Abstract

Diabetic foot ulcer is a life-threatening clinical problem in diabetic patients. Endothelial cell-derived small extracellular vesicles (sEVs) are important mediators of intercellular communication in the pathogenesis of several diseases. However, the exact mechanisms of wound healing mediated by endothelial cell-derived sEVs remain unclear. sEVs were isolated from human umbilical vein endothelial cells (HUVECs) pretreated with or without advanced glycation end products (AGEs). The roles of HUVEC-derived sEVs on the biological characteristics of skin fibroblasts were investigated both in vitro and in vivo. We demonstrate that sEVs derived from AGEs-pretreated HUVECs (AGEs-sEVs) could inhibit collagen synthesis by activating autophagy of human skin fibroblasts. Additionally, treatment with AGEs-sEVs could delay the wound healing process in Sprague–Dawley (SD) rats. Further analysis indicated that miR-106b-5p was up-regulated in AGEs-sEVs and importantly, in exudate-derived sEVs from patients with diabetic foot ulcer. Consequently, sEV-mediated uptake of miR-106b-5p in recipient fibroblasts reduces expression of extracellular signal-regulated kinase 1/2 (ERK1/2), resulting in fibroblasts autophagy activation and subsequent collagen degradation. Collectively, our data demonstrate that miR-106b-5p could be enriched in AGEs-sEVs, then decreases collagen synthesis and delays cutaneous wound healing by triggering fibroblasts autophagy through reducing ERK1/2 expression.

Introduction

Diabetic foot ulceration is associated with significant costs and considerable morbidity and mortality worldwide, which is a consequence of the complex interactions between wound repair and regeneration irregularities [1,2]. Advanced glycation end products (AGEs) are deemed to be critical regulators in the pathogenesis of diabetic skin tissues [3,4]. Our previous studies have found that excessive accumulation of AGEs have deleterious outcomes in diabetic dermopathy by delaying diabetic wound healing [5,6].

Fibroblasts play a key role in the proliferation and remodeling phases of wound healing, while the deposition of collagen by fibroblasts acts as a foundation for the extracellular matrix (ECM) formation [7]. In addition, wound healing is a complex process correlating with the appearance and dynamic balance of other cell types. Endothelial cells could secret chemokines and be responsive to many angiogenic factors, directly as well as indirectly, participating in the pathogenic processes of many diseases [8].

Extracellular vesicles (EVs) were proposed to define the lipid bilayer-enclosed extracellular structures since 2011 [9], including exosomes and microvesicles. Exosomes, a subtype of EVs, have the same size as intraluminal vesicles (ILVs) which are formed by the inward budding of endosomal membrane during maturation of multi-vesicular endosomes (MVEs) and they are secreted by fusion of MVEs to the cell membrane [10]. On the basis of the biogenesis and different components, the biological function among subtypes of EVs would be different. However, the current available isolation methods cannot totally separate exosomes from other types of EVs [11]. Moreover, it is still challenging to set a more precise nomenclature for EVs considering the overlapping range of size, semblable morphology and diverse compositon [12,13]. There are no EV-specific markers available that can distinguish subsets of EVs from each other [14]. In our study, to be more accurate, we refer ‘sEVs’ instead of ‘exosomes’ though the size distribution and some of the protein markers of our extracted particles is in accordance with the characteristics of exosomes.

sEVs are small lipid bilayer-enclosed EVs (30–200 nm) that have the capacity to load numerous microRNAs (miRNAs), which have been identified to participate in pathophysiological processes by working locally or secreting into the extracellular space to modulate the function of recipient cells [15–17]. Endothelial cells can release EVs carried with miRNAs into the surrounding environment or enter the circulation. Endothelial cells can reportedly regulate co-cultured smooth muscle cell phenotypes through an EV-mediated mechanism, suggesting the important role of endothelial cells in paracrine or endocrine regulation signaling [18]. Recently, Halkein et al. [19] reported that exosomes from endothelial cells could transfer miR-146a to cardiomyocytes and subsequently inhibit their metabolic activity by decreasing the expression of genes linked to glucose uptake. As an important component of intercellular communication, exosomes derived from endothelial progenitor cells can promote angiogenic activities of endothelial cells and, in turn, facilitate wound repair and regeneration [20]. This led us to hypothesize that endothelial cells secrete miRNAs packed in EVs, which serve as extracellular molecules that can regulate the wound healing process.

Table 1
Primer sequences of mRNAs and miRNAs
Gene name Primer sequence 
Collagen I Forward: GCTCGTGGAAATGATGGTGC 
 Reverse: ACCCTGGGGACCTTCAGAG 
Collagen III Forward: CCTGAAGCTGATGGGGTCAA 
 Reverse: ACAGCCTTGCGTGTTCGATA 
ERK1/2 Forward: GACTGGACGTGCTCAGACAT 
 Reverse: CCTCCAAACGGCTCAAAGGA 
Actin Forward: TGGAACGGTGAAGGTGACAG 
 Reverse: AACAACGCATCTCATATTTGGAA 
hsa-miR-22-3p AAGCTGCCAGTTGAAGAACT 
hsa-miR-31-5p GGCAAGATGCTGGCATAGC 
hsa-miR-92a-3p GCACTTGTCCCGGCCTGT 
hsa-miR-323a-3p ACATTACACGGTCGACCTCT 
hsa-miR-222-3p CTACATCTGGCTACTGGGT 
hsa-miR-224-5p CTCTAGTGGTTCCGTTTAGAA 
hsa-miR-500a-3p CACCTGGGCAAGGATTCTG 
hsa-miR-106b-5p TAAAGTGCTGACAGTGCAGAT 
hsa-miR-148b-3p TCAGTGCATCACAGAACTTTGT 
hsa-miR-181a-5p ATTCAACGCTGTCGGTGAGT 
hsa-miR-181b-5p ATTCATTGCTGTCGGTGGGT 
hsa-miR-181c-5p CATTCAACCTGTCGGTGAGT 
hsa-miR-181d-5p ATTCATTGTTGTCGGTGGGT 
hsa-miR-196b-5p TAGGTAGTTTCCTGTTGTTGG 
hsa-miR-487b-3p TCGTACAGGGTCATCCACTT 
hsa-miR-654-3p TGTCTGCTGACCATCACCTT 
U6 Forward: GGAACGATACAGAGAAGATTAGC 
 Reverse: TGGAACGCTTCACGAATTTGCG 
Gene name Primer sequence 
Collagen I Forward: GCTCGTGGAAATGATGGTGC 
 Reverse: ACCCTGGGGACCTTCAGAG 
Collagen III Forward: CCTGAAGCTGATGGGGTCAA 
 Reverse: ACAGCCTTGCGTGTTCGATA 
ERK1/2 Forward: GACTGGACGTGCTCAGACAT 
 Reverse: CCTCCAAACGGCTCAAAGGA 
Actin Forward: TGGAACGGTGAAGGTGACAG 
 Reverse: AACAACGCATCTCATATTTGGAA 
hsa-miR-22-3p AAGCTGCCAGTTGAAGAACT 
hsa-miR-31-5p GGCAAGATGCTGGCATAGC 
hsa-miR-92a-3p GCACTTGTCCCGGCCTGT 
hsa-miR-323a-3p ACATTACACGGTCGACCTCT 
hsa-miR-222-3p CTACATCTGGCTACTGGGT 
hsa-miR-224-5p CTCTAGTGGTTCCGTTTAGAA 
hsa-miR-500a-3p CACCTGGGCAAGGATTCTG 
hsa-miR-106b-5p TAAAGTGCTGACAGTGCAGAT 
hsa-miR-148b-3p TCAGTGCATCACAGAACTTTGT 
hsa-miR-181a-5p ATTCAACGCTGTCGGTGAGT 
hsa-miR-181b-5p ATTCATTGCTGTCGGTGGGT 
hsa-miR-181c-5p CATTCAACCTGTCGGTGAGT 
hsa-miR-181d-5p ATTCATTGTTGTCGGTGGGT 
hsa-miR-196b-5p TAGGTAGTTTCCTGTTGTTGG 
hsa-miR-487b-3p TCGTACAGGGTCATCCACTT 
hsa-miR-654-3p TGTCTGCTGACCATCACCTT 
U6 Forward: GGAACGATACAGAGAAGATTAGC 
 Reverse: TGGAACGCTTCACGAATTTGCG 

Abbreviation: ERK1/2, extracellular signal-regulated kinase 1/2.

In the current paper, we used sEVs derived from human umbilical vein endothelial cells (HUVECs) pretreated with AGEs (AGEs-sEVs) to explore whether sEVs could control fibroblasts’ phenotypes and the wound healing process. We found that AGEs-sEVs could inhibit the secretion of collagen types I and III in human skin fibroblasts, while local injection of AGEs-sEVs into the rats’ skin wounds markedly delayed the wound healing. AGEs-sEVs administration promoted autophagy flux in skin fibroblasts, and the addition of 3-methyladenine (3-MA) inhibited fibroblasts autophagy and rescued the collagen protein levels. Finally, we verified that miR-106b-5p is among the markedly altered miRNAs in AGEs-sEVs from HUVECs and the gene extracellular signal-regulated kinase 1/2 (ERK1/2) to be a direct target of miR-106b-5p and responsible for decrease in collagen synthesis in fibroblasts. Specifically, the inhibition of ERK1/2 has been described to be a key event in the induction of autophagy, which is consistent with the observed fibroblasts autophagy activation when treated with AGEs-sEVs in the present study [21,22].

Here, we studied the effect of AGEs-sEVs in wound healing both in vitro and in vivo, and for the first time, demonstrated that miR-106b-5p is among the differentially expressed miRNAs in AGEs-sEVs and that miR-106b-5p can inhibit fibroblasts phenotypes and trigger autophagy through a mechanism most likely related to suppression of the ERK1/2 pathway.

Materials and methods

Cell culture and treatment

Human primary foreskin fibroblasts, which were provided by Dr. Cheng (Sun Yat-sen University, China), were cultured in Dulbecco’s modified Eagle’s medium (DMEM, Gibco, U.S.A.) supplemented with 10% fetal bovine serum (FBS) (Gibco, U.S.A.), 100 U/ml of penicillin, and 100 μg/ml of streptomycin. The fibroblasts we obtained were identified using immunofluorescence of vimentin (Supplementary Figure S1). The HUVECs were purchased from Procell (Wu Han, China) and cultured in ECM supplemented with 5% FBS, 100 U/ml of penicillin, 100 μg/ml of streptomycin, and 1% endothelial cell growth supplement (ECGS). All the cells were incubated in a humidified incubator containing 5% CO2 at 37°C. Cells at passages 3–10 were used for subsequent experiments and were starved of serum overnight before various stimulations. For treatment of HUVECs, after reaching 80% confluence, cells were stimulated with or without 100 mg/l of AGEs-bovine serum albumin (AGEs, Merck Millipore) in ECM supplemented with sEVs-depleted serum for 48 h, and the cell medium was collected for subsequent sEVs isolation. sEVs-depleted serum was prepared by ultracentrifugation at 120000×g overnight (at least 12 h) at 4°C, followed by passage through a 0.22-μm filter (Millipore) prior to use. On the basis of the results of our preliminary experiments and published articles online, we finally determined the doses of HUVEC-derived sEVs used in in vitro and in vivo experiments. Fibroblasts were treated with 5 and 25 μg/ml of sEVs derived from HUVECs pretreated with or without 100 mg/l of AGEs for 48 h (AGEs-sEVs or Con-sEVs) or phosphate-buffered saline (PBS) only (Control).

Table 2
Reagents used in the current study
Antibodies Source Identifier 
Mouse monoclonal anti-CD63 Abcam Cat# ab8219 
Rabbit monoclonal anti-CD9 Abcam Cat# ab92726 
Rabbit polyclonal anti-TSG101 Abcam Cat# ab30871 
Rabbit polyclonal anti-Grp94 Abcam Cat# ab13509 
Rabbit monoclonal anti-vimentin Abcam Cat# ab92547 
Rabbit polyclonal anti-LC3B Cell Signaling Technology Cat# 2775 
Rabbit polyclonal anti-beclin-1 Cell Signaling Technology Cat# 3738 
Rabbit polyclonal anti-collagen I Abcam Cat# ab34710 
Mouse monoclonal anti-collagen III Abcam Cat# ab6310 
Rabbit polyclonal anti-Erk1/2 Cell Signaling Technology Cat# 9102 
Rabbit polyclonal anti-β-actin Cell Signaling Technology Cat# 4967 
Mouse monoclonal anti-argonaute 2 Abcam Cat# ab57113 
Antibodies Source Identifier 
Mouse monoclonal anti-CD63 Abcam Cat# ab8219 
Rabbit monoclonal anti-CD9 Abcam Cat# ab92726 
Rabbit polyclonal anti-TSG101 Abcam Cat# ab30871 
Rabbit polyclonal anti-Grp94 Abcam Cat# ab13509 
Rabbit monoclonal anti-vimentin Abcam Cat# ab92547 
Rabbit polyclonal anti-LC3B Cell Signaling Technology Cat# 2775 
Rabbit polyclonal anti-beclin-1 Cell Signaling Technology Cat# 3738 
Rabbit polyclonal anti-collagen I Abcam Cat# ab34710 
Mouse monoclonal anti-collagen III Abcam Cat# ab6310 
Rabbit polyclonal anti-Erk1/2 Cell Signaling Technology Cat# 9102 
Rabbit polyclonal anti-β-actin Cell Signaling Technology Cat# 4967 
Mouse monoclonal anti-argonaute 2 Abcam Cat# ab57113 

sEVs isolation and identification

sEVs were isolated from conditioned medium by differential centrifugations based on the method of Thery et al. [23]. Briefly, the collected cellular medium underwent a series of centrifugation steps to remove cell debris (300×g for 10 min, 3000×g for 20 min), and the supernatant was filtered through 0.22-μm filters (Merck Millipore). Then, the medium was subjected to ultracentrifugation at 10000×g for 30 min, and the sEVs were isolated by ultracentrifugation at 100000×g for 70 min. After washing with PBS (100000×g for another 70 min), the sEV-containing pellet was re-suspended in PBS. All procedures were performed at 4°C. The characterization of sEVs was confirmed by measuring the expression of protein markers, such as CD9, CD63 and TSG101 by Western blotting analysis. Nanosight particle tracking analysis (NTA) was performed to analyze the size distribution of sEVs, and sEVs morphology was investigated using transmission electron microscopy (TEM).

sEVs labeling

For sEVs labeling, sEVs were stained with a red fluorescent dye (PKH26; Sigma–Aldrich) following the manufacturer’s instructions. In brief, sEVs from 2 × 106 cells were suspended in 100 μl of PBS with 4 μl of 1:250 diluted PKH26 (in Diluent C), and the mixture was incubated at room temperature (RT) for 5 min, followed by adding an equal volume of sEVs-free serum to terminate the reaction. The labeled sEVs were harvested and washed twice with PBS through ultracentrifugation again. The re-suspended sEVs labeled with PKH26 were added to fibroblasts to co-incubate for 24 h at 37°C. After treatment with sEVs, cells were fixed with 4% paraformaldehyde in PBS for 15 min at RT, 4′,6-diamidino-2-phenylindole (DAPI, Solarbio) was added to stain the nuclei for 5 min at RT, and stained cells were observed by confocal laser scanning microscopy.

Table 3
Clinical characteristics of diabetic patients with foot ulcers and non-dabetic patients
 Control DFU P-value 
n 10 11 
Gender (female/male) 8/2 7/4 
Age 49.00 ± 5.70 62.64 ± 12.36 0.087 
BMI (kg/m221.20 ± 1.83 24.16 ± 2.38 0.079 
SBP (mmHg) 125.80 ± 15.63 128.18 ± 18.36 0.330 
DBP (mmHg) 82.30 ± 9.17 73.00 ± 10.27 0.194 
Glycosuria (%)1 63.63 0.0043 
FBG (mmol/l) 5.30 ± 0.39 11.56 ± 4.87 <0.0014 
Cr (μmol/l) 78.50 (69.00–99.25) 83.00 (57.00–141.00) 0.651 
RBC (×1012/l) 4.55 ± 0.45 3.44 ± 0.60 0.402 
WBC (×109/l) 5.30 ± 0.44 7.97 ± 1.70 0.0063 
PLT (×109/l) 252.76 ± 41.58 379.36 ± 96.08 0.0342 
Hb (g/l) 127.13 ± 18.41 94.00 ± 16.34 0.651 
 Control DFU P-value 
n 10 11 
Gender (female/male) 8/2 7/4 
Age 49.00 ± 5.70 62.64 ± 12.36 0.087 
BMI (kg/m221.20 ± 1.83 24.16 ± 2.38 0.079 
SBP (mmHg) 125.80 ± 15.63 128.18 ± 18.36 0.330 
DBP (mmHg) 82.30 ± 9.17 73.00 ± 10.27 0.194 
Glycosuria (%)1 63.63 0.0043 
FBG (mmol/l) 5.30 ± 0.39 11.56 ± 4.87 <0.0014 
Cr (μmol/l) 78.50 (69.00–99.25) 83.00 (57.00–141.00) 0.651 
RBC (×1012/l) 4.55 ± 0.45 3.44 ± 0.60 0.402 
WBC (×109/l) 5.30 ± 0.44 7.97 ± 1.70 0.0063 
PLT (×109/l) 252.76 ± 41.58 379.36 ± 96.08 0.0342 
Hb (g/l) 127.13 ± 18.41 94.00 ± 16.34 0.651 
1

The positive rates of glycosuria on the subjects.

2P<0.05.

3P<0.01.

4P<0.001.

Western blotting

Protein lysates were prepared from cells using radioimmunoprecipitation assay (RIPA) lysis buffer (CWBIO) supplemented with a cocktail of protease and phosphatase inhibitors (CWBIO). sEVs were directly used for protein analysis. Total protein levels of cells and sEVs were measured using the BCA Protein Assay Kit (Thermo Fisher Scientific). Lysates were diluted at a ratio of 1:5 with protein loading buffer (Solarbio) and heated at 95°C for 10 min. Then, equal amounts of protein (20 μg) were subjected to Western blotting. Protein extracts were separated by sodium dodecyl sulfate/polyacrylamide gel electrophoresis (SDS/PAGE) and transferred to polyvinylidene difluoride (PVDF) membranes (Merck Millipore). The membranes were then blocked for 1 h with 5% nonfat milk in TBST (Tris-buffered saline, 10 mM Tris/HCl pH 7.5, 150 mM NaCl, 0.1% Tween-20). The membranes were incubated with primary antibodies at 4°C overnight, followed by incubation with horseradish peroxidase–conjugated secondary antibodies at 37°C for 1 h. Immunoreactive bands were detected with the Immobilon Western Chemiluminescent HRP Substrate (Merck Millipore) and imaged by the Mini Chemi imaging system (Sage Creation). Densitometric quantitation of band intensity was carried out with ImageJ 5.0 software, and the relative expression level of target protein was normalized to the band intensity of the internal control (β-actin). Western blotting data in figures were all representative of more than three independent experiments. Information of antibodies used in the current study are listed in table 2.

RNA extraction and quantitative reverse transcription polymerase chain reaction

Total RNA from cultured cells was extracted using RNAiso Plus (Takara) according to the manufacturer’s instructions. MiRNAs of sEVs were isolated using the SeraMir Exosome RNA Purification Column Kit (SBI). For mRNA detection, complementary DNA (cDNA) was synthesized from 500 ng of total RNA using a ‘PrimeScript™ RT Master Mix (Takara)’. For miRNA expression analysis, 500 ng total RNA was reverse-transcription into cDNA using ‘Mir-X™ miRNA First Strand and Synthesis kit (Takara)’ as described by the manufacturer’s protocol. Then, quantitative reverse transcription polymerase chain reaction (qRT-PCR) analysis was performed with ‘TB Green™ Premix ExTaq™ II’ on a LightCycler 480 II instrument (Roche). The relative level of gene expressions were calculated by the 2−ΔΔCT method, after normalization with the abundance of U6. U6 was used as an internal control for comparison of relative changes in miRNA between different groups [24–26]. The sequences of all indicated primers are listed in Table 1.

Animal studies

All procedures were approved by the Animal Research Committee of Sun Yat-sen University. Eight-week-old male Sprague–Dawley (SD) rats (weighing 250–300 g) were purchased from the Laboratory Animal Center of the Sun Yat-Sen University. A skin wound was made as described previously [27]. Briefly, SD rats were anesthetized by intraperitoneal (i.p.) administration of 50 mg/kg of pentobarbital sodium (Sigma–Aldrich, St. Louis, MO, U.S.A.) before operation. After shaving the rat, one full-thickness excisional skin wound (10 mm in diameter) was made on the dorsum. The SD rats were divided into three groups randomly, which were subcutaneously injected with Con-sEVs or AGEs-sEVs (200 μg dissolved in 100 μl PBS) or an equal volume of PBS around the wounds at four injection sites (25 μl per site). One week after operation, they were killed, and skin specimens were obtained for further experiments.

Hematoxylin and Eosin, Masson’s trichrome staining and Sirius Red staining

The skin tissues excised 1 week after operation were stained with Hematoxylin and Eosin (HE) for historical analysis. The edge of scars and the wound areas were measured using ImageJ software, and the percentage of re-epithelialization was calculated using the equation: E% = WN/WO × 100, where WO stands for original wound area, and WN means the length of newly generated epithelium across the surface of the wound. Masson’s trichrome staining (Bogoo Biotechnology, Shanghai, China) and Sirius Red staining (Solarbio, Beijing, China) were conducted following the manufacturers’ instructions to analyze the degree of collagen maturity in the wound beds.

Proliferation assay

Cell proliferation was performed using a Cell Counting Kit 8 (CCK-8) kit (CW Biotech, Beijing, China) according to the manufacturer’s instructions. The 5-Ethynyl-2′-deoxyuridine (EdU) DNA proliferation assay was performed according to the manufacturer’s instructions (Ribobio). Images were obtained using the inverted fluorescence microscope at 100× magnification. The percentage of EdU-positive cells was calculated from five fields at random using ImageJ software.

Migration assay

Wound healing assay was determined to assess horizontal migration abilities of fibroblasts. Cells were seeded into a six-well plate, and when the cells had attached, the monolayer was scratched with a pipette tip and washed with PBS to remove floating cells, then exposed to sEVs (5 and 25 μg/ml) from different groups or an equal volume of PBS dissolved in DMEM without FBS. Cells were photographed at 0, 6 and 12 h after wounding. The wound closure rate was calculated using the equation: Migration area (%) = (A0 − An)/A0 × 100, where A0 represents the area of initial wound and An represents the remaining area of wound at the measuring point.

Flow cytometric analysis

Fibroblasts were collected from different groups and washed in PBS once, then re-suspended in binding buffer. A 5-μl Annexin V-FITC reagent was added, and the cells were incubated at RT in the dark for 15 min, and then 10 µl of propidium iodide (PI) was added and samples were detected using a fluorescence-activated cell sorting (FACS, Becton Dickinson, Franklin Lakes, NJ, U.S.A.) analyzer. Analysis was carried out in triplicate.

MiRNA microarray analysis and target prediction

Microarray analysis of miRNAs from sEVs, including sample labeling, array hybridization, data collection, and normalization, was performed by Kang Chen Bio-tech (Shanghai, China) according to the Agilent miRNA Microarray System with miRNA Complete Labeling and Hyb Kit protocol (Agilent Technology). Quantile normalization and subsequent data processing were performed using Gene Spring GX v12.1 software package (Agilent Technologies). Hierarchical clustering analysis of differentially expressed miRNAs between the two groups was performed using the R scripts. Fold change ≥ 2.0 or ≤ 0.5 and P<0.05 were the threshold to filtrate differentially expressed miRNAs. miRDB V5.0, miRNAMap and TargetScan 7.2 software were used to predict target genes of candidate miRNAs. Kyoto Encyclopedia of Genes and Genomes (KEGG) analysis of the common target genes were further performed using the DAVID 6.8 website (https://david.ncifcrf.gov/home.jsp).

Dual luciferase reporter assay

For identifying the binding site between miR-106b-5p and ERK1/2, the 3′ untranslated regions (UTRs) of ERK1/2 including wild-type (wt) or mutant type (mut) of the binding site were cloned downstream of the firefly luciferase gene in GV272 repoter vector (GenePharma Co., China) and 293T cells were used for reporter assays. Briefly, cells were co-transfected with wt or mut ERK1/2 3′ UTR vector and the control vector coding for Renilla luciferase. Then the cells were transfected with lentiviral vector with overexpression of miR-106b-5p or an empty vector. Luciferase activities were dected using the Dual-Luciferase Reporter Assay System (Promega, U.S.A.) according to manufacturer’s protocol. The relative luciferase activity was normalized to the Renilla luciferase activity.

Argonaute-RNA co-immunoprecipitation assay

An anti-AGO2 antibody (Ab57113, Abcam) and the Magna RIP RNA-Binding Protein Immunoprecipitation Kit (17-700, Millipore) were used to perform RNA immunoprecipitation (IP) of AGO2-containing RNA-induced silencing complex (RISC) according to manufacturer’s protocol.

Statistical analysis

For quantitation analysis, each experiment was performed at least three times, and all values were presented as mean ± standard deviation (S.D.). Data analysis was performed using the SPSS software version 22.0. The Student’s ttest was used to determine statistical significance between the two groups while one-way analysis of variance (ANOVA) was applied for comparison of three or more groups. A value of P<0.05 was considered statistically significant.

Results

Characterization of sEVs derived from HUVECs

We have previously elucidated the phenomenon of the decrease and disorganization of collagen in diabetic skin tissues compared with normal skin tissues [28,29]. In the present study, we further confirmed such changes both in human skin tissues and SD rat skin tissues (Figure 1A). We supposed that HUVEC-derived sEVs may play a role in human skin fibroblasts’ biological functions and regulate the wound healing process. To verify our supposition, we then collected and identified sEVs derived from HUVECs.

Characteristics of sEVs derived from HUVECs

Figure 1
Characteristics of sEVs derived from HUVECs

(A) Representative images of Masson’s staining of human and SD rat skin tissues. Scale bar: 100 μm. (B) TEM analysis of sEVs secreted by HUVECs. Scale bar: 200 nm. Black arrow indicates the representative morphology of sEVs. (C) Size distribution of sEVs was measured by NTA. (D) sEVs-related markers and negative markers were detected by Western blotting. The blots are representative of more than three replicated independent experiments. (E) sEVs production by HUVECs. (F) sEVs derived from HUVECs were labeled with PKH26 and co-incubated with fibroblasts for 12 h, and the representative images photographed by confocal microscope are showed above. Scale bar: 50 μm.

Figure 1
Characteristics of sEVs derived from HUVECs

(A) Representative images of Masson’s staining of human and SD rat skin tissues. Scale bar: 100 μm. (B) TEM analysis of sEVs secreted by HUVECs. Scale bar: 200 nm. Black arrow indicates the representative morphology of sEVs. (C) Size distribution of sEVs was measured by NTA. (D) sEVs-related markers and negative markers were detected by Western blotting. The blots are representative of more than three replicated independent experiments. (E) sEVs production by HUVECs. (F) sEVs derived from HUVECs were labeled with PKH26 and co-incubated with fibroblasts for 12 h, and the representative images photographed by confocal microscope are showed above. Scale bar: 50 μm.

sEVs were isolated and purified from conditioned media of HUVECs by ultracentrifugation. TEM, NTA and Western blotting were used to characterize the extracted pellets. The cup-shaped or sphere-shaped morphological structures were represented to be sEVs (Figure 1B). Size and number of HUVECs derived sEVs was detected by NTA, showing that particles isolated by ultracentrifugation contain abundant HUVEC-derived EVs with a diameter of 30–200 nm, which was in accordance with the previously reported size distributions of sEVs (Figure 1C). Western blotting showed the presence of sEVs protein markers, including CD63, CD9 and TSG101. The endoplasmic reticulum protein Grp94, which was reported to be hardly detectable in sEVs by Kowal et al. [13], was not detected in our study (Figure 1D). Moreover, we analyzed the sEVs production derived from HUVECs pretreated with or without AGEs, and there was no difference in sEVs secretion between the two groups (Figure 1E). In all, these results indicated that the vesicles isolated from the conditioned media of HUVECs were likely to be sEVs.

In order to analyze whether the HUVEC-derived sEVs can be taken up by human skin fibroblasts, we labeled the vesicles with a red fluorescent dye PKH26 (Sigma, U.S.A.) and after incubation, images were taken by confocal microscope. We found that fibroblasts exhibited efficient uptake of the HUVEC-derived sEVs by indication of the presence of red fluorescence staining in recipient cells (Figure 1F).

sEVs derived from HUVECs pretreated with AGEs trigger autophagy in human skin fibroblasts

Human skin fibroblasts were treated with HUVEC-derived sEVs (Con-sEVs) and AGEs-sEVs and the biological characters were investigated. The proliferation of fibroblasts was detected by CCK-8 assay and EdU staining assay. The results showed that AGEs-sEVs treatment did not affect the cell viability and proliferation (Figure 2A,B). Flow cytometric analysis was performed to analyze the apoptosis of fibroblasts. The percentage of apoptotic cells were not increased after treatments with AGEs-sEVs compared with control group or Con-sEVs group (Figure 2C). Wound healing assay was performed to evaluate the migration of fibroblasts. As shown in Figure 2D, we found no significant differences among groups at any time point in wound healing assay.

Biological impacts of HUVEC-derived sEVs on human skin fibroblasts

Figure 2
Biological impacts of HUVEC-derived sEVs on human skin fibroblasts

(A,B) Cell proliferation was determined using a CCK-8 assay in vitro at the indicated times as well as an EdU staining assay 72 h after sEVs administration. Scale bar: 500 μm. (C) Cells were treated with PBS control, Con-sEVs and AGEs-sEVs with different doses and cell apoptosis was analyzed by flow cytometry. Representative images of three replicated experiments and quantitative results of all tests are shown. (D) The motility of fibroblasts was analyzed by wound healing assay. Scale bar: 500 μm. (E) Autophagy-related proteins LC3 and Beclin-1 expression in fibroblasts treated with Con-sEVs or AGEs-sEVs or PBS control by Western blotting. The representative images of triple experiments were showed. (F,G) The LC3-II/LC3-I ratio among samples with and without rapamycin (5 mM) and 3-MA (10 mM), respectively, was compared under Con-sEVs or AGEs-sEVs with different concentration conditions. *P<0.05, **P<0.01.

Figure 2
Biological impacts of HUVEC-derived sEVs on human skin fibroblasts

(A,B) Cell proliferation was determined using a CCK-8 assay in vitro at the indicated times as well as an EdU staining assay 72 h after sEVs administration. Scale bar: 500 μm. (C) Cells were treated with PBS control, Con-sEVs and AGEs-sEVs with different doses and cell apoptosis was analyzed by flow cytometry. Representative images of three replicated experiments and quantitative results of all tests are shown. (D) The motility of fibroblasts was analyzed by wound healing assay. Scale bar: 500 μm. (E) Autophagy-related proteins LC3 and Beclin-1 expression in fibroblasts treated with Con-sEVs or AGEs-sEVs or PBS control by Western blotting. The representative images of triple experiments were showed. (F,G) The LC3-II/LC3-I ratio among samples with and without rapamycin (5 mM) and 3-MA (10 mM), respectively, was compared under Con-sEVs or AGEs-sEVs with different concentration conditions. *P<0.05, **P<0.01.

Autophagy participates in various physiological and pathological processes, and excess activation or inhibition of autophagy can affect cell viability and biological function. The process of autophagy has emerged as a potential therapeutic target for the treatment of diabetes and its complications [30,31]. Emerging evidence suggests that the coordination of autophagy and sEVs release occurs in multiple different ways [32]. Therefore, we investigated the impact of AGEs-sEVs on fibroblasts autophagy in the study. The relative expression of LC3-II to LC3-I ratio (LC3-II/LC3-I) and expression of Beclin-1 is used to evaluate the degree of autophagy. Our results indicated that the high dose of AGEs-sEVs administration stimulated the expressions of LC3-II/LC3-I and Beclin-1 in human skin fibroblasts (Figure 2E). In order to further confirm the relationship between fibroblasts autophagy and AGEs-sEVs derived from HUVECs, we treated fibroblasts with rapamycin or 3-MA to activate or inhibit the autophagy level, followed by detecting the autophagy related protein expression levels with administration of HUVEC-derived sEVs. As shown in Figure 2F, AGEs-sEVs together with rapamycin, an activator of autophagy, could further increase the level of autophagy. In contrast, when fibroblasts were treated with AGEs-sEVs together with 3-MA, an inhibitor of PI3K, the effect of AGEs-sEVs on autophagy activation in fibroblasts was suppressed (Figure 2G).

AGEs-sEVs suppress the collagen synthesis and secretion in human skin fibroblasts through triggering autophagy

Collagen, especially collagen types I and III, is an important component of ECM in skin and plays a significant role in wound healing. Collagen synthesis and secretion is a critical function of skin fibroblasts, and how hyperglycemia condition regulates this process remains unclear. We tend to investigate the effect of HUVEC-derived sEVs after AGEs treatment on collagen synthesis and secretion of human skin fibroblasts. There was no difference among groups with or without different concentrations of HUVEC-derived sEVs in collagen type I and III mRNA levels (Figure 3A). However, the protein level of collagen types I and III were both decreased under AGEs-sEVs administration (Figure 3B) and accordingly, the secretion of collagen was suppressed after AGEs-sEVs treatment by enzyme-linked immunosorbent assay (ELISA, Figure 3C). Together, the results indicated that AGEs-sEVs took part in the post-transcriptional mechanism of collagen synthesis.

AGEs-sEVs suppress the collagen synthesis and secretion in human skin fibroblasts through triggering autophagy

Figure 3
AGEs-sEVs suppress the collagen synthesis and secretion in human skin fibroblasts through triggering autophagy

(A) Expressions of collagen types I and III were validated by qRT-PCR. β-actin was the internal control, and experiments were replicated three times. (B) The protein expressions of collagen types I and III were suppressed by AGEs-sEVs. β-actin was used as an internal control. (C) The secretion level of collagen types I and III was performed by ELISA kit assay and AGEs-sEVs could decrease the secretion level of both collagen types I and type III. (D,E) AGEs-sEVs decreased the protein expression level of collagen types I and III under rapamycin administration conditions, while the collagen protein expression level was restored under the condition of AGEs-sEVs together with 3-MA administration. *P<0.05, **P<0.01.

Figure 3
AGEs-sEVs suppress the collagen synthesis and secretion in human skin fibroblasts through triggering autophagy

(A) Expressions of collagen types I and III were validated by qRT-PCR. β-actin was the internal control, and experiments were replicated three times. (B) The protein expressions of collagen types I and III were suppressed by AGEs-sEVs. β-actin was used as an internal control. (C) The secretion level of collagen types I and III was performed by ELISA kit assay and AGEs-sEVs could decrease the secretion level of both collagen types I and type III. (D,E) AGEs-sEVs decreased the protein expression level of collagen types I and III under rapamycin administration conditions, while the collagen protein expression level was restored under the condition of AGEs-sEVs together with 3-MA administration. *P<0.05, **P<0.01.

In our study, we demonstrated that AGEs-sEVs could activate the autophagy level of human skin fibroblasts, and at the same time, the collagen synthesis and secretion were suppressed. Whether AGEs-sEVs suppresses the collagen synthesis and secretion by triggering fibroblasts autophagy remains unknown. In the following, we activated or suppressed autophagy of fibroblasts at different stages of autophagy flux to see the relationship between autophagy level and collagen synthesis in human skin fibroblasts. Our results gave an indication that when autophagy was activated by rapamycin administration, the collagen protein level was decreased in the AGEs-sEVs treatment group compared with the control or Con-sEVs treatment groups (Figure 3D). Conversely, the collagen protein level was restored under AGEs-sEVs administration conditions compared with all other groups when we treated fibroblasts with 3-MA, an inhibitor of PI3K to suppress autophagy (Figure 3E). Overall, AGEs-sEVs affects the collagen synthesis and secretion of human skin fibroblasts probably through triggering fibroblasts autophagy.

AGEs-sEVs suppress cutaneous wound healing in SD rats in vivo

To explore whether the local administration of AGEs-sEVs could influence the collagen maturity during cutaneous wound healing, 18 SD rats weighing 250–300 g were randomly divided into three groups receiving PBS, Con-sEVs and AGEs-sEVs, respectively, and a full-thickness cutaneous wound of 1 cm in diameter was created on the dorsal skin of all of the rats. Seven days post-wounding, wound skin tissues were collected for HE, Masson’s staining and Sirius Red staining. The process in closure of the wounds with different treatments is showed by digital photographs, and as Figure 4A shows, the wound sizes of the AGEs-sEVs group were larger than the other two groups, and the difference became more obvious at day 7 post-wounding. The extents of re-epithelialization, scar formation and collagen maturity were measured to evaluate the regeneration of cutaneous wound healing. Our results showed that wounds treated with AGEs-sEVs led to delayed re-epithelialization and wider scars compared with that treated with PBS or Con-sEVs at day 7 post-wounding (Figure 4B–D). Moreover, Masson’s staining and Sirius Red staining demonstrated that the deposition of collagen especially collagen type I was sparser and heterogeneous in AGEs-sEVs treatment group after wounding (Figure 4E). The above results indicated that AGEs-sEVs treatment led to a significant delay of the wound healing process in SD rats.

AGEs-sEVs suppress cutaneous wound healing in SD rats in vivo

Figure 4
AGEs-sEVs suppress cutaneous wound healing in SD rats in vivo

(A) Representative images of cutaneous wounds with PBS, Con-sEVs or AGEs-sEVs treatment at days 0, 4 and 7 post-wounding. (B) HE staining of wound section with different treatments at day 7 post-wounding. Scale bar: 500 μm. The double-headed arrows represent the edge of the scar. (C,D) The extent of re-epithelialization and scar widths of three groups were measured at day 7 post-wounding. (E) Transmitted light images of Masson’s staining and Sirius Red staining of three groups to evaluate collagen maturity. Scale bar (left and right): 100 μm. Scale bar (middle): 50 μm. *P<0.05, **P<0.01.

Figure 4
AGEs-sEVs suppress cutaneous wound healing in SD rats in vivo

(A) Representative images of cutaneous wounds with PBS, Con-sEVs or AGEs-sEVs treatment at days 0, 4 and 7 post-wounding. (B) HE staining of wound section with different treatments at day 7 post-wounding. Scale bar: 500 μm. The double-headed arrows represent the edge of the scar. (C,D) The extent of re-epithelialization and scar widths of three groups were measured at day 7 post-wounding. (E) Transmitted light images of Masson’s staining and Sirius Red staining of three groups to evaluate collagen maturity. Scale bar (left and right): 100 μm. Scale bar (middle): 50 μm. *P<0.05, **P<0.01.

AGEs induce changes in miRNA expression of HUVEC-derived sEVs

To evaluate AGEs-induced changes in expression of miRNAs from HUVEC-derived sEVs, we conducted miRNA microarray assay of HUVEC-derived sEVs treated with or without AGEs. Differentially expressed miRNAs were identified with a cutoff of fold change ≥ 2 and P-value <0.05. The results showed that 45 miRNAs were up-regulated, and 141 miRNAs were down-regulated between groups (Figure 5A). Figure 5B showed the 30 miRNAs with the most significant difference (fold changes ≥ 5 and P-value <0.05) between Con-sEVs and AGEs-sEVs treatment groups. After this, we validated a set of miRNAs that were differentially expressed in AGEs-sEVs versus Con-sEVs treatment (Figure 5C). The expression of candidate miRNAs in HUVECs and fibroblasts after treatment of AGEs or BSA control respectively were quantitated (Figure 5D,E). MiR-106b-5p was identified to be up-regulated more than three-fold changes in HUVECs with AGEs treatment compared with the BSA control group, and, accordingly, the expression of miR-106b-5p in AGEs-sEVs was higher than that in Con-sEVs as expected. We then analyzed the expression of miR-106b-5p in human skin fibroblasts with treatment of AGEs or BSA control, and the results indicated that AGEs could not directly increase the level of miR-106b-5p in fibroblasts. After administration of HUVEC-derived sEVs in fibroblasts, the miR-106b-5p expression level was up-regulated, and the fold change was much higher in the AGEs-sEVs group than in the Con-sEVs group (Figure 5F). To validate the relationship between miR-106b-5p and autophagy as well as collagen expression changes in fibroblasts, we then transfected miR-106b-5p mimics into fibroblasts and the results showed that collagen type I protein expression was suppressed while autophagy related Beclin-1 and LC3-II/LC3-I was up-regulated when miR-106b-5p was overexpressed in fibroblasts (Figure 5G,H).

AGEs induce changes in miRNA expression of HUVEC-derived sEVs

Figure 5
AGEs induce changes in miRNA expression of HUVEC-derived sEVs

(A) Differential expression levels of miRNAs between Con-sEVs and AGEs-sEVs were presented in a heatmap. (B) Markedly differential expression of miRNAs (fold changes ≥ 5 and P-value <0.05) between Con-sEVs and AGEs-sEVs. (C) Expression levels of candidate miRNAs in sEVs derived from HUVECs treated with or without AGEs. *P<0.05, **P<0.01, ***P<0.001. (D) Expression levels of candidate miRNAs in HUVECs with treatment of AGEs or BSA control were quantitated by qRT-PCR. *P<0.05, **P<0.01, ***P<0.001. (E) There was no significant difference in the expression level of most of the candidate miRNAs in human skin fibroblasts with or without treatment of AGEs. ***P<0.001. (F) After 48 h of Con-sEVs or AGEs-sEVs treatment, the levels of miR-106b-5p in human skin fibroblasts were measured by qRT-PCR analysis. *P<0.05. (G) MiR-106b-5p expression level in human skin fibroblasts transfected with miR-106b-5p mimics was determined by qRT-PCR for triple independent experiments. ***P<0.001. (H) Western blotting assay of collagen type I and III expression as well as autophagy related LC3-II/I ratio and beclin-1 expression level in fibroblasts treated with miR-106b-5p mimics or miR-NC or blank control. Data were presented as mean ± S.D. More than three replicated experiments were conducted. *P<0.05, **P<0.01, ***P<0.001. (I) MiR-106b-5p expression level in exudate derived sEVs from patients with diabetic foot ulcer and control groups was measured by qRT-PCR. ***P<0.001.

Figure 5
AGEs induce changes in miRNA expression of HUVEC-derived sEVs

(A) Differential expression levels of miRNAs between Con-sEVs and AGEs-sEVs were presented in a heatmap. (B) Markedly differential expression of miRNAs (fold changes ≥ 5 and P-value <0.05) between Con-sEVs and AGEs-sEVs. (C) Expression levels of candidate miRNAs in sEVs derived from HUVECs treated with or without AGEs. *P<0.05, **P<0.01, ***P<0.001. (D) Expression levels of candidate miRNAs in HUVECs with treatment of AGEs or BSA control were quantitated by qRT-PCR. *P<0.05, **P<0.01, ***P<0.001. (E) There was no significant difference in the expression level of most of the candidate miRNAs in human skin fibroblasts with or without treatment of AGEs. ***P<0.001. (F) After 48 h of Con-sEVs or AGEs-sEVs treatment, the levels of miR-106b-5p in human skin fibroblasts were measured by qRT-PCR analysis. *P<0.05. (G) MiR-106b-5p expression level in human skin fibroblasts transfected with miR-106b-5p mimics was determined by qRT-PCR for triple independent experiments. ***P<0.001. (H) Western blotting assay of collagen type I and III expression as well as autophagy related LC3-II/I ratio and beclin-1 expression level in fibroblasts treated with miR-106b-5p mimics or miR-NC or blank control. Data were presented as mean ± S.D. More than three replicated experiments were conducted. *P<0.05, **P<0.01, ***P<0.001. (I) MiR-106b-5p expression level in exudate derived sEVs from patients with diabetic foot ulcer and control groups was measured by qRT-PCR. ***P<0.001.

Finally, we verified the above findings in wound exudate from the patients. We found that the expression level of miR-106-5p in exudate-derived sEVs from patients with diabetic foot ulcer was much higher than patients without diabetes (Figure 5I). The clinical characteristics of the two groups are shown in Supplementary Table S3. Collectively, AGEs induced high miR-106b-5p expression in HUVECs, and probably affected the physiological function of fibroblasts by means of HUVEC-derived sEVs.

MiR-106b-5p directly targets ERK1/2 in human skin fibroblasts

To identify the targets of miR-106b-5p in human skin fibroblasts, we used three bioinformatics tools (miRDB V5.0, miRNAMap and TargetScan 7.2) to predict a set of common target genes (Figure 6A). As shown in Figure 6A, most of the common target genes ranked ahead participated in mitogen-activated protein kinase (MAPK) signaling. The KEGG signaling analysis (Figure 6B) also indicated this prediction. Among these candidate target genes, we verified the gene ERK1/2 to be a direct target of miR-106b-5p and responsible for decrease in collagen synthesis in fibroblasts. First, we found that seed-matching sites exist between miR-106b-5p and the 3′-UTR of ERK1/2 (Figure 6C). Additionally, there was no difference in ERK1/2 mRNA expression level when fibroblasts were treated with AGEs-sEVs or miR-106b-5p mimics transfected directly into fibroblasts, but the protein expression was suppressed (Figure 6D–G). To further verify whether miR-106b-5p could directly target the 3′ UTR of ERK1/2, the wild-type and mutated miR-106b-5p-binding site were cloned into the luciferase vectors and then transfected into 293T cells with or without miR-106b-5p overexpression respectively. The results showed that the luciferase activity decreased obviously in cells co-transfected with the wild-type binding site vector in the presence of miR-106b-5p. On the contrary, cells containing the mutated binding site vector did not show such suppression (Figure 6H). As is known to all, the main role of miRNAs to regulate gene expression is to bind to a protein termed Argonaut and the bound miRNAs then recruit their target mRNAs into RISC. Therefore, to further show that ERK1/2 is a direct target of miR-106b-5p, we performed AGO2-RIP assay to detect the IP of AGO2 and its bound RNAs. The results showed that miR-106b-5p and ERK1/2 were enriched in the AGO2-IP fraction compared with the IgG control (Figure 6I). Collectively, these above results reveal that ERK1/2 is a direct target of miR-106b-5p in human skin fibroblasts.

MiR-106b-5p directly targets ERK1/2 in human skin fibroblasts

Figure 6
MiR-106b-5p directly targets ERK1/2 in human skin fibroblasts

(A) Target gene prediction of miR-106b-5p with three bioinformatics tools and the results are shown in the Venn diagram. (B) KEGG pathway analysis of target genes of miR-106b-5p. (C) The binding sites between miR-106b-5p and target gene ERK1/2. (D,E) qRT-PCR and Western blotting assay of ERK1/2 expression in fibroblasts treated with AGEs-sEVs, Con-sEVs, or PBS control, respectively. *P<0.05. (F,G) qRT-PCR and Western blotting assay of ERK1/2 expression in fibroblasts treated with miR-106b-5p mimics or NC control or blank control. **P<0.01. (H,I) Diagram of the wild-type and a mutated-type of binding site between miR-106b-5p and ERK1/2 and the relative luciferase activity of 293T cells in the presence of indicated treatments was shown. These experiments were performed in triplicate, and the results were showed as mean ± S.D. ***P<0.001. (J,K) The expression level of miR-106b-5p and ERK1/2 was measured in the AGO2-IP fraction and in the IgG control and protein–antibody complex lysates were prepared for IP Western blotting to detect IP efficiency. *P<0.05; **P<0.01.

Figure 6
MiR-106b-5p directly targets ERK1/2 in human skin fibroblasts

(A) Target gene prediction of miR-106b-5p with three bioinformatics tools and the results are shown in the Venn diagram. (B) KEGG pathway analysis of target genes of miR-106b-5p. (C) The binding sites between miR-106b-5p and target gene ERK1/2. (D,E) qRT-PCR and Western blotting assay of ERK1/2 expression in fibroblasts treated with AGEs-sEVs, Con-sEVs, or PBS control, respectively. *P<0.05. (F,G) qRT-PCR and Western blotting assay of ERK1/2 expression in fibroblasts treated with miR-106b-5p mimics or NC control or blank control. **P<0.01. (H,I) Diagram of the wild-type and a mutated-type of binding site between miR-106b-5p and ERK1/2 and the relative luciferase activity of 293T cells in the presence of indicated treatments was shown. These experiments were performed in triplicate, and the results were showed as mean ± S.D. ***P<0.001. (J,K) The expression level of miR-106b-5p and ERK1/2 was measured in the AGO2-IP fraction and in the IgG control and protein–antibody complex lysates were prepared for IP Western blotting to detect IP efficiency. *P<0.05; **P<0.01.

Discussion

In the present study, we have provided the first insights into the modulation of fibroblasts function by miR-106b-5p containing AGEs-sEVs during diabetic dermopathy. Taken together, the results presented here demonstrate that expression of miR-106b-5p is prominently enriched in sEVs derived from HUVECs pretreated with AGEs. MiR-106b-5p containing AGEs-sEVs could transfer to skin fibroblasts by reducing ERK1/2 expression to trigger autophagy and decrease collagen synthesis of fibroblasts, which could finally delay the regeneration of cutaneous wound healing in vivo (Figure 7). To our knowledge, this is the first evidence of a direct involvement of miR-106b-5p signaling in the HUVECs-fibroblasts cross-talk under the diabetes-related dermopathy. In addition, results of the study shed light on the important implications of coordinated interaction between EVs and autophagy in the context of diabetes.

Schematic diagram of the role of miR-106b-5p derived from HUVEC-derived sEVs in the regulation of human skin fibroblasts dysfunction

Figure 7
Schematic diagram of the role of miR-106b-5p derived from HUVEC-derived sEVs in the regulation of human skin fibroblasts dysfunction

miR-106b-5p was up-regulated in HUVEC-derived sEVs with administration of AGEs and triggered autophagy in human skin fibroblasts via ERK1/2 signaling, leading to the reduction in collagen and finally resulted in delayed wound healing.

Figure 7
Schematic diagram of the role of miR-106b-5p derived from HUVEC-derived sEVs in the regulation of human skin fibroblasts dysfunction

miR-106b-5p was up-regulated in HUVEC-derived sEVs with administration of AGEs and triggered autophagy in human skin fibroblasts via ERK1/2 signaling, leading to the reduction in collagen and finally resulted in delayed wound healing.

HUVECs, a type of endothelial cells, are widely used in the studies of mechanism of tumor angiogenesis [33–35] and cardiovascular diseases [18,19]. Moreover, HUVECs have also been applied in exploration of the pathophysiological process of wound healing [36,37]. Thus, HUVECs are selected in our current study to explore the possible impact of endothelial cells dysfunction on diabetic wound healing. EVs (e.g., exosomes, microparticles, microvesicles) are secreted vesicles that are implicated in intercellular communication through the transfer of cell-derived biomolecules [38]. The role for microparticle-mediated communication between endothelial cells and other cells as biological conveyors has recently been elucidated [39]. As described for endothelial cell-derived exosomes in van Balkom et al. [40], such exosomes containing miR-214 were shown to educate neighboring target cells and allow blood vessel formation by silencing of ataxia telangiectasia. In addition to this, miR-26a containing exosomes generated from endothelial cells maintains the contractile phenotype of smooth muscle cells, which might play an important role in the homeostasis of normal vascular physiological structure [41]. EV-mediated cross-talk between endothelial cells and other cell types has an effect on the regulation of physiologic homeostasis; however, such communication is disrupted under diabetes conditions [42]. As reported by Jansen et al. [43], miRNAs, including miR-126 and -26a in circulating endothelial derived EVs have changed dramatically in patients with diabetes, which may have potential implications on the pathogenic role for EVs under chronic hyperglycemia. Using microparticles from high glucose cultured endothelial cells, Caporali et al. [44] recently found a new mechanism in microvascular diabetic complications. These microparticles were secreted from diabetic endothelial cells carrying miR-503, which can be uptaken by pericytes, and thus lead to gene expression modification and biological phenotype impairment of pericytes in diabetes after limb ischemia. The extracellular properties of lysyl oxidase-like 2 (LOXL2) are widely documented as they can catalyze collagen cross-linking in the ECM and participate in the process of fibrosis and wound healing [45,46]. Interestingly, the presence of LOXL2 is up-regulated in endothelial cell-derived exosomes under hypoxic conditions, which could regulate focal ECM remodeling and result in fibroblasts activation and subsequent collagen contraction [47,48]. Thus, the above studies indicate the potential utility of endothelial cell-derived EVs as mediators during hyperglycemic responses and as potential targets to wound repair and regeneration.

Here, we first identified endothelial cell-derived sEVs with a typical size of 30–200 nm by electron microscopic analysis, NTA and presence of the protein markers CD63, TSG101 and CD9. Then, these AGEs-sEVs labeled with PKH26 fluorescent dye can be taken up by fibroblasts, which demonstrates a direct sEVs exchange between cells. AGEs are actively produced from chronic hyperglycemia and accumulated irreversibly in the circulatory system, which have an important influence on the occurrence and development of diabetic complications through various mechanisms [49]. As a result of the particular localization, endothelial cells are directly in contact with high blood glucose and AGEs exposure in diabetes. Of note, the present study found that cell-to-cell communication between AGEs-treated HUVECs and fibroblasts seems to be mediated by sEVs enriched in miR-106b-5p. Such miRNA cargo in AGEs-sEVs can be directly taken up by fibroblasts and induce fibroblasts autophagy, which finally suppresses fibroblasts collagen synthesis. Most importantly, collagen synthesized by fibroblasts are the most crucial component during the wound-healing process [8]. Therefore, wound healing with AGEs-sEVs treatment was further evaluated in in vivo experiments. Quantitation of the wound closure showed that wounds treated with miR-106b-5p containing AGEs-sEVs have a slower healing rate than the control group. The present study now provides further insights into the mechanisms by demonstrating that AGEs up-regulate miR-106b-5p in HUVECs and lead to the enrichment of miR-106b-5p in HUVEC-derived sEVs to modulate the biological behaviors of fibroblasts and impede diabetic cutaneous wound healing.

To further investigate the relationship between autophagy and collagen synthesis in human skin fibroblasts after treatment of HUVEC-derived sEVs, we then used autophagy activator rapamycin and inhibitor 3-MA to change the autophagy level in fibroblasts. As the results showed, when the autophagy level was increased, the collagen synthesis in fibroblasts was suppressed under administration of AGEs-sEVs, while such phenomenon disappeared when autophagy flux was reduced by 3-MA. Therefore, we supposed that AGEs-sEVs could reduce the collagen protein level in fibroblasts by triggering autophagy and inducing collagen degradation in autolysosomes. Raf/MEK/ERK signaling has been described to be a key mediator in the process of autophagy [50,51]. Mahli et al. [52] recently demonstrated that ERK activation along with autophagy impairment were central mediators of irinotecan-induced steatohepatitis. On the contrary, Cea et al. [21] have proven the inhibition of ERK1/2 to be a key event in autophagy induction in multiple myeloma cells. Under different pathological processes, ERK signaling may play totally opposite roles in autophagy. In our present study, we found that the predicted target genes of miR-106b-5p were mostly enriched in MAPK signaling, especially Raf/MEK/ERK signaling. Therefore, miR-106b-5p became the first consideration among many up-regulated miRNAs. Until now, miR-106b-5p has been validated to be involved in pathological process of autophagy by targeting the crucial mediators. Zhai et al. [53] verified miR-106b could repress the autophagic activity in intestinal epithelial cells by targeting ATG16L1. Moreover, Yan et al. [54] found that miR-106b could negatively regulate autophagy via suppression expression of ULK1. Our study indicated that miR-106b-5p could trigger autophagy in human skin fibroblasts by suppressing ERK1/2 expression. Autophagy is a complicated but sophisticated process with various mediators involved, which may explain the controversial results of different studies.

In summary, we found that HUVECs secreting miR-106b-5p-containing sEVs could influence cutaneous wound healing by triggering autophagy and decreasing collagen synthesis of fibroblasts. Given the known role of endothelial cells in processes of vascular homeostasis, it will be of interest to determine whether sEVs produced by endothelial cells could be a therapeutic target in diabetic foot ulcer.

Clinical perspectives

  • Endothelial cell-derived sEVs are demonstrated to be significant mediators of intercellular cross-talk in the pathogenesis of diabetic complications. Irregulation of fibroblasts autophagy and collagen deposition is proved to play an important role in diabetic wound healing process and therefore we hypothesize that sEVs derived from endothelial cells could regulate collagen synthesis of fibroblasts through triggering autophagy.

  • Our findings have critical basic and clinical applied values. In in vitro study we demonstrated that miR-106b-5p containing sEVs derived from AGEs-pretreated HUVECs could decrease collagen expression level of human skin fibroblasts through regulating autohphgy of fibroblasts by targeting ERK1/2. In in vivo study we found that administration of sEVs derived from HUVECs pretreated with AGEs could delay the wound healing process in SD rats. In particularly, miR-106b-5p is found to be dramatically up-regulated in exudate derived sEVs from patients with diabetic foot ulcer.

  • Our findings indicate that miR-106b-5p would be a novel target in clinical therapy of diabetic foot ulcer and sEVs would be a promising carrier to transport siRNA or therapeutic drugs to promote diabetic wound healing.

Author Contribution

All authors believe that the manuscript represents valid work and have reviewed and approved the final version. Tingting Zeng and Kan Sun were responsible for design of the experiment, article writing and verification of the manuscript. Xiaoyi Wang and Wei Wang worked together on analyzing the data and statistical analysis. Qiling Feng and Guojuan Lao performed the collection of clinical data and the measurement of miR-106b-5p expression level in wound exudate-derived sEVs. Ying Liang, Chuan Wang, Jing Zhou, and Yuying Chen performed the animal experiments together. Haiqi Gao and Biyun Lan worked together on the collection of associated data and the interpretation. The molecular biological experiments were performed by Yuxi Wu and Yuting Han. Liyi Liu was in charge of collaborating with other authors. Jing Liu and Yanyan Liu worked together on the isolation of sEVs from conditional medium of HUVECs and wound exudate samples. Hongxing Chen and Chuan Yang worked together on the culture and associated assessment of HUVECs and fibroblasts and collaborated with all other authors. Li Yan and Meng Ren also took part in experiments design and discussion of data analyses. This work has not been published previously, and is not under consideration for publication elsewhere, in part or in whole.

Competing Interests

The authors declare that there are no competing interests associated with the manuscript.

Funding

This work was supported by The National Natural Science Foundation of China [grant numbers 81600642, 81471034, 8137091, 81300675]; the Natural Science Foundation of Guangdong Province, China [grant numbers 2015A030310433, 2017A030313831]; the Sun Yat-sen University Medical 2016 Youth Teacher Research Funding Project [grant number 16ykpy27]; the Sun Yat-sen Clinical Research Cultivating Program [grant number SYS-Q-201801]; the Major Project of the People’s Livelihood Science and Technology in Guangzhou [grant number 201300000102]; The 863 Project of Young Scientist [grant number SS2015AA020927]; The Zhujiang Star of Science and Technology Foundation in Guangzhou [grant number 2014J2200046]; the Chinese Society of Endocrinology and National Clinical Research Center for Metabolic Diseases; the State Key Clinical Specialty Construction Project (2011); the Science and Technology Planning Project of Guangdong Province, China [grant number 2014A020212161]; the National Key R&D Program of China [grant number 2016YFC0901200]. The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.

Abbreviations

     
  • AGEs

    advanced glycation end products

  •  
  • AGEs-sEV

    sEVs derived from AGEs-pretreated HUVECs

  •  
  • CCK-8

    Cell Counting Kit 8

  •  
  • cDNA

    complementary DNA

  •  
  • DMEM

    Dulbecco’s modified Eagle’s medium

  •  
  • ECM

    extracellular matrix

  •  
  • EdU

    5-Ethynyl-2′-deoxyuridine

  •  
  • ERK1/2

    extracellular signal-regulated kinase 1/2

  •  
  • EV

    extracellular vesicle

  •  
  • FBS

    fetal bovine serum

  •  
  • HE

    Hematoxylin and Eosin

  •  
  • HUVEC

    human umbilical vein endothelial cell

  •  
  • IP

    immunoprecipitation

  •  
  • KEGG

    Kyoto Encyclopedia of Genes and Genomes

  •  
  • LC3-II/LC3-I

    LC3-II to LC3-I ratio

  •  
  • LOXL2

    lysyl oxidase-like 2

  •  
  • MAPK

    mitogen-activated protein kinase

  •  
  • miRNA

    microRNA

  •  
  • MVE

    multi-vesicular endosome

  •  
  • NTA

    Nanosight particle tracking analysis

  •  
  • PBS

    phosphate-buffered saline

  •  
  • RISC

    RNA-induced silencing complex

  •  
  • RT

    room temperature

  •  
  • SD

    Sprague–Dawley

  •  
  • sEV

    small EV

  •  
  • TEM

    transmission electron microscopy

  •  
  • UTR

    untranslated region

  •  
  • 3-MA

    3-methyladenine

References

References
1.
Bowling
F.L.
,
Rashid
S.T.
and
Boulton
A.J.
(
2015
)
Preventing and treating foot complications associated with diabetes mellitus
.
Nat. Rev. Endocrinol.
11
,
606
616
[PubMed]
2.
Markakis
K.
,
Bowling
F.L.
and
Boulton
A.J.
(
2016
)
The diabetic foot in 2015: an overview
.
Diabetes Metab. Res. Rev.
32
,
169
178
[PubMed]
3.
Peppa
M.
,
Stavroulakis
P.
and
Raptis
S.A.
(
2009
)
Advanced glycoxidation products and impaired diabetic wound healing
.
Wound Repair Regen.
17
,
461
472
[PubMed]
4.
Goh
S.Y.
and
Cooper
M.E.
(
2008
)
Clinical review: The role of advanced glycation end products in progression and complications of diabetes
.
J. Clin. Endocrinol. Metab.
93
,
1143
1152
[PubMed]
5.
Lu
W.
,
Li
J.
,
Ren
M.
,
Zeng
Y.
,
Zhu
P.
,
Lin
L.
et al. .
(
2015
)
Role of the mevalonate pathway in specific CpG site demethylation on AGEs-induced MMP9 expression and activation in keratinocytes
.
Mol. Cell Endocrinol.
411
,
121
129
[PubMed]
6.
Zhu
P.
,
Ren
M.
,
Yang
C.
,
Hu
Y.X.
,
Ran
J.M.
and
Yan
L.
(
2012
)
Involvement of RAGE, MAPK and NF-kappaB pathways in AGEs-induced MMP-9 activation in HaCaT keratinocytes
.
Exp. Dermatol.
21
,
123
129
[PubMed]
7.
Baum
C.L.
and
Arpey
C.J.
(
2005
)
Normal cutaneous wound healing: clinical correlation with cellular and molecular events
.
Dermatol. Surg.
31
,
674
686
,
8.
Velnar
T.
,
Bailey
T.
and
Smrkolj
V.
(
2009
)
The wound healing process: an overview of the cellular and molecular mechanisms
.
J. Int. Med. Res.
37
,
1528
1542
[PubMed]
9.
György
B.
,
Szabó
T.G.
,
Pásztói
M.
et al. .
(
2011
)
Membrane vesicles, current state-of-the-art: emerging role of extracellular vesicles
.
Cell. Mol. Life Sci.
68
,
2667
2688
10.
Harding
C.
,
Heuser
J.
and
Stahl
P.
(
1984
)
Endocytosis and intracellular processing of transferrin and colloidalgold transferrin in rat reticulocytes: demonstration of a pathway for receptor shedding
.
Eur. J. Cell Biol.
35
,
256
263
[PubMed]
11.
Théry
C.
,
Witwer
K.W.
,
Aikawa
E.
et al. .
(
2018
)
Minimal information for studies of extracellular vesicles 2018 (MISEV2018): a position statement of the International Society for Extracellular Vesicles and update of the MISEV2014 guidelines
.
J. Extracell. Vesicles
7
,
1535750
12.
Gould
S.J.
and
Raposo
G.
(
2013
)
As we wait: coping with an imperfect nomenclature for extracellular vesicles
.
J. Extracell. Vesicles
2
,
20389
13.
Kowal
J.
,
Arras
G.
and
Colombo
M.
(
2016
)
Proteomic comparison defines novel markers to characterize heterogeneous populations of extracellular vesicle subtypes
.
Proc. Natl. Acad. Sci. U.S.A.
113
,
E968
E977
[PubMed]
14.
Lötvall
J.
,
Hill
A.F.
,
Hochberg
F.
et al. .
(
2014
)
Minimal experimental requirements for definition of extracellular vesicles and their functions: a position statement from the International Society for Extracellular Vesicles
.
J. Extracellul. Vesicles
3
,
26913
15.
Bang
C.
,
Batkai
S.
,
Dangwal
S.
,
Gupta
S.K.
,
Foinquinos
A.
,
Holzmann
A.
et al. .
(
2014
)
Cardiac fibroblast-derived microRNA passenger strand-enriched exosomes mediate cardiomyocyte hypertrophy
.
J. Clin. Invest.
124
,
2136
2146
[PubMed]
16.
Fong
M.Y.
,
Zhou
W.
,
Liu
L.
,
Alontaga
A.Y.
,
Chandra
M.
,
Ashby
J.
et al. .
(
2015
)
Breast-cancer-secreted miR-122 reprograms glucose metabolism in premetastatic niche to promote metastasis
.
Nat. Cell Biol.
17
,
183
194
[PubMed]
17.
Valadi
H.
,
Ekstrom
K.
,
Bossios
A.
,
Sjostrand
M.
,
Lee
J.J.
and
Lotvall
J.O.
(
2007
)
Exosome-mediated transfer of mRNAs and microRNAs is a novel mechanism of genetic exchange between cells
.
Nat. Cell Biol.
9
,
654
659
[PubMed]
18.
Hergenreider
E.
,
Heydt
S.
,
Treguer
K.
,
Boettger
T.
,
Horrevoets
A.J.
,
Zeiher
A.M.
et al. .
(
2012
)
Atheroprotective communication between endothelial cells and smooth muscle cells through miRNAs
.
Nat. Cell Biol.
14
,
249
256
[PubMed]
19.
Halkein
J.
,
Tabruyn
S.P.
,
Ricke-Hoch
M.
,
Haghikia
A.
,
Nguyen
N.Q.
,
Scherr
M.
et al. .
(
2013
)
MicroRNA-146a is a therapeutic target and biomarker for peripartum cardiomyopathy
.
J. Clin. Invest.
123
,
2143
2154
[PubMed]
20.
Zhang
J.
,
Chen
C.
,
Hu
B.
,
Niu
X.
,
Liu
X.
,
Zhang
G.
et al. .
(
2016
)
Exosomes derived from human endothelial progenitor cells accelerate cutaneous wound healing by promoting angiogenesis through Erk1/2 signaling
.
Int. J. Biol. Sci.
12
,
1472
1487
[PubMed]
21.
Cea
M.
,
Cagnetta
A.
,
Fulciniti
M.
,
Tai
Y.T.
,
Hideshima
T.
,
Chauhan
D.
et al. .
(
2012
)
Targeting NAD+ salvage pathway induces autophagy in multiple myeloma cells via mTORC1 and extracellular signal-regulated kinase (ERK1/2) inhibition
.
Blood
120
,
3519
3529
[PubMed]
22.
Choi
J.
,
Jo
M.
,
Lee
E.
,
Lee
D.Y.
and
Choi
D.
(
2015
)
Dienogest enhances autophagy induction in endometriotic cells by impairing activation of AKT, ERK1/2, and mTOR
.
Fertil. Steril.
104
,
655
664.e1
23.
Thery
C.
,
Amigorena
S.
,
Raposo
G.
and
Clayton
A.
(
2006
)
Isolation and characterization of exosomes from cell culture supernatants and biological fluids
.
Curr. Protoc. Cell Biol.
Chapter 3:Unit 3 22
24.
Thomas
T.
,
Marcelo
A. M
,
Jonathan
M. D
et al. .
(
2017
)
Adipose-derived circulating miRNAs regulate gene expression in other tissues
.
Nature
542
,
450
455
[PubMed]
25.
Zhou
C.F.
,
Ma
J.
,
Huang
L.
et al. .
(
2019
)
Cervical squamous cell carcinoma-secreted exosomal miR-221-3p promotes lymphangiogenesis and lymphatic metastasis by targeting VASH1
.
Oncogene
38
,
1256
1268
[PubMed]
26.
Kyoko
H.
,
Hiroki
O.
,
Satoko
S.
et al. .
(
2018
)
Cancer-secreted hsa-miR-940 induces an osteoblastic phenotype in the bone metastatic microenvironment via targeting ARHGAP1 and FAM134A
.
Proc. Natl. Acad. Sci. U.S.A.
115
,
2204
2209
[PubMed]
27.
Li
N.
,
Luo
H.C.
,
Ren
M.
,
Zhang
L.M.
,
Wang
W.
,
Pan
C.L.
et al. .
(
2017
)
Efficiency and safety of beta-CD-(D3)7 as siRNA carrier for decreasing matrix metalloproteinase-9 expression and improving wound healing in diabetic rats
.
ACS Appl. Mater. Interfac.
9
,
17417
17426
28.
Ren
M.
,
Hao
S.
,
Yang
C.
,
Zhu
P.
,
Chen
L.
,
Lin
D.
et al. .
(
2013
)
Angiotensin II regulates collagen metabolism through modulating tissue inhibitor of metalloproteinase-1 in diabetic skin tissues
.
Diabetes Vasc. Dis. Res.
10
,
426
435
[PubMed]
29.
Wang
W.
,
Yang
C.
,
Wang
X.Y.
,
Zhou
L.Y.
,
Lao
G.J.
,
Liu
D.
et al. .
(
2018
)
MicroRNA-129 and -335 promote diabetic wound healing by inhibiting Sp1-mediated MMP-9 expression
.
Diabetes
67
,
1627
1638
[PubMed]
30.
Bhattacharya
D.
,
Mukhopadhyay
M.
,
Bhattacharyya
M.
and
Karmakar
P.
(
2018
)
Is autophagy associated with diabetes mellitus and its complications? A review.
EXCLI J.
17
,
709
720
[PubMed]
31.
Barlow
A.D.
and
Thomas
D.C.
(
2015
)
Autophagy in diabetes: beta-cell dysfunction, insulin resistance, and complications
.
DNA Cell Biol.
34
,
252
260
[PubMed]
32.
Xu
J.
,
Camfield
R.
and
Gorski
S.M.
(
2018
)
The interplay between exosomes and autophagy - partners in crime
.
J. Cell Sci.
131
(15)
,
33.
Lu
J.
,
Liu
Q.-H.
,
Wang
F.
et al. .
(
2018
)
Exosomal miR-9 inhibits angiogenesis by targeting MDK and regulating PDK/AKT pathway in nasopharyngeal carcinoma
.
J. Exp. Clin. Cancer Res.
37
,
147
[PubMed]
34.
Fang
J.H.
,
Zhang
Z.J.
,
Shang
L.R.
et al. .
(
2018
)
Hepatoma cell-secreted exosomal microRNA-103 increases vascular permeability and promotes metastasis by targeting junction proteins
.
Hepatology
68
,
1459
1475
[PubMed]
35.
Yang
H.
,
Zhang
H.
,
Ge
S.
et al. .
(
2018
)
Exosome-derived miR-130a activates angiogenesis in gastric cancer by targeting C-MYB in vascular endothelial cells
.
Mol. Ther.
26
,
2466
2475
[PubMed]
36.
Zhao
Y.
,
Wang
Q.
,
Jin
Y.
et al. .
(
2018
)
Discovery and characterization of a high-affinity small peptide ligand, H1, targeting FGFR2IIIc for skin wound healing
.
Cell. Physiol. Biochem.
49
,
1074
1089
[PubMed]
37.
Boucher
J.M.
,
Clark
R.P.
,
Chong
D.C.
et al. .
(
2017
)
Dynamic alterations in decoy VEGF receptor-1 stability regulate angiogenesis
.
Nat. Commun.
8
,
15699
[PubMed]
38.
Shah
R.
,
Patel
T.
and
Freedman
J.E.
(
2018
)
Circulating extracellular vesicles in human disease
.
N. Engl. J. Med.
379
,
958
966
[PubMed]
39.
Todorova
D.
,
Simoncini
S.
,
Lacroix
R.
,
Sabatier
F.
and
Dignat-George
F.
(
2017
)
Extracellular vesicles in angiogenesis
.
Circ. Res.
120
,
1658
1673
[PubMed]
40.
van Balkom
B.W.
,
de Jong
O.G.
,
Smits
M.
,
Brummelman
J.
,
den Ouden
K.
,
de Bree
P.M.
et al. .
(
2013
)
Endothelial cells require miR-214 to secrete exosomes that suppress senescence and induce angiogenesis in human and mouse endothelial cells
.
Blood
121
,
3997
4006
,
[PubMed]
41.
Lin
X.
,
He
Y.
,
Hou
X.
,
Zhang
Z.
,
Wang
R.
and
Wu
Q.
(
2016
)
Endothelial cells can regulate smooth muscle cells in contractile phenotype through the miR-206/ARF6&NCX1/exosome axis
.
PLoS ONE
11
,
e0152959
[PubMed]
42.
Armulik
A.
,
Abramsson
A.
and
Betsholtz
C.
(
2005
)
Endothelial/pericyte interactions
.
Circ. Res.
97
,
512
523
[PubMed]
43.
Jansen
F.
,
Wang
H.
,
Przybilla
D.
,
Franklin
B.S.
,
Dolf
A.
,
Pfeifer
P.
et al. .
(
2016
)
Vascular endothelial microparticles-incorporated microRNAs are altered in patients with diabetes mellitus
.
Cardiovasc. Diabetol.
15
,
49
[PubMed]
44.
Caporali
A.
,
Meloni
M.
,
Nailor
A.
,
Mitic
T.
,
Shantikumar
S.
,
Riu
F.
et al. .
(
2015
)
p75(NTR)-dependent activation of NF-kappaB regulates microRNA-503 transcription and pericyte-endothelial crosstalk in diabetes after limb ischaemia
.
Nat. Commun.
6
,
8024
[PubMed]
45.
Smith-Mungo
L.I.
and
Kagan
H.M.
(
1998
)
Lysyl oxidase: properties, regulation and multiple functions in biology
.
Matrix Biol.
16
,
387
398
46.
Bignon
M.
,
Pichol-Thievend
C.
,
Hardouin
J.
,
Malbouyres
M.
,
Brechot
N.
,
Nasciutti
L.
et al. .
(
2011
)
Lysyl oxidase-like protein-2 regulates sprouting angiogenesis and type IV collagen assembly in the endothelial basement membrane
.
Blood
118
,
3979
3989
[PubMed]
47.
de Jong
O.G.
,
van Balkom
B.W.
,
Gremmels
H.
and
Verhaar
M.C.
(
2016
)
Exosomes from hypoxic endothelial cells have increased collagen crosslinking activity through up-regulation of lysyl oxidase-like 2
.
J. Cell. Mol. Med.
20
,
342
350
[PubMed]
48.
Schietke
R.
,
Warnecke
C.
,
Wacker
I.
,
Schodel
J.
,
Mole
D.R.
,
Campean
V.
et al. .
(
2010
)
The lysyl oxidases LOX and LOXL2 are necessary and sufficient to repress E-cadherin in hypoxia: insights into cellular transformation processes mediated by HIF-1
.
J. Biol. Chem.
285
,
6658
6669
[PubMed]
49.
Rhee
S.Y.
and
Kim
Y.S.
(
2018
)
The role of advanced glycation end products in diabetic vascular complications
.
Diabetes Metab. J.
42
,
188
195
50.
Sooro
M.A.
,
Zhang
N.
and
Zhang
P.
(
2018
)
Targeting EGFR-mediated autophagy as a potential strategy for cancer therapy
.
Int. J. Cancer.
143
(
9)
,
2116
2125
[PubMed]
51.
Chen
K.L.
,
Chang
W.S.
,
Cheung
C.H.
,
Lin
C.C.
,
Huang
C.C.
,
Yang
Y.N.
et al. .
(
2012
)
Targeting cathepsin S induces tumor cell autophagy via the EGFR-ERK signaling pathway
.
Cancer Lett.
317
,
89
98
[PubMed]
52.
Mahli
A.
,
Saugspier
M.
,
Koch
A.
,
Sommer
J.
,
Dietrich
P.
,
Lee
S.
et al. .
(
2018
)
ERK activation and autophagy impairment are central mediators of irinotecan-induced steatohepatitis
.
Gut
67
,
746
756
[PubMed]
53.
Zhai
Z.
,
Wu
F.
,
Chuang
A.Y.
and
Kwon
J.H.
(
2013
)
miR-106b fine tunes ATG16L1 expression and autophagic activity in intestinal epithelial HCT116 cells
.
Inflamm. Bowel Dis.
19
,
2295
2301
[PubMed]
54.
Wu
H.
,
Wang
F.
,
Hu
S.
,
Yin
C.
,
Li
X.
,
Zhao
S.
et al. .
(
2012
)
MiR-20a and miR-106b negatively regulate autophagy induced by leucine deprivation via suppression of ULK1 expression in C2C12 myoblasts
.
Cell. Signal.
24
,
2179
2186
[PubMed]

Author notes

*

These authors contributed equally to this work.

Supplementary data