Abstract

Ubiquitin-specific peptidase 4 (USP4) protein is a type of deubiquitination enzyme that is correlated with many important biological processes. However, the function of USP4 in hepatic ischaemia/reperfusion (I/R) injury remains unknown. The aim of the present study was to explore the role of USP4 in hepatic I/R injury. USP4 gene knockout mice and primary hepatocytes were used to construct hepatic I/R models. The effect of USP4 on hepatic I/R injury was examined via pathological and molecular analyses. Our results indicated that USP4 was significantly up-regulated in liver of mice subjected to hepatic I/R injury. USP4 knockout mice exhibited exacerbated hepatic I/R injury, as evidenced by enhanced liver inflammation via the nuclear factor κB (NF-κB) signalling pathway and increased hepatocyte apoptosis. Additionally, USP4 overexpression inhibited hepatocyte inflammation and apoptosis on hepatic I/R stimulation. Mechanistically, our study demonstrates that USP4 deficiency exerts its detrimental effects on hepatic I/R injury by inducing activation of the transforming growth factor β-activated kinase 1 (TAK1)/JNK signalling pathways. TAK1 was required for USP4 function in hepatic I/R injury as TAK1 inhibition abolished USP4 function in vitro. In conclusion, our study demonstrates that USP4 deficiency plays a detrimental role in hepatic I/R injury by promoting activation of the TAK1/JNK signalling pathways. Modulation of this axis may be a novel strategy to alleviate the pathological process of hepatic I/R injury.

Introduction

Ischaemia/reperfusion (I/R) is a pathological condition characterized by an initial restriction of blood supply to an organ followed by subsequent restoration of perfusion and concomitant reoxygenation. I/R injury is a major challenge during liver transplantation (LT) [1]. Liver dysfunction and failure are serious post-operative complications that may ensue as a result of reperfusion injury.

Many biological processes are implicated in I/R injury, including cell death programmes, autoimmunity, innate and adaptive immune activation and transcriptional reprogramming [2,3]. An excessive inflammatory response and cell apoptosis are clearly recognized as two key mechanisms of injury during reperfusion [4]. Tissue ischaemia and oxidative stress activate families of protein kinases that converge on specific transcriptional factors that regulate the expression of inflammatory genes. This initial local inflammation is further amplified by the recruitment of circulating leukocytes, which appear to be key effector cells in cell apoptosis induction and tissue injury. Based on these observations, targeting inflammatory responses and cell death is a promising strategy for treatment of hepatic I/R injury [5,6].

The ubiquitin-specific peptidase (USP) protein family comprises deubiquitination enzymes and was first discovered in 1991 [7]. The amino terminus of USP contains a ZF domain and DUSP domain. The ZF domain is responsible for binding with ubiquitin protein. The carboxyl terminus contains the catalytic function domain, which has a conserved cysteine sequence, and its mutation leads to loss of the deubiquitination enzyme activity [8]. USP4 belongs to a member of the USP family. In different cells, USP4 protein is inconsistently localized and can be found in both the cytoplasm and nucleus. USP4 localisation is controlled by the existence of a nuclear positioning sequence and exonuclear sequence in USP4, which allow travel between the cytoplasm and nucleus under certain conditions [9,10]. Current studies have shown that USP4 primarily plays roles in inhibiting the inflammatory response, the anti-virus response, non-alcoholic fatty liver disease and promoting tumour formation [11–15]. USP4 serves as a critical control to down-regulate tumour necrosis factor α (TNF-α), IL-1β-, LPS- and TGFβ-induced nuclear factor κB (NF-κB) activation and inflammation [16]. These inflammatory factors are up-regulated to promote NF-κB activation in liver IRI [17]. However, the function of USP4 in hepatic I/R injury was largely unknown.

In the present study, we delineated the role and mechanism of USP4 in hepatic I/R injury. We used USP4 knockout mice and primary hepatocytes to simulate the hepatic I/R process in vivo and in vitro and evaluated the effect of UPS4 on I/R induced liver damage.

Materials and methods

Reagents

Antibodies against USP4 (2651), Ikkβ (8943), p-p65 (3033), p65 (4764), IkBα (4814), Bax (2772), Bcl2 (3498), Bid (2003), p-ERK (4370), ERK (4695), p-JNK (4668), JNK (9252), p-p38 (4511), p38 (9212), p-TAK1 (4531), TAK1 (4505), p-ASK1 (3765) and GAPDH (2118) were purchased from Cell Signaling Technology. Antibody against p-Ikkβ was purchased from Abcam (ab59195). Antibody against ASK1 was purchased from GeneTex (GTX107921). Antibody against p-MEKK1 was purchased from Santa Cruz Biotechnology (Sc130202). Antibody against MEKK1 was purchased from Proteintech (19970-1-AP). Antibody against Ly6g was purchased from BD Biosciences (551459). Goat anti-mouse (115-035-003) and goat anti-rabbit (111-035-003) secondary antibodies were purchased from Jackson Laboratory. A BCA protein assay kit was purchased from Pierce. Foetal calf serum was obtained from HyClone. Cell culture reagents and all other reagents were obtained from Sigma.

Animal models and procedures

USP4 gene knockout mice were generated according to the protocol [18]. Animals were maintained in accordance with Animal Experiment Center of Wuhan University standard guidelines. The study was approved by ethics committee of Renmin Hospital of Wuhan University. We conducted experiments following the National Institutes of Health guide for the care and use of laboratory animals. Mice were kept in an air-filtered, temperature-controlled (22–24°C), humidity-controlled (between 40 and 70%), and light-controlled room and were permitted free access to a standard diet.

Mouse hepatic I/R injury model

The mouse hepatic I/R injury model was constructed according to the classical method with little modification [18]. Mice were fasted for 12 h before surgery and given free access to drinking water. The mice were anaesthetized with 3% pentobarbital sodium before the operation, their limbs were fixed in a horizontal position and the hair of the abdominal area was shaved. The surgical area was disinfected with 10% iodine and 75% ethanol.

A ventral midline incision was made into the abdomen to expose the hepatic pedicles of the left and middle lobe of the liver. The portal vein and hepatic artery of the middle and left lobes were blocked with non-invasive vascular clamps, resulting in approximately 70% hepatic ischaemia to prevent severe mesenteric vein congestion. After 0.5 min, compared with the non-blocked right lobe, the blocked lobes turned white, indicating successful blood flow blockage. Then, the ischaemia was initiated and maintained for 60 min. No hepatic blood flow blockage was performed in Sham group mice. After ischaemia, the vascular clamps were removed, and the hepatic blood flow was restored. After the abdominal cavity was closed and sutured, the post-operative mice were placed in a clean cage and housed separately for observation.

Sampling: mice were taken from the Sham operation group (Sham group) and I/R group at 6 and 24 h after surgery and anaesthetized with 3% pentobarbital sodium. Then, 1 ml of blood was taken from the orbital venous plexus, and serum was isolated. At the same time, the middle hepatic lobes were collected and frozen in liquid nitrogen, left hepatic lobe was fixed in 10% formalin medium for 24 h, dehydrated, embedded and prepared into paraffin sections.

Serum biochemical analysis

Serum alanine aminotransferase (ALT) and serum aspartate aminotransferase (AST) in the serum were detected with an ADVIA 2400 biochemical analyser (Siemens, Tarrytown, NY, U.S.A.). The inflammation markers TNF-α, CCL2 and Cxcl10 in the serum were measured according to standard procedure recommended by the kit manufacturers’ (Murine TNF-α Standard TMB ELISA Development Kit, Peprotech, 900-T54; Mouse CCL2 Quantikine ELISA Kit, R&D Systems, MJE00; Mouse CXCL10/IP-10/CRG-2 Immunoassay, R&D Systems, MCX100).

Pathological analysis

HE staining

Liver sections (5 μm) were stained with haematoxylin and eosin (H&E) to analyse necrotic areas using Image Pro Plus software. The percentage of necrotic area in the total area of the tissue section was quantified blindly in more than five fields for each mouse [18]. A pathologist who was blinded to the experimental protocol provided the morphological assessments.

TUNEL staining

To detect apoptosis induced by ischaemia reperfusion, we used an in situ apoptosis detection kit (ApopTag® Plus In Situ Apoptosis Fluorescein Detection Kit, S7111; Millipore). TUNEL assays were performed according to the manufacturer’s instructions.

Images were obtained under a fluorescence microscope (Olympus DX51). TUNEL-positive cells per field of the tissue section was quantified using Image-Pro Plus (version 6.0).

Immunohistochemistry

We prepared liver sections according to the manufacturer’s guidelines for immunohistochemical assays. We analysed and evaluated the USP4 staining intensity via microscopy.

Immunofluorescence

The infiltration of inflammatory cells into the liver sections was detected via immunofluorescence staining by applying rat anti-mouse-Ly6g antibody. After incubation with Ly6g antibody overnight at 4°C, liver sections were incubated with secondary antibody (Alexa Flour 555 anti-Rat IgG (H+L), CST, 4417). The nuclei were labelled with DAPI. Immunofluorescence images were captured and analysed using Image-Pro Plus (version 6.0).

Isolation and culture of primary hepatocytes

Primary hepatocytes were isolated from 6- to 8-week-old male mice as described previously [18,19]. After anaesthesia, the mouse abdominal cavity was opened, and a needle was used to puncture the portal vein with 0.5% type IV collagenase (catalogue no. 17104-019). When the liver was digested completely, the liver was excised, minced and filtered through a 70-µm cell strainer (catalogue no. 352350; Falcon, BD Biosciences) to obtain primary hepatocytes. The cells were cultured in DMEM (catalogue no. 11965092; Invitrogen) supplemented with 10% fetal bovine serum (FBS) in plates coated with rat tail collagen at 37°C with 5% CO2.

In vitro hypoxia/reoxygenation of hepatocytes

To establish an I/R model in vitro, the primary hepatocytes were divided into a control group and hypoxia/reoxygenation (H/R) group. The hepatocytes in the control group were cultured in complete medium at 37°C with 5% CO2. For hepatocytes in the H/R group, the medium was replaced with serum-free DMEM medium equilibrated with 5% CO2 and 90% N2 and placed into a modular incubator chamber (Biospherix, Lacona, NY, U.S.A.) that was flushed with the same gas mixture. After 6 h, cells were incubated under normoxic conditions (air/5% CO2) for the indicated times. The cells were collected for further analysis.

The specific transforming growth factor β-activated kinase 1 (TAK1) inhibitor 5Z-7-oxozeaenol (5Z-7-ox; O9890-1MG; Sigma, St. Louis, MO, U.S.A.; 2.5 uM) was administered 30 min prior to H/R to primary hepatocytes isolated from USP4-KO and wild-type (WT) mice. The same volume of DMSO was administered as the vehicle control.

Cells

The hepatocyte cell line L02 and HEK293T, which were purchased from Chinese Academy of Sciences cell bank, was cultured in DMEM supplemented with 10% FBS, 100 U/ml penicillin and 100 μg/ml streptomycin at 37°C in a humidified atmosphere containing 5% CO2.

Plasmid constructs

The coding sequence of USP4 gene (NM_003363.3) was cloned into the lentiviral vector pHAGE-3×flag. Primers used were designed on the NCBI website (https://www.ncbi.nlm.nih.gov/tools/primer-blast/). The primer sequences were as following: forward: 5′-TCGGGTTTAAACGGATCCATGGCGGAAGGTGGA GGCT-3′; reverse: 5′-GGGCCCTCTAGACTCGAGTTAGTTGGTGTCCATG CTGCAA GC-3′.

Lentiviral transduction

The HEK293T cell was used for transduction. Briefly, USP4 expression vector was co-transfected into HEK293T cells together with the helper plasmids and PEI reagent. Media contain lentiviral particles were harvested 48 h later after transfection and transfered to L02 cells for infection in the presence of polybrene (8 μg/ml). Twenty four after viral infection, infected cells were selected with 4 μg/ml puromycin for additional 24 h cell culture, and then tested for expression.

Western blotting

Proteins were extracted from liver tissues and primary hepatocytes according to the standard protocols. Protein concentrations were determined using a BCA Protein Assay kit (Thermo Fisher Scientific, 23225). In brief, the protein samples were separated by on a 12.5% SDS/PAGE gel and then transferred to a nitrocellulose PVDF membrane. We blocked the membrane using 5% non-fat dry milk in TBS-T buffer and then incubated it overnight at 4°C with primary antibody. After the blots were rinsed extensively with TBS-T buffer, we incubated them with horseradish peroxidase (HRP)-conjugated secondary antibodies, developed them using an enhanced chemiluminescence system, and captured the results on a light-sensitive imaging film. Levels of particular proteins were anlysed by immunoblot using indicated primary antibodies, HRP-conjugated secondary antibodies and ECL chemiluminescent detection. Quantitation of expression level of protein was determined by Image J software.

Quantitative real-time PCR

TRIzol reagent (Invitrogen) was used to extract total RNA from cultured hepatocytes and hepatic tissues according to the manufacturer’s instructions. After RNA was reverse transcribed into cDNA using Transcriptor First Strand cDNA Synthesis Kit (04896866001, Roche, Basel, Switzerland), quantitative real-time PCR (qRT-PCR) amplification was performed using SYBR Green PCR Master Mix and analysed for real-time PCR using SYBR Green PCR Mix and specific primers. Each experiment was performed in triplicate, and the results were determined as the average gene expression normalized to β-actin expression. Reaction conditions were set as follows: incubation at 95°C for 10 min, followed by 40 cycles of 95°C for 10 s and 60°C for 1 min. The relative messenger RNA (mRNA) expression levels were calculated using the 2−ΔΔCt method and were normalized against β-actin. The primers for each gene used are listed in Table 1. β-actin used as housekeeping gene. The data represent the means of three experiments.

Table 1
Primers for qPCR detection
Gene  Sequence5′-3′ 
USP4 ACCTGTTTCCTGGACCTATTGA 
 CACAGCCATACCAATTCAGCA 
IL1b CCGTGGACCTTCCAGGATGA 
 GGGAACGTCACACACCAGCA 
IL6 AGTTGCCTTCTTGGGACTGA 
 TCCACGATTTCCCAGAGAAC 
Ccl2 TGGCTCAGCCAGATGCAGT 
 CCAGCCTACTCATTGGGATCA 
Cxcl10 ATGACGGGCCAGTGAGAATG 
 ATGATCTCAACACGTGGGCA 
Bcl2 TGGTGGACAACATCGCCCTGTG 
 GGTCGCATGCTGGGGCCATATA 
Bad CCAGAGTTTGAGCCGAGTGAGCA 
 ATAGCCCCTGCGCCTCCATGAT 
Bax TGAGCGAGTGTCTCCGGCGAAT 
 GCACTTTAGTGCACAGGGCCTTG 
β-actin GTGACGTTGACATCCGTAAAGA 
 GCCGGACTCATCGTACTCC 
Gene  Sequence5′-3′ 
USP4 ACCTGTTTCCTGGACCTATTGA 
 CACAGCCATACCAATTCAGCA 
IL1b CCGTGGACCTTCCAGGATGA 
 GGGAACGTCACACACCAGCA 
IL6 AGTTGCCTTCTTGGGACTGA 
 TCCACGATTTCCCAGAGAAC 
Ccl2 TGGCTCAGCCAGATGCAGT 
 CCAGCCTACTCATTGGGATCA 
Cxcl10 ATGACGGGCCAGTGAGAATG 
 ATGATCTCAACACGTGGGCA 
Bcl2 TGGTGGACAACATCGCCCTGTG 
 GGTCGCATGCTGGGGCCATATA 
Bad CCAGAGTTTGAGCCGAGTGAGCA 
 ATAGCCCCTGCGCCTCCATGAT 
Bax TGAGCGAGTGTCTCCGGCGAAT 
 GCACTTTAGTGCACAGGGCCTTG 
β-actin GTGACGTTGACATCCGTAAAGA 
 GCCGGACTCATCGTACTCC 

Statistical analysis

All data are presented as the mean ± S.D. We used SPSS 19.0 software for all statistical analyses. Statistical differences among more than 2 groups were compared using one-way ANOVA, followed by Bonferroni analysis (for data meeting homogeneity of variance) or Tamhane’s T2 analysis (for data demonstrating heteroscedasticity). Statistical differences between two groups were compared with a two-tailed Student’s t-test. P<0.05 was considered significant.

Results

USP4 expression was significantly up-regulated during hepatic I/R in vitro and in vivo

To analyse whether USP4 is involved in I/R-induced liver dysfunction, the expression of USP4 in livers and primary hepatocytes subjected to I/R injury was first measured. In the mouse model of hepatic I/R, the protein expression of USP4 was up-regulated at 6 and 24 h after reperfusion (Figure 1A). However, the mRNA expression of USP4 was not affected at 6 and 24 h after reperfusion (Figure 1B), indicating that the change of USP4 protein expression after hepatic I/R injury may be dependent on post-translational modification. Furthermore, immunohistochemistry staining of USP4 expression in sections of ischaemic liver lobes also demonstrated up-regulation of USP4 in WT mice at 6 and 24 h after hepatic I/R injury (Figure 1C). Consistently, the expression of USP4 was also significantly increased in primary hepatocytes at 6 h after H/R (Figure 1D). These results suggest that USP4 participates in the pathogenesis of hepatic I/R injury.

USP4 expression is up-regulated in hepatic I/R models in vitro and in vivo

Figure 1
USP4 expression is up-regulated in hepatic I/R models in vitro and in vivo

(A) Time-course of USP4 protein expression in WT livers after hepatic I/R injury (n=2 per group). (B) Time-course of USP4 mRNA expression in WT livers after hepatic I/R injury (n=6-7 per group). (C) Immunohistochemical staining of USP4 expression in sections of ischaemic liver lobes from WT mice at 6 and 24 h after hepatic I/R injury (n=4 per group). (D) USP4 protein expression in primary hepatocytes 6 h after H/R. The results shown are representative of three blots. For A and D, GAPDH served as the loading control. For statistical analysis, one-way ANOVA was used for (A) and (B), and two-tailed Student’s t-test was used for D. n.s., not significant, **P<0.01.

Figure 1
USP4 expression is up-regulated in hepatic I/R models in vitro and in vivo

(A) Time-course of USP4 protein expression in WT livers after hepatic I/R injury (n=2 per group). (B) Time-course of USP4 mRNA expression in WT livers after hepatic I/R injury (n=6-7 per group). (C) Immunohistochemical staining of USP4 expression in sections of ischaemic liver lobes from WT mice at 6 and 24 h after hepatic I/R injury (n=4 per group). (D) USP4 protein expression in primary hepatocytes 6 h after H/R. The results shown are representative of three blots. For A and D, GAPDH served as the loading control. For statistical analysis, one-way ANOVA was used for (A) and (B), and two-tailed Student’s t-test was used for D. n.s., not significant, **P<0.01.

Knockout of USP4 aggravated hepatic I/R injury

The dramatic increase in USP4 induced by hepatic I/R injury prompted us to investigate whether deficiency of USP4 contributes to liver injury. Therefore, we constructed USP4 knockout mice to evaluate USP4 function in hepatic I/R injury and confirmed knockout via Western blot analysis (Figure 2A). USP4 gene knockout (USP4-KO) and WT mice were used to construct a hepatic I/R injury model. Compared with the WT mice, the levels of ALT and AST in the USP4-KO group were increased significantly at 6 h after I/R (Figure 2B). According to HE staining results, necrotic area in the liver was significantly augmented in the USP4-KO group (Figure 2C). These results demonstrate that USP4 deficiency aggravates hepatic I/R injury.

USP4 deficiency exaggerates hepatic injury in an I/R model

Figure 2
USP4 deficiency exaggerates hepatic injury in an I/R model

(A) USP4 protein expression in livers from USP4-KO and WT mice. GAPDH served as the loading control (n=3 per group). (B) The serum ALT and AST levels in USP4-KO and WT mice at 6 h post-I/R and in sham controls. (n=8–10 per group). (C) Representative images of H&E stained necrotic areas in ischaemic liver lobes from USP4-KO and WT mice at 6 h post-I/R or from sham control mice. (n=6 per group). For statistical analysis, two-tailed Student’s t-test was used for (A) and (C), and one-way ANOVA was used for (B). n.s., not significant; **P<0.01.

Figure 2
USP4 deficiency exaggerates hepatic injury in an I/R model

(A) USP4 protein expression in livers from USP4-KO and WT mice. GAPDH served as the loading control (n=3 per group). (B) The serum ALT and AST levels in USP4-KO and WT mice at 6 h post-I/R and in sham controls. (n=8–10 per group). (C) Representative images of H&E stained necrotic areas in ischaemic liver lobes from USP4-KO and WT mice at 6 h post-I/R or from sham control mice. (n=6 per group). For statistical analysis, two-tailed Student’s t-test was used for (A) and (C), and one-way ANOVA was used for (B). n.s., not significant; **P<0.01.

USP4 deficiency aggravates liver inflammation during hepatic I/R injury

Sterile inflammation is the key mechanism of hepatic I/R injury. Therefore, we examined the inflammatory response in USP4-KO and WT mice post-I/R and in corresponding sham mice. In the hepatic I/R injury model with USP4-KO mice, the TNF-α, CCL2 and Cxcl10 concentration in the serum was significantly increased (Figure 3A). The infiltration of neutrophils (Ly6g positive cells) in hepatic tissue was significantly aggravated (Figure 3B). The mRNA expression levels of inflammatory factors, such as IL1β, IL6 and Ccl2, were also dramatically up-regulated (Figure 3C). Furthermore, Western blot showed that the classic pro-inflammatory NF-κB signalling pathway was dramatically activated by USP4 deficiency, which was demonstrated by the significant increment in p-IKKβ, p-p65 and IκBα degradation (Figure 3D). These observations demonstrate that USP4 deficiency aggravates liver inflammation during hepatic I/R injury.

USP4 deficiency aggravates the inflammation response during hepatic I/R

Figure 3
USP4 deficiency aggravates the inflammation response during hepatic I/R

(A) Serum levels of inflammatory cytokines and chemokines after I/R injury in USP4-KO and WT mice 6 h post-reperfusion. (n=8–10 per group). (B)The immunofluorescence staining of Ly6g in livers of WT and USP4-KO mice 6 h post-reperfusion.(n=6 per group) (C)The mRNA level of pro-inflammatory factors (IL1β, IL6 and Ccl2) after I/R injury in USP4-KO and WT mice 6 h post-reperfusion. (n=4 per group). (D) The protein expression levels of NF-κB signalling components in livers from USP4-KO and WT mice 6 h post-I/R injury. The results shown are representative of three blots. GAPDH served as the loading control. For statistical analysis, one-way ANOVA was used for (A), and two-tailed Student’s t-test was used for (B–D). n.s., not significant; **P<0.01.

Figure 3
USP4 deficiency aggravates the inflammation response during hepatic I/R

(A) Serum levels of inflammatory cytokines and chemokines after I/R injury in USP4-KO and WT mice 6 h post-reperfusion. (n=8–10 per group). (B)The immunofluorescence staining of Ly6g in livers of WT and USP4-KO mice 6 h post-reperfusion.(n=6 per group) (C)The mRNA level of pro-inflammatory factors (IL1β, IL6 and Ccl2) after I/R injury in USP4-KO and WT mice 6 h post-reperfusion. (n=4 per group). (D) The protein expression levels of NF-κB signalling components in livers from USP4-KO and WT mice 6 h post-I/R injury. The results shown are representative of three blots. GAPDH served as the loading control. For statistical analysis, one-way ANOVA was used for (A), and two-tailed Student’s t-test was used for (B–D). n.s., not significant; **P<0.01.

USP4 deficiency enhanced hepatocyte apoptosis during hepatic I/R injury

Then, apoptosis in USP4-KO and WT mouse livers was measured after hepatic I/R injury. TUNEL staining showed that USP4 deficiency dramatically enhanced hepatocyte apoptosis (Figure 4A). qRT-PCR was applied to detect the expression of apoptosis signalling pathway factors. The results showed that the expression of the pro-apoptotic proteins Bax and Bad was increased and the expression of the anti-apoptotic protein Bcl2 was significantly decreased in the USP4-KO group at 6 h after reperfusion (Figure 4B). Moreover, Western blot results further validated the down-regulation of Bcl-2 and up-regulation of Bax and Bid in the livers of USP4-KO mice compared with WT mice at 6 h after hepatic I/R injury (Figure 4C). These results demonstrated that USP4 deficiency promotes cell apoptosis during hepatic I/R injury.

USP4 deficiency exaggerates apoptosis in hepatic I/R

Figure 4
USP4 deficiency exaggerates apoptosis in hepatic I/R

(A) Representative TUNEL staining in liver lobes from USP4-KO mice and littermate control mice in I/R groups at 6 h post-reperfusion. (n=6 per group). (B) The mRNA levels of cell death-related genes (Bad, Bax and Bcl2) in livers from USP4-KO and littermate control mice in I/R groups at 6 h post-reperfusion. (n=4 per group). (C) The protein levels of cell death-related genes (Bax, Bcl2 and Bid) in livers from USP4-KO and littermate control mice in I/R the groups and from sham control mice at 6 h post-reperfusion. The results shown are representative of three independent experiments. GAPDH served as the loading control. For statistical analysis, two-tailed Student’s t-test was used for (A–C). *P<0.05; **P<0.01.

Figure 4
USP4 deficiency exaggerates apoptosis in hepatic I/R

(A) Representative TUNEL staining in liver lobes from USP4-KO mice and littermate control mice in I/R groups at 6 h post-reperfusion. (n=6 per group). (B) The mRNA levels of cell death-related genes (Bad, Bax and Bcl2) in livers from USP4-KO and littermate control mice in I/R groups at 6 h post-reperfusion. (n=4 per group). (C) The protein levels of cell death-related genes (Bax, Bcl2 and Bid) in livers from USP4-KO and littermate control mice in I/R the groups and from sham control mice at 6 h post-reperfusion. The results shown are representative of three independent experiments. GAPDH served as the loading control. For statistical analysis, two-tailed Student’s t-test was used for (A–C). *P<0.05; **P<0.01.

USP4 inhibits inflammation and apoptosis in hepatocytes after H/R treatment

To validate whether USP4 directly influences inflammation and apoptosis in hepatocytes, we detected the inflammation and apoptosis in H/R-treated primary hepatocyte and sham hepatocytes isolated from USP4-KO and WT mice. The results showed that USP4 deficiency did not affect the inflammation and apoptosis in hepatocytes without H/R stimulation (Figure 5A and C). However, USP4 deficiency in primary hepatocyte significantly promoted the inflammation and apoptosis after H/R treatment (Figure 5A-C). Furthermore, we overexpressed USP4 in human hepatocyte cell line L02 by lentivirus (Figure 5D) and examined the effect of USP4 overexpression on inflammation and apoptosis after H/R or sham treatment. Western blot showed that the classic pro-inflammatory NF-κB signalling pathway was dramatically inhibited by USP4 overexpression, as demonstrated by the significant decrease in p-IKKβ, p-p65 and IκBα degradation (Figure 5E). The mRNA expression levels of inflammatory factors, such as IL6, IL1β, Ccl2 and Cxcl10, were also dramatically down-regulated (Figure 5F). Additionally, Western blot results further validated the up-regulation of Bcl-2 and down-regulation of Bax and Bid in USP4 overexpressed L02 compared with control cells (Figure 5G). Taken together, these results demonstrated that USP4 inhibits inflammation and apoptosis in hepatocytes after H/R treatment.

USP4 inhibit hepatocyte inflammation and apoptosis after H/R treatment

Figure 5
USP4 inhibit hepatocyte inflammation and apoptosis after H/R treatment

(A) The protein expression levels of NF-κB signalling components in H/R-treated hepatocytes and sham hepatocytes isolated from USP4-KO and WT mice. (B) The mRNA expression levels of pro-inflammatory factors (IL6,IL1β,Ccl2 and Cxcl10) in H/R-treated hepatocytes isolated from USP4-KO and WT mice. (C) The protein expression levels of death-related genes (Bax, Bid and Bcl2) in H/R-treated hepatocytes and sham hepatocytes isolated from USP4-KO and WT mice. (D) USP4 protein expression in hepatocytes cell line infected with the lenti-UPS4 or lenti-GFP. (E) The protein expression levels of NF-κB signalling components in H/R-treated hepatocytes and sham hepatocytes infected with lenti-UPS4 or lenti-GFP. (F) The mRNA level of pro-inflammatory factors (IL6, IL1β,Ccl2 and Cxcl10) in USP4 overexpression hepatocytes post 6 h H/R. (G) The protein expression levels of death-related genes (Bax, Bid and Bcl2) in H/R-treated hepatocytes and sham hepatocytes with lenti-UPS4 or lenti-GFP. For (A), (C), (D), (E) and (G), the results shown are representative of three blots, and GAPDH served as the loading control. For B and F, the results shown are representative of three independent experiments. For statistical analysis, two-tailed Student’s t-test was used for (B), (D) and (F), and one-way ANOVA was used for (A), (C), (E) and (G).**P<0.01, n.s., not significant.

Figure 5
USP4 inhibit hepatocyte inflammation and apoptosis after H/R treatment

(A) The protein expression levels of NF-κB signalling components in H/R-treated hepatocytes and sham hepatocytes isolated from USP4-KO and WT mice. (B) The mRNA expression levels of pro-inflammatory factors (IL6,IL1β,Ccl2 and Cxcl10) in H/R-treated hepatocytes isolated from USP4-KO and WT mice. (C) The protein expression levels of death-related genes (Bax, Bid and Bcl2) in H/R-treated hepatocytes and sham hepatocytes isolated from USP4-KO and WT mice. (D) USP4 protein expression in hepatocytes cell line infected with the lenti-UPS4 or lenti-GFP. (E) The protein expression levels of NF-κB signalling components in H/R-treated hepatocytes and sham hepatocytes infected with lenti-UPS4 or lenti-GFP. (F) The mRNA level of pro-inflammatory factors (IL6, IL1β,Ccl2 and Cxcl10) in USP4 overexpression hepatocytes post 6 h H/R. (G) The protein expression levels of death-related genes (Bax, Bid and Bcl2) in H/R-treated hepatocytes and sham hepatocytes with lenti-UPS4 or lenti-GFP. For (A), (C), (D), (E) and (G), the results shown are representative of three blots, and GAPDH served as the loading control. For B and F, the results shown are representative of three independent experiments. For statistical analysis, two-tailed Student’s t-test was used for (B), (D) and (F), and one-way ANOVA was used for (A), (C), (E) and (G).**P<0.01, n.s., not significant.

USP4 deficiency promoted JNK and TAK1 activation during hepatic I/R injury

Furthermore, the underlying mechanisms of USP4 in hepatic I/R injury were explored in vitro and in vivo. MAPKs play an important role in mediating the inflammatory response and cell death [18]. Many studies have shown that I/R surgery or H/R insult activates MAPK signalling, which was evidenced by phosphorylation of JNK (p-JNK), ERK (p-ERK) in livers and primary hepatocytes [20,21]. Therefore, we investigated whether USP4 deficiency promotes hepatic I/R injury in a MAPK-dependent manner. However, in our experiment, we found that USP4 deficiency only increased p-JNK but not p-ERK or p-38 levels in livers after I/R injury or in hepatocytes after H/R treatment (Figure 6A,B). The phosphorylation of TAK1 (p-TAK1), ASK1, (p-ASK1) and MEKK1 (p-MEKK1) often regulate MAPKs in multiple physiological processes [22–25]. Thus, we examined the activation of p-ASK1, p-TAK1 and p-MEKK1, which are the classical upstream factors of the JNK and p38 signalling pathways. We also found that only TAK1 activation not ASK1 or MEKK1 activation was responsive to USP4 expression changes in vivo and in vitro (Figure 6C,D). Together, these observations suggest that USP4 ablation promotes activation of J TAK1/JNK signalling during hepatic I/R injury.

USP4 deficiency promotes TAK1-JNK/p38 signalling

Figure 6
USP4 deficiency promotes TAK1-JNK/p38 signalling

(A) Western blots showing the total and phosphorylated ERK, JNK and p38 expression levels in livers from USP4-KO and WT mice at 6 h post-I/R. (B) Western blots showing the total and phosphorylated ERK, JNK and p38 expression levels in H/R-treated hepatocytes isolated from USP4-KO and WT mice. (C) Western blots showing the total and phosphorylated TAK1, ASK1 and MEKK1 expression levels in livers from USP4-KO and WT mice at 6 h post-I/R injury. (D) Western blots showing the total and phosphorylated TAK1, ASK1 and MEKK1 expression levels in H/R-treated hepatocytes isolated from USP4-KO and WT mice. (A-D) The results shown are representative of three independent experiments. GAPDH served as the loading control. For statistical analysis, two-tailed Student’s t-test was used for A–D. n.s., not significant; **P<0.01.

Figure 6
USP4 deficiency promotes TAK1-JNK/p38 signalling

(A) Western blots showing the total and phosphorylated ERK, JNK and p38 expression levels in livers from USP4-KO and WT mice at 6 h post-I/R. (B) Western blots showing the total and phosphorylated ERK, JNK and p38 expression levels in H/R-treated hepatocytes isolated from USP4-KO and WT mice. (C) Western blots showing the total and phosphorylated TAK1, ASK1 and MEKK1 expression levels in livers from USP4-KO and WT mice at 6 h post-I/R injury. (D) Western blots showing the total and phosphorylated TAK1, ASK1 and MEKK1 expression levels in H/R-treated hepatocytes isolated from USP4-KO and WT mice. (A-D) The results shown are representative of three independent experiments. GAPDH served as the loading control. For statistical analysis, two-tailed Student’s t-test was used for A–D. n.s., not significant; **P<0.01.

TAK1 mediates the detrimental effect of USP4 deficiency during hepatic I/R injury

In the last step, we evaluated whether USP4 regulates hepatocyte inflammation and apoptosis was dependent on TAK1. Primary hepatocytes were isolated from the livers of USP4-KO and WT mice and were confirmed by Western blotting (Figure 7A). The TAK1 inhibitor 5Z-7-ox was employed to block the activity of TAK1 and its downstream JNK signalling (Figure 7B). The results showed that USP4 deficiency significantly increased the secretion of inflammatory factors and activation of NF-κB signalling in hepatocytes after H/R treatment; however, this effect was blocked by inhibition of TAK1 activation (Figure 7C,D). Notably, TAK1 inhibition significantly protected against hepatocyte apoptosis aggravated by USP4 deficiency, evidenced by decreased mRNA expression of Bax and Bad and protein expression of Bid and Bax and increased mRNA and protein expression of Bcl2 (Figure 7E,F). These observations demonstrated that TAK1 inhibition abolished the effect of USP4 deficiency on inflammation and hepatocyte apoptosis, suggesting that TAK1 mediates the protective function of USP4 in hepatic I/R injury.

TAK1 inhibitor treatment blocked the detrimental effect of UPS4 deficiency on hepatic I/R injury

Figure 7
TAK1 inhibitor treatment blocked the detrimental effect of UPS4 deficiency on hepatic I/R injury

(A) USP4 protein expression in primary hepatocytes isolated from USP4-KO and WT mice. (B) Protein levels of total and phosphorylated TAK1 and JNK in hepatocytes from USP4-KO and WT mice treated with vehicle or TAK1 inhibitor and harvested at 6 h after H/R. (C) mRNA levels of pro-inflammatory factors (IL6, IL1β, Ccl2 and Cxcl10) in hepatocytes from USP4-KO and WT mice treated with vehicle or TAK1 inhibitor and harvested at 6 h after H/R. (D) Protein levels of NF-κB signalling pathway components in hepatocytes from USP4-KO and WT mice treated with vehicle or TAK1 inhibitor and harvested at 6 h after H/R. (E and F) mRNA and protein levels of cell death-related genes (Bad, Bid, Bcl2 and Bax) in hepatocytes from USP4-KO and WT mice treated with vehicle or TAK1 inhibitor and harvested at 6 h after H/R. For A, B, D and F, the results shown are representative of three blots, and GAPDH served as the loading control. For C and E, the results shown are representative of three independent experiments. For statistical analysis, two-tailed Student’s t-test was used for A, and one-way ANOVA was used for B–F. *P<0.05; **P<0.01.

Figure 7
TAK1 inhibitor treatment blocked the detrimental effect of UPS4 deficiency on hepatic I/R injury

(A) USP4 protein expression in primary hepatocytes isolated from USP4-KO and WT mice. (B) Protein levels of total and phosphorylated TAK1 and JNK in hepatocytes from USP4-KO and WT mice treated with vehicle or TAK1 inhibitor and harvested at 6 h after H/R. (C) mRNA levels of pro-inflammatory factors (IL6, IL1β, Ccl2 and Cxcl10) in hepatocytes from USP4-KO and WT mice treated with vehicle or TAK1 inhibitor and harvested at 6 h after H/R. (D) Protein levels of NF-κB signalling pathway components in hepatocytes from USP4-KO and WT mice treated with vehicle or TAK1 inhibitor and harvested at 6 h after H/R. (E and F) mRNA and protein levels of cell death-related genes (Bad, Bid, Bcl2 and Bax) in hepatocytes from USP4-KO and WT mice treated with vehicle or TAK1 inhibitor and harvested at 6 h after H/R. For A, B, D and F, the results shown are representative of three blots, and GAPDH served as the loading control. For C and E, the results shown are representative of three independent experiments. For statistical analysis, two-tailed Student’s t-test was used for A, and one-way ANOVA was used for B–F. *P<0.05; **P<0.01.

Discussion

Hepatic I/R injury is a common pathological state during liver surgery, especially LT. Protein ubiquitination and deubiquitination have an essential role in multiple biological process, including apoptosis and inflammation. USP4 is a deubiquitinating enzyme and plays important roles in anti-virus response, non-alcoholic fatty liver disease and tumour formation [12,13,26]. However, the role of USP4 in hepatic I/R injury has not been reported. In the present study, we detected that during the development of hepatic I/R in mice and hepatocytes, a progressive increase in USP4 expression was induced, indicating that USP4 may play important roles in the progress of hepatic I/R injury. Based on various in vivo and in vitro hepatic I/R models, we clearly demonstrated that USP4 deficiency exacerbated hepatic I/R injury via promotion of inflammation and apoptosis, whereas USP4 overexpression alleviated the inflammation and apoptosis in hepatocyte after H/R treatment. Mechanistically, we found that USP4 deficiency promoted activation of TAK1/JNK signalling and the detrimental role of USP4 deficiency in hepatic I/R injury was blocked by inhibition of TAK1 activation in hepatocytes. Collectively, the present study reveals a novel function of USP4 in hepatic I/R injury, and suggests that USP4 may be served as a potential target to alleviate the pathological process of hepatic I/R injury

Increasing evidence shows that the inflammatory response plays a key role in the pathogenesis of hepatic I/R injury [2,17]. Hepatic I/R recruits inflammatory cells into the liver tissue and promotes the expression of inflammatory cytokines and chemokines. Ultimately, the inflammation induces cell apoptosis. Multiple signalling pathways are involved in the inflammation observed in I/R, including NF-κB, MAPK/ERK and MAPK/JNK pathways [18,27,28]. Many studies have shown that USP4 may be a potential key molecule in regulating inflammation through various pathways [13]. USP4 inhibits p53 and NF-κB by deubiquitinating and stabilizing HDAC2 [29]. USP4 can act as a positive regulator of the WNT/β-catenin pathway via deubiquitination and facilitates nuclear localisation of β-catenin [30,31]. In FaDu cells, USP4 negatively regulates RIP1-mediated NF-κB activation and promotes TNF-α-induced apoptosis [32]. In addition, USP4 deubiquitinates TRAF6 and thereby prevents activation of the NF-κB and AP-1 transcription factors and subsequent pro-inflammatory responses [33]. In fact, USP4 knockout mice exhibited more severe inflammatory responses and aggravated cell apoptosis via the NF-κB pathway (Figures 3 and 4).

In HEK-293T cells, USP4 inhibits RIP protein activity upstream of the IKK complex through deubiquitylase activity, thereby inhibiting the activity of the NF-κB pathway and exerting an anti-inflammatory effect. In addition, USP4 inhibits the degradation of RIG1 protein via deubiquitylase activity, promotes the synthesis of interferon, and plays an important role in anti-virus responses [34]. In the process of cell proliferation, correct splicing of precursor RNA is a prerequisite for normal cell division. USP4 can regulate the ubiquitination level of the component subunits of splices, affect the normal function of splices and play a role in regulating cell cycle. Therefore, the apoptosis mechanism was detected in the present study, and the results showed that USP4 deficiency exaggerated apoptosis by down-regulating Bad, Bid and Bax expression and up-regulating BCL-2 expression. In vitro, we applied the primary hepatocyte and hepatocyte cell lines treated with H/R, the result also validate the USP deficiency promoted the apoptosis and inflammation, whereas UPS4 overexpression has the opposite effect.

TAK1, which is an upstream MAP kinase kinase kinase (MAPKKK) family member, is essential in TNF-α-mediated activation of NF-kB, JNK and p38 [35]. TAK1 regulatory subunits include TAB1, TAB2, TAB3 and TAB4. TAB2, TAB3 and TAB4 are involved in regulation of TAK1 activation through binding to polyubiquitinated proteins and promoting a larger complex formation during TNF-α-induced TAK1 activation [36]. In multiple cell types, endogenous USP4 was shown to associate with TRAF6 and to inhibit IL-1R- and LPS-induced IKB phosphorylation [37]. Thus, USP4 was expected to function through targeting of TRAF6 deubiquitination [33]. A recent study showed that USP4 serves as a critical control to down-regulate TNF-α-induced NF-κB activation by deubiquitinating TAK1 [16,36]. In our study, the mechanism by which USP4 regulates hepatic I/R also depends on the TAK1-JNK/NF-κB axis (Figure 6). The underlying mechanism of USP4 in regulating hepatic I/R injury is USP4 activation of TAK1. To further confirm the role of TAK1 in the regulation of I/R injury by USP4 deficiency, we used a TAK1 inhibitor to confirm the regulation of TAK1 by USP4. The results showed that the destructive effects of USP4 deficiency in I/R-related liver injury were reversed, indicating that USP4 rescues hepatic I/R injury by inhibiting TAK1 activation (Figure 7). USP4 can also deubiquitinate interferon regulatory factor 4 and affect T helper type 2 cell function [26]. Because of the complex regulatory network of ubiquitin proteases, additional mechanisms need to be explored.

In conclusion, we provide evidence that endogenous USP4 is an essential molecule in the development of hepatic I/R, and the effects of USP4 are dependent on the TAK1-JNK1/2/p38 pathway. Thus, targeting USP4 may represent a promising strategy to alleviate hepatic I/R injury.

Clinical perspectives

  • The involvement of USP4 in various pathological processes was well established, but whether it participates in hepatic I/R is unknown.

  • Our study showed the deficiency of USP4 promotes liver inflammation and apoptosis induced by liver I/R injury by promoting activation of the TAK1/JNK signalling pathways.

  • Our study broadens our understanding of the molecular mechanisms on hepatic I/R reperfusion and suggests the therapeutic potential of USP4.

Funding

The present study was supported by the National Natural Science Foundation of China [grant numbers: 81870067 and 81400753].

Author contribution

Q.T. and Z.J. designed the research study and performed the research; C.Z. and M.X. contributed essential reagents or tools; Z.L. and Z.J. analysed the data; and Q.T. and W.T. wrote the paper.

Competing interests

The authors declare that there are no competing interests associated with the manuscript.

Abbreviations

     
  • ALT

    alanine aminotransferase

  •  
  • ASK

    Apopotosis signal-regulating kinase

  •  
  • AST

    aspartate aminotransferase

  •  
  • DMEM

    Dulbecco’s Modified Eagled Medium

  •  
  • DUSP

    Domain present in ubiquitin-specific proteases

  •  
  • HRP

    horseradish peroxidase

  •  
  • H&E

    haematoxylin and eosin

  •  
  • H/R

    hypoxia/reoxygenation

  •  
  • IKK

    inhibitor of nuclear factor kappa-B kinase

  •  
  • IRI

    ischaemia/reperfusion injury

  •  
  • I/R

    ischaemia/reperfusion

  •  
  • JNK

    c-Jun N-Terminal Kinase

  •  
  • KO

    knockout

  •  
  • LPS

    lipopolysaccharide

  •  
  • LT

    liver transplantation

  •  
  • MAP

    mitogen-activated protein

  •  
  • mRNA

    messenger RNA

  •  
  • NF-κB

    nuclear factor κB

  •  
  • qRT-PCR

    quantitative real-time PCR

  •  
  • TAK1

    transforming growth factor-β-activated kinase 1

  •  
  • TNF-α

    tumour necrosis factor α

  •  
  • USP4

    ubiquitin-specific peptidase 4

  •  
  • WT

    wild-type

  •  
  • ZF

    Zinc finger

References

References
1.
Nastos
C.
,
Kalimeris
K.
,
Papoutsidakis
N.
,
Tasoulis
M.K.
,
Lykoudis
P.M.
,
Theodoraki
K.
et al. .
(
2014
)
Global consequences of liver ischemia/reperfusion injury
.
Oxid. Med. Cell Longev.
2014
,
906965
[PubMed]
2.
Saidi
R.F.
and
Kenari
S.K.
(
2014
)
Liver ischemia/reperfusion injury: an overview
.
J. Invest. Surg.
27
,
366
379
[PubMed]
3.
Eltzschig
H.K.
and
Eckle
T.
(
2011
)
Ischemia and reperfusion–from mechanism to translation
.
Nat. Med.
17
,
1391
1401
[PubMed]
4.
Liu
B.
and
Qian
J.M.
(
2015
)
Cytoprotective role of heme oxygenase-1 in liver ischemia reperfusion injury
.
Int. J. Clin. Exp. Med.
8
,
19867
19873
[PubMed]
5.
Sun
P.
,
Zhang
P.
,
Wang
P.X.
,
Zhu
L.H.
,
Du
Y
,
Tian
S.
et al. .
(
2015
)
Mindin deficiency protects the liver against ischemia/reperfusion injury
.
J. Hepatol.
63
,
1198
1211
[PubMed]
6.
Lu
L.
,
Zhou
H.
,
Ni
M.
,
Wang
X.
,
Busuttil
R.
,
Kupiec-Weglinski
J.
et al. .
(
2016
)
Innate Immune Regulations and Liver Ischemia-Reperfusion Injury
.
Transplantation
100
,
2601
2610
[PubMed]
7.
Tobias
J.W.
and
Varshavsky
A.
(
1991
)
Cloning and functional analysis of the ubiquitin-specific protease gene UBP1 of Saccharomyces cerevisiae
.
J. Biol. Chem.
266
,
12021
12028
[PubMed]
8.
Wolberger
C.
(
2014
)
Mechanisms for regulating deubiquitinating enzymes
.
Protein Sci.
23
,
344
353
[PubMed]
9.
Lin
R.
,
Nie
J.
,
Ren
J.
,
Liang
R.
,
Li
D.
,
Wang
P.
et al. .
(
2017
)
USP4 interacts and positively regulates IRF8 function via K48-linked deubiquitination in regulatory T cells
.
FEBS Lett.
591
,
1677
1686
[PubMed]
10.
Kwon
S.K.
,
Kim
E.H.
and
Baek
K.H.
(
2017
)
RNPS1 is modulated by ubiquitin-specific protease 4
.
FEBS Lett.
591
,
369
381
[PubMed]
11.
Guo
W.
,
Ma
J.
,
Pei
T.
,
Zhao
T.
,
Guo
S.
,
Yi
X.
et al. .
(
2018
)
Up-regulated deubiquitinase USP4 plays an oncogenic role in melanoma
.
J. Cell. Mol. Med.
22
,
2944
2954
[PubMed]
12.
Li
T.
,
Yan
B.
,
Ma
Y.
,
Weng
J.
,
Yang
S.
,
Zhao
N.
et al. .
(
2018
)
Ubiquitin-specific protease 4 promotes hepatocellular carcinoma progression via cyclophilin A stabilization and deubiquitination
.
Cell Death Dis.
9
,
148
[PubMed]
13.
Zhao
Y.
,
Gao
L.
,
Xu
L.
,
Tong
R.
,
Lin
N.
,
Su
Y.
et al. .
(
2018
)
Ubiquitin-specific protease 4 is an endogenous negative regulator of metabolic dysfunctions in nonalcoholic fatty liver disease
.
Hepatology
14.
Li
Y.
,
Jiang
D.
,
Zhang
Q.
,
Liu
X.
and
Cai
Z.
(
2016
)
Ubiquitin-specific protease 4 inhibits breast cancer cell growth through the upregulation of PDCD4
.
Int. J. Mol. Med.
38
,
803
811
[PubMed]
15.
Zhong
M.
,
Jiang
Q.
and
Jin
R.
(
2018
)
USP4 expression independently predicts favorable survival in lung adenocarcinoma
.
IUBMB Life
70
,
670
677
[PubMed]
16.
Fan
Y.H.
,
Yu
Y.
,
Mao
R.F.
,
Tan
X.J.
,
Xu
G.F.
,
Zhang
H.
et al. .
(
2011
)
USP4 targets TAK1 to downregulate TNFα-induced NF-κB activation
.
Cell Death Differ.
18
,
1547
1560
[PubMed]
17.
Li
J.
,
Li
R.J.
,
Lv
G.Y.
and
Liu
H.Q.
(
2015
)
The mechanisms and strategies to protect from hepatic ischemia-reperfusion injury
.
Eur. Rev. Med. Pharmacol. Sci.
19
,
2036
2047
[PubMed]
18.
Wang
X.
,
Mao
W.
,
Fang
C.
,
Tian
S.
,
Zhu
X.
,
Yang
L.
et al. .
(
2017
)
Dusp14 protects against hepatic ischaemia-reperfusion injury via Tak1 suppression
.
J. Hepatol.
,
19.
Gao
L.
,
Wang
P.X.
,
Zhang
Y.
,
Yu
C.J.
,
Ji
Y.
,
Wang
X.
et al. .
(
2016
)
Tumor necrosis factor receptor-associated factor 5 (Traf5) acts as an essential negative regulator of hepatic steatosis
.
J. Hepatol.
65
,
125
136
[PubMed]
20.
King
L.A.
,
Toledo
A.H.
,
Rivera-Chavez
F.A.
and
Toledo-Pereyra
L.H.
(
2009
)
Role of p38 and JNK in liver ischemia and reperfusion
.
J. Hepatobiliary Pancreat. Surg.
16
,
763
770
[PubMed]
21.
Xu
D.
,
Zhu
J.
,
Jeong
S.
,
Li
D.
,
Hua
X.
,
Huang
L.
et al. .
(
2018
)
Rictor Deficiency Aggravates Hepatic Ischemia/Reperfusion Injury in Mice by Suppressing Autophagy and Regulating MAPK Signaling
.
Cell. Physiol. Biochem.
45
,
2199
2212
[PubMed]
22.
Aashaq
S.
,
Batool
A.
and
Andrabi
K.I.
(
2018
)
TAK1 mediates convergence of cellular signals for death and survival
.
Apoptosis
[PubMed]
23.
Hirata
Y.
,
Takahashi
M.
,
Morishita
T.
,
Noguchi
T.
and
Matsuzawa
A.
(
2017
)
Post-translational modifications of the TAK1-TAB complex
.
Int. J. Mol. Sci.
18
(1)
,
205
24.
Zhang
P.
,
Wang
P.X.
,
Zhao
L.P.
,
Zhang
X.
,
Ji
Y.X.
,
Zhang
X.J.
et al. .
(
2018
)
The deubiquitinating enzyme TNFAIP3 mediates inactivation of hepatic ASK1 and ameliorates nonalcoholic steatohepatitis
.
Nat. Med.
24
,
84
94
[PubMed]
25.
Mihaly
S.R.
,
Ninomiya-Tsuji
J.
and
Morioka
S.
(
2014
)
TAK1 control of cell death
.
Cell Death Differ.
21
,
1667
1676
[PubMed]
26.
Guo
Z.
,
Xu
P.
,
Ge
S.
,
Zhang
C.
,
Zheng
X.
,
Xu
J.
et al. .
(
2017
)
Ubiquitin specific peptidase 4 stabilizes interferon regulatory factor protein and promotes its function to facilitate interleukin-4 expression in T helper type 2 cells
.
Int. J. Mol. Med.
40
,
979
986
[PubMed]
27.
Qin
J.J.
,
Mao
W.
,
Wang
X.
,
Sun
P.
,
Cheng
D.
,
Tian
S.
et al. .
(
2018
)
Caspase recruitment domain 6 protects against hepatic ischemia/reperfusion injury by suppressing ASK1
.
J. Hepatol.
,
69
,
(5)
,
1110
1122
28.
Inokuchi
S.
,
Aoyama
T.
,
Miura
K.
,
Osterreicher
C.H.
,
Kodama
Y.
,
Miyai
K.
et al. .
(
2010
)
Disruption of TAK1 in hepatocytes causes hepatic injury, inflammation, fibrosis, and carcinogenesis
.
Proc. Natl. Acad. Sci. U.S.A.
107
,
844
849
[PubMed]
29.
Li
Z.
,
Hao
Q.
,
Luo
J.
,
Xiong
J.
,
Zhang
S.
,
Wang
T.
et al. .
(
2016
)
USP4 inhibits p53 and NF-κB through deubiquitinating and stabilizing HDAC2
.
Oncogene
35
,
2902
2912
[PubMed]
30.
Yun
S.I.
,
Kim
H.H.
,
Yoon
J.H.
,
Park
W.S.
,
Hahn
M.J.
,
Kim
H.C.
et al. .
(
2015
)
Ubiquitin specific protease 4 positively regulates the WNT/β-catenin signaling in colorectal cancer
.
Mol. Oncol.
9
,
1834
1851
[PubMed]
31.
Zhao
B.
,
Schlesiger
C.
,
Masucci
M.G.
and
Lindsten
K.
(
2009
)
The ubiquitin specific protease 4 (USP4) is a new player in the Wnt signalling pathway
.
J. Cell. Mol. Med.
13
,
1886
1895
[PubMed]
32.
Hou
X.
,
Wang
L.
,
Zhang
L.
,
Pan
X.
and
Zhao
W.
(
2013
)
Ubiquitin-specific protease 4 promotes TNF-α-induced apoptosis by deubiquitination of RIP1 in head and neck squamous cell carcinoma
.
FEBS Lett.
587
,
311
316
[PubMed]
33.
Zhou
F.
,
Zhang
X.
,
van Dam
H
,
Ten
D.P.
,
Huang
H.
and
Zhang
L.
(
2012
)
Ubiquitin-specific protease 4 mitigates Toll-like/interleukin-1 receptor signaling and regulates innate immune activation
.
J. Biol. Chem.
287
,
11002
11010
[PubMed]
34.
Wang
L.
,
Zhao
W.
,
Zhang
M.
,
Wang
P.
,
Zhao
K.
,
Zhao
X.
et al. .
(
2013
)
USP4 positively regulates RIG-I-mediated antiviral response through deubiquitination and stabilization of RIG-I
.
J. Virol.
87
,
4507
4515
[PubMed]
35.
Zhang
L.
,
Zhou
F.
,
Drabsch
Y.
,
Gao
R.
,
Snaar-Jagalska
B.E.
,
Mickanin
C.
et al. .
(
2012
)
USP4 is regulated by AKT phosphorylation and directly deubiquitylates TGF-β type I receptor
.
Nat. Cell Biol.
14
,
717
726
[PubMed]
36.
Liang
L.
,
Fan
Y.
,
Cheng
J.
,
Cheng
D.
,
Zhao
Y.
,
Cao
B.
et al. .
(
2013
)
TAK1 ubiquitination regulates doxorubicin-induced NF-κB activation
.
Cell. Signal.
25
,
247
254
[PubMed]
37.
Xiao
N.
,
Li
H.
,
Luo
J.
,
Wang
R.
,
Chen
H.
,
Chen
J.
et al. .
(
2012
)
Ubiquitin-specific protease 4 (USP4) targets TRAF2 and TRAF6 for deubiquitination and inhibits TNFα-induced cancer cell migration
.
Biochem. J.
441
,
979
986
[PubMed]

Author notes

These authors contributed equally to this work.