneal injection alleviated DSS-induced colitis in mice by triggering prostaglandin E2 (PGE2) release of intestine epithelial cells [15]. Welch et al. [14] also reported that the OXTR-deficient mice were more susceptible to TNBS- and DSS-associated colitis compared with their wild littermates according to clinical and histological damage scores. This was mainly caused by the increased macromolecular permeability of the GI mucosa, although the underlying mechanism was unknown. All the findings above indicated that oxytocin contributed to the elimination of inflammation and restoration of the intestinal homeostasis. As illustrated above, we hypothesize there exists a bidirectional interaction between macrophages and the oxytocinergic neurons in the intestine. Oxytocin, as the interplay between the ENS and the intestinal immune system, especially the macrophages, participates in monitoring the intestinal homeostasis and might become an intriguing therapeutic target for relieving immune diseases and injuries.

In conclusion, oxytocin and its receptors participate in the polarization of macrophages to a more anti-inflammatory phenotype during inflammation, and could have implications for the treatment of IBD.

Clinical perspectives

  • The phenotypes of macrophages differ depending on the microenvironment and make a difference in the progression of IBD. Oxytocin, as an intestinal neuropeptide, is reported to have a role in alleviating colitis. But the exactly mechanisms are still unclear. Here, we investigated if oxytocin and OXTR were involved in modulating the polarization of intestinal macrophages to cure IBD and the underlying mechanisms.

  • Our ex vivo and in vivo experiments demonstrated that oxytocin was directly involved in the modulation of M1/M2 polarization status. The anti-inflammatory effect of oxytocin functioned mainly by strengthening the expression of β-arrestin2, leading to the down-regulation of NF-κB and up-regulation of STAT6 signaling in a GPCR independent manner.

  • Oxytocin might become an important neuroimmunomodulator for the bidirectional regulation between ENS and gut immune system and have implications for the treatment of IBD.

Acknowledgments

We thank Dr. Chunhong Ma for critical reading of the manuscript, and Dr. Shangming Liu for kindly donating the LysM-Cre transgenic mice.

Author Contribution

Study concept: CL, YT, and JL. Experiment design and data acquisition: YT, YS, YG, and XX. YT, TH, XX, CL, and JL contributed to the analysis, interpretation of data and drafting the manuscript. Supervising the study and obtaining funding: CL.

Funding

This work was supported by grants from the National Scientific Foundation of China [grant numbers NSFC31471098 and 31671191].

Competing Interests

The authors declare that there are no competing interests associated with the manuscript.

Abbreviations

     
  • Arg1

    arginase1

  •  
  • CCL

    C–C motif chemokine ligand

  •  
  • CD

    cluster of differentiation

  •  
  • CXCL

    C-X-C motif chemokine

  •  
  • Chil3

    chitinase-like 3

  •  
  • DSS

    dextran sulfate sodium

  •  
  • ENS

    enteric neuron system

  •  
  • FBS

    fetal bovine serum

  •  
  • GPCR

    G protein-coupled receptor

  •  
  • HBSS

    Hanks’ balanced salt solution

  •  
  • IBD

    inflammatory bowel disease

  •  
  • IFN-γ

    interferon-γ

  •  
  • IκBα

    inhibitor of NF-κB

  •  
  • IL

    interleukin

  •  
  • iNOS

    inducible nitric oxide synthase

  •  
  • LPMC

    lamina propria mononuclear cell

  •  
  • LPS

    lipopolysaccharide

  •  
  • OXTR

    oxytocin receptor

  •  
  • OXTRmyel-KO

    myeloid-specific OXTR knockout mice

  •  
  • OXTRmyel-WT

    myeloid-specific OXTR wild-type control

  •  
  • PM

    peritoneal macrophages

  •  
  • PMA

    phorbol 12-myristate 13-acetate

  •  
  • shβ-arr2

    β-arrestin2 shRNA

  •  
  • STAT6

    signal transducer and activator of transcription 6

  •  
  • TGF-β

    transforming growth factor β

  •  
  • TNF-α

    tumor necrosis factor α

References

References
1.
Abraham
C.
and
Cho
J.H.
(
2009
)
Inflammatory bowel disease
.
N. Engl. J. Med.
361
,
2066
2078
[PubMed]
2.
Burisch
J.
and
Munkholm
P.
(
2015
)
The epidemiology of inflammatory bowel disease
.
Scand. J. Gastroenterol.
50
,
942
951
[PubMed]
3.
Ananthakrishnan
A.N.
(
2015
)
Epidemiology and risk factors for IBD
.
Nat. Rev. Gastroenterol. Hepatol.
12
,
205
217
[PubMed]
4.
Geremia
A.
,
Biancheri
P.
,
Allan
P.
,
Corazza
G.R.
and
Di Sabatino
A.
(
2014
)
Innate and adaptive immunity in inflammatory bowel disease
.
Autoimmun. Rev.
13
,
3
10
[PubMed]
5.
Mills
C.D.
,
Kincaid
K.
,
Alt
J.M.
,
Heilman
M.J.
and
Hill
A.M.
(
2000
)
M-1/M-2 macrophages and the Th1/Th2 paradigm
.
J. Immunol.
164
,
6166
6173
[PubMed]
6.
De Schepper
S.
,
Verheijden
S.
,
Aguilera-Lizarraga
J.
,
Viola
M.F.
,
Boesmans
W.
,
Stakenborg
N.
et al. .
(
2018
)
Self-Maintaining gut macrophages are essential for intestinal homeostasis
.
Cell
175
,
400e13
415e13
7.
Gordon
S.
and
Martinez
F.O.
(
2010
)
Alternative activation of macrophages: mechanism and functions
.
Immunity
32
,
593
604
[PubMed]
8.
Weidenbusch
M.
and
Anders
H.J.
(
2012
)
Tissue microenvironments define and get reinforced by macrophage phenotypes in homeostasis or during inflammation, repair and fibrosis
.
J. Innate Immun.
4
,
463
477
[PubMed]
9.
Gimpl
G.
and
Fahrenholz
F.
(
2001
)
The oxytocin receptor system: structure, function, and regulation
.
Physiol. Rev.
81
,
629
683
[PubMed]
10.
Graf
G.C.
(
1969
)
Ejection of milk in relation to levels of oxytocin injected intramuscularly
.
J. Dairy Sci.
52
,
1003
1007
[PubMed]
11.
Kosfeld
M.
,
Heinrichs
M.
,
Zak
P.J.
,
Fischbacher
U.
and
Fehr
E.
(
2005
)
Oxytocin increases trust in humans
.
Nature
435
,
673
676
[PubMed]
12.
Ndiaye
K.
,
Poole
D.H.
and
Pate
J.L.
(
2008
)
Expression and regulation of functional oxytocin receptors in bovine T lymphocytes
.
Biol. Reprod.
78
,
786
793
[PubMed]
13.
Li
T.
,
Wang
P.
,
Wang
S.C.
and
Wang
Y.F.
(
2016
)
Approaches mediating oxytocin regulation of the immune system
.
Front. Immunol.
7
,
693
[PubMed]
14.
Welch
M.G.
,
Tamir
H.
,
Gross
K.J.
,
Chen
J.
,
Anwar
M.
and
Gershon
M.D.
(
2009
)
Expression and developmental regulation of oxytocin (OT) and oxytocin receptors (OTR) in the enteric nervous system (ENS) and intestinal epithelium
.
J. Comp. Neurol.
512
,
256
270
[PubMed]
15.
Chen
D.
,
Zhao
J.
,
Wang
H.
,
An
N.
,
Zhou
Y.
,
Fan
J.
et al. .
(
2015
)
Oxytocin evokes a pulsatile PGE2 release from ileum mucosa and is required for repair of intestinal epithelium after injury
.
Sci. Rep.
5
,
11731
[PubMed]
16.
Szeto
A.
,
Nation
D.A.
,
Mendez
A.J.
,
Dominguez-Bendala
J.
,
Brooks
L.G.
,
Schneiderman
N.
et al. .
(
2008
)
Oxytocin attenuates NADPH-dependent superoxide activity and IL-6 secretion in macrophages and vascular cells
.
Am. J. Physiol. Endocrinol. Metab.
295
,
E1495
501
[PubMed]
17.
Garrido-Urbani
S.
,
Deblon
N.
,
Poher
A.L.
,
Caillon
A.
,
Ropraz
P.
,
Rohner-Jeanrenaud
F.
et al. .
(
2017
)
Inhibitory role of oxytocin on TNFalpha expression assessed in vitro and in vivo
.
Diabetes Metab.
44
,
292
295
18.
Ray
A.
and
Dittel
B.N.
(
2010
)
Isolation of mouse peritoneal cavity cells
.
J. Vis. Exp.
35
, 1488
19.
Li
M.
,
Zhang
L.
,
Cai
R.L.
,
Gao
Y.
and
Qi
Y.
(
2012
)
Lipid-soluble extracts from Salvia miltiorrhiza inhibit production of LPS-induced inflammatory mediators via NF-kappaB modulation in RAW 264.7 cells and perform antiinflammatory effects in vivo
.
Phytother. Res.
26
,
1195
1204
[PubMed]
20.
Li
B.
,
Alli
R.
,
Vogel
P.
and
Geiger
T.L.
(
2014
)
IL-10 modulates DSS-induced colitis through a macrophage-ROS-NO axis
.
Mucosal. Immunol.
7
,
869
878
[PubMed]
21.
Castaneda
F.E.
,
Walia
B.
,
Vijay-Kumar
M.
,
Patel
N.R.
,
Roser
S.
,
Kolachala
V.L.
et al. .
(
2005
)
Targeted deletion of metalloproteinase 9 attenuates experimental colitis in mice: central role of epithelial-derived MMP
.
Gastroenterology
129
,
1991
2008
[PubMed]
22.
Lenzen
H.
,
Qian
J.
,
Manns
M.P.
,
Seidler
U.
and
Jorns
A.
(
2018
)
Restoration of mucosal integrity and epithelial transport function by concomitant anti-TNFalpha treatment in chronic DSS-induced colitis
.
J. Mol. Med. (Berl.)
96
,
831
843
[PubMed]
23.
Chassaing
B.
,
Aitken
J.D.
,
Malleshappa
M.
and
Vijay-Kumar
M.
(
2014
)
Dextran sulfate sodium (DSS)-induced colitis in mice
.
Curr. Protoc. Immunol.
104
,
Unit 15 25
[PubMed]
24.
Wirtz
S.
,
Popp
V.
,
Kindermann
M.
,
Gerlach
K.
,
Weigmann
B.
,
Fichtner-Feigl
S.
et al. .
(
2017
)
Chemically induced mouse models of acute and chronic intestinal inflammation
.
Nat. Protoc.
12
,
1295
1309
[PubMed]
25.
Jo
H.
,
Eom
Y.W.
,
Kim
H.S.
,
Park
H.J.
,
Kim
H.M.
and
Cho
M.Y.
(
2018
)
Regulatory dendritic cells induced by mesenchymal stem cells ameliorate dextran sodium sulfate-induced chronic colitis in mice
.
Gut. Liver
12
,
664
673
[PubMed]
26.
Zaki
M.H.
,
Boyd
K.L.
,
Vogel
P.
,
Kastan
M.B.
,
Lamkanfi
M.
and
Kanneganti
T.D.
(
2010
)
The NLRP3 inflammasome protects against loss of epithelial integrity and mortality during experimental colitis
.
Immunity
32
,
379
391
[PubMed]
27.
Gonzalez-Rey
E.
and
Delgado
M.
(
2006
)
Therapeutic treatment of experimental colitis with regulatory dendritic cells generated with vasoactive intestinal peptide
.
Gastroenterology
131
,
1799
1811
[PubMed]
28.
Hart
A.L.
,
Al-Hassi
H.O.
,
Rigby
R.J.
,
Bell
S.J.
,
Emmanuel
A.V.
,
Knight
S.C.
et al. .
(
2005
)
Characteristics of intestinal dendritic cells in inflammatory bowel diseases
.
Gastroenterology
129
,
50
65
[PubMed]
29.
Randall
K.J.
,
Turton
J.
and
Foster
J.R.
(
2011
)
Explant culture of gastrointestinal tissue: a review of methods and applications
.
Cell Biol. Toxicol.
27
,
267
284
[PubMed]
30.
Ahn
S.
,
Nelson
C.D.
,
Garrison
T.R.
,
Miller
W.E.
and
Lefkowitz
R.J.
(
2003
)
Desensitization, internalization, and signaling functions of beta-arrestins demonstrated by RNA interference
.
Proc. Natl. Acad. Sci. U.S.A.
100
,
1740
1744
[PubMed]
31.
Welch
M.G.
,
Margolis
K.G.
,
Li
Z.
and
Gershon
M.D.
(
2014
)
Oxytocin regulates gastrointestinal motility, inflammation, macromolecular permeability, and mucosal maintenance in mice
.
Am. J. Physiol. Gastrointest. Liver Physiol.
307
,
G848
62
[PubMed]
32.
Clausen
B.E.
,
Burkhardt
C.
,
Reith
W.
,
Renkawitz
R.
and
Forster
I.
(
1999
)
Conditional gene targeting in macrophages and granulocytes using LysMcre mice
.
Transgenic Res.
8
,
265
277
[PubMed]
33.
Lawrence
T.
,
Bebien
M.
,
Liu
G.Y.
,
Nizet
V.
and
Karin
M.
(
2005
)
IKKalpha limits macrophage NF-kappaB activation and contributes to the resolution of inflammation
.
Nature
434
,
1138
1143
[PubMed]
34.
Wang
N.
,
Liang
H.
and
Zen
K.
(
2014
)
Molecular mechanisms that influence the macrophage m1-m2 polarization balance
.
Front. Immunol.
5
,
614
[PubMed]
35.
Hebenstreit
D.
,
Wirnsberger
G.
,
Horejs-Hoeck
J.
and
Duschl
A.
(
2006
)
Signaling mechanisms, interaction partners, and target genes of STAT6
.
Cytokine Growth Factor Rev.
17
,
173
188
[PubMed]
36.
Noh
H.
,
Yu
M.R.
,
Kim
H.J.
,
Lee
J.H.
,
Park
B.W.
,
Wu
I.H.
et al. .
(
2017
)
Beta 2-adrenergic receptor agonists are novel regulators of macrophage activation in diabetic renal and cardiovascular complications
.
Kidney Int.
92
,
101
113
[PubMed]
37.
Lee
S.H.
,
Starkey
P.M.
and
Gordon
S.
(
1985
)
Quantitative analysis of total macrophage content in adult mouse tissues. Immunochemical studies with monoclonal antibody F4/80
.
J. Exp. Med.
161
,
475
489
[PubMed]
38.
Bain
C.C.
,
Scott
C.L.
,
Uronen-Hansson
H.
,
Gudjonsson
S.
,
Jansson
O.
,
Grip
O.
et al. .
(
2013
)
Resident and pro-inflammatory macrophages in the colon represent alternative context-dependent fates of the same Ly6Chi monocyte precursors
.
Mucosal. Immunol.
6
,
498
510
[PubMed]
39.
Yona
S.
,
Kim
K.W.
,
Wolf
Y.
,
Mildner
A.
,
Varol
D.
,
Breker
M.
et al. .
(
2013
)
Fate mapping reveals origins and dynamics of monocytes and tissue macrophages under homeostasis
.
Immunity
38
,
79
91
[PubMed]
40.
Ohashi
W.
,
Hattori
K.
and
Hattori
Y.
(
2015
)
Control of macrophage dynamics as a potential therapeutic approach for clinical disorders involving chronic inflammation
.
J. Pharmacol. Exp. Ther.
354
,
240
250
[PubMed]
41.
Isidro
R.A.
and
Appleyard
C.B.
(
2016
)
Colonic macrophage polarization in homeostasis, inflammation, and cancer
.
Am. J. Physiol. Gastrointest. Liver Physiol.
311
,
G59
G73
[PubMed]
42.
Arranz
A.
,
Doxaki
C.
,
Vergadi
E.
,
Martinez de la Torre
Y.
,
Vaporidi
K.
,
Lagoudaki
E.D.
et al. .
(
2012
)
Akt1 and Akt2 protein kinases differentially contribute to macrophage polarization
.
Proc. Natl. Acad. Sci. U.S.A.
109
,
9517
9522
[PubMed]
43.
Enderlin Vaz da Silva
Z.
,
Lehr
H.A.
and
Velin
D.
(
2014
)
In vitro and in vivo repair activities of undifferentiated and classically and alternatively activated macrophages
.
Pathobiology
81
,
86
93
[PubMed]
44.
Lawrence
T.
and
Natoli
G.
(
2011
)
Transcriptional regulation of macrophage polarization: enabling diversity with identity
.
Nat. Rev. Immunol.
11
,
750
761
[PubMed]
45.
Shen
C.H.
and
Stavnezer
J.
(
1998
)
Interaction of stat6 and NF-kappaB: direct association and synergistic activation of interleukin-4-induced transcription
.
Mol. Cell. Biol.
18
,
3395
3404
[PubMed]
46.
Pierce
K.L.
and
Lefkowitz
R.J.
(
2001
)
Classical and new roles of beta-arrestins in the regulation of G-protein-coupled receptors
.
Nat. Rev. Neurosci.
2
,
727
733
[PubMed]
47.
Jiang
M.P.
,
Xu
C.
,
Guo
Y.W.
,
Luo
Q.J.
,
Li
L.
,
Liu
H.L.
et al. .
(
2018
)
beta-arrestin 2 attenuates lipopolysaccharide-induced liver injury via inhibition of TLR4/NF-kappaB signaling pathway-mediated inflammation in mice
.
World J. Gastroenterol.
24
,
216
225
[PubMed]
48.
Watari
K.
,
Nakaya
M.
,
Nishida
M.
,
Kim
K.M.
and
Kurose
H.
(
2013
)
beta-arrestin2 in infiltrated macrophages inhibits excessive inflammation after myocardial infarction
.
PLoS ONE
8
,
e68351
[PubMed]
49.
Gao
H.
,
Sun
Y.
,
Wu
Y.
,
Luan
B.
,
Wang
Y.
,
Qu
B.
et al. .
(
2004
)
Identification of beta-arrestin2 as a G protein-coupled receptor-stimulated regulator of NF-kappaB pathways
.
Mol. Cell
14
,
303
317
[PubMed]
50.
Iseri
S.O.
,
Gedik
I.E.
,
Erzik
C.
,
Uslu
B.
,
Arbak
S.
,
Gedik
N.
et al. .
(
2008
)
Oxytocin ameliorates skin damage and oxidant gastric injury in rats with thermal trauma
.
Burns
34
,
361
369
[PubMed]
51.
Szeto
A.
,
Sun-Suslow
N.
,
Mendez
A.J.
,
Hernandez
R.I.
,
Wagner
K.V.
and
McCabe
P.M.
(
2017
)
Regulation of the macrophage oxytocin receptor in response to inflammation
.
Am. J. Physiol. Endocrinol. Metab.
312
,
E183
E189
[PubMed]

Supplementary data